TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3622a-3p
miRNA Sequence: UCACCUGACCUCCCAUGCCUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000259chr1584747 4635 4370 4061 2478 1663 1377 1109 14583 --16085
NM_000332chr652705 2463 892 148 111 14652 11037 16309
NM_001012393chr1164240 1887 1760 1569 792 776 --14450 13174
NM_001018067chr1105008 4136 4104 4034 3962 3425 3281 1272 694 321 --15060 --
NM_001018068chr1105008 4136 4104 4034 3962 3425 3281 1272 694 321 --15060 --
NM_001018069chr1105008 4136 4104 4034 3962 3425 3281 1272 694 321 --15060 --
NM_001167chrX65938 5880 5219 2623 2392 1997 26269 4739 --15839
NM_001204chr237741 5780 2806 ----15874
NM_001695chr843015 764 452 208 1125 --12640
NM_001830chrX43215 2851 1298 985 --11431 13604
NM_001918chr188286 7977 7620 7601 5847 1485 434 344 ----19103
NM_002025chrX48802 7417 3576 2623 11689 --1495
NM_002137chr752164 1845 1648 940 79 ----1351
NM_002214chr755708 4939 4877 4537 4340 ----11397
NM_002545chr1164240 1887 1760 1569 792 776 --14450 13174
NM_003099chr1565827 4954 2421 448 389 236 34690 2305 1437 ----
NM_003112chr763013 2878 2565 702 690 549 ------
NM_004171chr1128468 8092 38724 3663 1573 --17749
NM_004464chr453989 3728 3069 1359 56 12883 --23836 3611
NM_005188chr1177450 7342 6397 5665 5572 5410 1200 18051 16384 11955
NM_006252chr136760 2273 613 --1924 16798
NM_006538chr283980 3722 3600 3404 3264 3029 1456 1047 1127 11643 --
NM_006544chr1455499 5275 4712 2381 483 1403 ----
NM_006750chr16107437 7356 7199 5738 2530 2337 2223 753 435 266 --17248 --
NM_006851chr1222755 214 --22780 78 1296
NM_007007chr1223786 3749 1651 24222 1314 14748
NM_007073chr634008 1221 85 12617 14149 11687
NM_007331chr432648 2319 714 ----22176 2018
NM_012316chr175618 5073 4666 4296 2104 2015 1186 ----11977
NM_014106chr1542958 2456 1900 710 ----1917
NM_014721chr646768 6239 2409 1860 1344 --15915
NM_014877chr1767401 6543 6480 6334 6294 1522 --16710 --
NM_015640chr1105008 4136 4104 4034 3962 3425 3281 1272 694 321 --15060 --
NM_016260chr237150 5696 5339 --12422 12814
NM_018017chr1051001 619 600 385 49 ----1478
NM_018225chr955103 3620 3326 1368 528 1896 --11670
NM_018374chr783996 3901 3777 1520 1437 1402 986 569 ------
NM_021964chr31983 --12304 25415 2029
NM_022459chr1344769 1638 1435 333 --11821 12332
NM_022758chr63989 966 283 ----32678 760 479
NM_024294chr63989 966 283 ----32678 760 479
NM_024511chr443300 3127 3082 2233 --13230 22790 2324
NM_024583chr231082 926 223 ----1236
NM_024596chr844376 3846 3394 663 1161 --1455
NM_024674chr152893 2569 1202 789 153 ----22319 1135
NM_024817chr1545583 5379 4355 578 25779 1013 --14504
NM_024989chr288140 7027 7016 6348 5867 2270 1735 1555 11107 ----
NM_031243chr752164 1845 1648 940 79 ----1351
NM_032012chr945033 1426 777 761 --23924 800 25142 3476
NM_032859chr1363384 3365 3059 2833 1247 705 13691 ----
NM_032873chr1163821 1760 1719 998 515 448 --14372 13866
NM_033143chr454320 4059 3400 1690 387 13214 --24167 3942
NM_133334chr4106086 4680 4557 4493 2450 2264 1547 760 660 34 35963 5496 4916 ----
NM_138621chr283980 3722 3600 3404 3264 3029 1456 1047 1127 11643 --
NM_144599chr1543613 3582 1343 123 24556 4204 --11791
NM_145259chr256661 6336 5719 5364 1930 ----1430
NM_147147chr634008 1221 85 12617 14149 11687
NM_148955chr1565827 4954 2421 448 389 236 34690 2305 1437 ----
NM_152624chr565988 5168 2622 2327 2272 924 1465 187 --
NM_152826chr1565827 4954 2421 448 389 236 34690 2305 1437 ----
NM_170710chr443199 2686 905 196 ----22033 726
NM_173829chr565703 4398 4232 4184 2070 1269 11419 25727 378 --
NM_175854chr1352716 2381 2288 848 140 ----1250
NM_181265chr443199 2686 905 196 ----22033 726
NM_181832chr2252481 1394 1231 1217 984 182 --23078 2329
NM_182493chr1645045 1972 1845 281 15311 1420 12152
NM_194071chr775249 4925 4557 3885 2046 1645 1232 11194 --13820
NM_213589chr273554 1875 1303 1294 1144 977 110 --178 --