TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3622a-5p
miRNA Sequence: CAGGCACGGGAGCUCAGGUGAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000018chr172116 35 ------
NM_000021chr141297 1182 ----
NM_000038chr521814 804 11968 ----
NM_000044chrX3349 327 93 ------
NM_000052chrX43106 1148 585 525 ------
NM_000068chr1931307 405 105 ------
NM_000074chrX1354 ------
NM_000084chrX76716 4583 2431 2320 1316 1294 941 ------
NM_000091chr212603 --12228 --
NM_000093chr931983 619 537 1560 ----
NM_000109chrX1416 ------
NM_000110chr11910 ------
NM_000125chr633934 3826 914 ------
NM_000127chr81101 ------
NM_000141chr1011031 ------
NM_000163chr522327 1794 --11616 --
NM_000168chr742870 2288 714 403 ------
NM_000176chr563765 3311 2671 1291 685 495 23018 2393 ----
NM_000183chr2------1403
NM_000188chr102715 637 ------
NM_000210chr222240 1607 ------
NM_000214chr2031579 431 66 ------
NM_000217chr1233670 1692 1656 --15196 --
NM_000240chrX12234 22173 1862 ----
NM_000245chr722117 1427 ------
NM_000252chrX1142 ------
NM_000253chr41767 ------
NM_000254chr12180 65 ------
NM_000259chr1595851 5619 5333 4670 4276 4229 2018 299 190 16339 ----
NM_000264chr952063 879 754 310 114 12449 --1829
NM_000266chrX2863 331 ------
NM_000271chr18--2656 35 ----
NM_000275chr15--1105 ----
NM_000276chrX22225 839 ------
NM_000280chr112894 638 ------
NM_000297chr411792 ------
NM_000304chr171972 ------
NM_000321chr132598 280 ------
NM_000325chr41190 ------
NM_000332chr667063 4493 2793 2019 281 190 17002 ----
NM_000335chr332028 1892 191 1430 ----
NM_000337chr511209 11403 1137 --
NM_000362chr223571 561 95 ------
NM_000367chr632258 2195 254 --11807 --
NM_000376chr1273054 2226 1186 1146 803 55 24 ------
NM_000378chr113414 165 144 ------
NM_000379chr231606 411 345 ------
NM_000386chr173513 314 158 ------
NM_000389chr621466 89 11301 ----
NM_000390chrX22944 2270 ------
NM_000391chr1121704 1540 21686 1605 ----
NM_000408chr213178 ------
NM_000411chr2142368 2026 1069 38 ------
NM_000417chr101116 1907 ----
NM_000430chr1752930 2777 2553 943 370 1458 ----
NM_000439chr542222 707 659 68 ------
NM_000461chr373450 3282 3216 3129 1632 1615 1341 ------
NM_000462chr1541818 1427 737 162 ------
NM_000474chr7--1624 ----
NM_000476chr921344 221 1228 ----
NM_000480chr1121200 287 ------
NM_000484chr2111066 ------
NM_000489chrX13101 ------
NM_000495chrX2936 72 ------
NM_000503chr82445 256 --11234 --
NM_000522chr7--11009 ----
NM_000523chr211145 ------
NM_000525chr1131582 1488 399 ------
NM_000527chr1941612 930 694 526 --11757 --
NM_000539chr31252 3595 364 334 ----
NM_000555chrX97634 6714 6052 5967 5686 2558 2048 298 96 ------
NM_000594chr62747 632 ------
NM_000609chr1032458 794 269 --13045 --
NM_000615chr1132645 2121 142 12631 ----
NM_000618chr1236122 1268 464 ------
NM_000618chr1236122 1268 464 ------
NM_000619chr122482 398 ------
NM_000620chr1252132 1670 1598 573 116 --1442 --
NM_000633chr1843855 954 737 354 ------
NM_000698chr10--1337 ----
NM_000701chr11236 ------
NM_000719chr12106412 5897 5322 4194 2339 1762 1638 1245 349 71 ------
NM_000722chr71249 ------
NM_000724chr1011503 --11706 --
NM_000747chr172612 165 2881 669 ----
NM_000780chr81136 ------
NM_000792chr11969 ------
NM_000793chr1445029 3855 3289 1890 25113 3387 ----
NM_000806chr511859 1486 ----
NM_000813chr545042 2170 1562 1378 1847 ----
NM_000814chr1523823 404 1640 ----
NM_000818chr101352 ------
NM_000824chr41800 ------
NM_000826chr421686 192 ------
NM_000827chr552273 1927 1637 359 286 ------
NM_000828chrX2813 171 ------
NM_000829chr1132312 423 25 22331 2271 ----
NM_000838chr641794 953 776 763 11691 ----
NM_000839chr31336 ------
NM_000844chr311015 ------
NM_000868chrX1900 ------
NM_000876chr61236 1952 ----
NM_000891chr171901 23437 1394 ----
NM_000899chr1221744 1270 --1313 --
NM_000901chr422305 959 ------
NM_000912chr843537 2791 2449 2351 ------
NM_000917chr102838 46 1398 ----
NM_000922chr112431 53 ------
NM_000924chr123921 853 247 ------
NM_000933chr201600 ------
NM_000944chr431725 1600 662 11687 ----
NM_000945chr221551 536 ------
NM_000958chr51412 ------
NM_000961chr20127 --11401 --
NM_000963chr132443 2043 1568 ------
NM_000965chr31380 ------
NM_000966chr123752 352 155 ------
NM_001001132chr211318 ------
NM_001001323chr1232513 2074 475 ------
NM_001001331chr3--12172 ----
NM_001001342chr101923 ----11476
NM_001001396chr164027 2924 1744 1545 1490 650 12817 ----
NM_001001419chr555175 5079 4680 1900 1069 --11449 --
NM_001001420chr555175 5079 4680 1900 1069 --11449 --
NM_001001433chr2043000 2919 1216 25 ------
NM_001001436chr162745 142 ------
NM_001001481chr8--13239 ----
NM_001001502chr53544 443 150 ------
NM_001001549chr752756 2545 1070 1064 749 ------
NM_001001550chr752756 2545 1070 1064 749 ------
NM_001001552chr12327 224 ------
NM_001001555chr752756 2545 1070 1064 749 ------
NM_001001556chr1521588 65 ------
NM_001001557chr82548 350 ------
NM_001001560chr224757 715 224 122 ------
NM_001001664chr273783 3173 2950 2770 1484 927 268 13735 ----
NM_001001669chr572492 2452 2112 2010 381 325 172 ------
NM_001001710chr9122 ------
NM_001001787chr11108 ------
NM_001001852chr223723 628 146 ------
NM_001001890chr2144192 4045 2666 1386 ------
NM_001001974chr1032323 895 651 1941 ----
NM_001002033chr171764 ------
NM_001002243chr21641 ------
NM_001002257chr243144 3135 932 612 ------
NM_001002259chr121328 ------
NM_001002295chr101169 ------
NM_001002762chr1021025 405 12797 ----
NM_001002814chr873754 3500 2857 1551 1248 916 224 --11165 --
NM_001002860chr1444389 4111 693 25 --1988 --
NM_001002876chr225366 170 65 57 33 ------
NM_001002909chr1742065 1695 1428 109 1727 ----
NM_001003406chr2231300 605 596 12696 ----
NM_001003407chr1045140 5027 1216 522 11611 ----
NM_001003408chr1045140 5027 1216 522 11611 ----
NM_001003652chr1868622 7719 7367 6916 3425 472 38204 2581 193 ----
NM_001003674chr18116622 5932 5625 5125 4945 4927 4853 4716 2394 1841 509 ----26861 6370
NM_001003675chr18116622 5932 5625 5125 4945 4927 4853 4716 2394 1841 509 ----26861 6370
NM_001003682chr11329 ------
NM_001003698chr651605 1384 556 222 209 ------
NM_001003699chr651605 1384 556 222 209 ------
NM_001003712chr1243548 3058 3019 2788 1249 ----
NM_001003792chr31942 ------
NM_001003793chr31942 ------
NM_001003800chr942965 2721 2627 783 1408 ----
NM_001003805chr141104 ------
NM_001003810chr43871 654 322 ------
NM_001003943chr153850 248 86 ------
NM_001004051chrX160 ------
NM_001004065chr953435 3097 2636 243 34 --1728 --
NM_001004106chr52920 826 ------
NM_001004317chr613920 11514 ----
NM_001004329chr1211495 191 ----
NM_001004342chr154758 4572 4059 1268 25 25522 2138 ----
NM_001004720chr23661 385 367 ------
NM_001004722chr22830 815 ------
NM_001005209chr23717 643 266 ------
NM_001005360chr193805 576 163 ------
NM_001005361chr193805 576 163 ------
NM_001005362chr193805 576 163 ------
NM_001005375chrY11607 ------
NM_001005386chr21141 1992 ----
NM_001005417chr11700 ------
NM_001005463chr1022104 1006 --12027 --
NM_001005473chr546491 4649 4480 1484 ------
NM_001005505chr31453 ------
NM_001005609chrX52576 1469 662 499 29 21354 870 ----
NM_001005861chr32892 38 1949 1126 --
NM_001005920chr162799 54 --1919 --
NM_001006115chr332789 2247 1880 12302 ----
NM_001006617chr93986 321 267 11202 ----
NM_001006619chr93986 321 267 11202 ----
NM_001006620chr93986 321 267 11202 ----
NM_001006621chr93986 321 267 11202 ----
NM_001006635chr22349 142 ------
NM_001006636chr22387 65 ------
NM_001006641chr941504 403 291 84 ------
NM_001006642chr941504 403 291 84 ------
NM_001006643chr941504 403 291 84 ------
NM_001006658chr1124 ------
NM_001006684chrX----1452 --
NM_001006935chrX134 ------
NM_001006936chrX134 ------
NM_001006937chrX134 ------
NM_001006944chr111693 ------
NM_001007023chr1445029 3855 3289 1890 25113 3387 ----
NM_001007024chr1763578 3524 3170 1616 1341 570 --11445 --
NM_001007025chr1763578 3524 3170 1616 1341 570 --11445 --
NM_001007075chr42942 121 ------
NM_001007097chr934016 339 41 ------
NM_001007098chr13784 706 99 ------
NM_001007102chr62491 174 ------
NM_001007156chr1531732 1523 383 ------
NM_001007224chr761718 1667 481 472 226 91 ------
NM_001007257chr111016 ------
NM_001007277chr112434 397 ------
NM_001007466chr634322 4122 3677 12042 ----
NM_001007527chr51546 --2623 499 --
NM_001007553chr11872 ------
NM_001007559chr1812021 --11909 --
NM_001008220chr573838 3797 3706 2429 1317 1243 277 ------
NM_001008222chrX1397 11427 ----
NM_001008225chr7140 ------
NM_001008239chr1823281 1478 ------
NM_001008272chr31335 ------
NM_001008273chr31335 ------
NM_001008392chr353440 3220 2628 403 106 11061 ----
NM_001008408chr775967 5909 3988 3877 1764 1558 1160 1276 15426 --
NM_001008410chr252171 2152 1639 842 599 ------
NM_001008495chr821848 320 ------
NM_001008540chr2--1196 ----
NM_001008564chr1321792 904 11379 ----
NM_001008660chr1121169 1060 ------
NM_001008709chr11122 --1279 --
NM_001008726chr1411642 11482 ----
NM_001008738chr532158 2092 352 ------
NM_001008801chr1921749 1607 ------
NM_001008895chr13170 11396 ----
NM_001009552chr82569 153 ------
NM_001009566chr12282 142 ------
NM_001009899chr3116233 6189 5246 4684 2375 2122 1475 1147 759 661 105 --11618 --
NM_001009955chr11517 ------
NM_001009955chr11517 ------
NM_001009959chr232655 2627 493 ------
NM_001009960chr712826 ------
NM_001009993chr274129 4107 3671 3438 3276 3181 1284 ------
NM_001010853chr632656 814 505 12074 ----
NM_001010854chr142249 68 ------
NM_001010867chr1166402 6222 5653 4602 2237 2220 1897 1885 1692 1650 1621 1188 610 461 393 314 1542 ----
NM_001010888chrX23449 3398 ------
NM_001010891chr566108 4645 2645 1231 1168 544 ------
NM_001010898chr183746 3004 2806 2503 2394 2347 2295 544 ------
NM_001010971chr11993 ------
NM_001010984chr121936 1712 ------
NM_001010986chrX1929 ------
NM_001010989chr161507 ------
NM_001010990chr161507 ------
NM_001011513chr412763 --11291 --
NM_001011537chr312292 --1537 --
NM_001011546chr202693 672 ------
NM_001011553chr71395 ------
NM_001011645chrX3349 327 93 ------
NM_001011666chr764880 4501 2463 2111 846 228 --11715 14615
NM_001011708chr212460 ------
NM_001011713chr143578 232 125 ------
NM_001012329chr132174 1845 357 ------
NM_001012393chr1154913 4828 3320 2020 590 ------
NM_001012398chr161201 ------
NM_001012415chr93258 198 70 1101 2820 118 --
NM_001012420chr1512133 1410 ----
NM_001012426chr662083 1152 762 595 539 452 ------
NM_001012427chr662083 1152 762 595 539 452 ------
NM_001012514chr2--11121 ----
NM_001012516chr2--11121 ----
NM_001012614chr42624 156 ------
NM_001012751chr1031255 549 96 ------
NM_001012755chrX24362 3340 11648 11774 --
NM_001012761chr531710 549 305 ------
NM_001012977chrX41154 1063 950 257 ------
NM_001012979chrX186 ------
NM_001013031chr1063077 2399 2220 1007 929 589 12782 ----
NM_001013399chr61838 ------
NM_001013415chr4--11554 ----
NM_001013437chr18139 ------
NM_001013438chr33366 208 47 ------
NM_001013439chr32212 54 ------
NM_001013620chr1278010 6039 5702 3114 1665 1094 1054 21449 792 ----
NM_001013635chr1221144 1108 1935 ----
NM_001013690chr1241968 1826 884 506 ------
NM_001013839chr1772048 1816 1631 878 669 300 42 ------
NM_001014283chr1341657 1441 1350 459 --11467 --
NM_001014443chr1190 ------
NM_001014794chr111206 ------
NM_001014795chr111206 ------
NM_001014809chr41676 ------
NM_001014812chr152434 418 ------
NM_001014839chr14873 421 381 301 ------
NM_001014841chr14873 421 381 301 ------
NM_001015053chr1741386 370 209 93 ------
NM_001015877chrX32192 1012 626 ------
NM_001015880chr1011602 41516 1148 320 133 ----
NM_001015881chrX11147 ------
NM_001015887chr331460 399 245 11180 ----
NM_001017368chr173458 52 27 ------
NM_001017396chr221808 826 ------
NM_001017405chr41676 1892 ----
NM_001017415chr12537 516 ------
NM_001017416chr12537 516 ------
NM_001017424chr13478 288 254 ------
NM_001017425chr13478 288 254 ------
NM_001017440chr737264 3310 215 ------
NM_001017523chr1231891 1444 401 ------
NM_001017535chr1273054 2226 1186 1146 803 55 24 ------
NM_001017916chr1731608 1367 36 --21875 222 --
NM_001017917chr1731608 1367 36 --21875 222 --
NM_001017962chr102838 46 1398 ----
NM_001017963chr141682 ------
NM_001017999chr12894 462 --21766 38 --
NM_001017999chr12894 462 --21766 38 --
NM_001018000chr12894 462 --21766 38 --
NM_001018000chr12894 462 --21766 38 --
NM_001018001chr12894 462 --21766 38 --
NM_001018004chr151197 1254 ----
NM_001018005chr151141 ------
NM_001018006chr151197 1254 ----
NM_001018007chr151197 1254 ----
NM_001018009chr3165 ------
NM_001018020chr151197 1254 ----
NM_001018057chr114562 473 198 66 ------
NM_001018065chr935476 2042 854 1742 1335 --
NM_001018066chr935476 2042 854 1742 1335 --
NM_001018067chr163827 3484 3322 1743 942 830 ------
NM_001018068chr163827 3484 3322 1743 942 830 ------
NM_001018069chr163827 3484 3322 1743 942 830 ------
NM_001018072chr1231891 1444 401 ------
NM_001018074chr563765 3311 2671 1291 685 495 23018 2393 ----
NM_001018075chr563765 3311 2671 1291 685 495 23018 2393 ----
NM_001018076chr563765 3311 2671 1291 685 495 23018 2393 ----
NM_001018077chr563765 3311 2671 1291 685 495 23018 2393 ----
NM_001018078chr93670 174 76 ------
NM_001018090chr1542492 2483 2179 172 ------
NM_001018091chr1542602 2593 2289 282 ------
NM_001018100chr151628 ------
NM_001018102chr1542492 2483 2179 172 ------
NM_001018108chr1552145 1539 835 151 45 ------
NM_001018111chr741279 1081 427 212 ------
NM_001019chr16151 ------
NM_001020818chr1921457 686 ------
NM_001020819chr1921457 686 ------
NM_001020820chr1921457 686 ------
NM_001020821chr1921457 686 ------
NM_001020825chr521240 146 1493 ----
NM_001023567chr151182 11560 1354 --
NM_001024094chr563765 3311 2671 1291 685 495 23018 2393 ----
NM_001024226chr12808 127 ------
NM_001024227chr12808 127 ------
NM_001024228chr12808 127 ------
NM_001024455chrX32339 2282 183 ------
NM_001024463chr1541064 995 279 241 ------
NM_001024660chr3--11065 ----
NM_001024666chrX2643 82 ------
NM_001024808chr1262357 2215 1057 429 422 257 --21146 1097 --
NM_001024845chr14895 834 79 41 ------
NM_001024934chr6156 ------
NM_001024935chr6156 ------
NM_001024936chr6156 ------
NM_001024937chr171212 ------
NM_001024948chr1122 23167 2183 ----
NM_001024956chr1185760 4307 3846 3560 2043 1905 1450 1177 1379 13605 --
NM_001024959chr33725 277 145 --1197 --
NM_001024960chr33725 277 145 --1197 --
NM_001025068chr321411 1260 ------
NM_001025069chr321411 1260 ------
NM_001025076chr1056051 5625 4987 1984 790 ------
NM_001025077chr1057409 6983 6345 2148 234 1481 ----
NM_001025079chr331591 1361 492 ------
NM_001025108chr252865 1359 1237 801 586 13778 13430 --
NM_001025252chr823199 101 11147 ----
NM_001025253chr823199 101 11147 ----
NM_001025366chr621186 465 ------
NM_001025366chr621186 465 ------
NM_001025367chr621186 465 ------
NM_001025367chr621186 465 ------
NM_001025368chr621186 465 ------
NM_001025368chr621186 465 ------
NM_001025369chr621202 481 ------
NM_001025369chr621202 481 ------
NM_001025370chr621186 465 ------
NM_001025370chr621186 465 ------
NM_001025389chr1121200 287 ------
NM_001025390chr1121200 287 ------
NM_001025580chrX53664 2681 1517 1509 871 ------
NM_001025595chr411646 11509 ----
NM_001025596chr11--2480 69 ----
NM_001025616chr41525 ------
NM_001029858chr633062 1022 707 ------
NM_001029875chr532393 1005 841 ------
NM_001029998chr421400 143 ------
NM_001030006chr1752686 2542 2515 2430 272 ------
NM_001030007chr1622845 1379 13212 12439 --
NM_001030009chr16151 ------
NM_001030055chr1433556 3098 3066 ------
NM_001030287chr12466 348 1834 ----
NM_001031681chr172927 456 --1708 --
NM_001031690chr721898 282 ------
NM_001031695chr2254658 4575 4038 1918 707 1566 --1307
NM_001031709chr101326 ------
NM_001031732chr413647 ------
NM_001031804chr1643083 1684 708 263 ------
NM_001031812chr521450 230 11913 ----
NM_001032280chr621593 250 ------
NM_001032282chr81945 ------
NM_001032283chr121210 ------
NM_001032284chr121210 ------
NM_001032289chrX2733 186 ------
NM_001032393chrX1676 1525 ----
NM_001032999chr2075244 4973 4764 4704 4667 194 49 --24563 3827 --
NM_001033047chr42454 255 ------
NM_001033057chr32182 33 ------
NM_001033059chr62664 88 ------
NM_001033081chr121421 415 ------
NM_001033082chr121421 415 ------
NM_001033087chr2013236 --13169 --
NM_001033112chr51719 ------
NM_001033117chr374874 4839 3909 3455 1541 204 130 --2399 79 --
NM_001033506chr111323 ------
NM_001033518chr762881 2812 2151 1902 1002 306 ------
NM_001033519chr762881 2812 2151 1902 1002 306 ------
NM_001033520chr762881 2812 2151 1902 1002 306 ------
NM_001033551chr1763173 1621 1337 1208 1193 297 --1134 --
NM_001033578chr821501 99 ------
NM_001033602chr1322350 943 1464 ----
NM_001033756chr631120 731 399 ------
NM_001033756chr631120 731 399 ------
NM_001033859chr172116 35 ------
NM_001033925chr1021988 761 --1161 --
NM_001034194chr41141 ------
NM_001034850chr521544 1497 ------
NM_001034915chr81165 1376 ----
NM_001035254chr951828 1660 891 864 541 ------
NM_001035260chr101288 11523 ----
NM_001037132chr72838 753 ------
NM_001037133chr72838 753 ------
NM_001037164chr72322 181 2341 72 ----
NM_001037165chr7178503 8264 7942 6361 3584 3483 2871 2343 2140 2071 1828 1698 1632 1596 1485 1357 1125 17708 38588 6337 5436 --
NM_001037174chr2--11931 ----
NM_001037324chr35770 627 486 235 169 ------
NM_001037331chr183801 369 272 ------
NM_001037332chr51246 12300 ----
NM_001037333chr51246 12300 ----
NM_001037334chr1832281 2267 623 ------
NM_001037339chr11402 ------
NM_001037340chr11402 ------
NM_001037341chr11402 ------
NM_001037341chr11402 ------
NM_001037954chr1142182 2150 163 109 ------
NM_001038707chr131567 588 137 1509 ----
NM_001038707chr131567 588 137 1509 ----
NM_001039091chrX11345 ------
NM_001039465chr14197 ------
NM_001039490chr113538 145 95 ------
NM_001039538chr233330 862 306 --1685 --
NM_001039547chr347529 7000 6138 5632 21052 885 ----
NM_001039570chr2264100 3435 3382 3327 1665 549 --13775 --
NM_001039571chr2264100 3435 3382 3327 1665 549 --13775 --
NM_001039573chr17142 ------
NM_001039574chr14990 962 299 265 ------
NM_001039577chr164431 3918 3817 1707 712 161 --33239 1589 184 --
NM_001039590chrX43233 2614 979 71 12860 ----
NM_001039591chrX43233 2614 979 71 12860 ----
NM_001039618chr1114330 11810 ----
NM_001039690chr1632328 1830 50 ------
NM_001039709chr2075244 4973 4764 4704 4667 194 49 --24563 3827 --
NM_001039711chr12230 183 ------
NM_001039712chr12230 183 ------
NM_001039715chr11969 ------
NM_001039716chr121033 40 ------
NM_001039840chrX65977 4679 4171 1697 1681 54 24460 1433 ----
NM_001039916chr12150 ------
NM_001039917chr12150 ------
NM_001039918chr12150 ------
NM_001039919chr12150 ------
NM_001039920chr12150 ------
NM_001039937chr1353579 2732 2539 1231 279 ------
NM_001039960chr122595 41 21303 472 ----
NM_001040001chr631871 537 330 ------
NM_001040057chr741282 1143 534 213 ------
NM_001040100chr32199 79 ------
NM_001040101chr431355 1318 1209 ------
NM_001040113chr161875 1961 ----
NM_001040142chr22707 683 2655 139 ----
NM_001040143chr22707 683 2655 139 ----
NM_001040144chr1632328 1830 50 ------
NM_001040146chr1632328 1830 50 ------
NM_001040152chr723373 141 13500 ----
NM_001040158chr51372 --1235 --
NM_001040159chr431301 978 326 ------
NM_001040167chr73419 373 220 --2770 109 --
NM_001040181chr32956 764 ------
NM_001040182chr32956 764 ------
NM_001040183chr32956 764 ------
NM_001040199chr32956 764 ------
NM_001040200chr32956 764 ------
NM_001040202chr412513 2402 367 ----
NM_001040214chr64955 751 716 582 ------
NM_001040402chr453083 2979 2863 2823 2528 12367 ----
NM_001040429chr1342915 2703 2660 1232 ------
NM_001040446chr552682 1724 755 616 363 ------
NM_001040450chr152998 92 1871 ----
NM_001040453chr152998 92 1871 ----
NM_001040633chr72357 172 ------
NM_001040661chr74707 328 116 89 ------
NM_001040709chr172540 2340 2262 1948 534 239 225 ------
NM_001040712chr933356 2707 538 1925 13510 --
NM_001040876chr41602 ------
NM_001042355chr1621476 364 13403 ----
NM_001042388chr183658 652 21 ------
NM_001042406chr61917 ------
NM_001042412chr1621476 364 13403 ----
NM_001042413chr932790 992 681 13610 ----
NM_001042425chr621593 250 ------
NM_001042453chrX196 11447 ----
NM_001042473chr1031900 820 804 ------
NM_001042478chr1151 ------
NM_001042481chr143808 768 85 ------
NM_001042486chr2011516 ------
NM_001042494chr1522805 2653 --122 --
NM_001042495chr1522805 2653 --122 --
NM_001042496chr1522805 2653 --122 --
NM_001042497chr1522805 2653 --122 --
NM_001042506chrX51164 1073 1059 950 257 ------
NM_001042510chr822001 1650 ------
NM_001042511chr822001 1650 ------
NM_001042517chr131676 ------
NM_001042537chrX11710 12001 ----
NM_001042539chr162900 141 ------
NM_001042548chr22723 682 ------
NM_001042555chr1294388 3670 3204 3138 1780 1751 824 599 64 21873 238 ----
NM_001042599chr246730 4784 3104 512 21973 152 ----
NM_001042601chr32382 136 ------
NM_001042603chr1274512 4235 3349 3268 1684 579 202 ------
NM_001042632chr203411 256 215 ------
NM_001042633chr203411 256 215 ------
NM_001042646chr331408 1267 1234 ----1147
NM_001042669chr41525 ------
NM_001042681chr132360 2207 820 ------
NM_001042682chr132360 2207 820 ------
NM_001042682chr132360 2207 820 ------
NM_001042702chr2147 ------
NM_001042728chr123752 352 155 ------
NM_001043318chr1464049 3544 3328 3161 1547 1045 --22904 700 --
NM_001043351chr132083 905 148 ------
NM_001044305chr611405 1523 ----
NM_001044722chr521450 230 11913 ----
NM_001044723chr521450 230 11913 ----
NM_001046chr521177 335 21885 47 ----
NM_001048183chr153448 3079 2880 1321 208 ------
NM_001049chr1422223 1946 1708 ----
NM_001071775chr1321919 334 ------
NM_001083620chr421685 192 ------
NM_001087chr2126 ------
NM_001092chr1762309 2290 1880 252 239 159 ------
NM_001094chr17--1593 1841 --
NM_001095chr1211735 1769 ----
NM_001100108chr167716 6530 5229 5148 3052 2534 26972 1249 16071 --
NM_001106chr398143 7606 7558 7206 7032 6269 3859 2174 562 26389 3718 37184 2797 2076 --
NM_001109977chr4152 ------
NM_001113490chrX1629 23651 305 ----
NM_001116chr1652443 1179 737 254 74 --22862 2501 --
NM_001117chr1822065 736 ------
NM_001123chr101590 ------
NM_001127chr224901 862 297 205 ------
NM_001128chr1622845 1379 13212 12439 --
NM_001144chr162481 41 ------
NM_001146chr831842 1540 281 ------
NM_001148chr41405 ------
NM_001149chr10--11042 ----
NM_001173chr1433556 3098 3066 ------
NM_001174chrX42333 2063 1782 1542 ------
NM_001177chr1212308 ------
NM_001198chr622186 59 1253 ----
NM_001199chr82219 192 ------
NM_001204chr21405 ------
NM_001206chr91515 ------
NM_001219chr72914 709 --1181 --
NM_001222chr1011593 --1183 --
NM_001254chr172266 72 ------
NM_001256chr1732886 1980 129 ------
NM_001257chr1631397 1304 1166 ------
NM_001259chr776326 6201 5974 4429 1734 1538 1438 35739 2485 1526 ----
NM_001277chr11174 ------
NM_001282chr1752686 2542 2515 2430 272 ------
NM_001283chr71664 ------
NM_001292chr152105 58 ------
NM_001300chr101464 ------
NM_001304chr1763709 3679 3002 2594 2545 2432 ------
NM_001310chr1212043 ------
NM_001313chr41676 ------
NM_001315chr641421 608 168 86 ------
NM_001328chr42624 156 ------
NM_001331chr1131117 1077 99 ------
NM_001332chr52994 272 11566 ----
NM_001356chrX21619 313 ------
NM_001358chr4--1386 ----
NM_001364chr1174672 4464 4192 3588 3007 1329 344 ------
NM_001383chr172281 224 ------
NM_001386chr842188 2141 762 336 --2815 606 --
NM_001387chr543038 2105 1272 691 ------
NM_001391chr181124 ------
NM_001396chr2122449 1729 ------
NM_001399chrX52576 1469 662 499 29 21354 870 ----
NM_001402chr611980 ------
NM_001406chr172494 104 ------
NM_001408chr141186 575 424 78 ------
NM_001412chrX23323 874 ------
NM_001417chr1211524 1292 ----
NM_001419chr1953742 3506 3250 3003 1824 ------
NM_001420chr191323 ------
NM_001426chr21503 --1577 --
NM_001427chr711671 12051 ----
NM_001431chr61849 ------
NM_001438chr122365 1165 ------
NM_001447chr53574 561 423 ------
NM_001449chrX1527 ------
NM_001453chr61603 ------
NM_001465chr521575 1517 ------
NM_001482chr151100 ------
NM_001483chr71200 124 ----
NM_001490chr92546 363 ------
NM_001491chr632610 2290 1751 11047 ----
NM_001493chrX3670 223 40 ------
NM_001497chr962730 2458 2094 1848 1827 57 ------
NM_001543chr573488 3143 3051 1935 1855 1800 1565 ------
NM_001554chr11462 ------
NM_001584chr111147 ------
NM_001587chrX22225 839 ------
NM_001604chr112894 638 ------
NM_001616chr212830 ------
NM_001619chr1161104 940 838 328 297 230 ------
NM_001621chr74802 549 520 494 12817 ----
NM_001621chr74802 549 520 494 12817 ----
NM_001634chr62664 88 ------
NM_001635chr72422 235 ------
NM_001649chrX62495 2132 2072 793 777 295 ------
NM_001650chr1811578 ------
NM_001654chrX4392 330 321 147 ------
NM_001658chr12808 127 ------
NM_001660chr32659 181 ------
NM_001663chr1422264 1704 ------
NM_001665chr115471 144 80 61 52 1493 ----
NM_001668chr112055 ------
NM_001670chr223735 316 82 ------
NM_001674chr12466 348 1834 ----
NM_001675chr22130 ------
NM_001677chr13863 746 241 ------
NM_001679chr31324 1305 1142 --
NM_001682chr1232227 1788 189 ------
NM_001683chr3--12172 ----
NM_001684chr163744 2641 1461 1262 1207 367 ------
NM_001690chr322415 1615 1122 ----
NM_001693chr81145 ------
NM_001699chr1931821 1686 559 11240 ----
NM_001704chr61119 ------
NM_001706chr33835 823 98 11012 ----
NM_001707chr7--1189 ----
NM_001709chr1121794 1761 ------
NM_001718chr621308 127 ------
NM_001722chr8133 ------
NM_001730chr1311121 11647 ----
NM_001730chr1311121 11647 ----
NM_001753chr72660 622 ------
NM_001754chr2144192 4045 2666 1386 ------
NM_001759chr1265079 4780 4733 4595 4036 3724 1198 ----
NM_001777chr331591 1361 492 ------
NM_001781chr122690 125 ------
NM_001782chr9149 ------
NM_001788chr71395 ------
NM_001789chr32258 233 11374 ----
NM_001792chr182243 109 ------
NM_001796chr16--1229 ----
NM_001797chr162591 37 ------
NM_001829chr43803 682 293 ------
NM_001833chr91244 ------
NM_001839chr11671 ------
NM_001845chr132330 123 1876 ----
NM_001846chr131546 136 ----
NM_001851chr6--1489 ----
NM_001854chr13942 438 67 ------
NM_001855chr92895 617 ------
NM_001859chr931407 1322 848 ------
NM_001876chr112500 345 1375 ----
NM_001894chr222355 37 ------
NM_001895chr201419 --1110 --
NM_001901chr63672 375 153 ------
NM_001914chr181326 ------
NM_001915chr1731608 1367 36 --21875 222 --
NM_001931chr111947 11014 ----
NM_001933chr1421315 417 ------
NM_001935chr231023 896 736 ------
NM_001939chrX43824 3263 3247 3025 11138 ----
NM_001945chr52996 987 ------
NM_001946chr12134 ------
NM_001949chr62338 287 12029 21003 423 --
NM_001951chr82603 498 ------
NM_001955chr61366 ------
NM_001964chr52774 410 ------
NM_001967chr3171 ------
NM_001970chr171472 ------
NM_001982chr1241210 357 242 49 ------
NM_001991chr1741454 304 93 57 ------
NM_001999chr52959 506 ------
NM_002006chr422150 828 ------
NM_002015chr1353298 3204 2198 321 240 ------
NM_002024chrX1548 ------
NM_002025chrX99145 9069 7873 6698 2616 2398 2117 1314 262 --28673 2736 --
NM_002033chr1154071 3772 3542 3372 2810 23812 1189 ----
NM_002037chr61315 ------
NM_002039chr41166 ------
NM_002040chr211465 ------
NM_002044chr1521588 65 ------
NM_002051chr101169 ------
NM_002062chr631595 533 185 ------
NM_002063chrX21308 46 ------
NM_002069chr711682 ------
NM_002072chr92774 133 ------
NM_002073chr2221154 66 ------
NM_002076chr1253021 2886 2143 951 71 13003 ----
NM_002078chr3--122 ----
NM_002079chr101441 ------
NM_002080chr161931 ------
NM_002081chr231245 374 227 ------
NM_002082chr52883 789 ------
NM_002086chr1741990 1820 1658 863 ------
NM_002087chr171239 ------
NM_002095chr81254 ------
NM_002103chr1931062 1008 329 --1199 --
NM_002114chr61194 ------
NM_002126chr1753724 2736 2670 1598 167 ------
NM_002133chr221408 ------
NM_002135chr12156 ------
NM_002137chr742002 1909 1679 1603 ------
NM_002138chr43871 654 322 ------
NM_002139chrX1444 ------
NM_002140chr91997 ------
NM_002147chr172288 39 ------
NM_002148chr21179 ------
NM_002149chr23726 674 47 ------
NM_002156chr21341 ------
NM_002157chr21134 ------
NM_002158chr221209 748 13472 ----
NM_002165chr202295 61 ------
NM_002166chr21678 ------
NM_002193chr221717 513 --1586 --
NM_002196chr20134 ------
NM_002196chr20134 ------
NM_002198chr53685 280 182 ------
NM_002202chr51755 ------
NM_002204chr1721351 416 --1490 --
NM_002211chr1031100 837 240 ------
NM_002214chr721317 201 ------
NM_002222chr31213 ------
NM_002226chr145837 803 728 683 279 ------
NM_002228chr11851 11132 ----
NM_002230chr173372 176 152 1840 ----
NM_002232chr131356 173 48 ------
NM_002233chr111433 ------
NM_002241chr11461 12022 ----
NM_002246chr22497 149 1442 11143 --
NM_002247chr1022172 396 ------
NM_002253chr42201 195 ------
NM_002264chr3105071 4995 4397 4362 1861 1375 1251 1014 780 642 13521 ----
NM_002265chr1721096 403 ------
NM_002267chr1311848 ------
NM_002268chr331617 1207 318 ------
NM_002285chr252865 1359 1237 801 586 13778 13430 --
NM_002293chr172665 2199 1685 575 529 212 65 ------
NM_002309chr2262964 2405 1103 1037 413 137 ------
NM_002310chr51156 44833 4669 2355 598 ----
NM_002313chr1045140 5027 1216 522 11611 ----
NM_002319chr751046 763 316 233 85 ------
NM_002334chr113587 333 97 ------
NM_002336chr1234983 4895 213 13742 ----
NM_002346chr83597 418 109 --199 --
NM_002355chr1221126 1053 ------
NM_002356chr622408 472 ------
NM_002359chr17103922 2660 1713 1360 1282 1245 1206 678 659 355 11445 23589 1170 --
NM_002373chr1521292 189 ------
NM_002374chr233330 862 306 --1685 --
NM_002379chr12106 46 1117 ----
NM_002383chr161723 ------
NM_002387chr551951 1629 654 456 250 11144 ----
NM_002397chr5196 ------
NM_002398chr21969 ------
NM_002399chr15----1930 --
NM_002401chr1772386 2287 2255 2081 966 779 137 ------
NM_002402chr71772 ------
NM_002403chr12151 72 ------
NM_002430chr2222090 772 --1953 --
NM_002442chr1231719 708 316 21391 580 ----
NM_002449chr521219 355 ------
NM_002480chr1221032 430 ------
NM_002499chr1522339 392 --1323 --
NM_002500chr2--147 ----
NM_002501chr19103868 3546 3465 3447 2937 2799 1589 1536 1201 729 ------
NM_002515chr14--12058 ----
NM_002522chr1743354 3217 937 788 22485 327 1458 1313
NM_002537chr151940 ------
NM_002541chr74869 171 116 80 ------
NM_002545chr1154913 4828 3320 2020 590 ------
NM_002546chr81299 ------
NM_002547chrX54264 4163 3867 3330 3227 ------
NM_002552chr22262 147 ------
NM_002556chr1121619 93 ------
NM_002568chr8135 ------
NM_002569chr1521233 530 --21292 596 --
NM_002576chr112408 29 ------
NM_002577chr313188 ------
NM_002581chr954470 3904 2014 1469 323 15195 ----
NM_002585chr12273 35 ------
NM_002587chr54396 311 75 21 ------
NM_002588chr531725 1531 1371 ------
NM_002590chr132542 100 ------
NM_002591chr201414 1550 ----
NM_002595chr1221822 1737 ------
NM_002600chr11402 ------
NM_002607chr741175 1090 414 101 ------
NM_002609chr541914 1360 708 149 ------
NM_002613chr1695348 4477 3720 3479 1986 1568 1025 875 257 --1517 --
NM_002622chr5164 ------
NM_002628chr32963 344 ------
NM_002634chr172816 357 1243 ----
NM_002636chr6175 ------
NM_002645chr1142328 2180 959 620 ------
NM_002646chr132082 1538 654 ------
NM_002648chr631194 446 112 ------
NM_002655chr864296 3846 3378 688 478 47 24055 76 13895 --
NM_002657chr2033522 1373 127 ------
NM_002687chr141832 ------
NM_002693chr15184 ------
NM_002698chr1932682 2374 635 ------
NM_002699chr111219 ------
NM_002708chr11122 --1279 --
NM_002709chr2--11106 ----
NM_002714chr61798 ------
NM_002717chr81122 --1661 --
NM_002719chr1432322 1781 76 --21563 610 --
NM_002721chr9--1172 ----
NM_002731chr122784 204 --1726 --
NM_002737chr17106141 5862 5255 4825 4486 2428 1948 1688 1426 100 1961 11970 15994
NM_002738chr1611143 ------
NM_002742chr142553 286 ------
NM_002745chr2253597 3340 1308 562 37 --11708 --
NM_002747chr1811788 ------
NM_002748chr152900 865 ------
NM_002750chr10150 ------
NM_002752chr51454 ------
NM_002753chr41588 ------
NM_002755chr153260 220 135 1823 ----
NM_002758chr172514 408 ------
NM_002763chr11416 172 ----
NM_002765chrX11345 ------
NM_002787chr72682 597 ------
NM_002802chr141206 ------
NM_002819chr192926 333 ------
NM_002822chr122522 431 ------
NM_002830chr2160 ------
NM_002833chr152242 118 ------
NM_002837chr1264189 3984 3187 1213 987 586 ------
NM_002839chr933356 2707 538 1925 13510 --
NM_002843chr1172960 2685 2610 1033 1027 521 420 ------
NM_002844chr6--11394 ----
NM_002847chr72350 81 ------
NM_002851chr72507 166 ------
NM_002852chr32248 229 ------
NM_002855chr1173304 2846 2628 2455 1468 967 718 ------
NM_002865chr81262 ------
NM_002869chr1161912 1520 791 755 633 187 ------
NM_002873chr51386 ------
NM_002874chr912237 1744 ----
NM_002886chr384730 3859 1611 1048 1037 743 170 118 ------
NM_002892chr141523 ------
NM_002893chrX1295 ------
NM_002895chr202215 139 --1843 --
NM_002897chr24581 535 492 84 ------
NM_002902chr151220 ------
NM_002904chr62176 25 ------
NM_002906chr1131740 1721 435 1606 ----
NM_002911chr191401 ------
NM_002912chr6172 146 ----
NM_002918chr1961101 1043 1007 789 753 236 --1216 --
NM_002924chr11229 ------
NM_002930chr18196 ------
NM_002931chr6----1302 --
NM_002940chr41602 ------
NM_002941chr31265 ------
NM_002942chr3------11250
NM_002955chr651605 1384 556 222 209 ------
NM_002958chr32892 38 1949 1126 --
NM_002971chr331016 836 807 ------
NM_002994chr421935 331 ------
NM_002996chr1631973 1574 419 ------
NM_002998chr822129 427 ------
NM_003010chr1721681 1492 ------
NM_003011chr931217 1149 419 ------
NM_003016chr1721667 577 ------
NM_003017chr61902 ------
NM_003026chr931272 1258 211 11039 ----
NM_003030chr311299 ------
NM_003035chr1142 ------
NM_003036chr131154 1088 827 11069 11191 1121
NM_003040chr71147 ------
NM_003042chr311697 ------
NM_003043chr333139 1621 1172 12832 ----
NM_003045chr1384580 4225 4218 3772 3646 3426 1614 249 --13823 --
NM_003048chr22268 30 ------
NM_003055chr101372 ------
NM_003060chr531295 940 125 ------
NM_003068chr82848 444 ------
NM_003069chrX1728 ------
NM_003070chr92854 321 ------
NM_003074chr331839 224 126 --1134 --
NM_003076chr123606 301 228 ------
NM_003077chr173570 271 101 ------
NM_003079chr17--1344 ----
NM_003081chr202423 167 ------
NM_003085chr53544 443 150 ------
NM_003088chr711077 ------
NM_003108chr277183 7177 5140 4552 2601 2461 2256 --22573 291 --
NM_003110chr171247 1921 ----
NM_003112chr711993 ------
NM_003113chr21163 ------
NM_003128chr212695 2341 91 ----
NM_003131chr642169 433 365 320 12010 ----
NM_003132chr12173 60 ------
NM_003139chr112826 70 ------
NM_003145chr1166 2455 433 ----
NM_003155chr862564 1952 1858 1722 520 81 ------
NM_003156chr111447 11004 ----
NM_003161chr1712642 ------
NM_003168chr172775 265 ------
NM_003173chrX21312 1254 1455 --1555
NM_003178chr372060 1903 1581 649 486 463 266 --1188 --
NM_003182chr72357 150 ------
NM_003182chr72357 150 ------
NM_003184chr811000 ------
NM_003189chr132345 2221 551 ------
NM_003194chr62469 232 ------
NM_003199chr1844572 4396 3897 1093 1334 ----
NM_003200chr1952302 2251 1835 1746 254 1494 1662 --
NM_003203chr22463 76 --1153 --
NM_003204chr1721718 1204 11677 ----
NM_003211chr1221434 1424 ------
NM_003215chr411592 --11091 --
NM_003217chr1211757 ------
NM_003220chr621593 250 ------
NM_003221chr6--1210 ----
NM_003223chr161537 --1830 --
NM_003234chr342364 954 253 68 ------
NM_003236chr232856 300 95 1961 ----
NM_003239chr141929 ------
NM_003246chr1521987 121 11582 ----
NM_003250chr173406 319 81 ------
NM_003253chr2121787 1497 ----11833
NM_003255chr1732204 993 232 ------
NM_003257chr1511272 ------
NM_003262chr333767 1567 903 13598 ----
NM_003270chrX2949 200 ------
NM_003274chr213565 499 402 12593 ----
NM_003275chr911179 ------
NM_003288chr2041376 1291 1246 975 ------
NM_003298chr375483 5159 4888 3956 2162 1322 992 --13811 --
NM_003304chr31272 11556 ----
NM_003305chr42375 354 ------
NM_003319chr22658 352 ------
NM_003320chr1174453 4118 3146 2820 1460 696 621 ------
NM_003325chr221164 ------
NM_003336chrX--1332 ----
NM_003338chr1021949 539 ------
NM_003339chr52449 339 ------
NM_003342chr1773062 2910 2837 2731 2669 2563 680 ------
NM_003347chr2242063 1973 1694 98 ------
NM_003348chr1211075 ------
NM_003350chr82752 737 ------
NM_003356chr112983 34 ------
NM_003360chr41306 ------
NM_003368chr12537 516 ------
NM_003369chr1132647 1738 977 12136 ----
NM_003373chr1021803 447 ------
NM_003376chr621186 465 ------
NM_003376chr621186 465 ------
NM_003390chr111306 ------
NM_003391chr71363 ------
NM_003392chr343084 2967 1399 959 ------
NM_003406chr811377 21929 1578 ----
NM_003409chr181134 1216 ----
NM_003410chrX22196 696 12054 ----
NM_003411chrY31749 1650 1603 ------
NM_003412chr32760 647 ------
NM_003413chrX21393 425 ------
NM_003430chr191558 ------
NM_003452chr92717 660 ------
NM_003453chr131288 ------
NM_003458chr343125 2776 745 356 ------
NM_003463chr653164 3097 2758 2146 233 ------
NM_003466chr232524 1567 885 ------
NM_003467chr2--1196 ----
NM_003468chr2103697 3116 3002 1635 1179 846 726 687 480 416 23946 622 ----
NM_003470chr1631810 1646 77 ------
NM_003471chr32144 50 ------
NM_003472chr611086 ------
NM_003474chr103751 534 290 1407 ----
NM_003478chr1123223 47 12239 ----
NM_003483chr1242794 1176 1034 400 ------
NM_003489chr2123117 592 ------
NM_003498chr161578 ----1362
NM_003502chr162438 26 ----1142
NM_003505chr731964 1912 78 ------
NM_003507chr21475 1285 ----
NM_003559chr1773888 3615 3555 3127 1134 1072 973 ------
NM_003565chr1231438 389 207 ------
NM_003566chr1243301 2995 2979 2919 ------
NM_003574chr1842048 1055 629 452 --11985 --
NM_003581chr23661 385 367 ------
NM_003583chr1233219 2817 2797 ------
NM_003589chr13170 11396 ----
NM_003590chr243868 3697 1220 1186 13186 ----
NM_003591chr102305 83 ------
NM_003600chr205679 630 540 296 145 ------
NM_003603chr431355 491 328 ------
NM_003615chr32411 130 11136 ----
NM_003618chr21326 1200 ----
NM_003621chr112483 396 ------
NM_003629chr192938 2910 2485 2177 1240 1173 1042 987 895 ------
NM_003631chr101824 11014 ----
NM_003632chr172831 712 ------
NM_003633chr521591 782 ------
NM_003644chr17115726 5363 4948 4868 4520 4121 1570 1242 679 331 252 --16321 --
NM_003648chr232478 989 522 --21641 358 --
NM_003654chr112716 111 ------
NM_003655chr171318 ------
NM_003658chr111577 1342 ----
NM_003663chr3--33363 3038 2222 ----
NM_003672chr111264 11809 ----
NM_003684chr131119 1007 884 21135 951 1402 --
NM_003685chr194995 959 946 193 ------
NM_003701chr132806 322 ------
NM_003709chr2--143 ----
NM_003716chr31277 ------
NM_003728chr41532 1467 ----
NM_003735chr531725 1531 1371 ------
NM_003736chr531725 1531 1371 ------
NM_003743chr231949 457 431 ------
NM_003749chr1341606 962 534 324 ------
NM_003750chr10274 31 ------
NM_003762chr111232 ------
NM_003763chr2043000 2919 1216 25 ------
NM_003768chr111461 11178 ----
NM_003769chr12191 ------
NM_003779chr11118 ------
NM_003780chr11700 ------
NM_003787chr1821119 165 ------
NM_003800chr611542 ------
NM_003822chr12615 609 ------
NM_003831chr1851827 1323 144 121 113 ------
NM_003861chr1462848 2637 855 464 267 130 12460 ----
NM_003862chr51244 ------
NM_003872chr241983 818 772 465 ------
NM_003873chr101753 --1628 --
NM_003876chr17----1284 --
NM_003884chr321579 547 21513 47 ----
NM_003885chr1742408 2214 552 278 186 11894 --
NM_003896chr22956 769 ------
NM_003902chr11338 ------
NM_003908chr2041412 382 339 228 ------
NM_003913chr622649 182 ------
NM_003924chr461316 1125 377 357 346 339 --11428 --
NM_003930chr711869 ------
NM_003931chr6156 ------
NM_003936chr231137 464 349 ------
NM_003938chr192843 271 --167 --
NM_003939chr1063711 2945 1669 1358 1223 476 ------
NM_003942chr111693 ------
NM_003949chr1751783 1739 1610 1289 226 166 ----
NM_003956chr10143 --1506 --
NM_003966chr556067 1202 646 305 54 ------
NM_003968chr31179 ------
NM_003981chr1511026 2708 41 197 --
NM_003993chr1167 --1337 --
NM_003994chr1221744 1270 --1313 --
NM_004004chr132499 62 ------
NM_004006chrX1416 ------
NM_004007chrX1416 ------
NM_004009chrX1416 ------
NM_004010chrX1416 ------
NM_004011chrX1416 ------
NM_004012chrX1416 ------
NM_004013chrX1416 ------
NM_004014chrX1416 ------
NM_004015chrX1416 ------
NM_004016chrX1330 ------
NM_004017chrX1416 ------
NM_004018chrX1330 ------
NM_004020chrX1416 ------
NM_004021chrX1330 ------
NM_004022chrX1330 ------
NM_004023chrX1330 ------
NM_004028chr1811578 ------
NM_004036chr21184 ------
NM_004055chr1131622 1456 379 ------
NM_004059chr92185 63 ------
NM_004067chr73590 228 150 ------
NM_004071chr2--1221 ----
NM_004073chr1282 31 ------
NM_004081chrY11607 ------
NM_004087chr321712 152 --1683 --
NM_004089chrX11147 ------
NM_004093chr1353044 2610 251 84 26 ------
NM_004094chr1433029 2786 663 ------
NM_004099chr921920 418 11318 ----
NM_004100chr632659 1654 654 ------
NM_004116chr21483 ------
NM_004124chr1433569 1030 795 ------
NM_004134chr52622 476 ------
NM_004156chr82569 153 ------
NM_004170chr931528 1500 481 ------
NM_004171chr1167811 2849 2229 1371 1035 181 28056 1661 ----
NM_004183chr112753 640 ------
NM_004203chr16145 ----1113
NM_004225chr831509 551 138 --1127 --
NM_004227chr753010 2824 2736 1193 162 ------
NM_004229chrX11939 ------
NM_004232chr1822673 169 --12688 --
NM_004236chr151131 ------
NM_004238chr2123 ------
NM_004242chr61344 ------
NM_004263chr241571 1552 1113 397 ------
NM_004268chr1131058 285 176 11049 ----
NM_004272chr511672 ------
NM_004274chr141744 ------
NM_004281chr102453 42 ------
NM_004293chr943847 682 616 61 1127 ----
NM_004295chr1751275 418 304 168 155 1974 ----
NM_004297chr9172 ------
NM_004302chr1271822 817 719 633 595 584 562 --1709 --
NM_004309chr1761088 1053 920 285 157 111 ------
NM_004320chr16133 ------
NM_004321chr2103366 2779 2427 2371 921 664 655 478 195 156 23033 2583 ----
NM_004326chr13809 288 21 ------
NM_004327chr2232439 2038 1766 ------
NM_004329chr1041008 527 341 294 1933 ----
NM_004331chr812694 ------
NM_004338chr18116622 5932 5625 5125 4945 4927 4853 4716 2394 1841 509 ----26861 6370
NM_004343chr192575 405 ------
NM_004357chr113538 145 95 ------
NM_004360chr1621536 428 11315 ----
NM_004364chr195987 975 288 151 123 --1346 --
NM_004370chr631623 588 546 ----180
NM_004379chr22576 154 ------
NM_004384chr521450 230 11913 ----
NM_004385chr52139 60 ------
NM_004389chr22601 129 ------
NM_004392chr1312318 ------
NM_004393chr312407 1416 ----
NM_004395chr51791 --178 --
NM_004397chr1163405 3244 2662 1170 956 460 --13237 --
NM_004408chr92357 172 ------
NM_004411chr71131 1320 ----
NM_004414chr2141518 1172 322 155 ------
NM_004415chr62652 88 ------
NM_004416chr122656 388 --1313 --
NM_004422chr173151 84 69 ------
NM_004426chr1212002 ------
NM_004427chr111110 ------
NM_004428chr13716 599 582 ------
NM_004429chrX3204 176 93 ------
NM_004430chr831040 513 41 ------
NM_004431chr1170 ------
NM_004432chr932249 1979 383 ------
NM_004433chr141550 666 440 268 11664 ----
NM_004438chr232639 1319 692 12481 ----
NM_004440chr621336 600 ------
NM_004442chr121061 59 ------
NM_004443chr31737 ------
NM_004444chr74882 815 691 86 ------
NM_004447chr1221100 399 ------
NM_004454chr32901 221 --11595 --
NM_004455chr121089 429 ------
NM_004457chr22603 179 ------
NM_004461chr19--1201 ----
NM_004464chr454342 4241 3945 1185 59 1983 ----
NM_004475chr175948 893 368 233 100 --1250 --
NM_004481chr192437 2323 1869 1726 1700 1676 902 525 469 ----12177
NM_004484chrX1253 ------
NM_004491chr19104023 3133 3055 2972 1704 1601 1310 774 594 317 ------
NM_004496chr1421075 402 ------
NM_004498chr152386 279 ------
NM_004499chr52473 198 ------
NM_004500chr14--11897 ----
NM_004501chr174042 3947 3816 1145 875 327 108 ------
NM_004505chr172665 284 ------
NM_004512chr92301 254 ------
NM_004516chr193933 92 78 ------
NM_004517chr111206 ------
NM_004519chr81188 ------
NM_004520chr52622 100 ------
NM_004521chr101311 --1289 --
NM_004525chr221241 146 ----1385
NM_004535chr2041683 1599 1586 1568 --1440 --
NM_004540chr211831 ------
NM_004576chr51319 ------
NM_004578chr11868 ------
NM_004586chrX54220 3453 1471 1380 437 25072 3857 ----
NM_004588chr1183655 3644 3350 1268 599 355 89 30 ------
NM_004593chr32806 188 2584 95 ----
NM_004595chrX--1431 ----
NM_004598chr53684 622 418 22026 411 12969 --
NM_004612chr964536 4529 3787 3131 3032 663 1845 ----
NM_004614chr1681870 1584 1518 858 313 247 149 103 11561 ----
NM_004626chr111137 ------
NM_004630chr111238 ------
NM_004637chr3--2898 392 ----
NM_004642chr121510 ------
NM_004643chr141565 ------
NM_004654chrY2938 70 ------
NM_004655chr1721126 854 ------
NM_004664chr12----160 --
NM_004667chr15188 ------
NM_004670chr1011602 41516 1148 320 133 ----
NM_004673chr121100 513 ------
NM_004687chr1731693 832 482 ------
NM_004709chrX41427 620 499 166 21821 485 ----
NM_004713chr141721 ------
NM_004719chr1232676 1142 652 ------
NM_004730chr521454 720 --131 --
NM_004731chr1231912 1634 597 ------
NM_004734chr1322702 905 ------
NM_004739chr11180 ------
NM_004740chr172219 87 ------
NM_004742chr34475 379 251 59 ------
NM_004744chr432785 2659 717 1150 ----
NM_004745chr835932 4558 1663 15767 ----
NM_004748chr152680 74 1652 ----
NM_004759chr152089 1958 1371 502 478 ------
NM_004762chr1741703 1627 787 623 ------
NM_004766chr3179 ------
NM_004768chr111134 ------
NM_004774chr1752574 2458 1044 540 227 ------
NM_004776chr2022728 112 11162 ----
NM_004779chr51971 146 ----
NM_004781chr12441 207 --1145 --
NM_004781chr12441 207 --1145 --
NM_004783chr162507 192 ------
NM_004788chr1132537 2047 866 ------
NM_004789chr9----1310 --
NM_004796chr142741 249 ------
NM_004798chr2062631 2570 1403 1374 493 162 ------
NM_004800chr131173 ------
NM_004801chr211348 ------
NM_004805chr231262 1123 1050 --1238 --
NM_004840chrX42471 909 362 30 ------
NM_004841chr12874 836 ------
NM_004842chr621493 83 11294 ----
NM_004844chr3165 ------
NM_004845chrX43825 3481 3107 468 ------
NM_004846chr2171 ------
NM_004859chr172692 526 ------
NM_004863chr1474985 4959 4651 4123 1792 1753 435 13985 ----
NM_004869chr1821432 1189 ------
NM_004871chr1763578 3524 3170 1616 1341 570 --11445 --
NM_004879chr112312 275 ------
NM_004886chr19129 ------
NM_004893chr51372 --1235 --
NM_004896chr101203 11438 ----
NM_004898chr442835 2331 361 242 ------
NM_004899chr21131 ------
NM_004902chr202591 286 ------
NM_004904chr764880 4501 2463 2111 846 228 --11715 14615
NM_004924chr192400 257 ------
NM_004925chr91878 ------
NM_004926chr1431628 374 150 --11309 --
NM_004930chr11602 ------
NM_004937chr172821 40 --11073 --
NM_004945chr193805 576 163 ------
NM_004947chr3--12354 ----
NM_004952chr11935 ------
NM_004953chr33418 121 105 ------
NM_004956chr723245 2811 ------
NM_004957chr93670 174 76 ------
NM_004961chrX31479 1111 408 ------
NM_004965chr211559 ------
NM_004973chr61502 ------
NM_004976chr1144949 3825 3625 1527 --24930 3655 --
NM_004978chr131653 1625 577 ------
NM_004982chr121627 ------
NM_004985chr1264319 4019 3029 2755 1540 1269 13201 ----
NM_004992chrX68091 8055 7701 6907 6612 5725 --27494 5782 --
NM_004992chrX68091 8055 7701 6907 6612 5725 --27494 5782 --
NM_004999chr684223 3983 3360 1460 1028 945 546 62 ------
NM_005010chr72838 753 ------
NM_005012chr11142 ------
NM_005028chr1042311 2269 1771 1720 ------
NM_005032chrX--177 ----
NM_005033chr41141 ------
NM_005044chrX64368 3958 3880 1497 1111 634 14457 14317 --
NM_005056chr1274756 4479 3593 3512 1928 823 446 ------
NM_005057chr12542 107 21269 1199 ----
NM_005063chr1063422 3373 2939 2798 2697 1436 ------
NM_005065chr1422082 1838 --12051 --
NM_005066chr12311 266 ------
NM_005069chr2141517 1426 646 628 11713 ----
NM_005070chr2----1246 --
NM_005077chr91389 ------
NM_005079chr823199 101 11147 ----
NM_005080chr221940 1370 ----
NM_005087chr32212 54 ------
NM_005093chr2075244 4973 4764 4704 4667 194 49 --24563 3827 --
NM_005095chr11768 ------
NM_005099chr1--1485 11063 --
NM_005102chr22723 682 ------
NM_005109chr322325 274 11929 ----
NM_005110chr52156 111 --1141 --
NM_005112chr42690 159 ------
NM_005116chr2063894 1615 569 429 176 164 ------
NM_005117chr11----169 --
NM_005119chr121086 826 ------
NM_005134chr183658 652 21 ------
NM_005135chr1522805 2653 --122 --
NM_005151chr1832281 2267 623 ------
NM_005154chr151533 ------
NM_005156chr974070 3594 3587 1716 1236 1055 674 23612 1069 ----
NM_005157chr921766 1505 ------
NM_005159chr1541892 1559 1397 134 22274 2196 ----
NM_005168chr231612 1388 320 ------
NM_005171chr121814 ------
NM_005180chr101416 ------
NM_005186chr114472 200 100 29 ------
NM_005187chr1651611 1585 591 76 39 ------
NM_005188chr11157352 7190 6999 6768 6727 6701 6244 5926 5675 2501 2383 1914 1331 1174 378 17293 ----
NM_005189chr1762422 2321 1845 1791 1677 1619 --1797 --
NM_005190chr61838 ------
NM_005197chr1475691 4797 4177 4047 3981 1916 901 25184 4041 ----
NM_005198chr221182 ------
NM_005206chr1711163 --1374 --
NM_005207chr2283123 2616 2287 1430 1356 1087 836 598 --12737 --
NM_005219chr531381 1255 395 169 ----
NM_005225chr2031151 937 438 ------
NM_005235chr246730 4784 3104 512 21973 152 ----
NM_005238chr1153372 2956 2533 591 333 ------
NM_005244chr203665 491 130 --1610 --
NM_005245chr45706 201 147 83 24 ------
NM_005252chr141296 ------
NM_005254chr1521103 868 ------
NM_005257chr181347 --2118 58 --
NM_005274chr11110 ------
NM_005277chr461922 1878 1834 1326 610 96 --11727 --
NM_005296chrX21079 890 --1703 --
NM_005302chr71162 ------
NM_005311chr752756 2545 1070 1064 749 ------
NM_005316chr1121068 838 ------
NM_005318chr2231243 892 793 ------
NM_005324chr1721789 1754 --11805 --
NM_005327chr44656 526 256 66 ------
NM_005329chr1631714 1660 567 ------
NM_005338chr733455 2758 880 ------
NM_005339chr444020 4007 595 431 13548 ----
NM_005342chrX62777 2764 2353 1039 189 82 ------
NM_005348chr141682 ------
NM_005359chr1875837 5743 4871 4550 4345 4171 466 12542 ----
NM_005369chrX3522 430 231 ------
NM_005370chr192829 47 ------
NM_005374chr1742233 1597 1522 205 11544 ----
NM_005375chr611179 ------
NM_005376chr11833 --2381 29 --
NM_005378chr2--1342 ----
NM_005385chr332571 987 755 ------
NM_005386chr201811 ------
NM_005397chr741279 1081 427 212 ------
NM_005400chr233035 639 476 ------
NM_005402chr7----11799 --
NM_005407chr1431575 1335 591 1168 ----
NM_005417chr2041840 1696 1446 380 --11530 --
NM_005418chr112255 31 ------
NM_005433chr1822516 2016 11845 ----
NM_005435chr72500 177 --1170 --
NM_005436chr1033648 3610 3181 ------
NM_005437chr101988 ------
NM_005438chr112257 148 ------
NM_005455chr161667 1586 1284 653 637 176 ------
NM_005474chr1741386 370 209 93 ------
NM_005475chr122873 129 ------
NM_005479chr1031455 1329 515 ------
NM_005493chr6--1795 1756 --
NM_005497chr1764985 1758 796 500 239 26 --15616 --
NM_005501chr1721164 229 --1303 --
NM_005502chr94898 691 488 190 11191 ----
NM_005505chr122757 141 ------
NM_005507chr112428 372 ------
NM_005509chr52727 680 ------
NM_005512chr1161696 1645 1530 633 485 283 1402 ----
NM_005520chr5--1521 ----
NM_005521chr102831 152 ------
NM_005523chr71591 ------
NM_005530chr1521488 203 1224 ----
NM_005537chr1321011 780 ------
NM_005541chr281184 924 885 816 802 411 391 274 ------
NM_005542chr71226 1399 ----
NM_005544chr23326 314 213 ------
NM_005575chr51176 ------
NM_005578chr344170 4094 2045 391 ------
NM_005594chr12129 ------
NM_005596chr986240 5685 5096 4473 4208 1878 1329 1047 15858 11488 --
NM_005598chr12673 510 ------
NM_005604chr622500 258 12164 ----
NM_005610chr11370 1920 ----
NM_005613chr132162 437 92 ------
NM_005614chr721004 793 ------
NM_005626chr11147 1125 ----
NM_005627chr61357 ------
NM_005637chr1812021 --11909 --
NM_005638chrX21357 441 ------
NM_005639chr12--11479 ----
NM_005647chrX43465 922 833 349 ------
NM_005650chr221938 --1151 --
NM_005655chr81945 ------
NM_005668chr512799 --24186 947 --
NM_005677chr331321 1268 1050 ------
NM_005686chr171495 1411 980 633 600 510 110 1301 ----
NM_005688chr311103 ------
NM_005692chr71158 ------
NM_005704chr131127 938 79 --11020 --
NM_005715chr642753 977 858 766 ------
NM_005717chr1--21172 1102 ----
NM_005718chr33725 277 145 --1197 --
NM_005721chr22960 260 ------
NM_005722chr21141 1992 ----
NM_005724chr151145 ------
NM_005730chr12113602 3450 2781 2740 2719 2229 1289 1080 629 94 56 ------
NM_005731chr21166 ------
NM_005734chr111554 1805 ----
NM_005737chr222842 722 ------
NM_005738chr72322 181 2341 72 ----
NM_005749chr171692 ------
NM_005751chr7173 ------
NM_005754chr521123 800 ------
NM_005756chrX21314 1164 ------
NM_005759chr214705 --11860 --
NM_005765chrX2142 75 ------
NM_005766chr13----1995 --
NM_005767chr13163 1262 ----
NM_005768chr123604 456 130 ------
NM_005779chr51817 ------
NM_005786chr182842 421 ------
NM_005795chr222237 35 ------
NM_005808chr353440 3220 2628 403 106 11061 ----
NM_005809chr19365 43 28 ------
NM_005819chr122343 396 ----12183
NM_005822chr62855 803 ------
NM_005828chr17104275 3192 1840 1391 1121 1045 1022 976 592 351 1332 ----
NM_005839chr11876 ------
NM_005840chrX47137 2068 1611 381 27089 2470 27389 1033 --
NM_005841chr41953 ------
NM_005842chr131155 ------
NM_005851chr111392 ------
NM_005857chr111451 11179 ----
NM_005859chr511507 ------
NM_005863chr1011024 ------
NM_005877chr222768 451 ------
NM_005880chr162288 79 ------
NM_005882chr41676 1892 ----
NM_005885chr541042 632 520 352 ------
NM_005895chr1264146 4006 3675 2781 2653 1543 --24092 253 --
NM_005897chr111189 ------
NM_005901chr1868622 7719 7367 6916 3425 472 38204 2581 193 ----
NM_005903chr555175 5079 4680 1900 1069 --11449 --
NM_005904chr1851199 469 422 407 83 ------
NM_005906chr621183 364 ------
NM_005909chr544226 3670 3434 1171 ------
NM_005910chr1783843 3748 3711 3019 1563 1028 730 610 ------
NM_005911chr231413 1047 300 ------
NM_005917chr2----1132 --
NM_005920chr153774 2633 613 119 113 ------
NM_005933chr1152471 2223 2003 830 593 ------
NM_005935chr485199 4945 4003 3820 3476 1364 936 553 14342 ----
NM_005938chrX1230 ------
NM_005941chr823833 2691 ------
NM_005964chr1741308 1212 1131 119 ------
NM_005966chr222428 1918 ------
NM_005967chr121469 ------
NM_005977chr131137 1394 ----
NM_005984chr222354 202 ------
NM_005985chr201660 ------
NM_005990chr582602 2588 2495 877 776 149 135 106 ------
NM_006007chr943154 2911 380 289 ------
NM_006010chr31217 ------
NM_006011chr1534002 3981 1059 1831 ----
NM_006016chr641657 656 499 394 ------
NM_006022chr131300 ------
NM_006030chr31453 ------
NM_006036chr22696 126 1719 ----
NM_006037chr284716 3546 3272 3264 3254 1824 674 74 21315 418 ----
NM_006039chr1741073 444 412 259 ------
NM_006042chr172464 394 ------
NM_006054chr1111510 --21584 1246 --
NM_006067chr1621068 128 --1709 --
NM_006080chr722856 1129 --11142 --
NM_006106chr1132937 2578 2428 53233 3140 2704 2255 1157 ----
NM_006133chr1142352 685 466 65 --11518 --
NM_006135chr121297 1248 ------
NM_006136chr72292 35 ------
NM_006145chr192435 341 ------
NM_006153chr31543 --184 --
NM_006154chr1542578 2038 406 231 ------
NM_006156chr141213 ------
NM_006158chr821830 1578 ------
NM_006159chr121219 ------
NM_006162chr1821567 404 --11407 --
NM_006167chr832127 1907 54 ------
NM_006186chr2--11033 ----
NM_006191chr121330 ------
NM_006203chr533467 1302 1004 ------
NM_006206chr422265 289 ------
NM_006216chr21628 ------
NM_006224chr1752504 2291 2222 920 108 11788 ----
NM_006238chr631980 1859 164 ------
NM_006241chr3--22259 197 ----
NM_006243chr11377 ------
NM_006245chr62965 677 ------
NM_006251chr51640 ------
NM_006252chr147342 6170 2967 1204 34769 1567 205 ----
NM_006254chr3--1429 ----
NM_006256chr132263 899 79 ------
NM_006265chr811367 144 ----
NM_006267chr221580 606 ------
NM_006268chr1141157 813 475 127 ------
NM_006275chr2022511 2418 ------
NM_006279chr12236 147 ------
NM_006282chr2031646 800 169 ------
NM_006283chr834724 4158 813 21694 1542 11859 --
NM_006293chr152822 676 ------
NM_006300chr191193 ------
NM_006306chrX75063 4074 3931 2183 1212 898 603 --13938 --
NM_006312chr121756 ------
NM_006320chr421089 721 ------
NM_006325chr122116 80 ------
NM_006328chr112442 432 ------
NM_006335chr11263 ------
NM_006338chr11164 --1110 --
NM_006352chr1--11630 ----
NM_006359chrX11710 12001 ----
NM_006363chr201231 ------
NM_006366chr621143 437 ------
NM_006371chr385065 4807 4770 4234 3686 3298 1544 358 ------
NM_006372chr61357 ------
NM_006375chrX41563 519 505 298 ------
NM_006377chr921253 411 ------
NM_006378chr9243 28 ------
NM_006379chr7183 ------
NM_006380chr1713735 ------
NM_006387chr1931206 805 171 ------
NM_006389chr112933 447 1486 ----
NM_006390chr1251527 1373 653 360 112 ------
NM_006391chr11129 ------
NM_006393chr1054164 3456 3210 1492 216 ------
NM_006403chr621688 1546 --1258 --
NM_006410chr111482 ------
NM_006415chr931221 1041 344 11128 ----
NM_006416chr61621 ------
NM_006420chr2032381 1115 676 ------
NM_006421chr81106 ------
NM_006451chr511012 ------
NM_006454chr4143067 2968 2849 2818 2738 2540 2385 2160 2109 1880 1152 793 106 49 ----12484
NM_006457chr412763 --11291 --
NM_006459chr1041902 1892 1746 1485 ------
NM_006460chr1731360 631 617 --1168 --
NM_006465chr1541974 1882 913 134 12283 ----
NM_006467chr522170 1484 1273 ----
NM_006469chr11560 11032 ----
NM_006480chr52321 85 ------
NM_006482chr1233219 2817 2797 ------
NM_006489chr14--12058 ----
NM_006494chr192626 27 ------
NM_006496chr131684 1565 1268 ------
NM_006497chr17192 --1167 --
NM_006516chr141608 1238 1149 286 ------
NM_006517chrX42194 1487 667 23 ------
NM_006526chr2011559 2803 46 ----
NM_006538chr253756 3499 3331 1364 1066 ----13801
NM_006540chr8--178 ----
NM_006544chr1435673 5278 1821 14979 ----
NM_006546chr1755945 5850 5018 4332 4209 11270 ----
NM_006547chr712089 1819 ----
NM_006554chr22349 142 ------
NM_006557chr91641 1673 11491 --
NM_006560chr11--2480 69 ----
NM_006561chr1056051 5625 4987 1984 790 ------
NM_006570chr9--187 ----
NM_006593chr21786 ------
NM_006595chr1111450 ------
NM_006599chr1687832 6118 5736 5614 5037 2651 1408 1196 15669 ----
NM_006601chr121904 ------
NM_006609chr232381 2065 23 12004 ----
NM_006614chr323285 688 ------
NM_006618chr121091 630 ------
NM_006621chr111849 ------
NM_006624chr101757 ------
NM_006628chr1543716 795 712 502 21236 601 ----
NM_006633chr52717 156 ------
NM_006640chr171631 --21852 1182 --
NM_006650chr573838 3797 3706 2429 1317 1243 277 ------
NM_006654chr1294388 3670 3204 3138 1780 1751 824 599 64 21873 238 ----
NM_006667chrX11180 1993 ----
NM_006690chr2051953 1839 1458 200 185 ------
NM_006695chr172305 231 --1278 --
NM_006699chr132645 2615 232 ------
NM_006700chr121143 ------
NM_006704chr131129 ------
NM_006706chr5----1546 --
NM_006717chr943020 2935 2765 547 ------
NM_006720chr1045140 5027 1216 522 11611 ----
NM_006721chr101590 ------
NM_006726chr42776 443 ------
NM_006734chr62988 244 ------
NM_006738chr1583737 3524 3409 3166 1743 1731 1418 517 22815 1512 24277 947 --
NM_006742chr1671799 1684 1643 752 600 520 143 ------
NM_006749chr831043 520 75 ------
NM_006750chr1677368 7215 4909 3070 3038 857 106 1394 12238 --
NM_006754chr71155 ------
NM_006763chr13254 211 34 --1234 --
NM_006766chr811766 12568 ----
NM_006769chr1170 --129 --
NM_006772chr611400 ------
NM_006775chr652929 2222 1191 1158 618 ------
NM_006777chrX12251 12163 ----
NM_006788chr182460 108 ------
NM_006791chr152418 82 2552 440 ----
NM_006802chr121048 259 ------
NM_006807chr172153 133 ------
NM_006814chr2032547 849 221 12111 ----
NM_006815chr1211120 ------
NM_006816chr51234 1256 ----
NM_006823chr8--1358 11304 --
NM_006827chr1443194 3076 2864 2257 --164 --
NM_006838chr1221910 737 ------
NM_006852chr1742282 1045 352 117 1403 ----
NM_006854chr741925 1484 671 367 ------
NM_006861chr1271944 1820 1761 1747 557 462 93 ------
NM_006870chr202693 672 ------
NM_006875chrX1870 ------
NM_006884chr311299 ------
NM_006885chr1632656 1693 1292 ------
NM_006887chr22486 161 ------
NM_006888chr1443162 2979 2846 1294 ------
NM_006892chr2011363 ------
NM_006892chr2011363 ------
NM_006897chr12----1606 --
NM_006899chr20182 ------
NM_006902chr12593 48 --11074 --
NM_006908chr741098 1064 962 347 ------
NM_006916chr21297 ------
NM_006918chr1185760 4307 3846 3560 2043 1905 1450 1177 1379 13605 --
NM_006920chr21675 21765 138 ----
NM_006922chr232096 1015 647 1132 ----
NM_006924chr1734226 4099 356 1759 1169 --
NM_006925chr14197 ------
NM_006927chr1642009 1642 726 117 ------
NM_006931chr1232010 763 539 11593 ----
NM_006936chr212988 84 ------
NM_006939chr1421160 322 ------
NM_006941chr22155 1446 ----
NM_006943chr2043151 2697 2311 129 13325 ----
NM_006950chrX4815 781 754 748 --1787 --
NM_006951chr101240 ------
NM_006981chr932873 1941 426 ----12442
NM_006982chr121205 ------
NM_006990chr181994 1896 1868 1762 980 371 255 158 ------
NM_006993chr102238 25 ------
NM_006999chr551972 1864 1689 628 393 --1318 --
NM_007005chr941417 1256 1123 1115 11427 ----
NM_007006chr161725 ------
NM_007007chr1222969 619 --11138 --
NM_007008chr21606 ------
NM_007011chr1546660 1393 931 319 1191 16352 --
NM_007017chr51136 ------
NM_007023chr22965 256 ------
NM_007026chr171582 ------
NM_007039chr1412046 ------
NM_007052chrX1104 ------
NM_007064chr3--11065 ----
NM_007067chr1751353 1097 1070 364 342 ------
NM_007073chr632667 1519 39 ------
NM_007096chr91244 ------
NM_007107chr331977 1731 902 134 ----
NM_007124chr611763 11531 ----
NM_007129chr132824 762 ------
NM_007144chr1721248 308 ------
NM_007146chr1722538 1860 ------
NM_007149chr61392 ------
NM_007150chrX1696 ------
NM_007158chr11872 ------
NM_007166chr1121169 1060 ------
NM_007174chr1242011 1739 206 97 --11725 --
NM_007182chr32543 53 ------
NM_007187chr13--1227 ----
NM_007189chr731497 1421 1113 ------
NM_007192chr1441050 748 331 186 ------
NM_007195chr1823617 3125 ------
NM_007198chr811629 1143 ----
NM_007200chr1583737 3524 3409 3166 1743 1731 1418 517 22815 1512 24277 947 --
NM_007203chr953435 3097 2636 243 34 --1728 --
NM_007212chr121565 772 11816 ----
NM_007214chr631128 962 162 ------
NM_007218chr82677 314 ------
NM_007231chrX22296 1908 1188 ----
NM_007235chr12174 122 ----
NM_007236chr1532437 1764 1621 ------
NM_007245chr161325 ------
NM_007249chr1359244 7938 6441 1114 258 18066 18096 --
NM_007260chr11724 ------
NM_007269chr11225 ------
NM_007275chr311114 1756 ----
NM_007308chr42179 78 ------
NM_007313chr921766 1505 ------
NM_007315chr211418 ------
NM_007325chrX2813 171 ------
NM_007345chr1812077 1278 ----
NM_007353chr792580 2132 1966 1199 1123 594 545 512 111 --11139 1651
NM_007357chr13585 505 116 ------
NM_007363chrX--1856 ----
NM_007365chr151891 1752 289 235 143 11739 ----
NM_007372chr172723 68 ------
NM_007375chr131953 1715 904 ------
NM_012064chr1221088 277 ------
NM_012069chrX1194 2732 696 ----
NM_012074chr1421040 146 --1918 --
NM_012081chr522529 1444 ------
NM_012083chr1051299 1118 1100 849 218 1984 ----
NM_012086chr2154 ------
NM_012089chr131480 1149 563 ------
NM_012090chr11925 ------
NM_012093chr12472 169 ------
NM_012097chr2--11931 ----
NM_012098chr91584 11459 ----
NM_012102chr132360 2207 820 ------
NM_012117chr12--1114 ----
NM_012120chr622918 552 1834 ----
NM_012134chr141758 1201 747 571 ------
NM_012137chr152841 2200 291 96 61 ------
NM_012141chr1353579 2732 2539 1231 279 ------
NM_012153chr1132321 2309 322 1790 ----
NM_012156chr2033390 2920 931 ------
NM_012164chr936998 4916 4839 27441 5715 ----
NM_012193chr1144073 2010 1130 597 23635 1336 ----
NM_012199chr162854 2828 1201 778 302 61 ------
NM_012207chr101991 ------
NM_012214chr266372 6350 2453 2415 1412 1127 ----12442
NM_012218chr1922442 559 --42049 981 886 201 --
NM_012223chr2--21019 223 ----
NM_012234chr322733 541 ------
NM_012242chr10--1705 ----
NM_012247chr103358 340 307 199 ----
NM_012249chr222420 608 ------
NM_012250chr11--1272 ----
NM_012262chr155229 4241 3707 3225 910 ------
NM_012281chr71893 ------
NM_012284chr121291 ------
NM_012286chrX1426 ------
NM_012293chr252120 1899 1516 202 37 ----12135
NM_012294chr741520 907 838 309 23781 540 ----
NM_012300chr532346 829 737 22416 2131 ----
NM_012301chr72159 149 ------
NM_012304chr532551 2003 1921 ------
NM_012308chr1182370 2116 2104 1905 846 519 375 342 11015 1621 --
NM_012309chr1194852 4733 3836 3312 1767 1088 679 197 59 23935 1187 14454 --
NM_012319chr181944 ------
NM_012325chr2021322 480 154 11214 --
NM_012326chr21101 --143 --
NM_012328chr741004 907 545 246 ------
NM_012330chr101297 ------
NM_012333chr131558 1475 542 ------
NM_012339chr103495 226 133 ------
NM_012342chr101381 ------
NM_012388chr1552699 1218 958 134 84 ------
NM_012399chr221141 ------
NM_012402chr112897 428 2971 542 ----
NM_012412chr71615 ------
NM_012413chr21134 ------
NM_012414chr1----1565 --
NM_012416chr91213 ------
NM_012421chr11400 ------
NM_012424chr12654 192 1773 ----
NM_012425chr1012144 ------
NM_012429chr222249 38 ----1177
NM_012434chr641289 606 498 66 ------
NM_012446chr51642 ------
NM_012453chr71216 ------
NM_012474chr11212 ------
NM_012475chr1190 ------
NM_012479chr732593 1843 1001 ------
NM_013232chr52384 288 ------
NM_013253chr114562 473 198 66 ------
NM_013256chr191140 1550 ----
NM_013257chr821501 99 ------
NM_013259chr31335 ------
NM_013261chr433188 1319 342 ------
NM_013279chr1142244 2003 709 690 ------
NM_013281chr2021441 1318 ------
NM_013309chr1512272 --1305 --
NM_013341chr212460 ------
NM_013348chr191820 11288 ----
NM_013354chr811008 ------
NM_013365chr224757 715 224 122 ------
NM_013368chr191166 ------
NM_013372chr1562932 2588 2404 455 338 173 12374 ----
NM_013373chr223991 933 242 --2661 635 --
NM_013400chr72260 78 ------
NM_013411chr132394 2050 845 ------
NM_013423chrX41295 1025 504 320 ------
NM_013427chrX41295 1025 504 320 ------
NM_013433chr1931465 748 86 ------
NM_013443chr92216 106 ------
NM_013444chrX21115 970 ------
NM_013449chr1232650 1204 355 --11062 --
NM_013943chr122903 800 ------
NM_013951chr232524 1567 885 ------
NM_013952chr232601 1644 962 ------
NM_013953chr232601 1644 962 ------
NM_013958chr8173 ------
NM_013959chr8173 ------
NM_013961chr8173 ------
NM_013962chr8173 ------
NM_013989chr1445029 3855 3289 1890 25113 3387 ----
NM_013992chr232601 1644 962 ------
NM_013996chr72357 150 ------
NM_013996chr72357 150 ------
NM_013997chr72357 150 ------
NM_013997chr72357 150 ------
NM_013998chr72357 150 ------
NM_013998chr72357 150 ------
NM_014000chr1021803 447 ------
NM_014007chr92922 82 ------
NM_014011chr21695 1172 ----
NM_014016chr311223 ------
NM_014023chr1051980 1032 863 492 115 ------
NM_014028chr642531 2228 2090 1110 13156 ----
NM_014030chr1711190 ------
NM_014038chr7--1345 ----
NM_014043chr31591 ------
NM_014048chr1635306 1704 1078 13765 ----
NM_014059chr131289 ------
NM_014071chr201334 ------
NM_014079chr3----3263 255 247 --
NM_014080chr151425 ------
NM_014089chr1321792 904 11379 ----
NM_014106chr1532165 1826 713 ------
NM_014112chr824804 1528 ------
NM_014117chr1622074 523 ------
NM_014154chr31141 --1166 --
NM_014155chr11117508 6905 6376 6206 6110 2401 2188 1114 319 313 210 15456 ----
NM_014181chr22737 36 ------
NM_014188chr12293 284 ------
NM_014217chr13478 288 254 ------
NM_014225chr191377 ------
NM_014231chr1232082 1936 714 --1608 --
NM_014233chr1732135 1514 491 ------
NM_014234chr61141 ------
NM_014240chr364093 2612 1346 566 200 142 ------
NM_014241chr10124 ------
NM_014243chr42793 569 ------
NM_014253chrX----22404 966 --
NM_014263chr1021272 336 ------
NM_014264chr41475 ------
NM_014268chr1821431 432 ------
NM_014282chr931220 368 114 ------
NM_014283chr12491 368 ------
NM_014284chr14873 421 381 301 ------
NM_014289chrX31421 998 35 ------
NM_014292chr2241874 1260 1209 101 ------
NM_014293chr2233245 1336 121 ------
NM_014294chr831262 984 537 ------
NM_014300chr151109 1339 ----
NM_014309chr2254648 4565 4028 1908 697 1556 --1297
NM_014315chr14--1157 ----
NM_014319chr1221504 1490 ------
NM_014320chr62138 93 ----187
NM_014325chr1241624 810 342 50 ------
NM_014331chr427668 5508 37046 4953 2363 ----
NM_014333chr111297 11110 ----
NM_014335chr152570 88 ------
NM_014342chr111137 ------
NM_014361chr111339 ------
NM_014368chr921718 840 --12117 --
NM_014374chr72260 78 ------
NM_014376chr51246 12300 ----
NM_014383chr191277 ------
NM_014390chr71528 ------
NM_014392chr431355 1318 1209 ------
NM_014405chr1762249 1928 1752 1466 823 600 ------
NM_014415chr321614 1352 ------
NM_014423chr553862 1420 1081 955 665 ------
NM_014426chr201752 ------
NM_014431chr1031397 1163 56 ------
NM_014445chr351905 1650 1600 902 193 1495 ----
NM_014447chr411645 11508 ----
NM_014452chr61165 ------
NM_014454chr61116 ------
NM_014456chr101437 11359 ----
NM_014460chr224501 390 162 143 ------
NM_014472chr103673 592 480 ------
NM_014494chr1611923 1263 ----
NM_014500chrX153 ------
NM_014504chr731800 473 273 ------
NM_014521chr241641 1396 1377 58 --21776 629 --
NM_014548chr1521526 1218 ------
NM_014554chr1211442 ------
NM_014574chr141271 11286 ----
NM_014575chr31179 ------
NM_014577chr221238 ------
NM_014584chr1431498 1303 22 ------
NM_014585chr21118 154 ----
NM_014587chr1671585 1306 1079 1023 536 471 108 ------
NM_014600chr22424 353 --21281 1191 11631
NM_014608chr151115 ------
NM_014614chr21577 ------
NM_014615chr1643493 1321 772 115 23440 3360 ----
NM_014630chr1542739 806 129 47 22437 1545 ----
NM_014634chr2272872 2631 1164 946 673 607 115 12948 12486 --
NM_014636chr973986 2848 1000 935 709 485 322 ------
NM_014646chr1832129 1233 113 11134 11204 --
NM_014647chr1631860 903 586 ------
NM_014659chr1541064 995 279 241 ------
NM_014661chr1053376 3263 2814 2408 681 --23782 498 --
NM_014665chr853552 3243 2456 535 388 ------
NM_014666chr51886 ------
NM_014667chr33802 702 368 --1474 --
NM_014671chr73562 230 41 ------
NM_014674chr353500 3081 2584 1115 893 22679 1018 ----
NM_014677chr82169 103 ------
NM_014679chr1121239 384 ------
NM_014682chr8----11470 --
NM_014685chr161507 ------
NM_014686chr1962479 2174 1805 1676 1007 728 --11992 --
NM_014690chr721898 282 ------
NM_014693chr35770 627 486 235 169 ------
NM_014702chr613144 ------
NM_014705chr731950 1598 846 ------
NM_014709chr22507 87 ------
NM_014711chr1641987 1722 1515 1371 1220 ----
NM_014717chr191660 ------
NM_014720chr1011255 1627 ----
NM_014721chr687047 6524 6279 1990 1863 1444 1438 613 26149 5279 ----
NM_014723chr2032088 2061 675 ------
NM_014726chr172338 146 ------
NM_014729chr831624 1535 892 ------
NM_014730chr1294626 4505 3782 3640 3333 1912 1159 737 638 --1195 --
NM_014730chr1294626 4505 3782 3640 3333 1912 1159 737 638 --1195 --
NM_014731chr20--1381 ----
NM_014733chr521737 670 ------
NM_014735chrX31860 1692 598 11574 ----
NM_014739chr633862 2972 1260 11201 ----
NM_014743chr441198 807 561 267 ------
NM_014746chr264342 4219 3672 1320 695 106 ------
NM_014747chr194570 4497 3780 1387 1240 828 424 281 45 --24267 85 --
NM_014748chr2162 ------
NM_014750chr141218 ------
NM_014751chr832144 2057 1709 ------
NM_014752chr1131851 1818 637 ------
NM_014754chr82899 804 137 ----
NM_014755chr274145 3458 2929 2871 2859 820 164 ------
NM_014757chr521537 342 ------
NM_014764chr123954 121 23 ------
NM_014765chr132685 2308 2008 ------
NM_014766chr763792 3549 3276 2987 533 521 1648 ----
NM_014767chr1073614 3404 2929 2365 1156 777 402 ------
NM_014770chr122882 332 ------
NM_014772chr1833352 2346 1076 ------
NM_014779chr3155 ------
NM_014781chr81905 ------
NM_014782chrX1251 ------
NM_014786chr113892 216 115 ------
NM_014787chr111745 ------
NM_014790chr5122 ------
NM_014795chr2----195 --
NM_014798chr1741761 1532 579 94 ------
NM_014810chr12978 95 ------
NM_014811chr91166 ------
NM_014819chr5--1661 ----
NM_014820chr321959 1272 11589 ----
NM_014824chr1121975 647 --1177 --
NM_014828chr1432204 1637 94 ------
NM_014835chr2041819 1706 1543 190 --1824 --
NM_014838chr2222131 145 --1155 --
NM_014839chr122334 325 ------
NM_014840chr1232851 2140 1253 ------
NM_014841chr61280 ------
NM_014847chr11527 ------
NM_014850chr374874 4839 3909 3455 1541 204 130 --2399 79 --
NM_014853chr1711429 ------
NM_014859chr171251 ------
NM_014871chr121113 ------
NM_014873chr134566 4177 2996 --1661 --
NM_014876chr22155 12075 11417 --
NM_014877chr1747101 1966 1641 930 25723 809 22685 1684 --
NM_014884chr19165 ------
NM_014893chrY42278 2065 714 104 ------
NM_014902chr2011516 ------
NM_014903chr121437 ------
NM_014904chr101999 23211 2570 ----
NM_014906chr1763366 3276 1189 720 231 93 1398 ----
NM_014909chr1443789 3504 2725 357 1301 ----
NM_014912chr1033249 2751 1330 13432 ----
NM_014913chr18--11505 ----
NM_014917chr12889 35 ------
NM_014918chr1511439 ------
NM_014923chr1331846 1494 728 1143 ----
NM_014926chr34363 302 234 27 ------
NM_014931chr191700 --1530 --
NM_014939chr1831294 1220 1058 ------
NM_014942chr632031 442 139 1431 ----
NM_014944chr12282 142 ------
NM_014946chr21515 ------
NM_014947chr132796 889 783 ------
NM_014949chr11260 ------
NM_014953chr1354205 2652 986 852 672 ------
NM_014956chr112864 57 ------
NM_014961chr421742 478 11450 ----
NM_014962chr2022765 271 ------
NM_014964chr1752325 2317 2055 1651 755 ----11894
NM_014969chr12201 176 ------
NM_014975chr19176 ------
NM_014982chr1445302 5284 3599 1829 23710 862 1925 --
NM_014988chr412181 ------
NM_014989chr612032 ------
NM_014990chr141529 ------
NM_014991chr42990 624 ------
NM_014994chr1522371 2029 --12021 --
NM_014997chr732350 722 561 22138 525 1187 --
NM_015000chr1222314 1064 22288 109 ----
NM_015001chr11750 ------
NM_015011chr1321141 1042 ------
NM_015017chr1146 ------
NM_015023chr111267 11160 ----
NM_015025chr252212 2113 1762 1699 912 ------
NM_015026chr1234019 3632 1053 14613 ----
NM_015027chr1651735 1698 139 111 78 2573 284 ----
NM_015032chr1331810 1031 300 ------
NM_015035chr20136512 5990 5943 5629 5503 5107 2199 2180 1665 1330 841 537 440 12624 ----
NM_015042chr1543835 1314 875 497 ------
NM_015045chr101760 ------
NM_015051chr952675 2092 1228 1016 360 12060 ----
NM_015052chr711181 ------
NM_015057chr131640 ------
NM_015059chr1543525 2644 1452 905 --2242 133 --
NM_015061chr93602 113 78 ------
NM_015064chr1253631 2939 2898 1364 816 ------
NM_015069chr161232 ------
NM_015074chr184285 3994 3721 3356 3309 3222 3215 925 ------
NM_015075chrX21567 1484 ------
NM_015076chr644356 3723 1769 649 11271 ----
NM_015080chr114953 697 256 162 ------
NM_015082chr52869 260 12124 ----
NM_015092chr1653114 3036 1751 1304 291 ------
NM_015093chr6--11468 1535 --
NM_015094chr2263035 1289 1088 858 422 416 11073 1396 --
NM_015103chr31281 --181 --
NM_015107chrX1390 ------
NM_015110chr922475 1579 ------
NM_015115chr453083 2979 2863 2823 2528 12367 ----
NM_015125chr191566 ------
NM_015129chrX21789 1580 ------
NM_015132chr751764 681 198 110 90 11445 ----
NM_015137chr821836 765 ----12588
NM_015143chr421285 929 ------
NM_015144chr1622627 114 ------
NM_015149chr141941 1790 1782 476 ------
NM_015153chr6191 ------
NM_015155chr1043108 2943 526 105 1222 13142 --
NM_015156chr1473700 2901 1072 902 853 832 232 ------
NM_015157chr112789 728 ------
NM_015158chr94825 781 320 93 ------
NM_015170chr812237 22040 1548 ----
NM_015172chr11221 --11141 --
NM_015173chr421233 102 11558 ----
NM_015185chrX22839 672 ------
NM_015191chr1121043 505 ----11881
NM_015192chr2043008 2568 2468 309 ------
NM_015199chr321949 48 ------
NM_015200chr412182 12379 ----
NM_015206chr1553757 3237 3209 910 573 ------
NM_015209chr12894 462 --21766 38 --
NM_015215chr122091 2029 ------
NM_015216chr521084 438 ------
NM_015219chr1772048 1816 1631 878 669 300 42 ------
NM_015225chr923072 209 ------
NM_015233chr1322350 943 1464 ----
NM_015236chr4--11152 ----
NM_015246chr1651423 1364 630 486 466 ------
NM_015247chr1621476 364 13403 ----
NM_015250chr921267 531 ------
NM_015260chr1961057 301 252 187 67 49 --1349 --
NM_015265chr222476 1711 ------
NM_015271chr411379 --1855 --
NM_015277chr1821351 266 --11499 --
NM_015282chr222578 48 ------
NM_015284chr141915 1650 1470 830 ------
NM_015288chr543745 3506 3059 718 ------
NM_015289chr1561818 1794 1492 1374 503 133 ------
NM_015292chr122303 109 1712 ----
NM_015294chr171452 --11090 --
NM_015296chr131350 ------
NM_015299chr1451325 801 687 665 117 12749 ----
NM_015305chr1431693 746 220 ------
NM_015310chr856738 6474 5629 2992 2283 23119 1647 15656 --
NM_015314chr731717 1575 327 12503 ----
NM_015315chr572834 2741 2125 1154 1107 1058 1006 ------
NM_015317chr222703 1791 ------
NM_015318chr1941951 1690 1569 1438 ------
NM_015326chr1--1974 ----
NM_015328chr742314 657 164 115 1584 12597 --
NM_015329chr1932846 1893 342 12378 189 --
NM_015335chr1222023 540 ------
NM_015336chr1242575 1839 53 40 --163 --
NM_015344chr832046 1876 671 ------
NM_015347chr1222851 1107 ------
NM_015349chr621929 669 1275 ----
NM_015353chr1792333 2321 2125 1893 1097 1004 940 416 389 ------
NM_015355chr1721862 1334 ------
NM_015361chr21813 ------
NM_015365chrX53664 2681 1517 1509 871 ------
NM_015367chr2211627 --31454 1421 1388 --
NM_015374chr2231293 334 218 1449 ----
NM_015393chr422986 660 154 ----
NM_015396chr311077 ------
NM_015436chr423161 211 ------
NM_015443chr1731272 1044 492 11509 ----
NM_015444chr3386 80 51 ------
NM_015446chr121167 277 ------
NM_015455chr544098 2561 1238 941 13440 ----
NM_015460chr321875 57 ------
NM_015464chr71951 ------
NM_015469chr92211 153 163 ----
NM_015472chr31118 ------
NM_015472chr31118 ------
NM_015475chr211077 ------
NM_015483chr721080 39 --1392 --
NM_015488chr221593 1468 11760 ----
NM_015493chr1941984 1927 1538 1483 --12128 --
NM_015497chr151871 ------
NM_015508chr311074 ------
NM_015516chr112293 81 ------
NM_015520chr32880 731 ------
NM_015525chr61991 ------
NM_015530chr2----154 --
NM_015532chr1542492 2483 2179 172 ------
NM_015541chr321439 374 11418 ----
NM_015542chr101414 ------
NM_015550chr732832 1127 45 1114 ----
NM_015553chr684909 4841 3591 3333 1970 1363 1173 535 11087 ----
NM_015554chr15--12911 11893 --
NM_015559chr18--11057 ----
NM_015560chr352716 2490 2047 2040 472 ------
NM_015564chr512767 13204 ----
NM_015565chr2132164 2078 599 ------
NM_015569chr144219 3106 1823 933 ------
NM_015570chr711850 ------
NM_015571chr612193 12447 ----
NM_015575chr253423 2557 1340 1002 223 ------
NM_015576chr372739 2570 2486 2120 1143 1064 763 ----12890
NM_015601chr101824 ------
NM_015602chr111264 1123 ----
NM_015608chr10271 38 ------
NM_015609chr142844 2326 2134 2059 ------
NM_015610chr762881 2812 2151 1902 1002 306 ------
NM_015627chr181834 1812 1800 1567 1459 1205 1174 740 ------
NM_015630chr2--1404 ----
NM_015640chr163827 3484 3322 1743 942 830 ------
NM_015642chr31256 ------
NM_015651chr9102259 2070 1690 1436 859 515 337 227 220 120 ------
NM_015652chr102678 275 ------
NM_015686chrX42303 1958 1814 601 ------
NM_015687chr6173 ------
NM_015695chr661966 1720 778 649 564 197 ------
NM_015696chr1176 1383 ----
NM_015716chr171212 ------
NM_015726chr111551 ------
NM_015836chr13512 330 35 ------
NM_015850chr852260 1638 1603 449 412 --1456 --
NM_015866chr111016 ------
NM_015878chr81469 11577 ----
NM_015879chr18108576 6299 5526 3212 3184 3140 3131 3125 2115 900 ------
NM_015881chr114562 473 198 66 ------
NM_015885chr111193 ------
NM_015898chr1922115 1564 ------
NM_015904chr21217 ------
NM_015905chr71406 ------
NM_015906chr122936 368 ------
NM_015912chr822304 150 ------
NM_015915chr14185 ------
NM_015963chr2144 ------
NM_015976chr12270 78 ------
NM_015980chr511670 ------
NM_015981chr553017 2928 2384 1252 33 ------
NM_015982chr171389 ------
NM_015987chr124359 78 46 37 ------
NM_015990chr42942 121 ------
NM_015995chr1554963 4949 2176 820 456 15029 11727 14800
NM_015999chr1143 ------
NM_016003chr762881 2812 2151 1902 1002 306 ------
NM_016009chr154940 4881 4539 4461 1595 ------
NM_016018chr831932 1780 712 ------
NM_016032chrX1397 11427 ----
NM_016037chr11361 ------
NM_016048chr51233 ------
NM_016061chr22508 460 ------
NM_016072chr121326 11682 ----
NM_016075chr1312949 12115 --12752
NM_016076chr122846 1109 11988 ----
NM_016078chr1721080 21 ------
NM_016081chr421407 534 ------
NM_016083chr632453 1044 543 22520 1339 ----
NM_016096chr822001 1650 ------
NM_016100chr201322 ------
NM_016107chr52353 292 ------
NM_016129chr41313 ------
NM_016131chr23943 512 404 ------
NM_016132chr1512906 1914 ----
NM_016133chr231322 479 335 ------
NM_016141chr3196 ------
NM_016152chr31380 ------
NM_016156chr1132275 804 658 ------
NM_016185chr171764 ------
NM_016201chr331701 698 55 ------
NM_016203chr72357 172 ------
NM_016205chr421198 561 ----11400
NM_016206chr359003 7968 7533 3323 576 ------
NM_016217chr63727 438 131 13282 ----
NM_016227chr12491 368 ------
NM_016231chr171194 ------
NM_016240chr81165 ------
NM_016248chr1321225 813 ------
NM_016252chr21191 ------
NM_016255chr621280 914 ------
NM_016258chr12719 531 ------
NM_016260chr227429 6894 ------
NM_016271chr1822030 1678 ------
NM_016272chr2222041 466 ------
NM_016281chr123195 151 139 ------
NM_016284chr16128 ------
NM_016287chr12185 173 ------
NM_016297chr262849 2684 2563 989 639 592 ------
NM_016308chr121761 285 ------
NM_016319chr12183 ------
NM_016322chr942850 2760 2464 2168 12611 --1590
NM_016370chrX127 ------
NM_016374chr121356 230 11416 ----
NM_016374chr121356 230 11416 ----
NM_016376chr1734330 2748 101 12704 ----
NM_016377chr621493 83 11294 ----
NM_016396chr1532747 2607 2211 ------
NM_016410chr91472 ------
NM_016413chr131441 ------
NM_016418chr2253501 2695 1175 1054 371 13584 --12530
NM_016422chr1132769 1098 870 ------
NM_016423chr143470 448 430 ------
NM_016424chr172247 233 ------
NM_016436chr2022012 294 ------
NM_016470chr201118 1476 ----
NM_016480chr51719 ------
NM_016485chr62764 649 22023 1903 ----
NM_016506chr113663 243 119 ------
NM_016507chr1712995 ------
NM_016530chr1533733 3709 1397 ------
NM_016532chr1731077 832 368 ------
NM_016542chrX196 11447 ----
NM_016545chr11744 ----1927
NM_016547chr11655 ------
NM_016592chr203512 481 431 --2390 320 --
NM_016598chr331479 1002 317 ------
NM_016603chr512216 ------
NM_016605chr532544 1966 356 ------
NM_016612chr81492 ----1503
NM_016615chr12384 31 24 ------
NM_016620chr111177 ------
NM_016621chr1174524 3594 1733 1555 1477 303 144 21844 1672 13708 --
NM_016623chr81170 ------
NM_016651chr142403 171 ------
NM_016654chr1521103 868 ------
NM_016823chr1711033 --1244 --
NM_016834chr1783843 3748 3711 3019 1563 1028 730 610 ------
NM_016835chr1783843 3748 3711 3019 1563 1028 730 610 ------
NM_016836chr24581 535 492 84 ------
NM_016839chr24581 535 492 84 ------
NM_016841chr1783843 3748 3711 3019 1563 1028 730 610 ------
NM_016929chr633967 3403 513 23603 856 ----
NM_016930chr41818 --2812 58 --
NM_016936chr163751 211 156 ------
NM_016946chr163253 2239 1296 987 597 163 ----12382
NM_016950chr431301 978 326 ------
NM_016952chr1142579 2541 820 161 ------
NM_016954chrX1146 ------
NM_017409chr123228 164 63 ------
NM_017415chr583324 1774 1545 1340 1223 1087 673 631 ------
NM_017420chr1443607 3281 3109 985 13721 ----
NM_017423chr43544 432 269 11411 ----
NM_017433chr102560 171 ------
NM_017449chr121061 59 ------
NM_017450chr1741471 1012 593 305 ------
NM_017456chr1741703 1627 787 623 ------
NM_017459chr12151 72 ------
NM_017481chr11139 ------
NM_017491chr42690 159 ------
NM_017514chrX5830 655 255 171 42 --1815 --
NM_017520chr133623 537 166 ------
NM_017540chr542077 2015 989 400 ------
NM_017541chr31216 ------
NM_017544chrX3837 717 209 ------
NM_017545chr201541 ------
NM_017546chr22874 207 ------
NM_017548chr32790 539 ------
NM_017549chr731527 1161 149 ------
NM_017551chr1032667 1970 654 ------
NM_017553chr152197 174 ------
NM_017580chr102667 552 ------
NM_017596chr1134019 3870 3495 3412 3219 3126 3120 2898 1688 1582 1559 1516 1486 ------
NM_017628chr465112 4878 4826 4646 1591 82 1696 1797 --
NM_017629chr111496 ------
NM_017632chr4----1465 --
NM_017633chr62824 530 ------
NM_017634chr811397 21769 1632 ----
NM_017635chr11--11526 ----
NM_017637chr978920 6084 3310 3301 3127 902 190 ------
NM_017641chr121979 2268 182 ----
NM_017644chr384709 4484 3809 3589 1083 324 129 92 ------
NM_017649chr1061244 1219 1063 503 375 137 ------
NM_017650chr755879 4117 2208 2033 1916 25531 4535 ----
NM_017657chr21641 ------
NM_017662chr9130 ------
NM_017666chrX22234 760 ------
NM_017670chr113742 707 172 ------
NM_017686chr11983 ------
NM_017697chr81165 1376 ----
NM_017709chr123421 1189 24188 3842 ----
NM_017714chr201328 ------
NM_017715chr71181 ------
NM_017719chr342073 534 488 422 ------
NM_017728chr1722875 914 --11139 --
NM_017730chr31632 ------
NM_017737chr12414 315 21876 892 1435 --
NM_017738chr921246 837 ------
NM_017748chr172323 255 ------
NM_017754chr674662 3852 3261 3090 1965 149 25 ------
NM_017762chr1552221 2149 915 651 377 12414 ----
NM_017776chrX31142 1048 421 ------
NM_017778chr811287 --11018 --
NM_017786chr83248 49 25 ------
NM_017787chr1052368 2015 996 504 348 ------
NM_017798chr2031180 1063 65 1889 ----
NM_017799chr1441690 1576 1373 1357 ------
NM_017802chr7190 1686 ----
NM_017813chr845625 4956 3882 193 ------
NM_017831chr1874576 4357 4257 4127 3036 1614 1206 ------
NM_017848chrX54409 3741 3162 1874 884 ------
NM_017851chr152998 41 ------
NM_017873chr952682 2226 765 717 629 ------
NM_017896chr2043475 3152 2602 2411 ------
NM_017902chr10145743 5237 5212 5191 5147 4699 4348 4091 2212 1540 1338 869 432 213 12206 ----
NM_017905chr132275 266 ------
NM_017916chr19121 ------
NM_017919chr935822 3588 727 ------
NM_017925chr9--11205 ----
NM_017933chr211482 ------
NM_017955chr1421097 854 --1262 --
NM_017964chr21389 ------
NM_017994chr733005 656 139 --2279 202 --
NM_018003chr1521687 509 ------
NM_018014chr2139 1388 ----
NM_018036chr1453801 3667 3050 3014 1561 24242 2875 ----
NM_018046chr51736 --11834 --
NM_018047chr53841 832 693 ------
NM_018061chr12405 149 ------
NM_018062chr21414 ------
NM_018070chr11517 ------
NM_018077chr7--1263 180 --
NM_018084chr232521 2082 807 13068 ----
NM_018085chr177903 7227 5642 2106 1027 933 464 1843 ----
NM_018086chr231198 366 354 11554 ----
NM_018092chr161551 ------
NM_018095chr113663 243 119 ------
NM_018098chr311145 ------
NM_018110chr161376 ------
NM_018120chr82503 429 ------
NM_018121chr1052631 2374 1238 924 120 ------
NM_018133chr311776 ------
NM_018150chr11871 ------
NM_018157chr1222531 2301 22345 1218 ----
NM_018171chr121214 ------
NM_018178chr121534 288 ------
NM_018179chr121632 ------
NM_018181chr1831490 522 502 --1579 --
NM_018184chr3--21839 1744 ----
NM_018189chr32332 164 ------
NM_018195chr1151723 1676 1393 473 115 ------
NM_018199chr1431205 884 371 ------
NM_018200chr1522602 2259 ------
NM_018201chr962365 739 684 376 153 51 --1912 --
NM_018202chr12693 21 ------
NM_018206chr16184 ------
NM_018214chr64899 156 82 32 21274 882 ----
NM_018221chr2--1130 ----
NM_018234chr252171 2152 1639 842 599 ------
NM_018241chr42709 71 ------
NM_018244chr204915 876 162 63 ------
NM_018247chr612510 33044 848 306 ----
NM_018254chr112134 ------
NM_018263chr222369 769 ------
NM_018290chr42350 293 ------
NM_018293chr332947 2854 663 ------
NM_018299chr8--13239 ----
NM_018302chr451806 1763 835 474 249 ------
NM_018303chr621366 592 1470 ----
NM_018312chr1122090 1933 ----11436
NM_018313chr32564 511 11997 ----
NM_018315chr4--11554 ----
NM_018320chr113835 474 108 ------
NM_018323chr411537 ------
NM_018330chr101567 ------
NM_018339chr9--11767 ----
NM_018361chr854076 3983 933 791 781 ------
NM_018362chr1133315 1590 1567 ------
NM_018364chr144022 2653 1091 409 12733 ----
NM_018371chr82539 222 ------
NM_018375chr141456 --1653 --
NM_018388chrX--2967 583 ----
NM_018394chr321579 1379 ------
NM_018403chr353634 2578 2521 1584 1226 13330 ----
NM_018412chr7156 ------
NM_018424chr931171 100 63 ------
NM_018433chr21374 ------
NM_018440chr8108210 7641 7378 6582 6293 5937 1868 1527 201 41 26516 3186 ----
NM_018448chr12--190 ----
NM_018452chr6_random31515 539 174 1386 ----
NM_018469chr1731360 462 93 ------
NM_018482chr812377 12054 ----
NM_018489chr11793 ------
NM_018555chr193401 302 138 1590 ----
NM_018557chr221150 464 ------
NM_018566chr164087 3892 3709 779 725 501 2638 192 ----
NM_018569chr411436 21258 78 ----
NM_018571chr21470 ------
NM_018584chr121256 1013 ------
NM_018602chr1561460 614 588 549 297 140 ------
NM_018638chr12--25066 4284 ----
NM_018649chr102588 440 ------
NM_018653chr171113 1377 ----
NM_018667chr1641043 1030 424 87 --12307 --
NM_018685chr71114 1906 ----
NM_018686chr121268 ------
NM_018689chr1541746 563 276 260 1191 ----
NM_018691chr5------1789
NM_018697chr751907 1868 674 543 63 22292 403 ----
NM_018700chr531191 451 160 ------
NM_018704chr121969 390 ------
NM_018710chr81874 138 ----
NM_018715chr152240 2127 1518 899 627 --1494 --
NM_018718chr762230 2127 756 697 592 390 ------
NM_018836chr13410 391 51 ------
NM_018841chr153927 3620 3057 1034 417 ------
NM_018847chr911211 ------
NM_018890chr741098 1064 962 347 ------
NM_018898chr542284 1700 1467 142 --12199 --
NM_018899chr542284 1700 1467 142 --12199 --
NM_018900chr542284 1700 1467 142 --12199 --
NM_018901chr542284 1700 1467 142 --12199 --
NM_018902chr542284 1700 1467 142 --12199 --
NM_018903chr542284 1700 1467 142 --12199 --
NM_018904chr542284 1700 1467 142 --12199 --
NM_018905chr542284 1700 1467 142 --12199 --
NM_018906chr542284 1700 1467 142 --12199 --
NM_018907chr542284 1700 1467 142 --12199 --
NM_018908chr542284 1700 1467 142 --12199 --
NM_018909chr542284 1700 1467 142 --12199 --
NM_018910chr542284 1700 1467 142 --12199 --
NM_018911chr542284 1700 1467 142 --12199 --
NM_018912chr531725 1531 1371 ------
NM_018913chr531725 1531 1371 ------
NM_018914chr531725 1531 1371 ------
NM_018915chr531725 1531 1371 ------
NM_018916chr531725 1531 1371 ------
NM_018917chr531725 1531 1371 ------
NM_018918chr531725 1531 1371 ------
NM_018919chr531725 1531 1371 ------
NM_018920chr531725 1531 1371 ------
NM_018921chr531725 1531 1371 ------
NM_018922chr531725 1531 1371 ------
NM_018923chr531725 1531 1371 ------
NM_018924chr531725 1531 1371 ------
NM_018925chr531725 1531 1371 ------
NM_018926chr531725 1531 1371 ------
NM_018927chr531725 1531 1371 ------
NM_018928chr531725 1531 1371 ------
NM_018929chr531725 1531 1371 ------
NM_018953chr121773 ------
NM_018970chr732765 2612 503 ------
NM_018977chrX21068 937 ------
NM_018979chr1252594 1833 1600 908 570 ------
NM_018999chr1034019 3536 1049 ------
NM_019000chr521544 1497 ------
NM_019004chr71608 ------
NM_019009chr1182396 2289 1827 913 763 220 131 106 ------
NM_019016chr17127 ------
NM_019024chr22433 120 ------
NM_019027chr41733 21872 476 1234 --
NM_019036chr61917 ------
NM_019045chrX1311 ------
NM_019049chr11194 1268 ----
NM_019050chr42615 311 12137 ----
NM_019057chr52366 84 ------
NM_019063chr211439 ------
NM_019071chr71631 ------
NM_019073chr1135 ------
NM_019074chr153392 193 105 ------
NM_019083chr111244 ------
NM_019091chr231005 819 402 ------
NM_019106chr2233169 2679 2183 1601 1798 --
NM_019116chr1663446 3268 3183 896 885 656 --12395 --
NM_019555chr33727 355 229 ------
NM_019558chr21143 ------
NM_019590chr1011346 1205 ----
NM_019593chr2063101 2374 2172 2098 914 476 11275 ----
NM_019594chr921545 221 --11115 --
NM_019597chrX1676 1525 ----
NM_019605chr12680 293 ------
NM_019610chr121373 712 ------
NM_019845chr2163 ------
NM_019859chr101290 11085 ----
NM_019860chr101338 11133 ----
NM_019885chr252633 2017 996 391 300 --12375 --
NM_019891chr111018 ------
NM_019895chr32956 764 ------
NM_020039chr1211735 1769 ----
NM_020064chr92581 552 ------
NM_020116chr421730 467 ------
NM_020122chr235833 743 549 24228 4209 ----
NM_020127chr151870 1691 1378 323 135 ------
NM_020130chr811044 ------
NM_020134chr22750 167 ------
NM_020144chr711957 ------
NM_020148chr1852539 2418 2338 1081 672 ------
NM_020151chr231451 508 32 ------
NM_020155chr112119 97 ------
NM_020159chr41392 ------
NM_020166chr3264 35 ------
NM_020168chr1531362 1206 184 1842 ----
NM_020177chr531266 519 320 ------
NM_020178chr171150 ------
NM_020184chr222276 2115 11577 ----
NM_020205chr132344 2330 571 ------
NM_020226chr41675 ------
NM_020231chr31674 1177 ----
NM_020234chr15162 ------
NM_020235chr32112 30 ------
NM_020239chr131567 588 137 1509 ----
NM_020245chr634228 4028 3583 11948 ----
NM_020248chr132174 1845 357 ------
NM_020310chr1752572 2152 1000 700 237 ------
NM_020315chr224968 933 889 297 ------
NM_020336chr2043742 3736 3462 1255 ------
NM_020337chr42340 215 42565 2534 193 153 ----
NM_020338chr1073048 2991 1484 1165 835 340 84 12477 ----
NM_020340chr62861 287 ------
NM_020341chr2031250 666 168 ------
NM_020342chr211597 1155 ----
NM_020346chr1111646 ------
NM_020382chr1221339 273 ------
NM_020384chrX199 ------
NM_020401chr121182 ------
NM_020403chr1321190 370 ------
NM_020420chrY11607 ------
NM_020428chr1921087 360 11161 ----
NM_020431chr1432705 1735 960 12619 12744 --
NM_020438chr921213 983 ------
NM_020443chr155225 5194 2517 1305 217 ------
NM_020452chr181913 1555 1508 1343 567 388 305 25 ------
NM_020456chr13--12319 ----
NM_020457chr161489 ------
NM_020458chr23561 227 194 ------
NM_020465chr1621462 805 ------
NM_020474chr182371 99 11571 ----
NM_020532chr21606 ------
NM_020546chr56673 523 199 170 160 97 12810 23085 1943 --
NM_020638chr121315 ------
NM_020640chr312030 1630 ----
NM_020647chr821632 203 1766 ----
NM_020673chr2077313 5690 5671 2212 2147 1609 653 14852 ----
NM_020689chr2031615 1449 661 ------
NM_020697chr84356 324 184 52 1914 ----
NM_020699chr164808 3812 3634 2155 1942 86 199 ----
NM_020708chr2052410 1000 687 109 103 ------
NM_020711chr232655 2627 493 ------
NM_020713chr2062807 2719 2158 1240 272 220 --12895 --
NM_020715chr1432236 163 39 ------
NM_020718chr1696292 6157 5657 4975 1473 1247 1001 112 83 22410 154 ----
NM_020728chr782553 2305 2239 2229 751 300 294 252 --12179 --
NM_020739chr152680 74 1652 ----
NM_020742chrX2729 426 ------
NM_020752chr1032813 2055 537 12367 ----
NM_020762chr12--199 ----
NM_020766chrX23763 1265 ------
NM_020768chr521214 499 ------
NM_020769chrX1803 ------
NM_020772chr1776763 6446 5234 3237 1944 849 782 ------
NM_020774chr1844761 4640 3926 2396 24472 1386 ----
NM_020776chr1832583 851 90 ------
NM_020783chr1842385 2372 1609 287 ------
NM_020792chr322827 1822 ------
NM_020801chr521796 270 ------
NM_020807chr162574 171 ------
NM_020808chr12884 83 ------
NM_020809chr1131867 696 554 ------
NM_020813chr1942498 2066 363 194 32354 2324 451 ----
NM_020819chr62288 150 ------
NM_020826chr1142726 1122 827 67 1241 ----
NM_020839chr321606 1220 ------
NM_020841chr1243548 3058 3019 2788 1249 ----
NM_020845chr1222410 1711 ------
NM_020850chr1652404 2356 2280 2218 1218 ------
NM_020854chr1821198 497 ------
NM_020856chr1911511 ------
NM_020858chr1522306 2129 ------
NM_020870chr41219 ------
NM_020871chrX22075 586 ------
NM_020872chr32709 57 ------
NM_020873chr31349 ------
NM_020888chr12665 519 ------
NM_020896chr1141046 1010 874 288 ------
NM_020898chr123679 552 140 ------
NM_020899chr1722422 2357 ------
NM_020914chr1751675 554 343 146 90 ------
NM_020918chr1052339 1235 1043 534 140 ------
NM_020927chr1641596 598 107 74 12353 ----
NM_020946chr931494 1317 583 ------
NM_020948chr1--11077 ----
NM_020958chr141377 ------
NM_020962chr1562219 941 875 604 416 87 ------
NM_020964chr1874313 4003 3891 3866 3841 3771 3112 --11056 --
NM_020977chr41405 ------
NM_020987chr10--11042 ----
NM_020993chr1262357 2215 1057 429 422 257 --21146 1097 --
NM_021005chr15--1401 ----
NM_021007chr22707 683 2655 139 ----
NM_021012chr1783086 2946 2915 2705 2555 2215 2041 801 --11025 --
NM_021020chr813134 --12287 --
NM_021033chr1323103 2896 ------
NM_021038chr333239 588 49 ------
NM_021064chr621120 429 ------
NM_021069chr431355 491 328 ------
NM_021072chr52522 439 ------
NM_021076chr22--1576 ----
NM_021077chr15144 ------
NM_021079chr1721095 1064 13026 1202 --
NM_021083chrX33543 3386 2765 ------
NM_021088chr221808 826 ------
NM_021090chr2264628 3123 3046 1537 1365 1337 ----13139
NM_021096chr2231300 605 596 12696 ----
NM_021097chr232118 1050 935 11938 --1719
NM_021101chr352270 2235 1617 567 507 ------
NM_021120chrX73063 3053 2772 2290 1979 943 233 ------
NM_021132chr101122 ------
NM_021140chrX--21048 114 ----
NM_021148chr722102 980 ------
NM_021155chr1922352 1070 ------
NM_021156chr2011040 ------
NM_021158chr20199 2847 191 ----
NM_021159chr41435 ------
NM_021165chr11267 ------
NM_021183chrX1465 ------
NM_021190chr111051 --1305 --
NM_021191chr1232119 1935 300 ------
NM_021198chr281460 1179 1094 1069 1004 401 212 205 ------
NM_021202chr2032975 2621 781 --12325 --
NM_021205chr132833 2818 2033 ------
NM_021227chr41444 ------
NM_021238chr12--21597 407 ----
NM_021240chr91121 ------
NM_021253chr631397 87 66 ------
NM_021255chr1423466 3023 1437 ----
NM_021574chr2232439 2038 1766 ------
NM_021622chr1032323 895 651 1941 ----
NM_021627chr31207 11208 ----
NM_021629chr375116 3869 3764 1952 1278 1055 599 ------
NM_021637chrX21268 1244 ------
NM_021638chr485020 3921 3648 1092 859 532 510 144 13438 ----
NM_021643chr231869 1555 558 ------
NM_021644chr101991 ------
NM_021648chr632733 566 177 ------
NM_021729chr111300 ------
NM_021785chrX1305 ------
NM_021814chr6163 11659 ----
NM_021825chr111166 ------
NM_021911chr545042 2170 1562 1378 1847 ----
NM_021912chr1523823 404 1640 ----
NM_021913chr1931821 1686 559 11240 ----
NM_021931chr2011060 ------
NM_021935chr33379 85 69 ------
NM_021940chr611405 1523 ----
NM_021943chr631703 487 203 ------
NM_021947chr173452 268 35 ------
NM_021948chr13352 303 243 ------
NM_021951chr93370 310 206 ------
NM_021956chr6--1125 ----
NM_021959chr62251 30 ------
NM_021960chr112712 11991 ----
NM_021961chr1197258 6870 6713 6127 5870 5005 4659 2407 1313 ------
NM_021962chr1762309 2290 1880 252 239 159 ------
NM_021964chr346500 5264 4537 1394 ------
NM_021965chr941342 1180 330 85 ------
NM_021976chr6123 ------
NM_021980chr10167 ------
NM_021984chrX31479 1111 408 ------
NM_021987chrX31479 1111 408 ------
NM_021990chrX31479 1111 408 ------
NM_021999chr131190 ------
NM_022036chr171113 1377 ----
NM_022041chr1611838 21718 501 ----
NM_022048chr1555807 5515 806 538 508 --25358 1605 --
NM_022060chr1441347 909 855 102 ------
NM_022066chr172737 386 ------
NM_022079chr101824 ------
NM_022114chr174804 4173 3807 1590 1158 815 614 --14422 --
NM_022123chr141425 ------
NM_022143chr71522 ------
NM_022157chr1266 29 ------
NM_022166chr1666184 5427 4641 2428 1852 1720 14862 ----
NM_022167chr171802 ------
NM_022170chr731437 425 202 11392 ----
NM_022337chr113617 56 21 ------
NM_022346chr431212 1072 964 ------
NM_022374chr21462 ------
NM_022463chr1741202 1110 132 90 ------
NM_022465chr1242865 2324 2177 567 1934 ----
NM_022469chr132496 940 221 ------
NM_022470chr311155 --1199 --
NM_022474chr1422042 444 ------
NM_022476chr161201 ------
NM_022483chr521795 1209 ------
NM_022495chr141227 ------
NM_022552chr21869 ------
NM_022572chr221593 1468 11760 ----
NM_022648chr274280 3069 3043 980 780 587 557 ----14516
NM_022652chr12134 ------
NM_022658chr1221141 334 ------
NM_022716chr11437 --1918 --
NM_022719chr2252461 1023 848 473 177 ------
NM_022737chr1951165 1043 1028 381 55 ------
NM_022743chr1135 ------
NM_022745chr132904 2596 127 ------
NM_022753chr152760 2177 1084 210 85 ------
NM_022755chr962556 2482 1031 842 823 806 ------
NM_022758chr62923 457 13195 ----
NM_022760chr20130 ------
NM_022763chr321254 893 12024 ----
NM_022776chr351398 1315 580 495 402 ------
NM_022780chr231664 1619 752 ------
NM_022781chr933298 2592 328 --11257 --
NM_022817chr232276 2000 51 12086 ----
NM_022821chr12490 36 ------
NM_022824chr51133 11323 ----
NM_022831chr131623 1601 580 ------
NM_022838chrX1266 ------
NM_022841chr1542597 2559 234 72 1180 ----
NM_022844chr161875 1961 ----
NM_022893chr252975 2779 2639 729 170 ------
NM_022894chr21620 ------
NM_022898chr14104776 4103 4004 3502 3393 1602 900 150 107 82 ------
NM_022910chr1621462 805 ------
NM_022912chr252876 2802 1905 957 159 22682 637 ----
NM_022917chr91369 1413 ----
NM_022918chr11--11727 ----
NM_022970chr1011031 ------
NM_023000chr141523 ------
NM_023001chr141523 ------
NM_023004chr22125 ------
NM_023009chr12543 98 ------
NM_023010chrX175 1778 ----
NM_023015chr11606 --1767 --
NM_023018chr141285 1131 227 78 ------
NM_023035chr191574 ------
NM_023037chr13172 ------
NM_023071chr124931 847 373 120 ------
NM_023076chr1642509 2318 2212 293 ------
NM_023079chr1721223 370 ------
NM_023105chr852260 1638 1603 449 412 --1456 --
NM_023106chr852260 1638 1603 449 412 --1456 --
NM_023110chr852260 1638 1603 449 412 --1456 --
NM_023111chr852260 1638 1603 449 412 --1456 --
NM_023923chr153448 3079 2880 1321 208 ------
NM_023925chr121328 ------
NM_023927chr531153 333 58 ------
NM_023929chr822266 1046 ------
NM_024007chr521120 735 ------
NM_024034chr203988 38 24 ------
NM_024046chr321064 476 11294 ----
NM_024050chr192609 602 ------
NM_024052chr1741941 1205 1050 461 ------
NM_024067chr72342 152 1523 ----
NM_024076chr191643 --134 --
NM_024082chrX181 1392 ----
NM_024092chr1131212 791 385 ------
NM_024117chr93986 321 267 11202 ----
NM_024294chr62923 457 13195 ----
NM_024320chr171160 ------
NM_024329chr141175 1161 342 91 --11144 --
NM_024336chr16----1270 --
NM_024337chr51258 --1252 --
NM_024345chr926105 242 25102 4367 15088 --
NM_024408chr133527 537 472 ------
NM_024424chr113414 165 144 ------
NM_024425chr113414 165 144 ------
NM_024426chr113414 165 144 ------
NM_024429chr72357 172 ------
NM_024430chr18136 ------
NM_024501chr22541 225 ------
NM_024511chr43888 178 33 ------
NM_024519chr161225 ------
NM_024522chr141824 743 117 81 ------
NM_024524chr322463 671 ------
NM_024529chr11121 ------
NM_024539chrX21290 1015 1422 ----
NM_024541chr1031299 704 457 ------
NM_024551chr1232210 1876 650 12230 ----
NM_024551chr1232210 1876 650 12230 ----
NM_024567chr81289 --1534 --
NM_024572chr2141 ------
NM_024582chr41336 ------
NM_024586chr1--1640 ----
NM_024594chr511656 ------
NM_024595chr11218 ------
NM_024598chr1631288 1019 842 ------
NM_024599chr17187 ------
NM_024612chr1731112 1071 53 ------
NM_024613chr82491 133 ------
NM_024624chr211358 ------
NM_024639chr62636 621 ------
NM_024645chr821421 1108 ------
NM_024646chr153541 3262 3068 2467 267 ------
NM_024656chr1971656 1461 1440 1194 1047 616 252 2433 180 11617 156
NM_024659chr22387 65 ------
NM_024665chr323224 235 ------
NM_024676chr131236 314 287 ------
NM_024692chr21442 11379 ----
NM_024702chr171200 ------
NM_024704chr203260 163 37 ------
NM_024711chr761718 1667 481 472 226 91 ------
NM_024713chr15--11665 ----
NM_024721chr83881 730 643 ----125
NM_024740chr1174137 3915 2636 1589 1498 1400 194 ------
NM_024742chr1651916 1535 1342 389 85 ------
NM_024749chr1140 ------
NM_024753chr22543 93 ------
NM_024770chr236487 6305 194 16199 ----
NM_024779chr1231127 432 281 ------
NM_024798chr1562500 2354 2310 749 125 44 ------
NM_024811chr1141720 772 424 298 11698 ----
NM_024824chr14--1150 ----
NM_024834chr1021859 1576 --1386 --
NM_024850chr52161 43 ------
NM_024852chr12537 456 ------
NM_024859chrX2814 338 --1398 --
NM_024863chrX134 ------
NM_024875chr1031563 1527 315 ------
NM_024877chr192906 172 ------
NM_024881chr1963225 2515 441 347 268 226 --23045 1203 --
NM_024884chr142698 467 24210 4161 ----
NM_024915chr862815 1148 759 227 169 128 ------
NM_024920chr41980 ------
NM_024930chr511948 ------
NM_024939chr1631519 1462 538 ------
NM_024940chr82406 32 1593 ----
NM_024945chr911171 ------
NM_024947chr339366 8769 6496 46261 6184 2385 771 ----
NM_024949chr443887 3149 3127 401 23354 869 ----
NM_024989chr278167 6778 6137 5870 5554 1738 845 27383 3030 ----
NM_025054chr824206 2835 ------
NM_025057chr142244 147 ------
NM_025058chr11596 --1137 --
NM_025061chr191266 11081 ----
NM_025073chr184459 4149 3439 3246 1720 1290 554 84 ------
NM_025080chr1131103 1034 882 ------
NM_025138chr1331269 1239 380 1591 ----
NM_025154chr711501 ------
NM_025164chr1132047 1375 79 ------
NM_025181chr21633 194 ----
NM_025182chr93827 758 199 ------
NM_025187chr1641362 1221 928 437 ------
NM_025195chr811628 ----11650
NM_025204chr223963 770 370 ------
NM_025208chr1121783 673 ------
NM_025222chr332680 2489 2095 1809 ----
NM_025235chr1022216 1686 ------
NM_025248chr1762838 2692 2635 2245 2150 118 ----12493
NM_025263chr6----1616 --
NM_030576chr172689 311 ------
NM_030594chr1531187 468 328 ------
NM_030621chr1442686 2612 1592 268 13476 12722 --
NM_030625chr1021833 290 1408 ----
NM_030627chr51451 13783 ----
NM_030647chr785879 5680 4782 4453 2438 1287 291 157 11875 ----
NM_030648chr475490 4318 1990 1975 1828 416 368 11621 ----
NM_030650chr233551 3295 1194 21662 1231 ----
NM_030665chr1711128 ------
NM_030670chr122667 318 11886 ----
NM_030671chr122667 318 11886 ----
NM_030751chr1041805 1380 552 208 ------
NM_030751chr1041805 1380 552 208 ------
NM_030755chr1422586 235 ------
NM_030756chr101112 ------
NM_030758chr2231111 462 227 ------
NM_030759chr101524 ------
NM_030791chr142749 408 ------
NM_030799chr512229 ------
NM_030805chr221106 234 ------
NM_030806chr1107693 7127 6354 6241 6230 2760 2613 2503 2087 2075 16109 ----
NM_030808chr173414 92 75 ------
NM_030816chr133386 2921 186 ------
NM_030820chr6138 1962 ----
NM_030914chr93956 909 770 ------
NM_030915chr232023 1926 759 ------
NM_030918chr143832 1335 736 333 ------
NM_030926chr2--11121 ----
NM_030934chr131290 762 30 ------
NM_030935chr73334 93 24 ------
NM_030939chr6--11160 ----
NM_030940chr9188 ------
NM_030958chr8169 ------
NM_030964chr563464 3388 3286 2500 1206 790 ------
NM_030979chr13135 ------
NM_030981chr1131068 1043 762 ------
NM_030984chr7--137 ----
NM_031216chr1822082 1844 ------
NM_031243chr742002 1909 1679 1603 ------
NM_031262chr91940 ------
NM_031263chr91997 ------
NM_031266chr52473 198 ------
NM_031268chr1695348 4477 3720 3479 1986 1568 1025 875 257 --1517 --
NM_031283chr23764 637 246 ------
NM_031305chr41525 ------
NM_031314chr14--11897 ----
NM_031362chr212529 --12154 --
NM_031365chr212665 --12290 --
NM_031366chr212665 --12290 --
NM_031369chr43871 654 322 ------
NM_031370chr43871 654 322 ------
NM_031371chr121356 230 11416 ----
NM_031371chr121356 230 11416 ----
NM_031372chr411390 11595 ----
NM_031407chrX1423 ------
NM_031411chr542284 1700 1467 142 --12199 --
NM_031427chr1424908 4858 11289 ----
NM_031435chr1243251 3105 796 193 ------
NM_031439chr831449 1252 51 ------
NM_031442chrX32021 658 630 12950 ----
NM_031452chr15165 ------
NM_031453chr1042307 2145 1824 56 ------
NM_031459chr161437 1397 1348 1184 1173 321 ------
NM_031461chr832007 1838 309 ------
NM_031468chr737264 3310 215 ------
NM_031476chr1682741 2670 2488 1813 1807 854 603 215 ------
NM_031477chr16----1344 --
NM_031844chr174042 3947 3816 1145 875 327 108 ------
NM_031845chr233330 862 306 --1685 --
NM_031847chr233330 862 306 --1685 --
NM_031849chr542284 1700 1467 142 --12199 --
NM_031857chr542284 1700 1467 142 --12199 --
NM_031860chr542284 1700 1467 142 --12199 --
NM_031890chr2242310 2069 505 436 --1791 --
NM_031892chrX3824 643 82 ------
NM_031904chr1162059 1998 1393 685 418 315 ------
NM_031934chr173329 257 48 ------
NM_031942chr221129 950 ------
NM_031954chr1242715 1940 1169 54 1215 1547 --
NM_031964chr173316 105 74 ------
NM_031966chr5155 ------
NM_031990chr192926 333 ------
NM_031991chr192926 333 ------
NM_031992chr731437 425 202 11392 ----
NM_032012chr943394 2089 1004 919 192 ----
NM_032017chr121944 1441 ------
NM_032042chr5----22800 204 --
NM_032088chr531725 1531 1371 ------
NM_032092chr531725 1531 1371 ------
NM_032102chr1121171 181 ------
NM_032121chrX22699 160 ------
NM_032124chr182466 244 ------
NM_032128chr43661 214 86 ------
NM_032139chr1931100 1087 92 ------
NM_032144chr251768 1377 643 607 485 ------
NM_032145chr621662 479 11535 ----
NM_032146chr31384 ------
NM_032151chr52756 237 1496 ----
NM_032153chr332186 1078 1047 ------
NM_032156chr121328 ------
NM_032174chr11508 ------
NM_032186chr111177 ------
NM_032189chr1344675 4079 3631 235 24534 4374 138 --
NM_032192chr173738 604 561 ------
NM_032199chr1033825 3291 3243 ------
NM_032208chr212885 ------
NM_032229chr1331144 274 72 ------
NM_032231chr152310 294 ------
NM_032239chr4--1468 ----
NM_032242chr373013 2822 2775 2718 2682 760 612 12442 ----
NM_032246chr15132 ------
NM_032256chr121311 ----1188
NM_032268chr1633186 2304 2196 --11194 --
NM_032276chr22977 855 ------
NM_032281chr191323 ------
NM_032283chr131222 289 166 ------
NM_032288chr312292 --1537 --
NM_032289chr531824 1805 547 ------
NM_032295chr72456 80 ------
NM_032305chr1----125 --
NM_032307chr9----1296 --
NM_032312chr21296 ------
NM_032316chr331909 617 38 --22334 639 --
NM_032373chr1044999 3824 2233 269 ------
NM_032379chr112360 150 ------
NM_032403chr531725 1531 1371 ------
NM_032410chr82366 215 11136 ----
NM_032420chr52749 639 ------
NM_032427chr111448 1647 ----
NM_032429chr101409 ------
NM_032430chr192155 51 --1448 --
NM_032438chr62491 174 ------
NM_032440chr1012276 12526 ----
NM_032445chr151686 ------
NM_032449chr142126 804 660 280 ------
NM_032457chr422668 2601 ------
NM_032458chrX42522 2103 1342 956 12080 ----
NM_032466chr811651 ------
NM_032468chr811651 ------
NM_032491chr122973 282 11252 ----
NM_032510chr181948 ------
NM_032538chr632568 2291 1935 ------
NM_032547chr41401 ------
NM_032557chr43842 765 133 ------
NM_032558chr911106 ------
NM_032561chr22--1257 ----
NM_032564chr112897 84 ------
NM_032575chr1621924 1282 ------
NM_032578chr1051440 1397 607 192 132 ------
NM_032582chr172680 296 ------
NM_032595chr1721357 486 ------
NM_032596chr91125 ------
NM_032626chr161332 ------
NM_032632chr1421943 1712 ------
NM_032638chr321241 572 ------
NM_032646chr1741449 1363 1217 235 ------
NM_032663chr1231422 457 246 ------
NM_032682chr323027 2583 ------
NM_032711chr17103922 2660 1713 1360 1282 1245 1206 678 659 355 11445 23589 1170 --
NM_032731chr1731430 1164 526 1118 ----
NM_032784chr63784 670 219 ------
NM_032801chr1152131 1986 1938 1875 330 ------
NM_032804chr1032205 64 39 --11594 --
NM_032809chr931042 1024 1013 ------
NM_032810chr1041355 1241 1071 227 ------
NM_032833chr142419 1768 248 55 1390 ----
NM_032837chr17--11703 ----
NM_032880chr11109 ------
NM_032883chr202888 869 ------
NM_032900chr1083622 3194 2613 2523 1553 1374 1328 188 2971 205 ----
NM_032905chr1041120 468 292 210 ------
NM_032918chr12--11048 ----
NM_032927chr41511 --1119 --
NM_032932chr1715407 25942 814 25527 2048 --
NM_032943chr112360 150 ------
NM_032947chr52791 127 --145 --
NM_032949chr132542 100 ------
NM_032961chr421027 251 ------
NM_032978chr181124 ------
NM_032979chr181124 ------
NM_032981chr181124 ------
NM_032998chr12230 183 ------
NM_033012chr132806 322 ------
NM_033020chr122936 368 ------
NM_033023chr741151 1066 390 77 ------
NM_033025chr192909 791 ------
NM_033030chr21318 ------
NM_033036chr1111242 ------
NM_033044chr11925 ------
NM_033083chr362987 2214 1179 792 292 184 13325 ----
NM_033117chr91295 ------
NM_033118chr202863 123 ------
NM_033121chr1241677 1488 1385 382 ------
NM_033132chr132860 454 ------
NM_033133chr1753163 1282 1170 957 54 ------
NM_033135chr1121783 673 ------
NM_033141chr141198 --12117 --
NM_033143chr454673 4572 4276 1516 390 11314 ----
NM_033181chr632453 1044 543 22520 1339 ----
NM_033185chr172257 25 ------
NM_033211chr521850 675 22081 795 ----
NM_033224chr716740 22200 449 ----
NM_033225chr832582 2090 1162 --12670 --
NM_033238chr1542766 2512 2478 470 ------
NM_033260chr62759 526 1807 1128 --
NM_033266chr16135 ------
NM_033267chr5145 ------
NM_033274chr573591 3452 2630 1408 887 839 162 ------
NM_033285chr834166 2726 266 143 ----
NM_033309chr162796 100 ------
NM_033310chr111245 ------
NM_033326chr113782 562 392 ------
NM_033360chr1264440 4140 3150 2876 1661 1390 13322 ----
NM_033380chrX2936 72 ------
NM_033381chrX2936 72 ------
NM_033425chr1142182 2150 163 109 ------
NM_033496chr102715 637 ------
NM_033497chr102715 637 ------
NM_033498chr102715 637 ------
NM_033500chr102715 637 ------
NM_033505chr285502 5249 5165 5029 2595 2528 1277 753 14418 ----
NM_033516chr921237 386 ------
NM_033551chr572834 2741 2125 1154 1107 1058 1006 ------
NM_033626chrX51242 1126 709 365 317 ------
NM_033631chr123031 1246 ------
NM_033632chr4--11554 ----
NM_033637chr1063711 2945 1669 1358 1223 476 ------
NM_033644chr532346 829 737 22416 2131 ----
NM_033645chr532346 829 737 22416 2131 ----
NM_052840chr1561336 1225 1201 558 188 136 11213 ----
NM_052864chr421484 480 ------
NM_052869chr1741449 1363 1217 235 ------
NM_052874chr162742 560 ------
NM_052876chr1922301 456 11011 1611 --
NM_052886chr811786 ----11544
NM_052896chr13980 205 131 ------
NM_052898chr831413 1180 331 ------
NM_052900chr81321 21442 222 ----
NM_052901chr941504 403 291 84 ------
NM_052904chr621127 1045 ------
NM_052905chr2--21260 183 ----
NM_052917chr212177 2451 32 ----
NM_052918chr1063276 2598 2419 1206 1128 788 12981 ----
NM_052927chr51409 11521 ----
NM_052932chr112527 424 ------
NM_052934chr131684 1499 37 ------
NM_052954chr21127 2489 470 ----
NM_052962chr611254 11704 ----
NM_052978chr143725 319 247 11652 ----
NM_053002chr31290 ------
NM_053016chr957711 5966 5479 237 190 ----17848
NM_053023chr1111085 ------
NM_053024chr331285 158 123 ------
NM_053043chr775967 5909 3988 3877 1764 1558 1160 1276 15426 --
NM_053064chr142736 467 ------
NM_053280chr111196 ------
NM_054016chr11222 ------
NM_054016chr11222 ------
NM_054016chr11222 ------
NM_054027chr531750 348 144 11623 11778 --
NM_054033chr21612 ------
NM_057089chr71462 ------
NM_057175chr422450 1813 ------
NM_057178chr173458 52 27 ------
NM_058172chr421274 553 ------
NM_058237chr141285 ------
NM_078467chr621466 89 11301 ----
NM_078471chr1751137 1005 460 419 164 ------
NM_078485chr6--1489 ----
NM_080392chr1184 ------
NM_080415chr17------190
NM_080538chr331321 1268 1050 ------
NM_080539chr331321 1268 1050 ------
NM_080541chr331321 1268 1050 ------
NM_080546chr942298 1547 919 781 ------
NM_080599chr101414 ------
NM_080616chr201485 ------
NM_080617chr201181 ------
NM_080629chr13942 438 67 ------
NM_080630chr13942 438 67 ------
NM_080632chrX175 1778 ----
NM_080645chr631623 588 546 ----180
NM_080664chr1431886 585 497 ------
NM_080666chr1411642 11482 ----
NM_080670chr52884 110 ------
NM_080671chr232098 196 74 ------
NM_080676chr2013236 --13169 --
NM_080679chr63936 644 71 ------
NM_080680chr63936 644 71 ------
NM_080681chr63936 644 71 ------
NM_080738chr151625 702 633 622 460 11389 ----
NM_080759chr1312318 ------
NM_080760chr1312318 ------
NM_080872chr833338 2802 371 ------
NM_080881chr51791 --178 --
NM_080927chr31681 ------
NM_130391chr933356 2707 538 1925 13510 --
NM_130392chr933356 2707 538 1925 13510 --
NM_130393chr933356 2707 538 1925 13510 --
NM_130436chr2122449 1729 ------
NM_130438chr2123026 2306 ------
NM_130766chr1731077 832 368 ------
NM_130811chr202423 167 ------
NM_130831chr352716 2490 2047 2040 472 ------
NM_130832chr352716 2490 2047 2040 472 ------
NM_130833chr352716 2490 2047 2040 472 ------
NM_130834chr352716 2490 2047 2040 472 ------
NM_130835chr352716 2490 2047 2040 472 ------
NM_130836chr352716 2490 2047 2040 472 ------
NM_130837chr352716 2490 2047 2040 472 ------
NM_130838chr1541818 1427 737 162 ------
NM_130839chr1541818 1427 737 162 ------
NM_130847chr11115836 5626 5615 5601 4875 4702 3775 1883 1811 840 465 15333 ----
NM_133171chr202962 74 ------
NM_133177chr131127 938 79 --11020 --
NM_133178chr131127 938 79 --11020 --
NM_133264chr172938 306 13540 1278 --
NM_133265chrX1629 23651 305 ----
NM_133334chr466371 5970 4666 4425 2126 968 --15566 --
NM_133338chr51386 ------
NM_133339chr51386 ------
NM_133340chr51386 ------
NM_133341chr51386 ------
NM_133342chr51386 ------
NM_133343chr51386 ------
NM_133344chr51386 ------
NM_133369chr53884 829 244 ------
NM_133370chr413647 ------
NM_133372chr532158 2092 352 ------
NM_133378chr22658 352 ------
NM_133432chr22658 352 ------
NM_133433chr51878 ------
NM_133437chr22658 352 ------
NM_133443chr1662095 2085 1963 1614 862 155 ------
NM_133452chr193906 348 290 ------
NM_133468chr742492 1679 761 88 ------
NM_133476chr12150 ------
NM_133494chr11111 ------
NM_133496chr143191 1644 822 603 ------
NM_133499chrX4885 851 824 818 --1857 --
NM_133631chr31265 ------
NM_133634chr2151801 1682 1434 1364 158 ------
NM_133638chr51154 11462 ----
NM_133646chr241620 963 957 235 ------
NM_133647chr1522805 2653 --122 --
NM_134421chr23726 674 47 ------
NM_134442chr22576 154 ------
NM_138270chrX13101 ------
NM_138286chr1953993 3205 3029 2698 1255 ------
NM_138340chr181491 ------
NM_138356chr15146 ------
NM_138357chr1011453 21256 677 ----
NM_138360chr14139 ------
NM_138373chr1921457 686 ------
NM_138375chr1821104 451 ------
NM_138426chr722511 2201 11557 ----
NM_138437chrX160 ------
NM_138457chr662083 1152 762 595 539 452 ------
NM_138459chr633667 2248 142 ------
NM_138468chr286050 5350 5252 4998 4848 2161 1060 786 14390 11511 --
NM_138473chr1244524 4490 3980 187 14816 ----
NM_138479chr142049 1541 1418 241 1440 ----
NM_138492chr531477 384 303 ------
NM_138494chr712826 ------
NM_138559chr2129 1378 ----
NM_138568chr192408 332 ------
NM_138576chr14104776 4103 4004 3502 3393 1602 900 150 107 82 ------
NM_138609chr51372 --1235 --
NM_138610chr51372 --1235 --
NM_138621chr253756 3499 3331 1364 1066 ----13801
NM_138633chr621493 83 11294 ----
NM_138713chr1687832 6118 5736 5614 5037 2651 1408 1196 15669 ----
NM_138714chr1687832 6118 5736 5614 5037 2651 1408 1196 15669 ----
NM_138730chr61369 ------
NM_138731chr1423909 1123 ----13712
NM_138732chr114953 697 256 162 ------
NM_138734chr114953 697 256 162 ------
NM_138735chr211330 ------
NM_138771chr7--1459 ----
NM_138782chr53821 761 499 2796 293 ----
NM_138795chr121545 612 ------
NM_138799chr242066 1683 334 273 ------
NM_138811chr721176 868 ------
NM_138931chr33835 823 98 11012 ----
NM_138967chr1522462 250 ------
NM_138970chr142741 249 ------
NM_138980chr41457 ------
NM_138981chr41588 ------
NM_138982chr41457 ------
NM_139012chr641421 608 168 86 ------
NM_139014chr651501 688 248 166 46 ------
NM_139029chr113538 145 95 ------
NM_139030chr113538 145 95 ------
NM_139035chrX1728 ------
NM_139045chr92854 321 ------
NM_139046chr10150 ------
NM_139057chr1552609 2598 1082 355 155 ------
NM_139070chr51454 ------
NM_139071chr123606 301 228 ------
NM_139072chr22856 232 ------
NM_139136chr121139 --1898 --
NM_139157chr112255 31 ------
NM_139168chr531910 803 440 ------
NM_139169chr101804 ------
NM_139207chr1221931 407 ------
NM_139242chr1521509 1000 --2941 375 --
NM_139244chr62350 207 ------
NM_139312chr1021272 336 ------
NM_139316chr72422 235 ------
NM_139319chr121439 ------
NM_139321chr2043145 3104 2579 1073 1796 ----
NM_144498chr2041819 1706 1543 190 --1824 --
NM_144568chr142676 24 1226 ----
NM_144571chr431536 1356 860 56867 5633 5253 5058 1831 ----
NM_144580chr1149 ------
NM_144588chr102572 371 11562 11522 --
NM_144599chr1594692 4577 3879 3735 3574 2138 1578 663 434 ------
NM_144600chr162464 366 ------
NM_144607chr173134 93 61 11931 ----
NM_144618chr121441 97 ------
NM_144633chr331092 965 365 ------
NM_144635chr34962 934 448 64 ------
NM_144642chr311352 ------
NM_144664chr1132354 681 507 ------
NM_144721chr43477 380 194 --11715 --
NM_144723chr51677 ------
NM_144767chr1583737 3524 3409 3166 1743 1731 1418 517 22815 1512 24277 947 --
NM_144775chr1753915 1801 1462 670 110 24921 4266 ----
NM_144778chr1311774 1807 ----
NM_144949chr21695 1172 ----
NM_144963chr82523 194 ------
NM_144976chr193667 443 140 ------
NM_145008chr112857 21 ------
NM_145012chr102898 758 ------
NM_145055chr1823281 1478 ------
NM_145065chr1161116 840 303 287 137 28 ------
NM_145117chr1162500 2096 777 632 540 485 --1610 --
NM_145159chr145837 803 728 683 279 ------
NM_145166chr362521 1909 779 629 498 386 ------
NM_145171chr14123 ------
NM_145173chr1952500 2179 1969 969 539 --12021 --
NM_145176chr6154 12585 ----
NM_145203chr131236 ------
NM_145234chrX1664 ------
NM_145251chr1411479 ------
NM_145259chr245633 4485 792 565 36091 2458 2192 12322 --
NM_145268chr731148 294 272 ------
NM_145284chrX51609 1564 937 908 280 ------
NM_145303chr62484 40 ------
NM_145313chr1031555 415 394 ------
NM_145320chr732832 1127 45 1114 ----
NM_145321chr732832 1127 45 1114 ----
NM_145322chr732832 1127 45 1114 ----
NM_145341chr101437 11359 ----
NM_145349chr1761654 591 523 292 227 190 ------
NM_145638chr1141046 1010 874 288 ------
NM_145649chr632610 2290 1751 11047 ----
NM_145655chr632610 2290 1751 11047 ----
NM_145690chr811377 21929 1578 ----
NM_145698chr1031900 820 804 ------
NM_145716chr11517 ------
NM_145730chr224901 862 297 205 ------
NM_145731chr221621 1236 ----
NM_145733chr222958 468 ------
NM_145738chr221621 1236 ----
NM_145799chrX23120 2911 ------
NM_145800chrX2853 272 ------
NM_145802chrX2802 221 ------
NM_145810chr221129 950 ------
NM_145861chr151625 702 633 622 460 11389 ----
NM_145891chr161603 ------
NM_145892chr161603 ------
NM_145893chr161725 ------
NM_145909chr61219 ------
NM_147147chr632667 1519 39 ------
NM_147150chr953435 3097 2636 243 34 --1728 --
NM_147161chr131001 831 69 ------
NM_147168chr91125 ------
NM_147171chr7173 ------
NM_147185chr7173 ------
NM_147189chr821615 333 141 ----
NM_147202chr952636 2176 1720 1089 1021 22480 968 ----
NM_147223chr232132 640 614 ------
NM_147233chr231949 457 431 ------
NM_148174chr81469 11577 ----
NM_148571chr1721540 436 152 11766 --
NM_148904chr1--1640 ----
NM_148905chr1--1640 ----
NM_148906chr1--1640 ----
NM_148907chr1--1640 ----
NM_148908chr1--1640 ----
NM_148909chr1--1640 ----
NM_148921chr1752325 2317 2055 1651 755 ----11894
NM_152221chr222355 37 ------
NM_152227chr201752 ------
NM_152238chr12270 78 ------
NM_152240chr311155 --1199 --
NM_152261chr1231995 1988 350 2849 416 ----
NM_152272chr81254 ------
NM_152277chr552154 1835 1410 660 593 ------
NM_152280chr153489 2975 2903 2730 515 ------
NM_152305chr341831 890 674 294 1177 ----
NM_152330chr143808 768 85 ------
NM_152342chr163134 99 69 ------
NM_152344chr171960 --11305 --
NM_152345chr172738 461 ------
NM_152346chr1751085 322 271 110 39 ----11107
NM_152348chr172669 54 ------
NM_152371chr131345 436 430 --11626 --
NM_152380chr12493 87 11528 ----
NM_152384chr23505 384 294 --11826 --
NM_152390chr22449 192 ----1606
NM_152410chr64478 449 351 187 ------
NM_152414chr81344 ------
NM_152418chr8----1639 --
NM_152420chr92301 113 2681 147 ----
NM_152422chr921590 457 ------
NM_152424chrX53885 3855 3314 3089 705 24402 298 ----
NM_152437chr1222081 1707 ------
NM_152450chr1542021 1963 1856 117 11420 ----
NM_152451chr151628 ------
NM_152455chr1512659 1258 ----
NM_152470chr1863314 3252 3086 2839 1392 539 ------
NM_152475chr1912405 ------
NM_152478chr191444 ----1548
NM_152493chr131050 582 558 ------
NM_152519chr22865 360 11659 ----
NM_152520chr2--1480 ----
NM_152523chr21719 ------
NM_152536chr32864 414 ------
NM_152538chr331460 399 245 11180 ----
NM_152588chr1211192 ------
NM_152594chr1511475 ------
NM_152607chr12447 194 ------
NM_152608chr122396 2122 22131 39 1769 --
NM_152624chr555838 5300 2625 1927 62 26505 4984 ----
NM_152629chr932790 992 681 13610 ----
NM_152630chrX11032 11386 ----
NM_152636chr1112453 ------
NM_152641chr1212547 12745 ----
NM_152653chr31651 1462 ----
NM_152663chr12327 90 ------
NM_152678chr362676 2396 2004 1844 1051 467 ------
NM_152695chrX42017 2002 702 692 11646 ----
NM_152704chr131157 1395 ----
NM_152716chr1111572 ------
NM_152722chr1141562 1531 257 127 11854 ----
NM_152724chr1012144 ------
NM_152735chr621010 681 ------
NM_152738chr62362 319 ------
NM_152742chr71431 ------
NM_152744chr742740 1410 994 941 22467 571 ----
NM_152745chr71837 1103 ----
NM_152756chr51445 13583 ----
NM_152758chr822103 1911 ------
NM_152774chr722752 2404 ------
NM_152780chrX21290 1228 ------
NM_152787chrX23411 1029 --1448 --
NM_152789chr741282 1143 534 213 ------
NM_152793chr754996 4106 3284 1582 1353 ------
NM_152835chr122398 1988 ------
NM_152857chr621040 361 ------
NM_152858chr621040 361 ------
NM_152862chr21166 ------
NM_152879chr232478 989 522 --21641 358 --
NM_152890chr121306 875 ------
NM_152896chr92731 553 ------
NM_152902chr132026 707 282 ------
NM_152910chr131219 1541 ----
NM_152924chr1546660 1393 931 319 1191 16352 --
NM_152996chr121853 1411 ------
NM_153020chr611083 ------
NM_153029chr1674138 3997 3948 2999 2899 2782 2735 24157 586 13555 --
NM_153035chr142794 2280 442 183 ------
NM_153047chr61315 ------
NM_153048chr61315 ------
NM_153050chr2264628 3123 3046 1537 1365 1337 ----13139
NM_153051chr2264628 3123 3046 1537 1365 1337 ----13139
NM_153184chr31251 ------
NM_153186chr94825 781 320 93 ------
NM_153207chr1233943 3580 395 ------
NM_153211chr182442 113 ------
NM_153223chr511393 ------
NM_153246chr681829 1803 1606 1567 1491 1452 1414 1295 --11529 --
NM_153247chr74707 328 116 89 ------
NM_153252chrX1118 ------
NM_153261chr1631319 465 178 ------
NM_153262chr153131 2774 2170 1195 564 ------
NM_153273chr332789 2247 1880 12302 ----
NM_153321chr171972 ------
NM_153322chr171972 ------
NM_153331chr32201 151 ------
NM_153333chrX----1452 --
NM_153347chr1132715 2473 947 ------
NM_153350chr1631156 386 266 ------
NM_153354chr5157 ------
NM_153360chr2031144 957 554 ------
NM_153365chr432309 1053 1014 ------
NM_153367chr1063937 3813 3259 1130 606 85 --23807 830 --
NM_153426chr41190 ------
NM_153427chr41190 ------
NM_153437chr91102 ------
NM_153453chr6167 ------
NM_153464chr191268 ------
NM_153605chr311611 --11362 --
NM_153607chr532302 602 470 ------
NM_153616chr1522306 2129 ------
NM_153617chr1522306 2129 ------
NM_153618chr1522306 2129 ------
NM_153619chr1553544 3367 2533 1174 21 --1356 --
NM_153634chr123661 128 61 11169 ----
NM_153646chr1452574 2058 1979 1592 278 --11636 --
NM_153647chr1452574 2058 1979 1592 278 --11636 --
NM_153648chr1452574 2058 1979 1592 278 --11636 --
NM_153649chr132083 905 148 ------
NM_153689chr212288 --1632 --
NM_153712chr273206 2588 1320 1108 1021 341 316 ------
NM_153748chr121139 --1898 --
NM_153756chr111519 ------
NM_153757chr421055 1000 1401 ----
NM_153759chr21869 ------
NM_153810chr1064916 3954 3403 1167 835 600 ------
NM_153812chr131824 1495 461 22066 126 ----
NM_153827chr171212 ------
NM_153828chr21606 ------
NM_153832chr12496 72 ------
NM_153836chr21614 ------
NM_170662chr3197 ------
NM_170663chr171212 ------
NM_170665chr1253631 3553 3251 2842 405 13199 12946 --
NM_170674chr15----1930 --
NM_170677chr15----1930 --
NM_170692chr12874 836 ------
NM_170709chr821501 99 ------
NM_170712chr32543 53 ------
NM_170713chr32543 53 ------
NM_170714chr32543 53 ------
NM_170719chr1331269 1239 380 1591 ----
NM_170720chr191820 11288 ----
NM_170721chr1711281 --1448 --
NM_170731chr1121794 1761 ------
NM_170732chr1121794 1761 ------
NM_170733chr1121794 1761 ------
NM_170734chr1121794 1761 ------
NM_170735chr1121794 1761 ------
NM_170768chr1111251 ------
NM_171825chr553017 2928 2384 1252 33 ------
NM_171998chrX21811 168 ------
NM_171999chr181237 ------
NM_172016chr631397 87 66 ------
NM_172020chr7--11330 ----
NM_172037chr831297 1152 956 ------
NM_172058chr82445 256 --11234 --
NM_172059chr82445 256 --11234 --
NM_172060chr82445 256 --11234 --
NM_172070chr21149 ------
NM_172071chr166574 6347 5599 1236 895 505 22881 1243 ----
NM_172103chr632659 1654 654 ------
NM_172105chr632659 1654 654 ------
NM_172110chr203665 491 130 --1610 --
NM_172111chr203665 491 130 --1610 --
NM_172112chr203665 491 130 --1610 --
NM_172113chr203665 491 130 --1610 --
NM_172159chr32144 50 ------
NM_172160chr32144 50 ------
NM_172169chr1011593 --1183 --
NM_172170chr1011593 --1183 --
NM_172171chr1011593 --1183 --
NM_172173chr1011593 --1183 --
NM_172315chr15----1930 --
NM_172316chr15----1930 --
NM_172387chr1821520 357 --11360 --
NM_172388chr1821567 404 --11407 --
NM_172389chr1821567 404 --11407 --
NM_173078chrX3327 123 53 ------
NM_173156chr141804 1489 1464 523 ------
NM_173157chr12156 ------
NM_173163chr161377 1128 ----
NM_173171chr2--11033 ----
NM_173172chr2--11341 ----
NM_173173chr2--11033 ----
NM_173198chr932873 1941 426 ----12442
NM_173199chr91192 ------
NM_173200chr932873 1941 426 ----12442
NM_173214chr1687832 6118 5736 5614 5037 2651 1408 1196 15669 ----
NM_173468chr475873 3854 2391 2154 2138 385 294 ------
NM_173470chrX--12349 ----
NM_173473chr102583 355 --12296 --
NM_173475chr1611161 ------
NM_173491chr511126 11038 11432 --
NM_173500chr1511395 ------
NM_173510chr222803 646 12378 ----
NM_173511chr243074 815 720 526 22485 195 ----
NM_173515chr63945 822 47 ------
NM_173536chr445130 2026 406 63 ------
NM_173546chr31567 ------
NM_173552chr322462 1836 ------
NM_173561chr621035 93 ------
NM_173562chr623238 590 12569 --1319
NM_173570chr322236 849 ------
NM_173576chr102510 257 ------
NM_173595chr1275063 4588 4556 4544 4264 2015 1003 14525 ----
NM_173602chr1223657 215 11030 ----
NM_173607chr1422101 224 21920 1752 ----
NM_173642chr1118227 7906 7644 6959 6714 6668 3206 2236 1969 1342 1151 ------
NM_173667chr541870 1525 990 833 ------
NM_173683chr831404 1285 1171 ------
NM_173698chrX31363 535 95 ------
NM_173797chr511131 ------
NM_173809chr101923 ----11476
NM_173812chr1221017 491 ------
NM_173822chr231973 1580 468 --1740 --
NM_173825chr333132 2607 1968 ------
NM_173829chr5105886 5492 4788 4738 4614 4433 2461 794 585 269 ------
NM_173832chr8113391 3375 3320 2548 2488 674 590 578 166 120 74 ------
NM_173851chr833684 2513 935 2689 559 ----
NM_173854chr132345 953 263 ------
NM_173872chr43735 614 225 ------
NM_174856chr20182 ------
NM_174858chr12472 169 ------
NM_174911chr853529 3348 1528 959 891 13886 ----
NM_174921chr421074 863 ------
NM_174963chr12236 147 ------
NM_174964chr12236 147 ------
NM_174965chr12255 166 ------
NM_174966chr12236 147 ------
NM_174967chr12255 166 ------
NM_174968chr12236 147 ------
NM_174969chr12236 147 ------
NM_174970chr12255 166 ------
NM_174971chr12236 147 ------
NM_175061chr752056 2041 745 588 21 ------
NM_175566chr111339 ------
NM_175610chr1511272 ------
NM_175624chr1236360 3057 737 14856 16925 --
NM_175625chr1236360 3057 737 14856 16925 --
NM_175629chr21869 ------
NM_175733chr1132097 507 26 11940 ----
NM_175736chr12126453 6296 5353 2831 2074 1783 1706 656 498 489 186 151 15298 ----
NM_175748chr1431645 459 308 ------
NM_175847chr192926 333 ------
NM_175848chr2011363 ------
NM_175848chr2011363 ------
NM_175849chr2011363 ------
NM_175849chr2011363 ------
NM_175850chr2011363 ------
NM_175850chr2011363 ------
NM_175852chr152413 1946 885 877 703 12390 ----
NM_175854chr1311075 ------
NM_175858chr211325 ------
NM_175861chr1265883 5583 2214 596 302 41 ------
NM_175873chr51929 1526 ----
NM_175884chr721460 204 --1403 --
NM_175898chr1531644 1472 245 ------
NM_175920chr51176 ------
NM_175921chr533389 2922 1336 12627 ----
NM_175931chr1651611 1585 591 76 39 ------
NM_176814chr721471 1322 ------
NM_177422chr12537 456 ------
NM_177424chr1148 ------
NM_177438chr1442686 2612 1592 268 13476 12722 --
NM_177524chr71772 ------
NM_177525chr71772 ------
NM_177539chr1140 --1118 --
NM_177559chr201419 --1110 --
NM_177560chr201419 --1110 --
NM_177949chrX1251 ------
NM_177951chr143887 245 72 189 ----
NM_177968chr242238 2046 1502 301 ------
NM_177972chr1174453 4118 3146 2820 1460 696 621 ------
NM_177976chr31384 ------
NM_177977chr1751783 1739 1610 1289 226 166 ----
NM_177985chr2--11931 ----
NM_177990chr2031250 666 168 ------
NM_177995chr921590 457 ------
NM_177996chr2033390 2920 931 ------
NM_177999chr963245 2789 1328 1280 1192 435 ------
NM_178009chr131182 1504 ----
NM_178011chr1032667 1070 493 ------
NM_178037chr1253631 2939 2898 1364 816 ------
NM_178038chr1253631 2939 2898 1364 816 ------
NM_178039chr1253266 2574 2533 999 451 ------
NM_178040chr1253266 2574 2533 999 451 ------
NM_178135chr421375 1185 1238 ----
NM_178151chrX97634 6714 6052 5967 5686 2558 2048 298 96 ------
NM_178152chrX97634 6714 6052 5967 5686 2558 2048 298 96 ------
NM_178153chrX97634 6714 6052 5967 5686 2558 2048 298 96 ------
NM_178234chr81234 ------
NM_178313chr222155 2030 ------
NM_178423chr721229 853 ------
NM_178425chr721229 853 ------
NM_178427chr112055 ------
NM_178450chr5154 ------
NM_178502chr121521 ------
NM_178517chr17173 ------
NM_178526chr1931976 1776 492 --1420 --
NM_178544chr1951792 1101 615 397 257 ------
NM_178554chr343463 2677 1110 1052 --1475 --
NM_178565chr811690 1320 ----
NM_178578chr2032547 849 221 12111 ----
NM_178585chr42990 624 ------
NM_178586chr1432322 1781 76 --21563 610 --
NM_178812chr82442 306 ------
NM_178815chr1012495 --1990 --
NM_178830chr191236 1774 ----
NM_178864chr111585 ------
NM_180976chr62965 677 ------
NM_180977chr62965 677 ------
NM_181050chr162438 26 ----1142
NM_181093chr12358 141 ------
NM_181332chrX2729 426 ------
NM_181351chr1132645 2121 142 12631 ----
NM_181353chr201552 1102 1136 --
NM_181358chr153155 2808 1630 1590 1564 ------
NM_181443chr2022765 271 ------
NM_181458chr21916 ------
NM_181481chr18116622 5932 5625 5125 4945 4927 4853 4716 2394 1841 509 ----26861 6370
NM_181482chr18116622 5932 5625 5125 4945 4927 4853 4716 2394 1841 509 ----26861 6370
NM_181483chr18116622 5932 5625 5125 4945 4927 4853 4716 2394 1841 509 ----26861 6370
NM_181492chr221876 --189 --
NM_181504chr544108 3472 1105 338 1216 ----
NM_181505chr173738 604 561 ------
NM_181521chr1645829 5625 2257 449 --139 --
NM_181523chr544108 3472 1105 338 1216 ----
NM_181524chr544108 3472 1105 338 1216 ----
NM_181527chr201322 ------
NM_181528chr201377 ------
NM_181598chr14185 ------
NM_181644chr1----1464 --
NM_181672chrX2606 578 ------
NM_181673chrX2606 578 ------
NM_181674chr51319 ------
NM_181675chr51319 ------
NM_181676chr51319 ------
NM_181677chr51319 ------
NM_181678chr51319 ------
NM_181689chr201811 ------
NM_181701chr951695 1620 1604 858 59 1892 11647 --
NM_181704chr213966 326 263 11277 ----
NM_181714chr61448 ------
NM_181741chr22262 147 ------
NM_181742chr22262 147 ------
NM_181762chrX--1332 ----
NM_181777chrX--1332 ----
NM_181787chr843480 3112 229 71 ------
NM_181828chr2253501 2695 1175 1054 371 13584 --12530
NM_181829chr2253501 2695 1175 1054 371 13584 --12530
NM_181830chr2253501 2695 1175 1054 371 13584 --12530
NM_181838chr52449 339 ------
NM_181839chr8--1358 11304 --
NM_181844chr1721330 96 ------
NM_181877chr154521 448 285 88 ------
NM_182314chrX41563 519 505 298 ------
NM_182481chr212111