TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3622b-5p
miRNA Sequence: AGGCAUGGGAGGUCAGGUGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000021chr1411069 ------
NM_000037chr842463 973 455 84 --1532 --
NM_000038chr51731 --11416 --
NM_000044chrX2280 37 1380 ----
NM_000052chrX63268 2277 1204 387 103 38 23463 2464 32849 2162 1295 12151
NM_000081chr121400 449 ------
NM_000084chrX106834 6677 6608 6032 5424 4303 2742 1641 1039 332 --36520 4259 1664 12105
NM_000087chr42381 33 1332 ----
NM_000093chr92635 73 22421 51 1291 --
NM_000108chr731328 1307 271 ------
NM_000109chrX22630 274 31930 1726 775 ----
NM_000111chr71291 ------
NM_000125chr664131 3858 3061 1381 723 59 14009 13203 --
NM_000127chr81288 ------
NM_000129chr63996 466 162 ------
NM_000138chr1532637 2264 2018 2834 296 ----
NM_000165chr621619 623 11564 ----
NM_000170chr92445 363 ------
NM_000208chr1964698 4480 3094 1831 1193 687 --1101 --
NM_000210chr2----21532 76 1626
NM_000217chr12105308 5037 5029 4481 4425 4092 3386 1351 1328 903 186 ----
NM_000222chr421667 505 ------
NM_000240chrX191 --12185 --
NM_000242chr1052662 2648 2514 838 519 2803 201 ----
NM_000245chr722232 698 ------
NM_000248chr331931 344 119 ------
NM_000259chr1544740 2512 2492 2105 25903 460 ----
NM_000262chr2241634 1432 236 66 11722 2290 159 --
NM_000264chr982872 2828 2063 1344 989 642 513 393 22611 2351 --1311
NM_000266chrX3898 802 152 ------
NM_000267chr1742962 2682 137 87 12658 ----
NM_000280chr111774 ----1979
NM_000296chr16--1758 ----
NM_000297chr461789 1776 1721 827 586 84 ------
NM_000310chr12131 76 11158 ----
NM_000314chr1033153 2936 2612 22070 599 ----
NM_000319chr121261 ------
NM_000322chr641651 464 401 262 ------
NM_000332chr676706 5994 5456 5369 5297 4492 2332 ------
NM_000337chr5116438 6389 5761 5247 5236 4975 2091 1954 1324 1047 1013 36409 2387 1169 11407 --
NM_000353chr161921 --1877 1117
NM_000362chr2243550 2566 544 143 23226 1087 23130 2927 1248
NM_000368chr964576 4039 3914 3822 1917 1162 24716 959 24105 3228 --
NM_000378chr111307 --1846 --
NM_000387chr32582 530 ------
NM_000390chrX32842 893 294 --1852 --
NM_000393chr241987 1494 1364 533 11556 ----
NM_000408chr242685 2611 551 53 12901 ----
NM_000411chr2122924 470 --31222 1211 38 --
NM_000430chr1743256 2777 2340 161 12814 21245 1174 --
NM_000439chr53714 430 36 ------
NM_000450chr121210 584 ----1110
NM_000451chrX61659 1529 330 265 232 109 --1453 --
NM_000461chr364376 4103 3129 1406 1279 498 24258 3402 14333 11327
NM_000474chr7--1123 ----
NM_000482chr111108 ------
NM_000489chrX32861 1084 309 ------
NM_000495chrX2816 138 ------
NM_000508chr41841 1784 ----
NM_000522chr711053 ------
NM_000531chrX1332 ----1363
NM_000536chr111522 ------
NM_000555chrX57727 5120 4844 1484 967 26563 1490 15211 --
NM_000572chr11847 ------
NM_000598chr751070 1043 473 292 38 ------
NM_000599chr263458 3209 2809 861 851 804 --33167 1849 1463 --
NM_000612chr1132462 1462 788 12341 33811 3601 140 13287
NM_000618chr1285591 5492 4780 2502 2262 1744 1061 662 135 25447 2031 16216
NM_000618chr1285591 5492 4780 2502 2262 1744 1061 662 135 25447 2031 16216
NM_000619chr122473 378 1411 ----
NM_000633chr1834760 3571 380 --24483 556 --
NM_000663chr1642879 2544 1104 443 13050 ----
NM_000665chr71154 --121 --
NM_000679chr51206 ------
NM_000684chr1011314 ------
NM_000720chr33329 207 142 ------
NM_000721chr13502 121 27 22423 2263 --1889
NM_000725chr1221036 988 ------
NM_000726chr21163 11124 1320 --
NM_000756chr8--192 ----
NM_000793chr1484403 4082 3598 3553 984 545 475 316 ----14642
NM_000801chr2011120 1230 ----
NM_000807chr43625 562 197 ------
NM_000812chr42250 156 ------
NM_000813chr595455 5067 4081 3849 3779 671 434 388 259 23896 1554 ----
NM_000814chr1573934 3865 3239 1664 1191 359 225 ------
NM_000817chr21347 --1401 --
NM_000826chr432228 1034 111 ------
NM_000827chr532238 2127 561 21743 1638 ----
NM_000828chrX1364 ------
NM_000829chr1132169 1637 582 1413 ----
NM_000831chr185712 5217 4598 2440 2227 1882 498 259 14919 65236 4387 3905 2341 1907 1642 22325 2165
NM_000834chr122870 503 168 ----
NM_000836chr192988 979 ------
NM_000838chr652374 2255 1976 996 363 1413 1383 --
NM_000842chr112774 584 ------
NM_000844chr32913 895 1747 ----
NM_000859chr52214 173 1638 ----
NM_000864chr12969 785 ------
NM_000866chr331772 309 240 11693 ----
NM_000868chrX42403 2050 1763 154 11948 ----
NM_000870chr521453 496 --135 --
NM_000875chr1526259 4827 15826 36444 5881 946 --
NM_000891chr171196 12880 1189 --
NM_000901chr411938 1139 1324 --
NM_000905chr71167 ------
NM_000912chr863251 2932 2813 2225 717 471 1685 ----
NM_000922chr113234 173 113 ------
NM_000926chr11169165 8662 8515 8374 7833 7645 7141 6687 3301 2845 2607 1900 1076 1017 801 292 16248 33537 2936 1389 --
NM_000933chr20----1515 21262 527
NM_000934chr17--1709 ----
NM_000938chr41131 ------
NM_000944chr442076 1596 930 229 ------
NM_000945chr211772 ------
NM_000949chr51123 ------
NM_000950chrX33291 1101 431 --1178 --
NM_000956chr142994 802 ------
NM_000965chr33964 937 222 ------
NM_000977chr16138 1368 ----
NM_001001323chr1212634 ------
NM_001001331chr342390 1864 1042 298 --32384 1812 936 --
NM_001001349chr1711356 ----11154
NM_001001396chr134500 3087 1715 34015 4000 197 ----
NM_001001419chr565118 1448 1186 534 274 232 24421 645 ----
NM_001001420chr565118 1448 1186 534 274 232 24421 645 ----
NM_001001438chr211311 ------
NM_001001481chr842796 1342 523 197 ------
NM_001001502chr51535 --1448 --
NM_001001556chr152222 161 ----11589
NM_001001557chr8----1541 1530
NM_001001664chr233503 408 292 ------
NM_001001787chr11433 ------
NM_001001936chr10179 132 ----
NM_001001974chr1032294 1603 1551 --11476 --
NM_001001995chrX1372 1412 ----
NM_001002033chr17----146 --
NM_001002258chr211908 11525 1615 --
NM_001002762chr1042877 2532 2233 488 --1405 --
NM_001002814chr8103472 3437 3293 1424 1164 1028 600 521 429 252 11249 ----
NM_001002843chr154955 934 517 423 ------
NM_001002860chr1484440 4434 3534 3207 1765 1421 987 416 23237 163 ----
NM_001002909chr1712032 --11542 --
NM_001002914chr171792 ------
NM_001003652chr1878730 8567 7912 7283 2587 1399 879 --12974 --
NM_001003674chr1896008 5824 4779 2595 2105 1803 1729 1306 958 36670 4830 4815 ----
NM_001003675chr1896008 5824 4779 2595 2105 1803 1729 1306 958 36670 4830 4815 ----
NM_001003676chr1111047 ------
NM_001003677chr111603 ------
NM_001003682chr1------147
NM_001003712chr1222779 1589 23773 1448 --12530
NM_001003722chr92871 130 188 ----
NM_001003760chr62716 139 13362 1680 --
NM_001003799chr71565 ------
NM_001003800chr952793 2337 1458 1380 1252 ------
NM_001003810chr42249 223 ------
NM_001003940chr1521205 669 13243 ----
NM_001003942chr1521205 669 13243 ----
NM_001003943chr1521209 673 13247 ----
NM_001003945chr941882 1632 1200 104 2165 125 ----
NM_001004065chr963487 3434 3096 2923 2632 1587 1640 12815 --
NM_001004317chr654463 867 659 392 54 23246 2997 ----
NM_001004346chr421193 1142 2402 37 ----
NM_001004419chr1243502 1541 398 70 ------
NM_001004439chr1531234 1208 1026 ----1271
NM_001005207chr17182 ------
NM_001005209chr22669 635 1652 ----
NM_001005210chr1122219 1936 1871 127 --
NM_001005266chr15--1538 1692 --
NM_001005267chr15--1538 1692 --
NM_001005268chr15--1538 1692 --
NM_001005269chr15--1538 1692 --
NM_001005335chr191288 159 ----
NM_001005354chr12169 ------
NM_001005386chr241694 1685 792 347 ------
NM_001005408chr17----1179 --
NM_001005463chr1022026 80 --22439 317 --
NM_001005473chr586361 6197 5628 5111 2039 1717 1685 567 14378 ----
NM_001005609chrX33111 1315 252 --129 --
NM_001005743chr142829 472 ------
NM_001005744chr142829 472 ------
NM_001005745chr142829 472 ------
NM_001005746chr21163 11124 1320 --
NM_001005747chr21163 11124 1320 --
NM_001005751chr102485 165 ------
NM_001005920chr161767 --1759 --
NM_001006115chr311091 ----12139
NM_001006600chr52810 394 ------
NM_001006610chr161940 ------
NM_001006617chr921250 267 --2986 321 1572
NM_001006619chr921250 267 --2986 321 1572
NM_001006620chr921250 267 --2986 321 1572
NM_001006621chr921250 267 --2986 321 1572
NM_001006634chr16--1239 2594 539 --
NM_001006636chr21247 ------
NM_001006657chr263150 2671 2299 1218 416 227 ------
NM_001006684chrX1227 ------
NM_001006933chrX1189 ------
NM_001006935chrX130 ------
NM_001006936chrX130 ------
NM_001006937chrX130 ------
NM_001007023chr1484403 4082 3598 3553 984 545 475 316 ----14642
NM_001007097chr974935 4355 3249 3201 1809 947 61 --11772 14378
NM_001007102chr611397 ------
NM_001007156chr151382 --21442 445 11713
NM_001007257chr12204 52 ------
NM_001007466chr664870 4235 3270 1122 1033 47 --11130 --
NM_001007471chr9--1572 --1346
NM_001007559chr1811817 --21908 1390 --
NM_001007794chr12249 208 ------
NM_001008220chr553796 3624 1153 903 381 --23156 2616 1826
NM_001008225chr71129 ------
NM_001008239chr1833260 2877 616 12794 ----
NM_001008392chr373358 2920 2643 2574 1064 624 105 13260 22704 135 --
NM_001008408chr765909 5425 5397 5047 3872 2306 11293 35612 5477 1729 15473
NM_001008495chr81217 ------
NM_001008541chr1051862 814 746 623 573 ----1652
NM_001008541chr1051862 814 746 623 573 ----1652
NM_001008563chr9124 --11326 --
NM_001008707chr1411351 11759 ----
NM_001008726chr1411477 --11701 --
NM_001008738chr521999 626 22965 2243 ----
NM_001008783chr61858 ------
NM_001008897chr6--1482 ----
NM_001008925chr443289 2531 2478 271 ----23420 25
NM_001008938chr111114 ------
NM_001009185chr5--2768 481 ----
NM_001009554chr464724 3718 3705 3606 1438 22 11126 ----
NM_001009554chr464724 3718 3705 3606 1438 22 11126 ----
NM_001009899chr345089 4606 4530 1616 11476 15151 24449 152
NM_001009944chr16--1758 ----
NM_001009955chr12439 176 ------
NM_001009955chr12439 176 ------
NM_001009993chr253818 3115 1514 1487 702 --1919 14412
NM_001009996chr31214 --1445 1390
NM_001010854chr143595 526 172 ----1476
NM_001010861chr112419 21122 425 ----
NM_001010862chrX53282 3199 3046 2947 374 --12614 --
NM_001010867chr186698 4840 4756 2179 2128 622 492 475 26403 5433 32135 587 169 --
NM_001010888chrX51736 1564 1512 1438 302 --2567 283 --
NM_001010891chr555280 2699 1216 922 814 --12653 1133
NM_001010895chr941753 841 394 186 11373 21633 1520 --
NM_001010908chr101249 ------
NM_001010924chr103873 472 308 ------
NM_001010927chr6--1498 ----
NM_001010942chr1231256 861 330 ------
NM_001010971chr11869 ------
NM_001010986chrX32060 516 82 ------
NM_001010989chr161206 ------
NM_001010990chr161206 ------
NM_001011513chr442716 1303 1290 222 32549 1568 898 13251 --
NM_001011537chr352253 2019 1560 1500 270 11923 ----
NM_001011546chr202298 34 ------
NM_001011553chr7--145 ----
NM_001011645chrX2280 37 1380 ----
NM_001011666chr731714 1054 48 --24613 1484 --
NM_001011708chr222001 1133 22387 303 ----
NM_001011713chr1421238 104 1627 ----
NM_001011724chr13----1279 --
NM_001011725chr13----1279 --
NM_001011885chr15--11673 ----
NM_001012329chr121920 1669 ------
NM_001012393chr1143958 660 492 481 24786 1374 13544 --
NM_001012398chr162130 26 ------
NM_001012420chr152949 352 1514 ----
NM_001012423chr152949 352 1514 ----
NM_001012426chr623092 1010 ------
NM_001012427chr623092 1010 ------
NM_001012732chr411124 1877 21025 802 --
NM_001012751chr102581 115 ------
NM_001012756chr1933049 2534 2219 --22752 2491 --
NM_001012761chr531951 871 105 --2795 490 --
NM_001012968chrX2455 408 ------
NM_001012979chrX1189 ------
NM_001013031chr1031170 779 181 2996 633 ----
NM_001013398chr751070 1043 473 292 38 ------
NM_001013406chr711133 ------
NM_001013438chr31837 ------
NM_001013439chr31683 ------
NM_001013620chr1267684 7035 6491 3269 1472 1128 11774 ----
NM_001013734chr61698 --1309 --
NM_001013843chr151821 ------
NM_001014283chr1362167 1466 1441 1330 630 323 11456 ----
NM_001014435chr163643 489 445 ----158
NM_001014442chr13163 ------
NM_001014443chr12219 191 ------
NM_001014796chr1122 --169 176
NM_001014796chr1122 --169 176
NM_001014797chr1066527 5989 1444 1212 303 208 17217 17504 --
NM_001014839chr11378 ------
NM_001014841chr11378 ------
NM_001015508chr81671 ------
NM_001015877chrX22178 669 32764 510 403 1798 --
NM_001017368chr1731735 384 154 ----1140
NM_001017371chr2----1871 --
NM_001017395chr312608 --43153 2851 2472 463 --
NM_001017406chr1139 ------
NM_001017415chr11164 ------
NM_001017416chr11164 ------
NM_001017424chr121899 52 ------
NM_001017425chr121899 52 ------
NM_001017434chr11173 ------
NM_001017440chr762963 2669 1951 1558 1511 51 --35989 2948 1017 12877
NM_001017524chr11174 ------
NM_001017922chr11618 ------
NM_001017923chr1411259 11673 143 --
NM_001017926chr811327 ------
NM_001017930chrX41298 1186 955 156 ------
NM_001017973chr5------145
NM_001017974chr5------145
NM_001017975chr12430 64 ------
NM_001018008chr152465 49 2580 503 ----
NM_001018009chr3--187 ----
NM_001018024chrX126 ------
NM_001018037chr92406 243 11353 ----
NM_001018050chr2243367 3342 2658 561 ------
NM_001018052chr2243367 3342 2658 561 ------
NM_001018053chr131610 1508 722 11941 ----
NM_001018054chr141176 972 45 24 ------
NM_001018065chr9105870 5789 5702 5275 4593 1850 1820 1474 946 727 15459 164 45573 5198 4295 219
NM_001018066chr9105870 5789 5702 5275 4593 1850 1820 1474 946 727 15459 164 45573 5198 4295 219
NM_001018100chr151797 ------
NM_001020818chr1921182 667 ----1632
NM_001020819chr1921182 667 ----1632
NM_001020820chr1921182 667 ----1632
NM_001020821chr1921182 667 ----1632
NM_001023567chr1542488 2438 1563 352 1517 ----
NM_001024218chr14134 ------
NM_001024401chr1632818 2798 1977 21779 1065 12733 --
NM_001024647chr1286955 5287 5152 2878 2746 2105 1850 163 --34917 1488 21 --
NM_001024649chr542489 2143 1911 923 ------
NM_001024845chr15856 180 163 156 40 ------
NM_001024847chr332444 2077 858 11654 3544 188 27 --
NM_001024858chr1442965 2908 1986 1153 --21134 191 --
NM_001024934chr61617 ------
NM_001024935chr61617 ------
NM_001024936chr61617 ------
NM_001024947chr5199 ------
NM_001024948chr132370 1143 26 ------
NM_001025076chr1086017 5932 5629 2224 1380 267 85 56 25430 4988 11327 --
NM_001025077chr1087375 7290 6987 2738 1625 1443 1414 1041 26788 6346 22685 149 --
NM_001025079chr312889 11603 ----
NM_001025105chr5--21484 321 ----
NM_001025108chr254173 4134 3429 1365 1091 12866 23224 3001 --
NM_001025266chr334613 1780 665 23813 1728 13868 --
NM_001025580chrX12779 --13451 --
NM_001025595chr411494 ------
NM_001025596chr11178 ------
NM_001025616chr421893 178 ------
NM_001025780chr931112 467 193 2611 99 ----
NM_001029858chr633345 2568 44 1477 ----
NM_001029859chr1142363 1888 1593 513 149 ----
NM_001029863chr643233 1242 455 311 22724 2015 12454 --
NM_001029875chr562089 1080 972 878 253 111 --12280 --
NM_001029998chr451440 1399 453 404 281 --11321 --
NM_001030001chr14----1179 --
NM_001030006chr1721746 635 --2267 31 --
NM_001030007chr1643791 3321 3083 2438 --11501 --
NM_001030019chr7132 ----126
NM_001030055chr1431790 650 177 --1505 --
NM_001030272chr111375 ------
NM_001030273chr111375 ------
NM_001031679chr1233287 2220 164 23122 912 12204 --
NM_001031695chr2295352 4977 4403 4218 3800 1766 885 544 304 --1291 --
NM_001031696chr191231 ------
NM_001031700chr41313 1239 ----
NM_001031710chr71357 ------
NM_001031716chr22733 41 11068 ----
NM_001031732chr453545 2934 2858 1102 850 ----12906
NM_001031740chr121225 405 ------
NM_001031804chr1643239 991 886 708 13030 189 --
NM_001031855chrX1213 ------
NM_001032221chr921615 1322 ------
NM_001032280chr6----11316 1576
NM_001032293chr171590 1649 ----
NM_001032393chrX2491 226 ------
NM_001032394chr61733 1103 ----
NM_001033045chr221368 691 31668 945 587 14204 11583
NM_001033057chr311934 ------
NM_001033087chr2053168 2910 2303 873 224 21283 1053 ----
NM_001033112chr51138 --1638 --
NM_001033504chr172597 159 ------
NM_001033507chr121770 279 --1321 --
NM_001033557chr21297 1953 ----
NM_001033566chr171129 ------
NM_001033568chr171129 ------
NM_001033578chr852036 1764 1719 748 426 ------
NM_001033677chr122328 267 ------
NM_001033925chr1022070 826 --1549 --
NM_001034025chr121163 --1652 --
NM_001034837chr53789 738 254 ----1591
NM_001034838chr53789 738 254 ----1591
NM_001034852chr1431875 746 124 ----1599
NM_001034954chr1063160 3154 2752 2592 2393 995 --12623 --
NM_001034955chr1063160 3154 2752 2592 2393 995 --12623 --
NM_001034956chr1063160 3154 2752 2592 2393 995 --12623 --
NM_001034957chr1063160 3154 2752 2592 2393 995 --12623 --
NM_001035chr11491 ------
NM_001035254chr982388 2364 2235 2092 863 693 272 124 --3891 177 114 --
NM_001037132chr711885 ------
NM_001037133chr711885 ------
NM_001037164chr71707 ------
NM_001037172chr31324 1949 --135
NM_001037317chr112419 21122 425 ----
NM_001037332chr552495 1900 641 458 165 --2426 186 --
NM_001037333chr552495 1900 641 458 165 --2426 186 --
NM_001037339chr121684 426 149 ----
NM_001037340chr121684 426 149 ----
NM_001037341chr121684 426 149 ----
NM_001037341chr121684 426 149 ----
NM_001037535chrX21086 279 11444 ----
NM_001037536chrX21086 279 11444 ----
NM_001037540chrX21086 279 11444 ----
NM_001037582chr421158 25 11226 ----
NM_001037631chr21452 ------
NM_001037872chr21535 1734 ----
NM_001038493chr22976 158 --21395 48 --
NM_001038707chr111963 ------
NM_001038707chr111963 ------
NM_001039140chr20165 ------
NM_001039350chr711317 ------
NM_001039360chr1821825 1803 --21809 1408 1279
NM_001039372chr71252 --1547 --
NM_001039459chr731166 318 22 ------
NM_001039479chr142769 118 1953 2255 33 11639
NM_001039538chr2--12365 --12707
NM_001039547chr3127265 6955 6392 4953 3212 2812 2641 2074 1121 1055 790 372 12290 12901 --
NM_001039574chr141017 1003 972 142 ------
NM_001039585chr1--31106 931 159 ----
NM_001039590chrX43958 3103 3042 1580 ----2939 454
NM_001039591chrX43958 3103 3042 1580 ----2939 454
NM_001039618chr1125982 320 ----159
NM_001039690chr16----12005 --
NM_001039711chr12787 180 --1926 --
NM_001039712chr12787 180 --1926 --
NM_001039802chr121370 319 ------
NM_001039840chrX125877 4347 4006 3668 2285 2068 1740 1568 1383 708 460 315 1596 --14752
NM_001039960chr1211115 --1135 --
NM_001040057chr711289 --1578 --
NM_001040092chr81134 ------
NM_001040100chr33344 164 120 21187 189 ----
NM_001040110chr741747 1479 1265 516 --1555 --
NM_001040142chr21564 ----197
NM_001040143chr21564 ----197
NM_001040144chr16----12005 --
NM_001040146chr16----12005 --
NM_001040152chr733701 1162 950 24136 1958 --14475
NM_001040158chr5132 ------
NM_001040159chr421146 431 ------
NM_001040172chr521453 496 --135 --
NM_001040173chr521453 496 --135 --
NM_001040202chr441999 974 431 336 ------
NM_001040214chr621978 1733 41914 1804 677 489 ----
NM_001040284chr1655896 1204 1120 1054 46 --25077 1002 --
NM_001040402chr431057 630 89 53158 1112 1036 611 527 ----
NM_001040429chr1313338 33363 1400 660 ----
NM_001040431chr17123 ------
NM_001040441chr164471 3799 1784 796 138 31 24340 3640 ----
NM_001040446chr52181 84 11725 11095 --
NM_001040455chr1131070 989 350 ----11320
NM_001040458chr531752 323 185 --1489 --
NM_001040619chr11341 ------
NM_001040624chr842653 2428 2001 419 11721 11021 --
NM_001040625chr842653 2428 2001 419 11721 11021 --
NM_001040626chr842653 2428 2001 419 11721 11021 --
NM_001040627chr842653 2428 2001 419 11721 11021 --
NM_001040628chr842653 2428 2001 419 11721 11021 --
NM_001040629chr842653 2428 2001 419 11721 11021 --
NM_001040630chr842653 2428 2001 419 11721 11021 --
NM_001040653chr331776 322 82 --1861 --
NM_001040665chr754928 4127 1372 1363 1164 33137 3054 46 ----
NM_001040712chr923025 2459 ------
NM_001040876chr431434 1293 91 1392 ----
NM_001042355chr161528 11138 13721 --
NM_001042369chr1184 ------
NM_001042388chr182817 671 ------
NM_001042406chr621091 433 ------
NM_001042412chr161528 11138 13721 --
NM_001042413chr922690 2552 2596 542 22992 475 13274
NM_001042414chr13150 ------
NM_001042425chr6----11316 1576
NM_001042453chrX21157 93 11422 ----
NM_001042473chr1011413 --11370 --
NM_001042479chrX31868 1580 658 --12005 1161
NM_001042480chrX31868 1580 658 --12005 1161
NM_001042481chr1432379 1721 614 12297 1654 --
NM_001042486chr2011353 --2967 404 --
NM_001042492chr1742962 2682 137 87 12658 ----
NM_001042510chr852134 1559 1478 734 159 ------
NM_001042511chr852134 1559 1478 734 159 ------
NM_001042517chr131304 --150 --
NM_001042537chrX32140 1667 87 ------
NM_001042548chr22782 307 ------
NM_001042555chr1264763 4003 3203 679 317 270 ----14322
NM_001042573chr1732184 2154 601 11559 11619 --
NM_001042599chr2107519 7500 6773 6171 6109 5360 4843 2086 1988 1529 27460 843 --1400
NM_001042601chr331167 445 347 ------
NM_001042603chr1254056 3264 878 232 191 ------
NM_001042604chr324259 155 11085 ----
NM_001042632chr201450 --32121 524 230 --
NM_001042633chr201450 --32121 524 230 --
NM_001042646chr361876 1541 1431 709 625 145 ------
NM_001042669chr421893 178 ------
NM_001042678chr1126 --191 --
NM_001042679chr1126 --191 --
NM_001042749chrX3688 278 120 --11407 --
NM_001042750chrX3688 278 120 --11407 --
NM_001042751chrX3688 278 120 --11407 --
NM_001043351chr131594 835 741 --11549 --
NM_001044385chr223484 3299 13837 21478 1360 --
NM_001045556chr841378 1224 236 26 ------
NM_001045557chr841378 1224 236 26 ------
NM_001046chr512369 22672 2618 1763 --
NM_001083620chr432226 1033 111 ------
NM_001094chr173290 195 121 --1654 --
NM_001095chr1221934 560 --1269 --
NM_001099678chr375298 4888 2579 2060 1863 762 183 24973 465 14692 11044
NM_001100108chr187716 6785 6202 6070 3322 2943 2237 1198 37087 6962 5996 ----
NM_001106chr379506 3889 3328 2968 2796 2140 1373 33860 1326 1247 1288 12933
NM_001109977chr41755 ------
NM_001116chr1642978 2409 2242 2114 1574 ----
NM_001117chr1811609 --11976 --
NM_001121chr1011707 ------
NM_001122chr9126 ------
NM_001122631chr111533 1426 ----
NM_001126chr14923 861 849 283 ------
NM_001128chr1643791 3321 3083 2438 --11501 --
NM_001140chr171512 1506 1104 --
NM_001147chr81137 ------
NM_001149chr10----1279 --
NM_001153chr21258 ------
NM_001167chrX106380 6164 6111 5678 5621 4372 4170 2053 1962 1342 14256 32007 1105 449 --
NM_001173chr1431790 650 177 --1505 --
NM_001174chrX2166 35 12270 ----
NM_001178chr111375 ------
NM_001186chr2153173 2531 2518 2406 216 --11282 --
NM_001196chr22--190 1899 --
NM_001198chr632442 1581 933 ------
NM_001204chr297520 7285 7114 5621 3065 1856 930 416 153 22377 1232 ----
NM_001206chr932860 1046 836 11948 ----
NM_001241chr231843 1704 63 ------
NM_001241chr231843 1704 63 ------
NM_001256chr17--12051 12663 --
NM_001259chr766134 4339 4235 1769 1193 789 --1602 14289
NM_001270chr521063 923 ------
NM_001271chr1532489 2257 109 ----13034
NM_001273chr121118 ------
NM_001281chr191138 ------
NM_001282chr1721746 635 --2267 31 --
NM_001290chr43771 384 107 ------
NM_001293chr111395 ------
NM_001298chr211299 ------
NM_001304chr1743701 3514 1325 1019 ----13525
NM_001310chr1231137 616 353 ------
NM_001315chr642257 2097 1991 365 ------
NM_001326chr111193 ------
NM_001331chr1142836 2591 1114 387 2686 557 ----
NM_001343chr511691 11069 ----
NM_001349chr21530 ------
NM_001356chrX--22074 983 ----
NM_001357chr1--154 ----
NM_001358chr41173 ------
NM_001364chr1164100 3409 1651 1116 959 438 14755 --13726
NM_001378chr22449 73 ------
NM_001379chr19--176 ----
NM_001391chr18166 1354 ----
NM_001396chr2162716 2662 2608 1977 899 619 --1192 --
NM_001399chrX33111 1315 252 --129 --
NM_001400chr11339 ------
NM_001401chr941185 995 575 433 ------
NM_001406chr1731713 1298 1208 ------
NM_001412chrX63372 3260 2432 1274 1066 273 13466 1242 --
NM_001415chrX31444 1369 277 --11225 --
NM_001417chr1241733 1501 268 160 ------
NM_001418chr111715 ------
NM_001418chr111715 ------
NM_001419chr1964128 4066 3502 3249 612 305 ------
NM_001420chr1952990 2261 1093 947 859 13176 ----
NM_001422chr111116 ----1296
NM_001423chr1231895 599 338 21613 712 ----
NM_001427chr711906 --1646 --
NM_001429chr2211018 ------
NM_001438chr123642 919 --13446 --
NM_001448chrX1220 ------
NM_001458chr7--1691 ----
NM_001463chr21286 ------
NM_001478chr12--2770 677 ----
NM_001483chr71954 1933 ----
NM_001489chr91228 ------
NM_001491chr632723 2584 709 1681 ----
NM_001497chr932649 1949 220 22225 839 12463 --
NM_001527chr644826 4162 1439 1416 --21760 210 --
NM_001530chr141899 ------
NM_001533chr191288 159 ----
NM_001541chr11--1148 ----
NM_001543chr523940 785 14648 ----
NM_001546chr621150 537 ------
NM_001564chr4192 ------
NM_001566chr2156 ------
NM_001570chr331361 1165 455 --1966 --
NM_001584chr11------1242
NM_001604chr111774 ----1979
NM_001614chr17--186 ----
NM_001614chr17--186 ----
NM_001616chr23837 711 662 --12718 --
NM_001620chr114704 696 217 113 ------
NM_001621chr722998 2908 1119 ----
NM_001621chr722998 2908 1119 ----
NM_001642chr1131269 1255 315 ------
NM_001647chr3135 --1126 --
NM_001649chrX32430 848 674 ------
NM_001650chr181445 1120 ----
NM_001654chrX2365 143 ------
NM_001655chr111162 --1642 --
NM_001659chr1242145 125 117 87 ------
NM_001663chr142737 452 ------
NM_001664chr32783 348 ------
NM_001665chr11----1531 --
NM_001677chr141071 851 378 241 ------
NM_001679chr33690 538 319 ------
NM_001682chr1222348 1165 ------
NM_001683chr342390 1864 1042 298 --32384 1812 936 --
NM_001684chr144217 2804 1638 1432 23732 3717 ----
NM_001689chr211908 11525 1615 --
NM_001693chr851149 1086 1073 473 103 1821 ----
NM_001701chr91575 1500 11411 1352
NM_001706chr31970 ----1255
NM_001707chr71219 ------
NM_001709chr1152731 2629 2503 303 168 ------
NM_001729chr41368 ------
NM_001730chr1311546 ------
NM_001730chr1311546 ------
NM_001731chr12------1102
NM_001737chr51102 ------
NM_001742chr72651 61 ------
NM_001743chr21142 ------
NM_001746chr542489 2143 1911 923 ------
NM_001753chr731841 1767 1737 ------
NM_001755chr161283 1372 22055 1723 --
NM_001759chr1295039 4677 4450 3813 3719 3650 1022 924 317 13617 ----
NM_001777chr312889 11603 ----
NM_001781chr122376 267 --1243 --
NM_001788chr7--145 ----
NM_001791chr121370 319 ------
NM_001798chr1211007 ------
NM_001801chr51622 ------
NM_001819chr201232 ------
NM_001829chr41693 ------
NM_001839chr11300 ------
NM_001843chr121236 ------
NM_001855chr92862 570 ------
NM_001859chr973716 3214 3151 3101 2426 1161 312 --1528 --
NM_001884chr5180 ------
NM_001892chr5--21484 321 ----
NM_001895chr201799 21029 942 ----
NM_001901chr61333 ----1159
NM_001907chr16269 60 ------
NM_001921chr411124 1877 21025 802 --
NM_001924chr11368 ------
NM_001933chr143357 107 33 ------
NM_001936chr711317 ------
NM_001941chr1833603 2706 2679 --11096 --
NM_001945chr531153 436 241 --11037 --
NM_001946chr123260 243 205 --1807 --
NM_001949chr642308 498 442 69 12079 1422 --
NM_001955chr621070 992 ------
NM_001962chr52447 435 1491 --1499
NM_001964chr52829 317 --1236 --
NM_001967chr31584 ------
NM_001969chr1422616 1270 1110 ----
NM_001981chr1----12335 --
NM_001987chr1221154 901 34081 3750 861 --1235
NM_001991chr1732208 1681 863 --1149 --
NM_001995chr41201 ------
NM_001999chr521121 1029 ------
NM_002009chr1532500 884 612 ------
NM_002014chr121424 --1658 1461
NM_002015chr1363129 3104 2570 1153 938 445 ----12199
NM_002017chr1121376 1052 1215 ----
NM_002024chrX2679 436 ------
NM_002025chrX168953 8909 8682 8315 8071 7691 7115 7098 3436 3227 2735 1833 1663 1552 1511 823 --48672 8198 6772 6219 1608
NM_002031chr62571 135 ------
NM_002033chr1184086 3973 3016 2721 1399 1087 983 370 24043 3364 23675 2810 --
NM_002040chr2132561 2098 2013 1685 ----
NM_002044chr152222 161 ----11589
NM_002061chr111718 ------
NM_002069chr71447 ------
NM_002077chr942070 1385 779 358 ------
NM_002092chr434259 4081 1985 44132 3909 1561 799 14029 --
NM_002094chr161418 ------
NM_002111chr463519 1528 1093 262 153 117 1453 1613 --
NM_002126chr1732902 1540 754 --1278 1485
NM_002130chr52545 193 ------
NM_002135chr12153 145 ----
NM_002136chr122598 279 ------
NM_002137chr732347 1520 122 ------
NM_002138chr42249 223 ------
NM_002140chr92410 326 ------
NM_002148chr21595 ------
NM_002151chr191201 ------
NM_002158chr22890 177 ------
NM_002166chr21767 1572 ----
NM_002167chr1------1320
NM_002190chr63891 834 280 11003 ----
NM_002193chr211340 --1616 --
NM_002199chr41679 ------
NM_002202chr5--1932 ----
NM_002203chr532933 652 103 ------
NM_002211chr1021160 975 1179 ----
NM_002214chr734557 1668 1361 31755 1608 108 11317 11453
NM_002232chr13903 48 22 --167 --
NM_002235chr1231695 1423 240 ------
NM_002240chr212535 475 ------
NM_002247chr1032109 1517 257 11672 ----
NM_002251chr2042521 1809 1796 97 --130 --
NM_002252chr2----1420 --
NM_002254chr21616 ------
NM_002264chr344161 3914 3645 1105 --14397 --
NM_002267chr131105 1327 1139 --
NM_002270chr575603 4682 4480 4230 3823 1672 930 ------
NM_002271chr1332126 1786 613 12189 ----
NM_002285chr254173 4134 3429 1365 1091 12866 23224 3001 --
NM_002312chr132974 702 --1110 --
NM_002332chr12----2546 217 --
NM_002336chr1253847 3525 1878 283 110 13633 ----
NM_002349chr23505 368 175 11132 1671 --
NM_002351chrX21390 142 ------
NM_002356chr62533 367 ------
NM_002359chr1733304 1410 266 --21700 1169 --
NM_002372chr5------1189
NM_002374chr2--12365 --12707
NM_002375chr371843 1668 1582 661 528 308 265 1890 31747 833 728 187
NM_002376chr142471 199 ------
NM_002380chr81246 ------
NM_002383chr16----1318 1844
NM_002384chr181787 ----1148
NM_002387chr544775 2043 1863 75 14701 ----
NM_002390chr1731750 733 92 --2698 551 --
NM_002395chr621466 1098 ------
NM_002397chr521474 1442 --1878 --
NM_002398chr231057 314 166 2497 54 ----
NM_002399chr152531 317 154 ----
NM_002401chr1722099 588 --12255 --
NM_002404chr17184 ----2620 144
NM_002429chr1221032 604 ------
NM_002444chrX22002 1706 1121 ----
NM_002455chr1142 ------
NM_002470chr17182 ------
NM_002473chr2231384 1210 111 ------
NM_002479chr12276 155 ------
NM_002480chr1231379 1220 326 ------
NM_002499chr1532025 1785 924 ------
NM_002500chr22505 340 --1429 --
NM_002504chr92958 74 1344 ----
NM_002515chr1421378 642 --11584 --
NM_002519chr1121384 141 ------
NM_002522chr1732754 235 155 1938 ----
NM_002539chr2164 ------
NM_002544chr171356 ------
NM_002545chr1143958 660 492 481 24786 1374 13544 --
NM_002569chr1541572 1291 1262 225 --21156 595 --
NM_002576chr1111190 11166 ----
NM_002577chr333961 2595 470 ------
NM_002583chr122394 83 ------
NM_002586chr631179 1028 511 ------
NM_002588chr51707 --2351 127 --
NM_002594chr2011650 --2219 187 --
NM_002595chr1211681 ------
NM_002600chr121684 426 149 ----
NM_002607chr72937 853 ------
NM_002618chr2--1403 ----
NM_002623chr201148 1237 ----
NM_002634chr172801 246 --1873 --
NM_002641chrX32018 1361 470 42012 1630 715 700 ----
NM_002645chr1132972 956 564 ------
NM_002655chr874746 4440 4210 3975 3679 1995 1347 1755 14101 --
NM_002657chr2033649 2967 1014 ------
NM_002670chr331380 1034 43 ------
NM_002687chr141869 ------
NM_002693chr15----1341 --
NM_002698chr1932823 1002 87 1712 1309 --
NM_002699chr111168 ------
NM_002706chr2--1236 ----
NM_002709chr233595 1126 869 --12700 --
NM_002710chr121730 ------
NM_002713chr131020 137 92 ------
NM_002715chr51210 ------
NM_002717chr8----1193 --
NM_002731chr123104 1977 --11170 --
NM_002732chr91467 ------
NM_002734chr1732238 1889 56 --2282 46 --
NM_002737chr1765992 4877 2061 1874 1238 215 34826 1633 846 25597 1948 --
NM_002738chr162876 98 1266 ----
NM_002740chr3--22010 209 --12536
NM_002745chr2253944 3197 1427 920 362 23064 1057 1981 --
NM_002748chr15--1192 ----
NM_002752chr51100 ------
NM_002753chr4----155 --
NM_002822chr1231804 499 79 ------
NM_002825chr71523 ------
NM_002827chr2021767 77 --1261 --
NM_002828chr18--1273 ----
NM_002834chr1222954 1235 ------
NM_002835chr71504 ------
NM_002837chr1263983 3532 3242 485 367 71 13519 13198 --
NM_002839chr923025 2459 ------
NM_002840chr131184 1116 288 ------
NM_002841chr31465 ------
NM_002843chr1133083 921 63 1354 ----
NM_002844chr611294 2290 221 ----
NM_002845chr181630 ------
NM_002849chr123950 892 117 ------
NM_002869chr1111977 ------
NM_002874chr931870 1586 174 12417 ----
NM_002886chr355117 3544 3457 1419 639 14336 ----
NM_002890chr52130 39 ----1169
NM_002892chr1411734 ------
NM_002897chr21701 ------
NM_002906chr1142422 1887 1699 180 --1455 --
NM_002912chr61137 ------
NM_002924chr12479 216 ------
NM_002940chr431434 1293 91 1392 ----
NM_002941chr311548 1360 ----
NM_002942chr31304 ------
NM_002948chr3155 --11032 --
NM_002956chr1221255 341 ----11218
NM_002959chr144095 3964 958 671 --33928 3362 3108 --
NM_002970chrX171 ------
NM_002971chr31930 ------
NM_002977chr242873 2455 347 283 22759 668 22900 2766 183
NM_002994chr41262 ------
NM_002998chr81344 12216 1448 12130
NM_003009chr19----1260 --
NM_003010chr173644 138 106 ------
NM_003022chrX21287 967 --11013 --
NM_003029chr11420 ------
NM_003031chr161940 ------
NM_003034chr1298034 7527 7080 6793 6466 5361 2957 2872 1759 ------
NM_003037chr11100 ------
NM_003048chr24926 834 589 88 1138 ----
NM_003051chr111816 ------
NM_003060chr511242 ------
NM_003062chr5162 ------
NM_003068chr82690 209 ------
NM_003071chr321960 272 11352 ----
NM_003074chr332112 1410 761 1317 1133 --
NM_003077chr171596 ------
NM_003081chr2021027 56 ------
NM_003085chr51535 --1448 --
NM_003093chr6166 ------
NM_003106chr321013 783 ------
NM_003107chr632483 2126 1866 22570 2557 ----
NM_003108chr256497 5941 5774 5406 679 16907 12572 --
NM_003111chr2----1871 --
NM_003112chr7--13105 ----
NM_003127chr9158 ------
NM_003137chr622098 1728 ------
NM_003144chr6------188
NM_003150chr1721907 1515 ------
NM_003155chr842692 411 267 208 ------
NM_003156chr111262 ------
NM_003161chr1722711 2508 12466 12400 --
NM_003162chr21973 1337 ----
NM_003164chr111449 ------
NM_003173chrX31402 1283 995 ------
NM_003178chr332075 885 141 21502 1429 ----
NM_003183chr22816 776 ------
NM_003184chr83996 317 32 ------
NM_003188chr61281 ------
NM_003199chr1854881 4163 3887 3703 1418 ------
NM_003211chr1221305 1189 1390 ----
NM_003220chr6----11316 1576
NM_003221chr621610 511 11204 ----
NM_003234chr311489 ------
NM_003242chr332444 2077 858 11654 3544 188 27 --
NM_003244chr181352 ------
NM_003246chr151604 1375 ----
NM_003247chr6--2273 41 --11560
NM_003250chr172416 332 ------
NM_003253chr2141488 1178 600 145 --1479 11296
NM_003255chr1762621 2203 2029 1759 1710 756 ------
NM_003257chr152914 154 1181 ----
NM_003262chr354009 3344 3206 915 820 25220 4556 24699 3530 --
NM_003275chr921451 385 --123 --
NM_003292chr1--2608 108 ----
NM_003295chr13--1173 ----
NM_003304chr321063 248 ------
NM_003305chr4----1336 --
NM_003319chr22937 381 ----1730
NM_003320chr1152968 1314 1052 966 921 --13436 1240
NM_003330chr1241792 1432 464 271 --155 --
NM_003336chrX21113 915 ------
NM_003337chr521536 692 11573 11129 --
NM_003340chr43969 347 153 1564 ----
NM_003341chr3--1523 ----
NM_003342chr1733019 2473 2402 32140 442 153 12147 --
NM_003350chr81360 ------
NM_003367chr193550 402 88 ------
NM_003368chr11164 ------
NM_003369chr114907 857 598 444 ------
NM_003373chr1021793 475 --1703 11682
NM_003379chr641117 906 452 309 1939 11135 --
NM_003387chr232851 2570 391 ------
NM_003390chr11--1382 ----
NM_003392chr353472 2958 2857 1305 617 2960 367 12974 --
NM_003400chr21253 ------
NM_003403chr142831 70 ------
NM_003405chr221707 --1260 1723
NM_003406chr841532 776 483 143 --2321 66 --
NM_003410chrX11023 1225 11183 --
NM_003412chr32908 719 ------
NM_003441chr43494 412 332 ------
NM_003452chr91843 ----1369
NM_003453chr134629 292 140 51 ------
NM_003457chr171590 1649 ----
NM_003458chr393796 3583 2514 2486 1413 1361 612 581 411 --23468 3363 --
NM_003463chr641055 674 607 269 ----1308
NM_003468chr253499 3116 3069 2673 1340 --13955 --
NM_003471chr31255 ------
NM_003472chr611280 ----1191
NM_003474chr1032196 2051 1568 12114 11808 12119
NM_003478chr1131204 395 212 1898 --12244
NM_003483chr1222936 2059 ------
NM_003489chr2122861 1070 ------
NM_003557chr141400 1182 1151 321 ------
NM_003558chr9--1454 ----
NM_003566chr12--22980 240 --11207
NM_003567chr1------1326
NM_003583chr1232837 438 422 12498 1410 --
NM_003590chr273925 3832 3354 2805 2624 1505 542 13196 ----
NM_003591chr10----1271 --
NM_003607chr154216 3967 2986 829 240 --23741 1759 --
NM_003615chr322759 91 163 ----
NM_003626chr112881 465 ------
NM_003629chr112979 --32546 356 199 --
NM_003633chr532457 1647 694 ----11800
NM_003644chr1775993 5903 5424 5372 4941 2418 325 --52482 1455 613 246 69 11387
NM_003663chr321126 326 ------
NM_003670chr3----11139 --
NM_003671chr91232 ----13162
NM_003677chr1231652 1495 360 --11458 --
NM_003685chr193231 201 162 --1959 --
NM_003692chr9132 ------
NM_003693chr171557 ------
NM_003701chr131410 --1136 --
NM_003704chr41667 ------
NM_003714chr511101 12441 11909 --
NM_003716chr32956 52 --2197 102 --
NM_003718chr71182 ------
NM_003728chr42166 159 ------
NM_003735chr51707 --2351 127 --
NM_003736chr51707 --2351 127 --
NM_003740chr641811 1709 265 168 --11507 --
NM_003743chr2--12039 11677 --
NM_003744chr142829 472 ------
NM_003745chr16175 ------
NM_003749chr1321605 930 2379 38 ----
NM_003750chr102745 165 ----1199
NM_003759chr463302 2794 1625 1247 1082 755 21391 34 ----
NM_003762chr11370 11218 ----
NM_003766chr171463 1188 ----
NM_003768chr131461 500 277 --11157 --
NM_003783chr11968 11024 ----
NM_003787chr1821477 1247 1127 ----
NM_003795chr62103 79 ------
NM_003800chr611779 ------
NM_003812chr2------1238
NM_003816chr81475 ------
NM_003822chr153194 3051 2355 2167 1032 23125 2580 ----
NM_003825chr1511357 ------
NM_003829chr91788 2953 306 ----
NM_003831chr1821412 141 11191 ----
NM_003861chr1432802 2321 595 1434 ----
NM_003873chr10--21804 400 ----
NM_003877chr12125 1724 ----
NM_003884chr31255 ------
NM_003885chr1722349 2262 --12098 --
NM_003887chr22205 107 12052 1856 --
NM_003902chr11835 ------
NM_003908chr2011329 ------
NM_003913chr634356 1231 428 14096 ----
NM_003916chrX41302 1122 136 67 1454 ----
NM_003927chr181833 ------
NM_003931chr61617 ------
NM_003932chr2211720 ------
NM_003936chr21799 --1133 --
NM_003949chr1741904 1370 688 630 ----11634
NM_003954chr171477 ------
NM_003966chr557112 4987 1892 1091 70 --36819 884 783 --
NM_003972chr1021126 226 ------
NM_003980chr611389 ------
NM_003993chr11290 ------
NM_004006chrX22630 274 31930 1726 775 ----
NM_004007chrX22630 274 31930 1726 775 ----
NM_004009chrX22630 274 31930 1726 775 ----
NM_004010chrX22630 274 31930 1726 775 ----
NM_004011chrX22630 274 31930 1726 775 ----
NM_004012chrX22630 274 31930 1726 775 ----
NM_004013chrX22630 274 31930 1726 775 ----
NM_004014chrX22630 274 31930 1726 775 ----
NM_004015chrX22630 274 31930 1726 775 ----
NM_004016chrX22544 188 31844 1640 689 ----
NM_004017chrX22630 274 31930 1726 775 ----
NM_004018chrX22544 188 31844 1640 689 ----
NM_004020chrX22630 274 31930 1726 775 ----
NM_004021chrX22544 188 31844 1640 689 ----
NM_004022chrX22544 188 31844 1640 689 ----
NM_004023chrX22544 188 31844 1640 689 ----
NM_004028chr181445 1120 ----
NM_004037chr12120 89 --171 1133
NM_004055chr1142042 1957 820 50 --11885 --
NM_004056chr81756 ------
NM_004080chr721164 99 11439 ----
NM_004090chr1762636 1011 793 433 289 72 ------
NM_004093chr1363113 2528 2393 2024 582 281 ------
NM_004098chr1011310 ------
NM_004104chr174637 613 160 71 --1253 --
NM_004107chr19152 ------
NM_004124chr1422474 78 23362 3236 ----
NM_004130chr3--1597 ----
NM_004133chr822650 798 --1920 1870
NM_004134chr51480 ------
NM_004157chr33685 328 279 ------
NM_004161chr21409 --11040 --
NM_004162chr311208 ------
NM_004163chr181106 ------
NM_004171chr1179062 8571 8414 8059 6614 3831 3321 12089 52816 2229 2096 608 423 --
NM_004185chr11556 --1726 --
NM_004187chrX21352 506 ----1393
NM_004199chr5------145
NM_004200chr1122262 50 --11032 --
NM_004209chr1621154 928 --2800 440 --
NM_004211chr111167 ------
NM_004227chr762365 2255 1180 544 285 162 ----1413
NM_004229chrX22111 643 ------
NM_004235chr91712 ------
NM_004238chr21273 ------
NM_004240chr19173 ------
NM_004241chr101314 ------
NM_004242chr62313 158 ------
NM_004255chr151130 ------
NM_004261chr1----1357 --
NM_004272chr531794 693 236 ------
NM_004273chr1095076 4759 4601 1575 1018 721 695 307 22 14561 ----
NM_004274chr1452768 2639 2624 2209 608 ------
NM_004276chr122328 267 ------
NM_004279chr721638 692 ------
NM_004293chr923429 660 12755 1849 --
NM_004296chr1454021 3208 2556 1513 697 ------
NM_004301chr31344 ------
NM_004302chr1241867 707 698 166 2799 596 1600 --
NM_004311chr1033001 2649 2619 ----12887
NM_004319chr13887 331 219 --22905 844 --
NM_004321chr233309 3262 1368 ----33466 3249 138
NM_004326chr121162 98 --1913 --
NM_004329chr102942 533 ------
NM_004338chr1896008 5824 4779 2595 2105 1803 1729 1306 958 36670 4830 4815 ----
NM_004342chr72561 141 --1235 --
NM_004349chr821230 1178 ------
NM_004356chr111444 1531 ----
NM_004362chr41567 2691 63 ----
NM_004368chr1921059 875 --2968 376 --
NM_004369chr21111 ------
NM_004370chr621904 1616 --1494 1335
NM_004379chr21108 ------
NM_004380chr1652556 2246 1001 782 314 ----1700
NM_004383chr151535 --1494 --
NM_004389chr2197 ------
NM_004392chr1322402 26 --12338 --
NM_004393chr342133 1949 806 292 ------
NM_004397chr1123257 882 21647 920 ----
NM_004408chr92383 188 ------
NM_004411chr71169 1632 ----
NM_004412chr1085136 5068 4357 4307 3976 3728 1363 155 35422 4958 3928 15944 1809
NM_004416chr124370 312 295 280 1174 ----
NM_004417chr5----148 --
NM_004423chr322195 994 --1686 1585
NM_004428chr12796 640 ------
NM_004430chr8--12210 1661 --
NM_004431chr1----2707 75 --
NM_004432chr952189 2004 1863 1835 1677 ------
NM_004434chr1411351 11759 ----
NM_004438chr222484 52 --1435 12418
NM_004441chr311332 ------
NM_004447chr123727 130 52 ------
NM_004450chr14----1363 --
NM_004454chr322111 630 ----1902
NM_004457chr22592 70 11378 ----
NM_004459chr1711534 ------
NM_004460chr21221 ------
NM_004463chrX----152 --
NM_004469chrX146 ------
NM_004472chr51215 ------
NM_004484chrX1145 --1298 --
NM_004496chr141140 1884 138 --
NM_004498chr15------1368
NM_004499chr52111 38 ------
NM_004500chr1442019 1555 140 108 1519 ----
NM_004501chr153766 3083 2504 1432 840 1954 1832 --
NM_004504chr231917 751 528 1799 ----
NM_004505chr1711648 --1808 --
NM_004512chr92250 240 ------
NM_004525chr21161 1500 ----
NM_004560chr91669 1823 --1344
NM_004566chr1022509 1639 --1147 --
NM_004571chr2142467 2392 1028 679 --12596 --
NM_004586chrX43917 1955 515 342 15169 ----
NM_004588chr1143446 897 731 618 12564 1203 --
NM_004593chr31670 ------
NM_004602chr2011063 ----1421
NM_004603chr7----1130 --
NM_004612chr964558 3760 617 562 371 181 14397 ----
NM_004613chr2031565 385 78 --11200 --
NM_004631chr141176 972 45 24 ------
NM_004654chrY135 ------
NM_004660chrY--21999 798 ----
NM_004661chr5160 --11212 --
NM_004663chr1511541 1197 1126 --
NM_004666chr621223 1206 ----11268
NM_004673chr121293 561 ------
NM_004685chr1322776 1201 22585 619 ----
NM_004687chr1711315 ------
NM_004697chr91111 ----1144
NM_004708chr19191 ------
NM_004717chr72577 358 ----1138
NM_004719chr1222417 940 --12317 11008
NM_004725chr1021281 28 ------
NM_004726chrX54737 4481 1789 1604 1061 34824 1292 554 ----
NM_004737chr222220 34 --195 --
NM_004738chr2042122 1976 401 76 ----11626
NM_004739chr112228 181 --2408 190 --
NM_004741chr1041523 1489 1185 459 ------
NM_004742chr331463 1262 80 ----11682
NM_004745chr884573 4415 2659 2619 2513 1815 1503 1122 12757 16026 --
NM_004747chr1021157 372 ------
NM_004748chr1541562 1224 923 428 ------
NM_004755chr1421246 55 ------
NM_004768chr121138 382 ------
NM_004772chr53625 581 462 ------
NM_004774chr1732947 2102 363 ------
NM_004776chr2042997 2721 2267 630 1803 ----
NM_004781chr141681 1132 385 144 11435 ----
NM_004781chr141681 1132 385 144 11435 ----
NM_004784chr42129 35 ------
NM_004788chr1132597 945 862 12547 11836 --
NM_004796chr141432 ------
NM_004798chr2083026 2920 2766 2720 2476 879 825 571 --1776 1790
NM_004801chr21164 ------
NM_004808chr1032289 1215 421 22859 1250 ----
NM_004815chr123978 1554 44872 4491 4455 3608 --13082
NM_004816chr91594 ------
NM_004834chr233107 2239 380 12268 12448 --
NM_004836chr2164 ------
NM_004840chrX22260 596 --12221 --
NM_004841chr11234 ------
NM_004842chr62499 283 1633 124 --
NM_004844chr3--187 ----
NM_004845chrX94051 4003 3520 3354 3162 2607 1626 1015 31 11462 ----
NM_004849chr6--159 --1147
NM_004858chr122214 28 ------
NM_004859chr1742422 2283 600 463 12169 --12196
NM_004866chr554960 3841 1323 1225 393 34781 1561 221 ----
NM_004867chrX199 ------
NM_004887chr541058 993 939 290 11095 ----
NM_004893chr5132 ------
NM_004898chr41668 12307 --1401
NM_004904chr731714 1054 48 --24613 1484 --
NM_004912chr711133 ------
NM_004922chr101178 ------
NM_004924chr193426 397 90 --1313 --
NM_004926chr1431628 1199 258 ------
NM_004929chr831282 561 215 ------
NM_004938chr931092 832 487 ------
NM_004939chr2--1129 ----
NM_004947chr34742 628 299 170 1492 ----
NM_004952chr12796 351 ------
NM_004956chr733900 1142 325 24565 807 --11253
NM_004969chr101206 1585 ----
NM_004973chr621126 648 ------
NM_004976chr1164961 4781 1970 1676 1422 618 --23976 1258 --
NM_004978chr151680 1666 1635 413 194 --2636 380 --
NM_004979chrX3921 305 126 ------
NM_004985chr1231082 491 114 1778 ----
NM_004992chrX98080 8020 7492 5951 5780 3183 2168 2162 348 --16924 11678
NM_004992chrX98080 8020 7492 5951 5780 3183 2168 2162 348 --16924 11678
NM_004993chr141277 --11313 --
NM_004999chr633507 1726 1390 ------
NM_005006chr22425 218 --1137 --
NM_005010chr711885 ------
NM_005011chr741747 1479 1265 516 --1555 --
NM_005023chr521478 66 ------
NM_005028chr1021771 1533 --11549 --
NM_005038chr41153 1168 1485 --
NM_005044chrX44514 4304 1695 395 --13203 --
NM_005045chr7----1997 --
NM_005054chr231111 444 266 11554 ----
NM_005056chr1254300 3508 1122 476 435 ------
NM_005065chr1455188 3715 3459 1441 1228 15123 11406 --
NM_005080chr222967 295 ------
NM_005087chr31683 ------
NM_005096chrX2937 789 --21205 56 1462
NM_005099chr121116 971 187 21292 1062 --
NM_005102chr22782 307 ------
NM_005103chr11180 ------
NM_005110chr53835 767 140 --1593 --
NM_005112chr41752 168 199 --
NM_005114chr42671 565 ------
NM_005116chr2033708 954 467 --24145 1352 23203 1748
NM_005121chr1711027 33594 1543 1444 ----
NM_005124chr61995 ------
NM_005134chr182817 671 ------
NM_005153chr161664 ------
NM_005156chr945379 4423 3634 3337 ----13595
NM_005164chr1232571 2044 1016 ------
NM_005168chr2--1233 11782 --
NM_005180chr1021213 601 162 --1482
NM_005182chr163643 489 445 ----158
NM_005188chr1197458 6368 6241 5996 2917 2826 2245 1701 566 11091 48324 6830 6738 925 11649
NM_005197chr1475685 5619 4365 2133 1915 1642 677 153 22024 1410 --
NM_005201chr31169 2246 49 ----
NM_005204chr10--1630 ----
NM_005214chr21415 ------
NM_005221chr71273 ------
NM_005229chrX1102 --149 --
NM_005231chr111348 1192 --2880 536
NM_005233chr332460 2059 678 ------
NM_005235chr2107519 7500 6773 6171 6109 5360 4843 2086 1988 1529 27460 843 --1400
NM_005241chr311347 ------
NM_005243chr221256 ------
NM_005245chr41588 ------
NM_005249chr142852 311 ------
NM_005252chr143576 525 173 ------
NM_005254chr1511063 ------
NM_005256chr111835 ------
NM_005259chr2--11063 --1560
NM_005277chr421484 325 ------
NM_005281chr1------1326
NM_005296chrX155 1668 ----
NM_005308chr101439 ------
NM_005324chr1721793 670 --12123 --
NM_005328chr8--1526 1301 --
NM_005339chr443105 2949 1701 451 1277 13750 --
NM_005359chr1835462 5393 470 --12234 16387
NM_005370chr1911268 ------
NM_005375chr62754 463 ------
NM_005385chr322155 745 1199 ----
NM_005386chr201745 ----1350
NM_005387chr11------1645
NM_005400chr21514 1618 1120 --
NM_005402chr741673 700 677 597 21348 1315 --11615
NM_005406chr182576 69 ------
NM_005415chr21750 ------
NM_005417chr2031896 1536 701 ------
NM_005429chr42351 134 ----1100
NM_005436chr1033930 3658 1401 12823 33382 2742 605 --
NM_005442chr31573 ------
NM_005445chr10--1255 ----
NM_005455chr131514 626 219 ------
NM_005458chr92773 624 --1794 --
NM_005461chr2021389 655 ------
NM_005465chr141575 1274 514 231 11280 ----
NM_005467chr11--1107 ----
NM_005493chr6--1695 ----
NM_005499chr191452 ------
NM_005501chr173946 151 68 ------
NM_005502chr952846 734 614 543 63 --1438 1434
NM_005503chr151987 ------
NM_005504chr1226434 1181 1157 14578 --
NM_005507chr11----1338 --
NM_005509chr511899 ----183
NM_005512chr1111539 ------
NM_005519chr101118 ------
NM_005520chr53484 91 49 ------
NM_005522chr72952 70 1333 ----
NM_005527chr61138 ------
NM_005539chr10------11083
NM_005544chr21807 ------
NM_005561chr132615 148 ------
NM_005563chr11825 ------
NM_005566chr112416 351 ------
NM_005573chr52548 179 ------
NM_005596chr976455 6423 6126 4772 4179 4029 1487 --14890 25097 1219
NM_005604chr621906 433 ------
NM_005607chr82828 665 ------
NM_005613chr172144 2110 787 699 132 120 43 1348 ----
NM_005618chr6165 ------
NM_005626chr1--2389 88 ----
NM_005629chrX--11365 ----
NM_005637chr1811817 --21908 1390 --
NM_005638chrX21760 62 11429 1146 --
NM_005639chr1221629 100 ------
NM_005648chr8--1228 ----
NM_005650chr222150 108 ----21147 161
NM_005656chr2141559 1355 1321 68 ------
NM_005662chr81326 ------
NM_005665chr133643 993 695 13226 ----
NM_005668chr51998 --1946 11083
NM_005670chr61375 ------
NM_005708chr13------192
NM_005717chr11919 ------
NM_005722chr241694 1685 792 347 ------
NM_005725chr142388 2030 636 545 12406 ----
NM_005733chr51210 ------
NM_005737chr242420 1890 1808 811 ------
NM_005738chr71707 ------
NM_005744chr15155 ------
NM_005746chr71186 ------
NM_005748chr1233157 99 44 22693 63 ----
NM_005751chr71195 ------
NM_005752chr1621201 216 --1477 --
NM_005754chr51944 ------
NM_005759chr234538 3659 2919 14053 ----
NM_005779chr533204 3135 569 12399 22413 965 13220
NM_005789chr1731997 1712 1524 11782 --11623
NM_005795chr232833 2100 1924 --1228 --
NM_005796chr16189 ------
NM_005801chr172719 154 --1177 --
NM_005802chr91634 ------
NM_005808chr373358 2920 2643 2574 1064 624 105 13260 22704 135 --
NM_005815chr192309 293 ------
NM_005819chr132881 395 352 --22311 243 --
NM_005822chr6145 --1549 --
NM_005840chrX56481 3023 963 742 689 16440 22034 1413 --
NM_005842chr132230 152 ------
NM_005851chr111407 ------
NM_005859chr521279 629 ------
NM_005862chr331022 902 712 ------
NM_005868chr722149 334 ------
NM_005871chr101709 ------
NM_005875chr31313 ------
NM_005876chr21770 ------
NM_005885chr521668 40 1353 ----
NM_005895chr1273674 3057 2768 2563 747 646 23 ----1704
NM_005901chr1878730 8567 7912 7283 2587 1399 879 --12974 --
NM_005903chr565118 1448 1186 534 274 232 24421 645 ----
NM_005904chr182963 94 ------
NM_005909chr563279 3004 1117 811 743 269 ------
NM_005911chr221377 244 ------
NM_005917chr21170 ------
NM_005924chr711113 ------
NM_005930chr14--1310 ----
NM_005933chr1122312 1011 1748 22688 763 --
NM_005935chr455041 4187 4101 1361 1218 14946 ----
NM_005938chrX1431 ------
NM_005941chr823572 1473 ------
NM_005955chr133862 3760 2041 --12132 --
NM_005962chr1051862 814 746 623 573 ----1652
NM_005962chr1051862 814 746 623 573 ----1652
NM_005964chr172377 139 11015 1603 --
NM_005986chr1311839 1825 ----
NM_005999chr131612 278 222 1458 ----
NM_006007chr964413 2788 1770 1484 286 205 11437 --14195
NM_006009chr121130 ------
NM_006022chr132284 247 1134 ----
NM_006034chr111200 --132 --
NM_006036chr252118 762 645 227 194 --11913 --
NM_006038chr202728 113 12129 ----
NM_006043chr162746 736 ------
NM_006048chr11264 ------
NM_006055chr232010 1141 922 ------
NM_006062chr21182 ------
NM_006090chr12249 208 ------
NM_006091chr15--1178 ----
NM_006095chr464430 3441 1690 1145 626 574 2986 306 ----
NM_006106chr1133383 3017 2427 1380 ----
NM_006133chr1152337 2040 1976 1517 693 12353 ----
NM_006135chr11452 11274 ----
NM_006136chr711014 ------
NM_006141chr1632030 1896 713 2189 90 ----
NM_006142chr12466 448 ------
NM_006154chr1551945 1876 1104 863 210 11965 ----
NM_006158chr831561 1317 1245 ------
NM_006159chr121232 ------
NM_006160chr1711065 ------
NM_006161chr51473 ------
NM_006164chr21103 ------
NM_006166chr1262623 2561 2051 1787 1651 662 ------
NM_006167chr81536 1632 ----
NM_006182chr1122 --169 176
NM_006186chr211300 --1358 --
NM_006191chr121927 ------
NM_006194chr14--1962 ----
NM_006195chr921165 33 ------
NM_006203chr584658 2175 1317 1221 1197 1171 1016 21 272 65 15507 1187
NM_006206chr421119 441 ------
NM_006209chr81134 ------
NM_006218chr31244 ------
NM_006224chr1722327 983 --12227 --
NM_006239chr42504 82 ------
NM_006245chr62846 194 1991 1677 --
NM_006256chr132245 957 344 ------
NM_006258chr10--21585 524 ----
NM_006265chr8160 ------
NM_006277chr23167 118 93 ------
NM_006283chr844970 1439 1399 128 ------
NM_006306chrX65557 5018 3921 1326 1196 1036 --45007 4963 3937 1849 --
NM_006310chr17--182 ----
NM_006317chr51687 ------
NM_006320chr4----1953 --
NM_006321chr351535 700 613 201 70 ------
NM_006322chr133175 128 90 ------
NM_006328chr112127 115 ------
NM_006330chr82436 390 1126 170 --
NM_006334chr9293 55 ------
NM_006335chr12976 424 ------
NM_006336chr9158 ------
NM_006357chr22527 411 ------
NM_006359chrX32140 1667 87 ------
NM_006361chr1721659 198 --11943 --
NM_006369chr1127 ------
NM_006379chr7--1191 ----
NM_006380chr1732849 409 72 13186 ----
NM_006386chr222370 156 --12095 --
NM_006390chr1231634 1395 327 ------
NM_006393chr1054283 2966 1732 1354 664 1774 23965 3237 --
NM_006401chr92399 170 ------
NM_006405chr14145 ------
NM_006420chr20--2286 51 13457 --
NM_006421chr81241 ------
NM_006434chr1063160 3154 2752 2592 2393 995 --12623 --
NM_006454chr463066 2943 2817 2402 2384 699 --12849 12969
NM_006457chr442716 1303 1290 222 32549 1568 898 13251 --
NM_006459chr1021878 485 --1800 --
NM_006469chr131078 497 146 ------
NM_006476chr11160 ------
NM_006482chr1232837 438 422 12498 1410 --
NM_006489chr1421378 642 --11584 --
NM_006494chr191558 --271 43 --
NM_006496chr11453 ------
NM_006510chr641033 169 142 106 --1893 --
NM_006513chr11210 ------
NM_006527chr42667 125 ------
NM_006540chr821165 617 --1352 1309
NM_006542chr1130 ------
NM_006549chr1242854 825 817 80 1295 1978 --
NM_006557chr911166 ------
NM_006560chr11178 ------
NM_006561chr1086017 5932 5629 2224 1380 267 85 56 25430 4988 11327 --
NM_006565chr161306 1487 ----
NM_006572chr1753489 3277 3245 2775 2474 ------
NM_006574chr31133 ------
NM_006575chr1421464 368 ----1953
NM_006589chr11373 ------
NM_006593chr21606 ------
NM_006595chr111777 ------
NM_006599chr1687509 6122 5735 5333 3091 2480 1419 158 15443 12447 --
NM_006603chrX3688 278 120 --11407 --
NM_006614chr332232 1424 97 13009 ----
NM_006621chr121892 1271 --11657 11329
NM_006624chr1012035 ------
NM_006625chr1--1988 ----
NM_006625chr1--1988 ----
NM_006625chr1--1988 ----
NM_006626chr911095 --1613 --
NM_006628chr1544605 4474 3633 1012 14115 33724 3589 1151 --
NM_006640chr1741851 1692 1632 130 --11181 --
NM_006646chr131602 ----12094
NM_006650chr553796 3624 1153 903 381 --23156 2616 1826
NM_006654chr1264763 4003 3203 679 317 270 ----14322
NM_006670chr61523 ------
NM_006675chr1243399 2178 1033 694 --13147 --
NM_006690chr2021623 622 --11839 1290
NM_006698chr2021285 591 ------
NM_006717chr922850 2646 11290 ----
NM_006722chr331931 344 119 ------
NM_006727chr5----150 --
NM_006729chrX65221 5099 2116 1959 1371 887 14093 24236 4100 --
NM_006734chr621637 92 ------
NM_006735chr71334 ------
NM_006741chr1221082 969 --1723 --
NM_006746chrX21086 279 11444 ----
NM_006748chr841378 1224 236 26 ------
NM_006754chr72893 784 ------
NM_006756chr821279 968 ------
NM_006763chr141915 483 39 33 ------
NM_006766chr8------12593
NM_006775chr622115 462 22698 2164 2851 53 --
NM_006777chrX32474 565 363 ------
NM_006788chr1842079 1866 1852 48 --11887 --
NM_006791chr151475 ------
NM_006805chr521310 538 --1460 --
NM_006807chr17----1960 --
NM_006813chr61182 --1761 --
NM_006815chr1211376 11300 ----
NM_006823chr811130 11400 ----
NM_006825chr124714 633 155 75 ------
NM_006826chr22971 845 --1455 --
NM_006827chr1453046 3028 673 410 63 --12639 --
NM_006832chr142932 365 ------
NM_006838chr1251829 1748 1506 124 107 ------
NM_006839chr2--138 ----
NM_006852chr172924 301 ----1969
NM_006854chr7--11988 ----
NM_006861chr1241780 1453 118 93 ----1463
NM_006870chr202298 34 ------
NM_006874chr42835 159 ------
NM_006875chrX1910 ----159
NM_006885chr1611537 12975 22979 173 12929
NM_006888chr1442916 1359 602 316 ------
NM_006899chr202328 257 ------
NM_006901chr151535 ------
NM_006902chr141073 1056 905 417 12164 ----
NM_006908chr721071 997 ------
NM_006912chr142372 421 304 116 ------
NM_006920chr242003 591 574 428 1506 ----
NM_006927chr162303 91 11691 ----
NM_006930chr531718 1425 1390 141 ----
NM_006939chr14--1741 ----
NM_006943chr203541 155 129 --23282 2301 --
NM_006948chr2111961 ------
NM_006951chr102632 261 ------
NM_006965chr1821021 241 ------
NM_006982chr121202 ------
NM_006990chr122446 1839 --21928 557 --
NM_006991chr32889 158 ------
NM_006993chr10339 29 22 ------
NM_007005chr9----11078 --
NM_007008chr22180 141 ------
NM_007011chr1576659 5336 4697 4164 2207 2157 134 ----15977
NM_007013chr81405 ------
NM_007026chr171579 ------
NM_007038chr2164847 4698 4423 4107 983 98 --12313 --
NM_007040chr191402 ------
NM_007050chr20107545 7274 7179 6755 5777 5768 5739 3078 1509 1334 45578 5479 1324 1053 ----
NM_007054chr543388 2844 2416 47 --13899 --
NM_007067chr1721303 313 11272 ----
NM_007073chr653954 3763 3575 1594 1149 11040 21585 225 13424
NM_007106chr1332624 910 46 ------
NM_007107chr31717 --12385 --
NM_007111chr13----1694 --
NM_007123chr12428 141 1343 ----
NM_007124chr63644 544 228 ----11689
NM_007126chr91462 ------
NM_007135chr92172 40 ------
NM_007146chr1752442 1847 1838 1056 926 ------
NM_007159chr321127 58 11572 ----
NM_007174chr1211770 ------
NM_007181chr191135 ------
NM_007197chr1211006 ------
NM_007203chr963487 3434 3096 2923 2632 1587 1640 12815 --
NM_007207chr11655 ------
NM_007212chr121662 597 ------
NM_007216chr113953 363 53 ------
NM_007221chr12399 62 ------
NM_007222chr811327 ------
NM_007236chr1551842 1763 1673 937 397 1317 ----
NM_007246chr421050 982 ------
NM_007247chr1711048 ------
NM_007249chr1388321 8181 7898 7485 6817 6352 2901 257 12253 27466 614 --
NM_007259chr12498 428 ------
NM_007260chr11742 ------
NM_007285chr16--1421 ----
NM_007294chr171159 ------
NM_007295chr171159 ------
NM_007296chr171159 ------
NM_007297chr171159 ------
NM_007298chr171159 ------
NM_007299chr171159 ------
NM_007300chr171159 ------
NM_007302chr171159 ------
NM_007303chr171159 ------
NM_007304chr171159 ------
NM_007305chr171159 ------
NM_007308chr42617 464 ------
NM_007325chrX1364 ------
NM_007347chr1543089 2427 979 552 ------
NM_007349chr7289 25 ------
NM_007358chr12634 280 ------
NM_007363chrX2972 733 ------
NM_007373chr10--1244 ----
NM_007375chr121777 626 ------
NM_012081chr523381 3093 ------
NM_012082chr81962 ------
NM_012084chrX1551 ------
NM_012090chr111080 ------
NM_012093chr13876 264 180 1944 ----
NM_012096chr343586 3564 1011 921 --13206 --
NM_012098chr921492 222 --11445 --
NM_012105chr21--1279 ----
NM_012115chr61613 ------
NM_012120chr622872 633 ------
NM_012129chr731943 1636 774 1562 ----
NM_012134chr11297 --11301 --
NM_012137chr132855 1848 1045 12710 ----
NM_012156chr2033389 3021 2944 --13367 --
NM_012161chr441188 1161 401 56 ----1290
NM_012164chr975960 2800 2405 1999 1520 1279 630 1205 24575 670 --
NM_012180chr41583 ------
NM_012188chr5--2868 35 --166
NM_012193chr1185298 4625 4558 4309 1847 1688 945 788 15208 14775 --
NM_012197chr931130 1059 627 ------
NM_012199chr144393 1064 332 211 --11311 --
NM_012200chr111364 ------
NM_012210chr931063 453 313 ----11119
NM_012214chr236419 2305 1849 --35091 2440 2204 --
NM_012215chr1021974 1875 ------
NM_012218chr1942132 2048 885 690 183 12965 --
NM_012234chr362971 2743 1122 971 658 307 23539 2436 168 --
NM_012238chr10--159 ----
NM_012239chr11174 ------
NM_012243chr12294 103 ------
NM_012244chr1411217 --1208 --
NM_012249chr233132 2764 2606 33565 1403 765 ----
NM_012250chr112255 112 ------
NM_012252chr75826 675 480 55 44 12091 ----
NM_012255chr20----1325 --
NM_012257chr71781 ------
NM_012259chr611422 --11145 1531
NM_012261chr203597 495 461 --2220 153 --
NM_012262chr154670 3993 3809 1553 477 12109 ----
NM_012268chr191231 ------
NM_012278chrX----1139 --
NM_012281chr732465 1795 1548 21953 484 ----
NM_012287chr344287 837 380 348 14542 ----
NM_012290chr231136 622 272 ------
NM_012294chr764110 3444 2548 1607 1455 643 --23902 575 2198 61
NM_012296chr1123296 1166 --1239 --
NM_012297chr421859 282 ------
NM_012300chr522516 1821 ------
NM_012301chr732102 1888 1387 ------
NM_012302chr11922 ------
NM_012307chr182350 40 --1844 --
NM_012308chr1142411 2353 2227 842 --22283 519 --
NM_012309chr1154452 4385 4109 679 189 24656 3905 14531 --
NM_012316chr185475 4943 4631 4590 4116 3545 2137 272 24849 2164 11987 --
NM_012317chrX1659 ------
NM_012319chr18185 ------
NM_012325chr2021446 264 ------
NM_012327chr1831380 616 353 ------
NM_012330chr102454 395 11541 ----
NM_012333chr12585 577 ------
NM_012334chr584083 3773 3717 1675 1339 1049 965 246 --178 --
NM_012338chr72312 138 1169 ----
NM_012345chr131165 ------
NM_012347chr61316 ------
NM_012382chr534410 4394 3277 13444 13587 --
NM_012384chr2022410 976 --1416 11518
NM_012396chr13706 248 108 132 ----
NM_012399chr2211536 ------
NM_012402chr112863 423 ------
NM_012406chr1241197 1136 1112 289 ------
NM_012412chr71612 ----1710
NM_012428chr154936 845 301 130 ------
NM_012448chr1722502 354 ----11659
NM_012454chr6--1498 ----
NM_012460chr141104 ------
NM_012463chr122693 50 ------
NM_012471chrX11590 1389 2498 313 --
NM_012475chr12219 191 ------
NM_012479chr721946 252 12240 ----
NM_013231chr1444077 3463 1577 695 --24342 2899 --
NM_013233chr2135 ------
NM_013246chr112383 240 172 ----
NM_013257chr852036 1764 1719 748 426 ------
NM_013261chr463624 3498 3381 3142 1154 892 ------
NM_013269chr1233429 1468 325 ------
NM_013283chr52682 177 ------
NM_013308chr31375 ------
NM_013309chr1512101 --12307 --
NM_013341chr222001 1133 22387 303 ----
NM_013354chr821196 44 ------
NM_013357chr8--1840 ----
NM_013374chr3--22441 1081 ----
NM_013380chr193685 271 260 ------
NM_013381chr121384 ------
NM_013386chr1--1363 ----
NM_013390chr941532 1144 536 168 ------
NM_013396chr211256 ------
NM_013433chr191690 --1207 --
NM_013434chr221918 482 ------
NM_013434chr221918 482 ------
NM_013437chr8--11105 ----
NM_013438chr911702 ------
NM_013448chr14169 ------
NM_013449chr1252616 755 519 509 355 ------
NM_013450chr21989 ------
NM_013986chr221256 ------
NM_013989chr1484403 4082 3598 3553 984 545 475 316 ----14642
NM_013995chrX32536 2521 2274 11870 ----
NM_014000chr1021793 475 --1703 11682
NM_014007chr91372 --11249 --
NM_014021chr113406 21080 571 ----
NM_014023chr1032805 2194 253 1669 12552 --
NM_014059chr13------1240
NM_014106chr1532340 1877 1009 22724 344 12227 --
NM_014109chr82868 62 ------
NM_014110chr131020 137 92 ------
NM_014112chr843503 1790 1587 542 14026 ----
NM_014117chr1652132 1951 752 596 472 12075 129 --
NM_014141chr775287 4718 4706 4623 4493 4031 3567 14636 14122 1578
NM_014155chr1146689 5077 4611 1392 ------
NM_014191chr123681 664 407 ------
NM_014217chr121899 52 ------
NM_014221chrX126 ------
NM_014231chr1241968 1550 710 48 --11520 --
NM_014232chr172431 330 --11646 --
NM_014232chr172431 330 --11646 --
NM_014233chr1722143 81 11485 ----
NM_014240chr353663 3460 3119 869 324 13586 ----
NM_014241chr101295 ------
NM_014245chr32903 364 ------
NM_014263chr1021395 963 ------
NM_014271chrX----1193 --
NM_014280chr1----1630 --
NM_014284chr11378 ------
NM_014294chr81132 --11317 --
NM_014296chr321213 613 11458 ----
NM_014299chr1951691 1583 675 589 162 ------
NM_014309chr2295342 4967 4393 4208 3790 1756 875 534 294 --1281 --
NM_014325chr1241735 1618 1514 342 ------
NM_014329chr161274 --1224 --
NM_014333chr1122328 636 --1862 --
NM_014335chr1511027 ------
NM_014345chr61299 ------
NM_014351chr22125 --1210 --
NM_014352chr1141483 1257 1132 63 --1260 --
NM_014363chr13----11044 --
NM_014368chr932111 1958 1838 ------
NM_014372chr121944 578 ------
NM_014376chr552495 1900 641 458 165 --2426 186 --
NM_014382chr32710 520 11170 11564 --
NM_014393chr81163 1103 ----
NM_014408chr12491 180 ------
NM_014410chr18--1318 ----
NM_014417chr19199 ------
NM_014423chr534634 4180 1399 1164 ----
NM_014432chr62235 171 ----11042
NM_014445chr32885 127 ----1830
NM_014447chr411493 ------
NM_014452chr611068 ------
NM_014456chr1031449 409 268 ------
NM_014470chr122589 296 --1556 --
NM_014472chr101701 ------
NM_014491chr72877 348 ------
NM_014494chr1642133 1951 894 166 1233 22265 501 --
NM_014503chr121460 ------
NM_014507chr221783 1236 11197 --
NM_014516chr19141 ------
NM_014521chr251767 1272 627 145 58 11378 ----
NM_014548chr151546 11060 ----
NM_014554chr1232061 1602 32 ------
NM_014586chr2113108 24419 667 ----
NM_014587chr1621462 1083 ------
NM_014591chr1031378 1190 896 --142 --
NM_014592chr53789 738 254 ----1591
NM_014600chr241615 1538 1280 159 --11190 --
NM_014603chr1731369 1091 585 --11053 --
NM_014612chr911106 1397 ----
NM_014613chr542209 2066 968 630 --1178 --
NM_014614chr211360 ------
NM_014615chr1651231 1118 1064 387 119 12681 1396 13408
NM_014616chr333062 1056 836 ------
NM_014630chr1553516 2688 1608 906 600 1807 ----
NM_014635chr231074 408 230 11526 ----
NM_014636chr913360 13987 --1895
NM_014660chr71331 ------
NM_014661chr1063780 3545 3376 3346 1176 961 --43515 3263 643 497 12815
NM_014663chr12840 287 ------
NM_014665chr833552 2856 768 --11362 --
NM_014666chr511262 ------
NM_014667chr32437 135 1530 ----
NM_014670chr241549 457 187 57 ------
NM_014671chr72596 234 ------
NM_014677chr841123 956 296 90 1380 ----
NM_014683chr1721729 381 --11988 --
NM_014685chr161206 ------
NM_014686chr1942340 1947 782 266 ------
NM_014705chr711321 11555 ----
NM_014707chr711830 ----1523
NM_014709chr2----152 --
NM_014711chr163833 501 251 ------
NM_014718chr123778 711 211 ------
NM_014720chr1021126 202 ------
NM_014721chr6135857 5783 5094 4577 2618 2036 1950 1854 1716 747 726 704 655 ----14939
NM_014727chr191253 ------
NM_014729chr821929 167 ------
NM_014730chr1241745 1301 1225 1187 --25228 3842 --
NM_014730chr1241745 1301 1225 1187 --25228 3842 --
NM_014731chr202269 33 ------
NM_014733chr511622 42233 2154 398 327 --12121
NM_014735chrX21814 579 11595 ----
NM_014742chr2021771 1292 11298 ----
NM_014746chr274127 4040 3939 3311 1737 359 307 --24047 549 --
NM_014747chr154421 4374 4266 624 113 --55068 3656 1311 828 59 --
NM_014752chr111327 ------
NM_014754chr81865 --1904 --
NM_014755chr234155 1639 1516 11049 125 --
NM_014756chr111114 ------
NM_014762chr142551 2229 1889 676 ------
NM_014764chr121172 ------
NM_014765chr132626 2236 881 ------
NM_014767chr1012798 --22779 1317 --
NM_014770chr121322 --1503 --
NM_014772chr1833062 2341 455 ------
NM_014779chr32310 173 --198 --
NM_014781chr81490 ------
NM_014786chr113897 382 326 ------
NM_014795chr2294 87 --11411 --
NM_014797chr612588 --12452 --
NM_014800chr731166 318 22 ------
NM_014803chr1031158 1004 812 ------
NM_014810chr113634 ------
NM_014819chr5--1118 ----
NM_014820chr32281 146 ------
NM_014822chr41433 ------
NM_014826chr154216 3967 2986 829 240 --23741 1759 --
NM_014828chr1421694 890 22482 1861 ----
NM_014830chr1233068 2644 226 ------
NM_014832chr1342051 567 253 67 1167 ----
NM_014839chr132183 482 401 ------
NM_014844chr1434173 4143 3816 --21616 1296 2578 522
NM_014859chr1721357 1090 1410 --1281
NM_014867chr853838 2681 863 655 512 --11306 --
NM_014868chr122814 277 --163 --
NM_014872chr942361 2139 2026 791 ----12349
NM_014873chr134489 1400 1355 ------
NM_014876chr2241987 768 512 435 --22093 484 --
NM_014877chr1777068 5455 3093 1683 1141 872 401 1655 27048 2589 16327
NM_014897chr173927 479 44 ------
NM_014898chr1941996 652 185 99 --12086 --
NM_014899chr51356 ------
NM_014901chr552031 1799 931 413 397 --1738 --
NM_014902chr2011353 --2967 404 --
NM_014903chr1221604 1574 ------
NM_014905chr221495 749 --11658 --
NM_014912chr1043108 2316 2165 1034 ------
NM_014913chr181273 ------
NM_014923chr13--1415 ----
NM_014926chr321135 306 ------
NM_014932chr31499 ----11700
NM_014934chr1363771 3178 3096 2431 1508 1347 1247 13821 23302 1216
NM_014946chr231992 1899 1183 ------
NM_014951chr1021927 311 --22290 722 --
NM_014952chr1511920 --11495 --
NM_014964chr1732254 1852 588 ------
NM_014969chr13190 131 24 ------
NM_014978chr1021191 504 --11444 1740
NM_014982chr1475032 4760 4245 882 382 304 293 22013 734 ----
NM_014988chr411104 1421 ----
NM_014989chr622091 217 11847 11901 --
NM_014990chr142251 129 ------
NM_014991chr442890 2714 2673 2526 11103 ----
NM_015008chr312608 --43153 2851 2472 463 --
NM_015015chr192253 53 ------
NM_015017chr11420 --1377 --
NM_015020chr1663694 3303 2601 1393 306 260 --1397 --
NM_015023chr131314 274 249 ----1731
NM_015025chr242686 912 236 211 --12079 --
NM_015026chr1243826 1872 686 672 23919 259 ----
NM_015032chr132625 167 ------
NM_015035chr2084281 4151 2491 2346 1664 1293 1187 90 25504 617 1101 14334
NM_015039chr163208 1578 446 407 368 290 --11049 --
NM_015044chr1652986 2875 2150 990 653 22951 307 --1846
NM_015045chr102245 156 1384 ----
NM_015049chr222206 1009 12632 ----
NM_015052chr71405 --1411 --
NM_015057chr131155 1682 ----
NM_015062chr101270 ------
NM_015063chr19----1420 --
NM_015068chr722553 1060 22988 810 11175 13327
NM_015069chr161663 --1195 --
NM_015071chr586386 6056 5574 5124 5006 4782 1000 625 --11075 25581 4073
NM_015075chrX31745 1480 292 --11590 --
NM_015076chr634009 3440 322 1656 13639 --
NM_015090chr195503 5302 5215 4645 3795 1442 1334 957 592 12259 25819 1050 15997
NM_015092chr1634626 3160 540 ------
NM_015093chr6--1330 ----
NM_015097chr331582 461 455 1545 1683 --
NM_015101chr11673 ------
NM_015104chr11----142 --
NM_015107chrX32282 1769 481 ------
NM_015111chr521298 394 13278 21505 775 12890
NM_015115chr431057 630 89 53158 1112 1036 611 527 ----
NM_015132chr741880 1831 1658 1284 ------
NM_015136chr3------1135
NM_015138chr1522212 35 12862 1253 --
NM_015143chr4146 ----1573
NM_015144chr1623281 2624 --1281 --
NM_015149chr142146 1824 1595 835 ------
NM_015155chr1033141 3096 313 ----12694
NM_015156chr1433594 1145 180 1549 ----
NM_015161chr163560 370 178 ------
NM_015163chr1421265 193 --1212 --
NM_015176chr111241 --1649 --
NM_015184chr32570 447 ------
NM_015187chr43890 797 306 ------
NM_015191chr1121059 1023 ------
NM_015192chr2052963 2650 2614 1007 178 --1166 --
NM_015194chr1721457 705 11757 182 --
NM_015199chr3----12284 --
NM_015200chr431841 1823 436 ------
NM_015206chr1523625 3431 ------
NM_015208chr1833014 777 90 24043 3149 ----
NM_015215chr123119 976 ------
NM_015216chr531447 1173 241 ------
NM_015231chr111795 ------
NM_015246chr1672059 1984 1843 1771 1726 1684 99 ------
NM_015247chr161528 11138 13721 --
NM_015250chr93639 420 202 1129 ----
NM_015252chr21762 ------
NM_015256chr5--2768 481 ----
NM_015262chr102485 165 ------
NM_015263chr152922 387 ------
NM_015265chr222601 1739 --11649 --
NM_015267chr1221743 127 ----1717
NM_015270chr1262340 1942 1874 607 539 152 --32215 465 340 --
NM_015271chr444311 3486 3149 841 197 ----
NM_015272chr1612121 ------
NM_015275chr1231724 1476 414 ------
NM_015277chr1821613 1322 ------
NM_015282chr242619 2253 708 255 ------
NM_015284chr121750 1546 ------
NM_015288chr523682 3094 --13301 --
NM_015291chr162770 2636 2566 1001 449 47 12830 1298 12329
NM_015299chr1433047 1266 801 --33307 1035 545 --
NM_015305chr1431357 275 74 --21620 492 --
NM_015308chr11----1217 --
NM_015310chr896793 6315 6287 6207 3301 2971 2929 2376 1920 ----12073
NM_015315chr51417 12566 43182 2834 1107 567 12700
NM_015317chr242155 1149 560 38 11876 ----
NM_015318chr1931667 1442 1433 --1719 --
NM_015335chr1232362 846 769 1152 ----
NM_015336chr1212271 1105 ----
NM_015339chr20131 ------
NM_015349chr632503 2084 699 ------
NM_015354chr91325 ------
NM_015355chr171624 ------
NM_015358chr213969 953 131 1940 --1391
NM_015365chrX12779 --13451 --
NM_015375chr134013 1877 844 1929 ----
NM_015381chr2231325 806 576 --1424 --
NM_015382chr141539 ----194
NM_015385chr1063160 3154 2752 2592 2393 995 --12623 --
NM_015396chr31293 ------
NM_015397chr9--11369 --1703
NM_015423chr1131645 1493 1078 21656 251 ----
NM_015436chr443108 2350 2297 90 ----13239
NM_015442chr3--1235 ----
NM_015443chr1731261 186 88 ------
NM_015455chr521613 287 ------
NM_015481chr12----1299 --
NM_015483chr741118 772 390 129 ------
NM_015488chr221479 1459 ------
NM_015509chr1231545 630 265 ------
NM_015520chr322632 192 ------
NM_015530chr2----1369 --
NM_015541chr321400 117 ----1996
NM_015542chr1021140 799 1812 ----
NM_015544chr172597 159 ------
NM_015550chr753103 2719 1298 422 339 ------
NM_015553chr654217 3669 1551 1372 544 --23298 3229 --
NM_015559chr181808 1950 ----
NM_015564chr531282 923 402 ------
NM_015565chr2122055 554 ------
NM_015569chr123098 1574 1647 ----
NM_015570chr731854 606 349 ------
NM_015576chr322791 2093 21202 226 ----
NM_015577chr52700 542 --21416 254 --
NM_015602chr121239 27 ------
NM_015609chr142159 423 359 167 --1723 --
NM_015630chr22361 249 ------
NM_015645chr11125 ------
NM_015646chr1231256 861 330 ------
NM_015657chr21786 1236 1673 --
NM_015678chr1311664 11691 ----
NM_015686chrX21931 302 12286 ----
NM_015691chrX2530 433 22600 1169 22242 806 --
NM_015695chr622088 1342 ----1639
NM_015844chr181787 ----1148
NM_015846chr181787 ----1148
NM_015847chr181787 ----1148
NM_015850chr841742 1713 678 455 11660 ----
NM_015852chr723456 2518 23178 2944 ----
NM_015866chr12204 52 ------
NM_015872chr121464 332 --21475 385 152
NM_015878chr821728 382 ------
NM_015879chr18137770 7477 7157 6816 6164 5969 3311 2743 2528 1650 1054 920 241 ------
NM_015892chr1011994 1395 ----
NM_015904chr22679 198 1765 ----
NM_015906chr124315 3214 43929 3711 891 528 13269 --
NM_015955chr21483 ------
NM_015980chr521349 265 ------
NM_015981chr523016 793 ----1108
NM_015995chr1585499 5171 5091 4905 4843 2197 1893 1726 --32080 1201 1033 11768
NM_016009chr164524 4289 3814 3373 1055 88 1197 13086 --
NM_016016chr171293 ------
NM_016018chr822210 1943 1234 ----
NM_016025chr16--1484 ----
NM_016027chr82546 397 ------
NM_016037chr12725 413 --1369 --
NM_016038chr72544 67 ------
NM_016045chr201489 ------
NM_016057chr122280 49 ------
NM_016061chr231635 1343 670 ------
NM_016073chr151285 1923 ----
NM_016075chr1352941 2772 2562 678 481 32502 435 226 12750 --
NM_016076chr11348 11272 --11014
NM_016078chr172276 82 1775 ----
NM_016083chr663932 3234 3208 2823 1563 990 --1106 --
NM_016096chr852134 1559 1478 734 159 ------
NM_016097chr181264 141 ----
NM_016129chr42318 42 ------
NM_016131chr241793 1567 777 214 ------
NM_016132chr1523242 2583 ------
NM_016133chr21356 21416 308 11339 --
NM_016141chr32289 52 ------
NM_016142chr111935 ------
NM_016147chr112755 104 ------
NM_016152chr33964 937 222 ------
NM_016162chr122834 648 1703 1272 --
NM_016169chr1031141 562 153 ----13040
NM_016185chr17----146 --
NM_016192chr21255 ------
NM_016201chr322232 766 11758 ----
NM_016205chr421398 289 --1419 --
NM_016206chr357720 7585 3196 2860 2495 28997 1307 27679 5721 2952 693
NM_016224chr6--1786 2689 632 1436
NM_016230chr61358 ------
NM_016231chr1721161 83 1541 ----
NM_016235chr1611262 ------
NM_016250chr141114 ------
NM_016252chr22934 635 --1119 1689
NM_016255chr643194 3096 2483 2356 23335 3140 ----
NM_016257chr142790 2611 2147 1307 ------
NM_016260chr276170 5364 2968 2798 2701 2099 285 ------
NM_016269chr41414 11052 ----
NM_016272chr222873 777 ------
NM_016275chr31672 12324 1503 --
NM_016287chr111321 1386 ----
NM_016290chr5153 ------
NM_016300chr32204 191 ------
NM_016302chr31761 1281 ----
NM_016308chr1132 ------
NM_016315chr2--2404 54 ----
NM_016316chr21535 1734 ----
NM_016320chr112816 32 ----1349
NM_016339chr1721790 672 --11515 --
NM_016352chr721422 304 ------
NM_016373chr163862 844 631 ------
NM_016377chr62499 283 1633 124 --
NM_016396chr1532841 1163 1091 ------
NM_016422chr111505 --1169 --
NM_016424chr1731434 742 233 21745 713 ----
NM_016436chr2062031 1841 1680 1036 606 88 1401 1491 --
NM_016441chr211619 ------
NM_016442chr512168 ------
NM_016448chr141784 724 499 363 ----11865
NM_016451chr112107 84 ------
NM_016470chr201395 ------
NM_016480chr51138 --1638 --
NM_016485chr642198 1681 1508 24 ------
NM_016507chr1722994 1011 32930 2304 2009 ----
NM_016522chr1111110 11216 11668 --
NM_016530chr1553895 3862 1543 1513 750 23067 143 ----
NM_016531chr433481 888 331 13681 1856 --
NM_016542chrX21157 93 11422 ----
NM_016577chr354470 3652 1078 909 858 21701 1518 ----
NM_016588chr61653 1370 148 --
NM_016591chr5----174 --
NM_016598chr321453 1423 ------
NM_016603chr531749 1370 719 ----1847
NM_016604chr531302 917 424 ------
NM_016605chr5------1165
NM_016607chrX11669 ------
NM_016618chr21147 ------
NM_016620chr111101 11109 ----
NM_016621chr1133365 1554 211 --14477 1257
NM_016623chr81622 ------
NM_016626chr181487 ------
NM_016628chr101260 ------
NM_016644chr52523 346 1358 ----
NM_016654chr1511063 ------
NM_016824chr1011707 ------
NM_016836chr21701 ------
NM_016839chr21701 ------
NM_016950chr421146 431 ------
NM_016952chr1163348 998 778 318 280 180 13248 ----
NM_017412chr831305 416 99 ------
NM_017415chr554487 4176 3119 2832 1508 --23801 210 --
NM_017420chr1473843 3779 3701 3202 2926 2673 1373 13268 12889 11217
NM_017423chr442074 1846 1817 505 ------
NM_017424chr2272121 2079 2073 2004 1450 531 83 11936 41841 1715 1495 623 --
NM_017447chr2153321 2803 1638 1374 25 13359 ----
NM_017452chr2011063 ----1421
NM_017453chr2011063 ----1421
NM_017454chr2011063 ----1421
NM_017455chr154936 845 301 130 ------
NM_017488chr211013 --1232 --
NM_017491chr41752 168 199 --
NM_017519chr631035 437 315 ------
NM_017522chr141176 972 45 24 ------
NM_017545chr201383 ------
NM_017551chr1032604 2450 2032 1402 ----
NM_017572chr19164 ------
NM_017575chr172564 87 --2288 148 11413
NM_017580chr1031482 951 686 11556 --1886
NM_017582chr121638 333 ------
NM_017595chr1711356 ----11154
NM_017596chr134634 4506 2950 --44383 1540 1516 390 --
NM_017610chr1511380 ------
NM_017612chr121102 ------
NM_017626chr1031715 1370 592 ------
NM_017629chr131845 610 41 1713 ----
NM_017632chr41350 ------
NM_017633chr623745 2914 13068 ----
NM_017635chr11--11118 11545 --
NM_017637chr943546 3492 816 757 13703 27092 859 17973
NM_017640chr62702 274 ------
NM_017644chr312067 13810 --14168
NM_017645chr932765 2515 2309 ----151
NM_017649chr10----1100 --
NM_017650chr754761 4666 4037 1250 411 ------
NM_017651chr621408 495 --1419 --
NM_017658chr1441832 1190 725 674 23910 539 ----
NM_017661chr154955 934 517 423 ------
NM_017672chr151351 11037 ----
NM_017681chrX2159 49 ------
NM_017700chr41493 1154 ----
NM_017707chr1123 --1160 131
NM_017709chr142804 1560 970 645 1275 ----
NM_017724chr3----1225 --
NM_017730chr3----1577 --
NM_017734chr11134 ------
NM_017739chr11466 ------
NM_017742chr1821519 115 ------
NM_017744chr121791 852 ------
NM_017745chrX1237 ------
NM_017753chr911008 1210 ----
NM_017754chr644783 4342 1607 247 1798 1424 13203
NM_017768chr11920 ------
NM_017769chr1443002 1293 590 496 13298 --13174
NM_017772chr62660 638 --2203 163 --
NM_017779chr122099 980 ------
NM_017780chr81237 ------
NM_017786chr82231 39 ------
NM_017793chr151230 ------
NM_017799chr1411264 --1354 --
NM_017811chr932541 2081 869 ------
NM_017813chr885855 5312 5263 4953 3802 2141 1357 88 --11313 --
NM_017824chr103690 570 329 12051 ----
NM_017830chr42664 73 ------
NM_017831chr1833985 2953 129 13777 11816 --
NM_017848chrX--13551 ----
NM_017849chr232625 2476 1251 --32567 2430 2017 --
NM_017851chr1521010 79 --2943 72 --
NM_017856chrX31868 1580 658 --12005 1161
NM_017857chr11----1212 --
NM_017893chr1011102 ------
NM_017902chr1045107 1735 787 293 --13985 --
NM_017905chr13--1567 ----
NM_017911chr222601 188 11520 1557 --
NM_017913chr91380 ------
NM_017917chr141107 ------
NM_017919chr965295 1564 1289 1109 792 35 --35078 4071 1163 --
NM_017921chr171404 12127 ----
NM_017933chr2------21082 299
NM_017938chrX22161 276 ------
NM_017955chr1431150 1135 900 ----11031
NM_017964chr21652 ------
NM_017987chr1031992 1375 207 ------
NM_017988chr12------1142
NM_017993chr13138 ------
NM_018008chr31345 ------
NM_018009chr121157 1151 ----
NM_018011chr131141 ------
NM_018013chr612342 12807 12185 159
NM_018027chr1042394 2055 1016 691 --11315 --
NM_018031chr32175 93 --2560 84 --
NM_018032chr16----1254 --
NM_018045chr132390 513 164 1750 12369 12153
NM_018054chr16--1239 2594 539 --
NM_018061chr12686 306 ----11422
NM_018070chr12439 176 ------
NM_018071chr141333 ----1312
NM_018079chr21508 ------
NM_018084chr252617 2536 2416 2061 389 1525 ----
NM_018085chr156922 6253 2463 1323 769 46338 2305 1967 227 --12077
NM_018092chr16--21526 1453 ----
NM_018098chr31130 ----11135
NM_018114chr31214 --1445 1390
NM_018121chr1022559 557 --12228 --
NM_018124chr1632467 2091 29 ------
NM_018131chr103887 839 731 1130 ----
NM_018133chr3----1308 --
NM_018137chr121307 353 ------
NM_018150chr12580 106 ------
NM_018155chr332972 2614 719 --22950 267 11301
NM_018157chr1253220 3183 2354 1094 89 12101 1342 13279
NM_018178chr131826 1442 719 ------
NM_018179chr12181 ------
NM_018195chr1131851 649 389 --11932 --
NM_018206chr163628 507 33 ------
NM_018227chr442408 1185 765 420 ------
NM_018240chr11184 --2766 711 --
NM_018243chr474045 3993 3779 2725 2589 252 67 11257 ----
NM_018247chr633099 2602 624 ------
NM_018252chr12517 448 ------
NM_018293chr31446 12010 11969 --
NM_018299chr842796 1342 523 197 ------
NM_018302chr442480 1698 948 39 1792 22392 163 --
NM_018307chr171129 ------
NM_018313chr321871 869 ------
NM_018317chr4162 ------
NM_018323chr41274 1348 ----
NM_018327chr2011387 ------
NM_018348chr161213 --1278 1289
NM_018362chr1113949 --13458 --
NM_018364chr123539 3396 13482 ----
NM_018367chr111260 ------
NM_018368chr6--1200 ----
NM_018374chr735147 4639 2083 --14854 --
NM_018375chr1431645 652 443 ----1470
NM_018383chr241430 816 650 226 21755 1363 11370 --
NM_018388chrX21161 603 ----1312
NM_018398chr31212 150 ----
NM_018403chr363886 3215 2740 1651 1548 944 23126 703 ----
NM_018413chr12129 ------
NM_018416chr1232629 734 301 ------
NM_018423chr12127 ------
NM_018425chr1031655 825 223 1410 ----
NM_018429chr522809 525 12859 ----
NM_018439chr1821927 943 32270 1629 309 12214 12660
NM_018440chr897654 7430 7296 6996 6154 5936 2325 1954 922 25645 2424 37412 7394 5715 27358 2242
NM_018448chr121414 ------
NM_018457chr12169 ------
NM_018469chr1721454 299 ------
NM_018471chr21104 ------
NM_018482chr852029 1794 622 260 39 ------
NM_018489chr142193 1711 762 123 ------
NM_018638chr1265061 4071 4008 2168 1419 128 --15311 --
NM_018639chr1221376 1235 ------
NM_018649chr101213 ------
NM_018650chr12405 106 ------
NM_018667chr1642143 1043 1030 386 2425 418 163 --
NM_018686chr122323 82 ------
NM_018689chr1532203 1711 806 ------
NM_018695chr52810 394 ------
NM_018698chrX21956 200 11484 11641 --
NM_018700chr51167 ------
NM_018704chr121807 352 ------
NM_018712chr112434 112 11567 ----
NM_018713chr141120 884 212 114 ------
NM_018715chr131717 1414 56 ------
NM_018717chr42301 218 1545 ----
NM_018718chr71839 --22165 1600 --
NM_018719chr7--21261 1017 ----
NM_018834chr511013 ------
NM_018841chr123675 469 13177 ----
NM_018845chr13544 521 418 1503 ----
NM_018846chr71357 ------
NM_018890chr721071 997 ------
NM_018898chr552296 2198 2181 770 63 11701 ----
NM_018899chr552296 2198 2181 770 63 11701 ----
NM_018900chr552296 2198 2181 770 63 11701 ----
NM_018901chr552296 2198 2181 770 63 11701 ----
NM_018902chr552296 2198 2181 770 63 11701 ----
NM_018903chr552296 2198 2181 770 63 11701 ----
NM_018904chr552296 2198 2181 770 63 11701 ----
NM_018905chr552296 2198 2181 770 63 11701 ----
NM_018906chr552296 2198 2181 770 63 11701 ----
NM_018907chr552296 2198 2181 770 63 11701 ----
NM_018908chr552296 2198 2181 770 63 11701 ----
NM_018909chr552296 2198 2181 770 63 11701 ----
NM_018910chr552296 2198 2181 770 63 11701 ----
NM_018911chr552296 2198 2181 770 63 11701 ----
NM_018912chr51707 --2351 127 --
NM_018913chr51707 --2351 127 --
NM_018914chr51707 --2351 127 --
NM_018915chr51707 --2351 127 --
NM_018916chr51707 --2351 127 --
NM_018917chr51707 --2351 127 --
NM_018918chr51707 --2351 127 --
NM_018919chr51707 --2351 127 --
NM_018920chr51707 --2351 127 --
NM_018921chr51707 --2351 127 --
NM_018922chr51707 --2351 127 --
NM_018923chr51707 --2351 127 --
NM_018924chr51707 --2351 127 --
NM_018925chr51707 --2351 127 --
NM_018926chr51707 --2351 127 --
NM_018927chr51707 --2351 127 --
NM_018928chr51707 --2351 127 --
NM_018929chr51707 --2351 127 --
NM_018945chr653691 3556 2926 1043 784 1636 --21380 825
NM_018947chr794774 4544 4147 3337 3051 1953 1282 1182 633 11103 11916 1502
NM_018951chr71455 1237 ----
NM_018968chr2--1127 ----
NM_018979chr1232223 995 382 11025 21703 247 --
NM_018994chr11458 ------
NM_018999chr1054477 3404 3180 1226 641 24132 909 ----
NM_019001chr324259 155 11085 ----
NM_019004chr71587 ----11766
NM_019006chr15--1107 ----
NM_019015chr71131 ------
NM_019027chr472138 1737 750 730 586 233 192 ------
NM_019035chr432049 804 32 ------
NM_019036chr621091 433 ------
NM_019042chr731151 847 465 --11108 --
NM_019046chr101854 ------
NM_019049chr13760 626 314 ------
NM_019050chr43805 460 311 ------
NM_019053chr102392 307 --11047 --
NM_019058chr101808 ------
NM_019063chr252272 2037 838 599 118 ------
NM_019072chr531691 427 237 21063 246 11647 --
NM_019084chr1032594 2115 763 12092 ----
NM_019087chr521259 252 ------
NM_019091chr2140 ------
NM_019094chr1263841 2610 775 203 111 30 12732 21522 1390 --
NM_019096chr63784 739 430 --165 --
NM_019106chr221865 11095 1267 --
NM_019108chr192440 23 ------
NM_019114chr91744 ------
NM_019116chr1673615 3279 3180 2806 2619 1081 655 --13114 --
NM_019556chrX41331 1300 1212 538 ------
NM_019557chr12811 32 ------
NM_019558chr2--1119 ----
NM_019590chr1021159 986 ------
NM_019593chr2063073 3026 1047 993 757 391 --186 --
NM_019595chr23167 118 93 ------
NM_019597chrX2491 226 ------
NM_019600chr153655 186 166 ------
NM_019605chr1--2119 108 1123 --
NM_019606chr7----1171 --
NM_019610chr1------11473
NM_019845chr21178 ------
NM_019848chrX266 59 --1140 --
NM_019857chrX31749 1300 386 --11432 11668
NM_019859chr102471 311 --1347 --
NM_019860chr102519 359 --1395 --
NM_019885chr232893 831 271 --1391 1534
NM_019903chr1011707 ------
NM_020039chr1221934 560 --1269 --
NM_020066chr1--1305 ----
NM_020116chr411792 1692 ----
NM_020117chr521063 741 ----1984
NM_020122chr285867 5002 4694 3841 1567 1527 1367 1120 11110 14014 --
NM_020123chr1011379 ------
NM_020126chr192604 559 ------
NM_020130chr83931 471 203 ------
NM_020133chr663976 2567 1409 1024 430 196 26412 4387 13917 16314
NM_020134chr221192 271 ------
NM_020141chr111666 ------
NM_020144chr711716 ------
NM_020150chr10--1269 1106 --
NM_020153chr111126 ----199
NM_020159chr421313 1233 ------
NM_020177chr552203 891 849 577 533 23357 1053 ----
NM_020179chr111411 ------
NM_020194chr21647 192 ----
NM_020198chr1711060 ------
NM_020205chr123439 81 --13084 --
NM_020225chr41314 ------
NM_020228chr1122542 40 ------
NM_020231chr32681 135 ----1541
NM_020239chr111963 ------
NM_020248chr121920 1669 ------
NM_020310chr1732770 2730 2335 ------
NM_020336chr2053810 3736 3362 2779 2492 --13742 --
NM_020337chr422811 73 1691 1842 --
NM_020338chr1033737 2854 2467 --1249 12724
NM_020340chr61629 --1892 --
NM_020342chr23983 324 43 --11031 --
NM_020346chr1121135 360 ------
NM_020360chr17195 ------
NM_020362chr11296 ------
NM_020365chr11115 ----1149
NM_020390chr341704 1119 843 540 23424 1066 ----
NM_020403chr131186 143 195 --
NM_020416chr452154 1053 857 575 39 1941 1431 --
NM_020429chr722068 302 --22467 2041 2777 403
NM_020431chr141249 --32743 2577 1013 --
NM_020432chr721802 705 ----11492
NM_020440chr111163 32346 1063 151 22320 1067 --
NM_020443chr176971 5265 5137 4558 1384 1005 925 26895 2685 16378 11030
NM_020448chr173717 3570 2916 2271 1353 1006 434 12356 ----
NM_020449chrX1150 ------
NM_020452chr111900 --2651 421 --
NM_020455chr61733 1103 ----
NM_020456chr1311829 ------
NM_020457chr161435 ------
NM_020463chr221169 420 ------
NM_020466chr655020 4100 3552 314 39 24797 536 1796 --
NM_020473chrX32018 1361 470 42012 1630 715 700 ----
NM_020474chr1811848 --11717 --
NM_020475chr842400 910 392 21 --1469 --
NM_020476chr842400 910 392 21 --1469 --
NM_020477chr842400 910 392 21 --1469 --
NM_020478chr842463 973 455 84 --1532 --
NM_020480chr842400 910 392 21 --1469 --
NM_020526chr1--152 --11256
NM_020532chr22180 141 ------
NM_020640chr32708 450 ------
NM_020645chr111173 --1645 --
NM_020647chr81246 1571 1864 --
NM_020651chr211712 11605 ----
NM_020662chr621887 327 11706 ----
NM_020673chr2077627 7274 6330 5235 1856 999 114 37738 5413 1160 25677 1799 --
NM_020686chr1642879 2544 1104 443 13050 ----
NM_020689chr2031615 1448 193 --11406 --
NM_020697chr8199 --1195 --
NM_020708chr2042372 2153 1537 346 ------
NM_020713chr2032893 2401 29 --1539 --
NM_020717chrX63996 3809 3320 3240 1457 41 ----13105
NM_020718chr16106307 5873 5288 5037 4260 4246 1827 1200 637 112 26270 1460 ----
NM_020726chr52524 55 --129 --
NM_020727chr2163873 3559 2587 1074 775 409 ------
NM_020732chr631035 437 315 ------
NM_020734chr1212282 1815 1839 --
NM_020739chr1541562 1224 923 428 ------
NM_020742chrX12272 ------
NM_020748chr1721889 1378 --1328 --
NM_020750chr641108 963 507 320 21508 1442 ----
NM_020766chrX42965 2794 1155 733 ------
NM_020769chrX2349 183 ------
NM_020770chr12513 329 ------
NM_020772chr1787186 6486 5381 2030 1449 1127 777 594 11318 27950 5234 --
NM_020774chr1836007 1934 418 24641 1847 25639 1632 11871
NM_020779chr263150 2671 2299 1218 416 227 ------
NM_020783chr1832414 1527 374 1331 11542 --
NM_020794chr11379 11446 ----
NM_020795chr171319 --11825 --
NM_020796chr532403 623 561 11151 12548 --
NM_020801chr54546 331 195 152 ------
NM_020806chr14134 ------
NM_020810chr141920 23449 707 33594 2647 637 --
NM_020819chr61141 ------
NM_020824chr101749 ------
NM_020839chr32431 182 ------
NM_020841chr1222779 1589 23773 1448 --12530
NM_020843chr15197 ------
NM_020845chr1222515 2431 ----11914
NM_020850chr1643061 3018 1316 542 ------
NM_020854chr1811154 11541 ----
NM_020858chr15124 1548 ----
NM_020866chr1311065 ------
NM_020888chr13370 360 194 --1717 --
NM_020918chr1042740 2395 1168 1047 11183 ----
NM_020926chrX2392 378 ------
NM_020927chr16--11526 21777 433 1180
NM_020935chr244030 3958 1277 364 ----1169
NM_020940chr1032259 1139 674 12844 ----
NM_020947chr1611957 --1166 --
NM_020948chr123302 1089 ------
NM_020951chr1922163 761 --11788 --
NM_020952chr9--1572 --1346
NM_020963chr11228 ------
NM_020971chr192743 558 ------
NM_020975chr102608 47 1205 --1690
NM_020983chr1262340 1942 1874 607 539 152 --32215 465 340 --
NM_020987chr10----1279 --
NM_020998chr3263 23 ------
NM_021005chr151811 ------
NM_021007chr21564 ----197
NM_021012chr1742920 1024 694 457 --22962 2164 --
NM_021020chr833492 3251 60 --12286 12755
NM_021033chr1362641 2594 2198 1094 893 614 13259 ----
NM_021035chr2021325 912 21157 341 ----
NM_021038chr31644 2336 27 ----
NM_021064chr62429 107 11102 11309 --
NM_021072chr521830 1014 11970 ----
NM_021079chr1732714 2572 240 --13219 --
NM_021083chrX43080 1461 584 234 --12972 --
NM_021090chr2231561 1357 84 --23791 1392 --
NM_021111chr911319 1110 ----
NM_021116chr798300 6834 6255 5681 5630 2086 1663 1409 1145 27112 5496 43622 3228 3120 2694 --
NM_021120chrX43130 3052 1978 999 1931 ----
NM_021132chr1021262 1176 ------
NM_021140chrX2231 117 ------
NM_021151chr72252 155 ------
NM_021153chr181168 ------
NM_021155chr1962930 2749 2147 1996 284 133 ------
NM_021191chr1252341 2265 547 500 234 1774 ----
NM_021198chr21295 --1288 --
NM_021202chr2083022 2967 2806 2695 2407 2342 2324 400 --1235 --
NM_021229chr122488 162 ------
NM_021238chr1212008 11735 ----
NM_021244chr6160 ------
NM_021255chr1463974 2826 2597 850 265 186 14040 ----
NM_021572chr6------1428
NM_021614chr51253 ------
NM_021622chr1032294 1603 1551 --11476 --
NM_021627chr3166 ------
NM_021629chr323538 566 ------
NM_021643chr221603 1268 ------
NM_021647chr464724 3718 3705 3606 1438 22 11126 ----
NM_021728chr141275 ------
NM_021800chr102102 48 ------
NM_021809chr2011671 --32324 2063 1547 --
NM_021813chr655547 5336 4122 2145 497 13784 --1332
NM_021814chr62415 358 --11431 --
NM_021911chr595455 5067 4081 3849 3779 671 434 388 259 23896 1554 ----
NM_021912chr1573934 3865 3239 1664 1191 359 225 ------
NM_021914chr1452085 1518 707 498 259 11593 ----
NM_021943chr621964 1619 ------
NM_021945chr623371 3334 ------
NM_021956chr61114 ----11395
NM_021959chr6154 ------
NM_021961chr1137396 6235 4679 26330 1679 ----
NM_021964chr325720 5169 25672 534 14957 --
NM_021976chr6188 ------
NM_021998chrX11116 21278 931 ----
NM_022037chr21961 1838 ----
NM_022039chr10--1585 ----
NM_022041chr1652617 2587 2511 468 351 31816 526 428 ----
NM_022048chr1575661 5456 4174 2554 1737 1630 1209 --21604 1180 --
NM_022075chr11966 ------
NM_022080chr2052825 2715 2343 1005 213 ------
NM_022114chr142946 942 742 242 --14343 --
NM_022121chr6--11057 --1235
NM_022130chr521325 554 ------
NM_022137chr1431875 746 124 ----1599
NM_022143chr721081 261 ------
NM_022144chrX--157 ----
NM_022166chr1654712 4210 2543 2132 1156 ------
NM_022170chr721178 1086 1145 ----
NM_022173chr21961 1838 ----
NM_022340chr323399 3139 --13126 --
NM_022373chr72295 138 ------
NM_022456chr1286955 5287 5152 2878 2746 2105 1850 163 --34917 1488 21 --
NM_022458chr732119 2042 71 1961 1870 --
NM_022465chr1232483 2303 1115 ------
NM_022469chr132548 983 346 22497 752 ----
NM_022474chr1422076 450 --1353 12145
NM_022476chr162130 26 ------
NM_022477chr2041491 1293 271 105 ----1200
NM_022484chr721385 300 ------
NM_022552chr211112 ------
NM_022566chr153499 212 156 ------
NM_022572chr221479 1459 ------
NM_022648chr284514 3590 3099 3042 1566 1431 1085 669 ----13332
NM_022650chr52130 39 ----1169
NM_022652chr123260 243 205 --1807 --
NM_022716chr14917 900 749 261 12008 ----
NM_022719chr2242473 971 923 177 12462 ----
NM_022726chr6--11485 ----
NM_022728chr71526 ------
NM_022730chr211071 ------
NM_022731chr1------1277
NM_022735chr11355 11812 ----
NM_022737chr19136 --11144 --
NM_022744chr16--1874 --11259
NM_022748chr732717 2070 226 1808 32233 405 331 1642
NM_022751chr181134 ------
NM_022756chr131377 1162 549 ------
NM_022763chr333197 2224 1269 12917 ----
NM_022771chr1221005 95 ------
NM_022776chr31573 ------
NM_022778chr141217 501 455 342 --21404 1110 --
NM_022780chr241618 1587 1179 327 ------
NM_022782chr12--1123 ----
NM_022832chr412357 11571 --1275
NM_022838chrX1101 1328 ----
NM_022841chr1512220 ------
NM_022843chr1311326 ------
NM_022845chr161237 1326 22009 1677 --
NM_022893chr222204 112 --22090 482 --
NM_022894chr221194 1168 ------
NM_022912chr242950 2783 2270 386 22619 1120 --12235
NM_022917chr93426 206 128 ------
NM_023000chr1411734 ------
NM_023001chr1411734 ------
NM_023016chr232695 1827 1003 12635 ----
NM_023037chr131222 --150 --
NM_023076chr162975 69 ------
NM_023079chr1731793 1767 1370 ------
NM_023105chr841742 1713 678 455 11660 ----
NM_023106chr841742 1713 678 455 11660 ----
NM_023110chr841742 1713 678 455 11660 ----
NM_023111chr841742 1713 678 455 11660 ----
NM_023929chr82200 99 --1990 --
NM_023931chr1621098 309 --21411 1053 --
NM_023940chr42973 687 ------
NM_024007chr532692 2320 367 1601 ----
NM_024015chr17----1828 --
NM_024034chr2031032 760 655 ----1956
NM_024052chr1732460 2079 1181 21942 1206 ----
NM_024076chr1922063 639 ----12419
NM_024111chr151212 ------
NM_024117chr921250 267 --2986 321 1572
NM_024312chr1211024 11264 1130 1343
NM_024332chrX1662 ------
NM_024336chr161100 ------
NM_024411chr2051394 977 433 424 398 --199 --
NM_024424chr111307 --1846 --
NM_024425chr111307 --1846 --
NM_024426chr111307 --1846 --
NM_024494chr11556 --1726 --
NM_024513chr32561 508 22812 2779 22347 442 13803
NM_024525chr12594 450 ------
NM_024541chr1051763 1727 1627 1365 754 ------
NM_024548chr32634 132 ------
NM_024554chr131468 1196 201 1503 ----
NM_024563chr531782 1194 642 1124 ----
NM_024582chr421006 723 ------
NM_024612chr1721096 781 1877 ----
NM_024617chr91633 --1897 --
NM_024624chr231425 618 521 ------
NM_024646chr121564 149 22970 2468 ----
NM_024656chr1931114 668 293 31167 617 190 11616 --
NM_024659chr21247 ------
NM_024665chr364557 2867 1529 1484 1419 71 1706 ----
NM_024674chr182960 2818 2583 2283 1972 1216 570 107 12405 22374 190 1355
NM_024704chr202449 79 ------
NM_024713chr1511271 --1618 --
NM_024721chr831756 916 22 ------
NM_024725chr111639 ------
NM_024726chr22445 204 --155 --
NM_024744chr2------1949
NM_024745chr1621141 47 ------
NM_024755chr151821 ------
NM_024757chr9--1711 ----
NM_024759chr81765 ------
NM_024761chr944508 4426 3497 1665 --11899 13980
NM_024778chrX1213 ------
NM_024798chr1562747 2251 906 748 407 269 --42577 2330 2222 615 --
NM_024803chr10170 --1376 --
NM_024811chr113434 396 266 ------
NM_024828chr921290 601 ------
NM_024834chr1021728 1564 --11753 --
NM_024837chr1541828 1534 710 403 1505 ----
NM_024863chrX130 ------
NM_024875chr1011827 ------
NM_024884chr1463055 3028 2891 1212 1122 193 2782 41 21077 859 --
NM_024893chr201971 ------
NM_024896chr941585 704 45 28 --1683 --
NM_024920chr4------1996
NM_024930chr52379 71 --11823 --
NM_024939chr1641462 1362 532 50 --1309 --
NM_024943chr41602 ------
NM_024944chr212478 207 ------
NM_024947chr398250 7499 3657 3426 3015 1316 1264 499 173 --28205 7839 --
NM_024953chr12--12266 1446 --
NM_024971chr9--1572 --1346
NM_024989chr256473 2989 2851 2376 203 23204 2574 ----
NM_024991chr1063160 3154 2752 2592 2393 995 --12623 --
NM_025054chr854039 3861 3653 1080 909 ------
NM_025058chr13566 535 113 ----1589
NM_025073chr194664 4308 4058 4015 3761 3455 3209 3155 195 ------
NM_025074chr411046 13104 1931 --
NM_025083chr1522001 504 --11247 --
NM_025113chr1331165 1079 38 ------
NM_025126chr122589 274 --1173 --
NM_025133chr2------190
NM_025134chr161835 1677 ----
NM_025135chr181494 ------
NM_025140chr123518 87 33 193 ----
NM_025146chr322495 2268 ------
NM_025154chr711303 ------
NM_025160chr132765 220 106 ----13429
NM_025164chr1171922 1801 1698 870 665 235 184 ----12048
NM_025179chr134163 1343 1251 --21879 1518 --
NM_025182chr92196 23 1294 1119 --
NM_025191chr132787 929 164 ----13128
NM_025195chr8----11478 --
NM_025208chr1142465 720 399 271 ----1656
NM_025209chr10148 ------
NM_025211chr9193 ------
NM_025214chr1852772 2167 1988 965 606 ------
NM_025222chr353039 2225 595 448 325 22490 2242 ----
NM_025235chr10--11754 ----
NM_025250chr722534 511 32459 464 33 --2103 52
NM_030576chr1742472 1649 931 337 ------
NM_030583chr81246 ------
NM_030621chr1444165 4114 3425 2842 13599 12916 --
NM_030623chr211701 ------
NM_030627chr553074 2972 1366 400 93 ------
NM_030629chr161503 11850 21564 1513 11630
NM_030639chrX11791 11780 ----
NM_030647chr755840 5590 4938 4569 2434 ----11911
NM_030648chr494737 4495 2118 2101 1730 1219 120 94 51 25048 1353 ----
NM_030650chr234160 3739 2659 13308 --13566
NM_030660chr141277 --11313 --
NM_030674chr1294922 3678 1706 1551 1506 1346 961 564 177 ------
NM_030751chr102551 237 11160 ----
NM_030751chr102551 237 11160 ----
NM_030752chr6--1482 ----
NM_030756chr101116 ------
NM_030761chr142445 922 779 240 --22142 499 --
NM_030762chr122325 264 11491 ----
NM_030771chr11122 ------
NM_030786chr1--1196 ----
NM_030791chr1421850 1760 ------
NM_030792chr11--1558 1657 1325
NM_030795chr81336 ------
NM_030805chr231199 880 256 ------
NM_030806chr189151 8670 8256 6410 3395 2846 2129 580 22136 2041 19289 28398 523
NM_030809chr121103 --1924 --
NM_030816chr113206 22962 2638 ----
NM_030820chr651029 1009 780 364 336 1403 ----
NM_030881chr222370 156 --12095 --
NM_030884chr371843 1668 1582 661 528 308 265 1890 31747 833 728 187
NM_030885chr322164 860 ------
NM_030906chr112131 91 ------
NM_030915chr221985 1513 ------
NM_030918chr185248 4550 4481 3994 3723 982 872 194 --14386 --
NM_030920chr131964 1425 721 ----11802
NM_030935chr7173 ------
NM_030939chr62120 106 ------
NM_030948chr6127 ------
NM_030958chr81456 ------
NM_030963chr61156 --125 --
NM_030981chr111328 11151 11034 1763
NM_031157chr122598 279 ------
NM_031205chr122328 267 ------
NM_031216chr1811667 --1879 --
NM_031243chr732347 1520 122 ------
NM_031262chr92353 269 ------
NM_031263chr92410 326 ------
NM_031266chr52111 38 ------
NM_031267chr71182 ------
NM_031282chr121554 127 --11132 --
NM_031296chr421996 982 ------
NM_031305chr421893 178 ------
NM_031314chr1442019 1555 140 108 1519 ----
NM_031369chr42249 223 ------
NM_031370chr42249 223 ------
NM_031411chr552296 2198 2181 770 63 11701 ----
NM_031412chr122843 163 1211 1934 --
NM_031418chr1152348 1869 588 385 347 --1528 --
NM_031427chr1474286 4149 2336 2287 2064 1540 440 --25505 4243 12361
NM_031442chrX12989 --12916 --
NM_031445chr242635 2406 2103 1136 --22124 517 --
NM_031450chr11--1451 142 --
NM_031461chr811425 1320 --1446
NM_031468chr762963 2669 1951 1558 1511 51 --35989 2948 1017 12877
NM_031469chr644108 3335 3107 66 23624 2508 21501 520 --
NM_031492chr111369 ------
NM_031844chr153766 3083 2504 1432 840 1954 1832 --
NM_031845chr2--12365 --12707
NM_031847chr2--12365 --12707
NM_031849chr552296 2198 2181 770 63 11701 ----
NM_031857chr552296 2198 2181 770 63 11701 ----
NM_031860chr552296 2198 2181 770 63 11701 ----
NM_031889chr421362 1276 ------
NM_031890chr2252932 2056 2012 812 789 --22244 397 --
NM_031908chr541133 531 281 230 2365 345 ----
NM_031922chr6--1549 ----
NM_031946chr72405 107 ------
NM_031966chr5152 ------
NM_031992chr721178 1086 1145 ----
NM_032013chr2041491 1293 271 105 ----1200
NM_032017chr131940 1851 1547 12103 21521 283 --
NM_032023chr1011010 --21214 268 --
NM_032025chr341973 1339 533 304 21568 204 22037 1277 --
NM_032041chr842653 2428 2001 419 11721 11021 --
NM_032042chr532757 581 400 ------
NM_032051chr221109 --1462 1148
NM_032052chr2231068 282 208 --1143 --
NM_032088chr51707 --2351 127 --
NM_032092chr51707 --2351 127 --
NM_032102chr1122169 399 ------
NM_032121chrX62496 2423 2210 1097 945 410 ----1797
NM_032139chr1921000 271 ------
NM_032144chr221833 1124 ------
NM_032145chr62632 360 11837 ----
NM_032153chr31585 --12340 11079
NM_032174chr121116 962 --31040 236 140 --
NM_032182chr101382 ------
NM_032186chr111101 11109 ----
NM_032199chr1033633 2971 156 13826 ----
NM_032208chr232778 2378 1026 --11223 13606
NM_032228chr1133199 2446 344 23311 197 ----
NM_032236chr11107 ----1900
NM_032246chr152268 31 1992 ----
NM_032256chr125986 955 284 186 140 1921 ----
NM_032268chr1642466 2056 1193 870 ------
NM_032281chr1952990 2261 1093 947 859 13176 ----
NM_032288chr352253 2019 1560 1500 270 11923 ----
NM_032294chr1721408 70 ------
NM_032307chr93915 295 162 ------
NM_032315chr1--1257 ----
NM_032320chr11--131 ----
NM_032327chr102437 129 ------
NM_032373chr1045903 4631 3908 1089 14331 15015 --
NM_032403chr51707 --2351 127 --
NM_032410chr81925 ----1383
NM_032420chr54800 632 589 162 ------
NM_032424chr111148 ------
NM_032431chr11159 ------
NM_032434chr221124 604 11279 ----
NM_032435chr14311 259 111 82 --1174 --
NM_032438chr611397 ------
NM_032439chr1011646 41374 639 282 109 ----
NM_032440chr1032716 1097 303 ------
NM_032442chr17----1179 --
NM_032445chr1522132 817 ------
NM_032446chr543472 2763 1070 949 ------
NM_032457chr473806 3794 2769 1223 1120 933 212 ----12384
NM_032458chrX22508 999 33094 840 733 11128 --
NM_032482chr1942052 779 687 29 ------
NM_032505chr32601 304 --1779 --
NM_032521chr2021218 685 13079 21027 766 --
NM_032523chr22551 56 1541 ----
NM_032538chr622533 2510 22716 1936 1391 --
NM_032550chr10179 132 ----
NM_032557chr41228 ------
NM_032558chr911451 --3929 920 355 --
NM_032560chr142784 351 ------
NM_032564chr113998 752 640 ----1982
NM_032578chr102353 289 21308 523 ----
NM_032594chr141353 ------
NM_032595chr1711217 --11559 --
NM_032603chr21116 ----192
NM_032622chr41544 --11458 --
NM_032632chr1411557 ------
NM_032682chr312797 12225 ----
NM_032711chr1733304 1410 266 --21700 1169 --
NM_032717chr411058 1139 ----
NM_032727chr1011553 1353 31487 1090 656 --
NM_032737chr1952652 2419 1916 979 852 12435 12236 --
NM_032777chr82551 338 --11116 --
NM_032782chr5--1181 ----
NM_032784chr6--198 ----
NM_032804chr1051593 598 401 392 39 21873 1738 ----
NM_032813chr131419 --1724 --
NM_032828chr1983503 3181 1837 603 486 463 332 231 13130 2926 877 --
NM_032839chr3--1411 ----
NM_032859chr1343641 2751 1588 1374 ------
NM_032866chr1563168 2581 1230 714 496 393 22862 127 ----
NM_032875chr172541 532 ------
NM_032876chr1431423 336 224 ----12062
NM_032900chr1053886 3213 3194 488 31 --13698 --
NM_032926chrX1189 ------
NM_032961chr411286 ------
NM_032968chrX----34147 2633 334 --
NM_032969chrX----34147 2633 334 --
NM_032971chrY2947 264 ------
NM_032972chrY2947 264 ------
NM_032973chrY14139 --22632 334 --
NM_032978chr18166 1354 ----
NM_032979chr18166 1354 ----
NM_032981chr18166 1354 ----
NM_032998chr12787 180 --1926 --
NM_033012chr131410 --1136 --
NM_033020chr124315 3214 43929 3711 891 528 13269 --
NM_033023chr72913 829 ------
NM_033027chr31118 --2947 885 --
NM_033036chr1111690 11448 173 --
NM_033044chr111080 ------
NM_033055chr11349 ------
NM_033082chr12172 ------
NM_033089chr201388 --1133 --
NM_033132chr1322222 1792 ------
NM_033135chr1142465 720 399 271 ----1656
NM_033136chr531643 1411 468 1640 ----
NM_033137chr531643 1411 468 1640 ----
NM_033138chr72561 141 --1235 --
NM_033139chr72561 141 --1235 --
NM_033140chr72561 141 --1235 --
NM_033141chr1422116 260 1531 --11410
NM_033143chr444403 4253 4238 2855 13239 34508 4281 49 11425
NM_033157chr72561 141 --1235 --
NM_033181chr663932 3234 3208 2823 1563 990 --1106 --
NM_033201chr1631182 351 224 --1398 --
NM_033215chrX--1403 ----
NM_033224chr787448 6793 5832 5227 2713 2365 1709 354 25778 2647 16748 --
NM_033225chr811039 ------
NM_033226chr16------1170
NM_033251chr16138 1368 ----
NM_033274chr523564 85 ------
NM_033285chr854255 3657 3021 2763 756 --13548 --
NM_033290chrX22578 1144 11320 ----
NM_033300chr141176 972 45 24 ------
NM_033305chr92406 243 11353 ----
NM_033326chr11--21789 783 --22486 1853
NM_033331chr91232 ----13162
NM_033334chr91228 ------
NM_033340chr10----188 --
NM_033360chr1231203 612 235 1899 ----
NM_033375chr1721179 1130 --11463 1241
NM_033380chrX2816 138 ------
NM_033381chrX2816 138 ------
NM_033389chr1723744 3698 --21022 1008 --
NM_033394chr2----11064 --
NM_033401chr161129 ------
NM_033426chr14--1141 --22033 1079
NM_033427chr7--1228 ----
NM_033429chr1543176 2443 2413 1194 1674 ----
NM_033480chr61316 ------
NM_033481chr61316 ------
NM_033495chrX11058 ------
NM_033503chr1521205 669 13243 ----
NM_033505chr296535 6040 5719 4761 2426 1665 1070 1054 292 24226 2356 ----
NM_033535chr441188 1161 401 56 ----1290
NM_033540chr31976 ------
NM_033542chr2011503 ----1273
NM_033551chr51417 12566 43182 2834 1107 567 12700
NM_033631chr12739 651 ------
NM_033644chr522516 1821 ------
NM_033645chr522516 1821 ------
NM_052827chr1211007 ------
NM_052832chr842775 2098 1836 1083 ------
NM_052840chr1511191 11566 ----
NM_052849chr151664 ------
NM_052851chr1322041 549 11774 1840 --
NM_052864chr421384 751 ------
NM_052867chr13----11102 --
NM_052874chr163688 249 236 --1660 --
NM_052879chr1234026 1465 1398 ------
NM_052886chr832074 1541 1477 ------
NM_052896chr162007 1618 547 495 478 413 11638 --1176
NM_052897chr12------1224
NM_052898chr83726 717 567 ------
NM_052900chr81557 11599 ----
NM_052904chr6----182 --
NM_052905chr211441 11626 ----
NM_052907chr1273488 3367 2934 1506 635 323 34 ----1612
NM_052911chr181889 ------
NM_052918chr1031369 978 380 21195 832 ----
NM_052927chr512062 22118 496 ----
NM_052934chr141984 587 548 21 11618 11684 --
NM_052936chrX1740 1102 ----
NM_053002chr31236 2856 440 ----
NM_053016chr977388 7281 7119 6690 6600 3143 2796 --1396 --
NM_053025chr311799 11724 ----
NM_053026chr311799 11724 ----
NM_053027chr311799 11724 ----
NM_053028chr311799 11724 ----
NM_053031chr311799 11724 ----
NM_053032chr311799 11724 ----
NM_053043chr765909 5425 5397 5047 3872 2306 11293 35612 5477 1729 15473
NM_053056chr1152223 2085 1109 700 688 22528 1192 ----
NM_053064chr1442845 2392 2203 134 ------
NM_053281chrX1272 ------
NM_054016chr131757 1474 639 12039 ----
NM_054016chr131757 1474 639 12039 ----
NM_054016chr131757 1474 639 12039 ----
NM_054027chr532025 1964 1766 11704 ----
NM_054108chr11158 ------
NM_054114chr6------123
NM_057159chr941185 995 575 433 ------
NM_057161chr61109 ------
NM_057164chr21111 ------
NM_057165chr21111 ------
NM_057166chr21111 ------
NM_057167chr21111 ------
NM_057175chr41274 ------
NM_057178chr1731735 384 154 ----1140
NM_058170chr12216 172 ------
NM_058237chr141776 ------
NM_058241chr221743 1604 ------
NM_058241chr221743 1604 ------
NM_058243chr19--1127 1131 --
NM_078487chr913091 11182 ----
NM_078625chr61193 --1906 --
NM_080491chr1123296 1166 --1239 --
NM_080544chr351339 986 911 117 37 ------
NM_080546chr911759 ----1536
NM_080550chr1711048 ------
NM_080599chr1021140 799 1812 ----
NM_080612chrX32275 1783 22 1980 ----
NM_080617chr201227 ------
NM_080645chr621904 1616 --1494 1335
NM_080664chr142651 496 1443 31537 585 450 --
NM_080666chr1411477 --11701 --
NM_080669chr1724194 3661 --34883 3162 1574 --
NM_080671chr21683 12003 ----
NM_080676chr2053168 2910 2303 873 224 21283 1053 ----
NM_080679chr61641 --1949 --
NM_080680chr61641 --1949 --
NM_080681chr61641 --1949 --
NM_080738chr1--1288 1520 1540
NM_080759chr1322402 26 --12338 --
NM_080760chr1322402 26 --12338 --
NM_080821chr2032042 1461 738 ----22009 1737
NM_080872chr823007 345 23033 2633 ----
NM_100264chr101260 ------
NM_100486chr101260 ------
NM_130385chr1152237 2054 2047 1231 694 1766 ----
NM_130391chr923025 2459 ------
NM_130392chr923025 2459 ------
NM_130393chr923025 2459 ------
NM_130436chr2162716 2662 2608 1977 899 619 --1192 --
NM_130438chr2163293 3239 3185 2554 2268 1196 --1769 --
NM_130439chr1051862 814 746 623 573 ----1652
NM_130439chr1051862 814 746 623 573 ----1652
NM_130440chr131184 1116 288 ------
NM_130442chr731166 318 22 ------
NM_130446chr322840 374 --33865 461 260 --
NM_130466chr1231184 713 480 194 1507 --
NM_130797chr711317 ------
NM_130798chr1511357 ------
NM_130809chr522118 322 1160 ----
NM_130811chr2021027 56 ------
NM_130846chr123950 892 117 ------
NM_133170chr20107545 7274 7179 6755 5777 5768 5739 3078 1509 1334 45578 5479 1324 1053 ----
NM_133264chr1733746 2610 162 --1814 11253
NM_133329chr231859 1620 617 ------
NM_133369chr54829 679 616 346 ------
NM_133370chr453545 2934 2858 1102 850 ----12906
NM_133372chr521999 626 22965 2243 ----
NM_133378chr22937 381 ----1730
NM_133432chr22937 381 ----1730
NM_133437chr22937 381 ----1730
NM_133468chr731768 772 493 ------
NM_133478chr232521 2065 1902 22448 2160 12197 --
NM_133486chrX------1341
NM_133625chr32391 312 ------
NM_133631chr311548 1360 ----
NM_133638chr521159 487 11369 ----
NM_133642chr222220 34 --195 --
NM_133646chr222062 1020 13940 --25396 2208
NM_134325chr131519 122 83 11153 11219 --
NM_134424chr1221115 1001 --1431 --
NM_134442chr21108 ------
NM_138270chrX32861 1084 309 ------
NM_138277chr61188 ------
NM_138300chr121260 34 ------
NM_138333chr922546 397 12581 ----
NM_138338chr2243367 3342 2658 561 ------
NM_138340chr181623 --1226 --
NM_138357chr1021547 87 ------
NM_138373chr1921182 667 ----1632
NM_138395chr211036 ------
NM_138423chr1541986 1809 633 157 --1564 --
NM_138426chr722304 237 ------
NM_138444chr1354809 3725 1736 1659 1456 11143 21744 269 --
NM_138457chr623092 1010 ------
NM_138473chr1234902 1851 355 ------
NM_138492chr541393 1258 991 289 --128 --
NM_138558chr131020 137 92 ------
NM_138565chr111348 1192 --2880 536
NM_138609chr5132 ------
NM_138610chr5132 ------
NM_138633chr62499 283 1633 124 --
NM_138638chr1452085 1518 707 498 259 11593 ----
NM_138643chr18177 ------
NM_138644chr18177 ------
NM_138713chr1687509 6122 5735 5333 3091 2480 1419 158 15443 12447 --
NM_138714chr1687509 6122 5735 5333 3091 2480 1419 158 15443 12447 --
NM_138727chr121791 852 ------
NM_138728chr121791 852 ------
NM_138730chr62338 183 ------
NM_138735chr21164 ------
NM_138773chr51250 ------
NM_138775chr111691 ------
NM_138779chr13158 ------
NM_138799chr221810 273 --1184 1180
NM_138811chr711123 1966 ----
NM_138927chr21--154 ----
NM_138931chr31970 ----1255
NM_138966chr18--1477 ----
NM_138967chr1522247 234 --22162 996 --
NM_138970chr141432 ------
NM_138981chr4----155 --
NM_138991chr21--1279 ----
NM_138992chr21161 ------
NM_138994chr161129 ------
NM_139012chr642257 2097 1991 365 ------
NM_139014chr642337 2177 2071 445 ------
NM_139015chr121613 11279 11165 --
NM_139048chr311123 ------
NM_139057chr1522338 2009 2636 396 1557 --
NM_139068chr51231 --155 --
NM_139069chr51231 --155 --
NM_139070chr51100 ------
NM_139131chr11------1645
NM_139132chr112816 32 ----1349
NM_139156chr12120 89 --171 1133
NM_139168chr5--1644 11990 --
NM_139207chr12--12162 ----
NM_139244chr63760 749 131 1336 ----
NM_139276chr1721907 1515 ------
NM_139283chr1251645 1613 1032 647 55 41884 1774 1621 950 ----
NM_139312chr1021395 963 ------
NM_144571chr456519 4373 2033 1435 426 12777 ----
NM_144578chr1454659 4383 3994 3441 1055 ------
NM_144579chr252621 2488 2263 2055 991 12003 12435 12373
NM_144586chr21451 --1246 --
NM_144590chr103848 516 281 12799 ----
NM_144599chr1524773 1657 21607 808 14752 --
NM_144625chr1--1396 ----
NM_144631chr2122 ------
NM_144632chr242263 645 533 276 31889 1823 1777 ----
NM_144633chr32545 325 2939 477 1159 --
NM_144635chr32439 195 --1399 --
NM_144636chr32677 540 ------
NM_144642chr31426 11126 ----
NM_144643chr41312 ------
NM_144660chr101343 ------
NM_144664chr111375 ------
NM_144685chr19----1213 --
NM_144690chr19--2507 370 ----
NM_144723chr5134 ------
NM_144728chr11655 ------
NM_144729chr11655 ------
NM_144732chr191402 ------
NM_144778chr13--32245 474 112 --1856
NM_144967chrX2884 225 ------
NM_144973chr1245343 5114 3874 111 --24594 2146 --
NM_145049chr51429 ------
NM_145055chr1833260 2877 616 12794 ----
NM_145056chr191292 ------
NM_145065chr1141113 974 287 194 --1359 --
NM_145117chr1133259 2683 608 ----23268 486
NM_145206chr1022861 2537 ------
NM_145234chrX2897 131 ------
NM_145239chr1611196 ------
NM_145245chr1911230 ------
NM_145246chr1041217 1166 926 61 ------
NM_145259chr276511 6043 5247 2699 2321 1314 561 1419 ----
NM_145276chr191967 1907 1406 --
NM_145305chrX21284 139 ------
NM_145307chr1023740 1578 12940 ----
NM_145313chr10----21313 1039 --
NM_145320chr753103 2719 1298 422 339 ------
NM_145321chr753103 2719 1298 422 339 ------
NM_145322chr753103 2719 1298 422 339 ------
NM_145331chr61281 ------
NM_145341chr1031449 409 268 ------
NM_145649chr632723 2584 709 1681 ----
NM_145655chr632723 2584 709 1681 ----
NM_145686chr233107 2239 380 12268 12448 --
NM_145687chr233107 2239 380 12268 12448 --
NM_145690chr841532 776 483 143 --2321 66 --
NM_145698chr1011413 --11370 --
NM_145716chr12439 176 ------
NM_145731chr223662 548 190 ------
NM_145738chr223662 548 190 ------
NM_145739chr22551 56 1541 ----
NM_145799chrX42577 2392 119 21 ------
NM_145800chrX2792 21 ----11030
NM_145802chrX1741 ----1979
NM_145804chr111264 --159 --
NM_145805chr15139 --163 --
NM_145808chr752824 2368 2096 1158 654 11115 ----
NM_145861chr1--1288 1520 1540
NM_145893chr1611825 --144 --
NM_145912chr2241498 475 351 334 --44398 3286 1308 175 --
NM_145913chr1221059 719 1838 1359 --
NM_146388chr191900 ------
NM_147147chr653954 3763 3575 1594 1149 11040 21585 225 13424
NM_147150chr963487 3434 3096 2923 2632 1587 1640 12815 --
NM_147156chr102269 212 ------
NM_147161chr12820 24 ------
NM_147171chr71195 ------
NM_147175chrX21573 863 ------
NM_147185chr71195 ------
NM_147189chr832112 2016 134 1869 ----
NM_147202chr932635 1813 511 11763 ----
NM_147223chr2--12222 11860 --
NM_147233chr2--12039 11677 --
NM_147686chr6137 ------
NM_148174chr821728 382 ------
NM_148898chr72877 348 ------
NM_148899chr72877 348 ------
NM_148921chr1732254 1852 588 ------
NM_152133chr6------123
NM_152253chr2234042 2885 1072 --21410 1379 --
NM_152261chr1221789 820 ------
NM_152263chr166064 4984 4850 2334 1489 832 23955 200 ----
NM_152265chr121190 582 ------
NM_152271chr821049 997 --11027 --
NM_152280chr152975 2337 619 424 380 --1515 --
NM_152282chr31324 1949 --135
NM_152287chr1652133 979 807 600 296 --1495 --
NM_152291chr41838 ----1909
NM_152305chr341712 681 347 135 1891 12213 1541
NM_152330chr1432379 1721 614 12297 1654 --
NM_152331chr14----1101 --
NM_152332chr1411993 11755 --12360
NM_152350chr174654 540 174 149 ------
NM_152352chr1832822 2632 981 12482 12806 --
NM_152365chr12339 154 ------
NM_152371chr11742 21834 1776 ----
NM_152380chr121255 595 ------
NM_152388chr223484 3299 13837 21478 1360 --
NM_152390chr22629 142 ------
NM_152399chr42512 112 1242 ----
NM_152409chr553508 3190 2762 1424 267 --12826 --
NM_152414chr8--11175 ----
NM_152417chr821041 412 --11132 --
NM_152420chr91488 ----1191
NM_152424chrX63911 3405 2863 1574 1441 1151 --44000 3827 1810 1672 13233
NM_152437chr1222356 381 22099 158 ----
NM_152440chr1251079 1028 888 217 98 ------
NM_152450chr1542123 2021 615 491 ------
NM_152451chr151797 ------
NM_152455chr1542892 1847 915 623 1126 1580 --
NM_152470chr1853500 1506 1088 484 387 ------
NM_152486chr11398 ------
NM_152493chr121070 1045 ------
NM_152496chr12881 61 ------
NM_152519chr221529 224 ------
NM_152520chr221079 922 --11088 --
NM_152523chr21689 ------
NM_152527chr2143 11720 11487 --
NM_152529chr221368 691 31668 945 587 14204 11583
NM_152542chr42596 559 2841 53 ----
NM_152556chr71193 31660 1580 209 ----
NM_152570chr9194 ------
NM_152581chrX31391 358 150 ------
NM_152594chr1521551 661 --1163 --
NM_152622chr532446 2402 2379 12859 ----
NM_152624chr576387 6301 2719 2237 958 765 584 --12348 --
NM_152629chr922690 2552 2596 542 22992 475 13274
NM_152636chr1122444 835 11148 ----
NM_152641chr1232662 2355 759 32910 951 650 11978 --
NM_152653chr3--1507 ----
NM_152660chr11188 ------
NM_152663chr1----1220 --
NM_152688chr61641 ------
NM_152694chrX3693 331 301 --161 --
NM_152699chr352881 2296 1511 1403 170 --22973 2387 --
NM_152704chr131368 ----135
NM_152733chr686483 4725 2227 1987 1931 1001 856 631 --1825 16296
NM_152737chr621788 1629 12058 1697 --
NM_152742chr72593 573 ------
NM_152745chr74822 459 273 238 1438 ----
NM_152749chr71949 1366 ----
NM_152754chr722809 379 ------
NM_152756chr5--13826 ----
NM_152774chr742732 2441 2097 2025 --1883 --
NM_152780chrX11311 11037 ----
NM_152782chr7132 ----126
NM_152787chrX43749 3397 639 446 32426 885 741 13829 --
NM_152789chr711289 --1578 --
NM_152835chr131953 759 366 ------
NM_152860chr1251519 1403 1249 166 93 199 ----
NM_152888chr82974 95 ------
NM_152902chr141918 1663 761 399 11999 ----
NM_152912chr13122 ------
NM_152924chr1576659 5336 4697 4164 2207 2157 134 ----15977
NM_152994chr2--1620 183 --
NM_152999chr754928 4127 1372 1363 1164 33137 3054 46 ----
NM_153013chr511855 --21942 1810 --
NM_153020chr621368 1130 ----1120
NM_153026chr122430 115 ------
NM_153035chr123010 2409 1305 1593 1333
NM_153042chr61408 ------
NM_153050chr2231561 1357 84 --23791 1392 --
NM_153051chr2231561 1357 84 --23791 1392 --
NM_153181chr18--1477 ----
NM_153184chr341350 638 504 483 --11406 --
NM_153188chr575603 4682 4480 4230 3823 1672 930 ------
NM_153207chr1232813 2740 305 --12592 --
NM_153235chr612157 ------
NM_153252chrX--1132 ----
NM_153255chr62947 358 ------
NM_153257chr1911175 --11099 --
NM_153273chr311091 ----12139
NM_153331chr33649 537 169 ------
NM_153332chr842305 1059 751 497 --1779 --
NM_153333chrX1227 ------
NM_153347chr1172608 2396 2251 2135 1077 364 356 11686 --1750
NM_153367chr1043992 3788 2937 1507 --23543 283 --
NM_153456chr1345305 2538 2022 863 15725 1655 --
NM_153487chr654610 4595 4463 2946 223 --14072 --
NM_153499chr1242952 923 915 178 1393 11076 --
NM_153500chr1242952 923 915 178 1393 11076 --
NM_153607chr5--2776 83 ----
NM_153613chr15----158 --
NM_153616chr15124 1548 ----
NM_153617chr15124 1548 ----
NM_153618chr15124 1548 ----
NM_153619chr1552470 1262 1021 354 137 11175 1949 --
NM_153620chr721343 461 1724 ----
NM_153634chr12--11601 ----
NM_153649chr131594 835 741 --11549 --
NM_153715chr71455 1237 ----
NM_153759chr211112 ------
NM_153769chr18177 ------
NM_153810chr1021382 636 23404 413 13408 --
NM_153816chr61331 ------
NM_153828chr22180 141 ------
NM_153831chr82828 665 ------
NM_153836chr231757 738 158 ------
NM_170600chr91393 ------
NM_170665chr1244217 1483 907 656 14266 12945 --
NM_170674chr152531 317 154 ----
NM_170675chr151207 ------
NM_170676chr151207 ------
NM_170677chr152531 317 154 ----
NM_170679chr511023 ------
NM_170692chr11234 ------
NM_170695chr181352 ------
NM_170706chr163208 1578 446 407 368 290 --11049 --
NM_170709chr852036 1764 1719 748 426 ------
NM_170724chr62970 836 11102 ----
NM_170725chr11173 ------
NM_170731chr1152731 2629 2503 303 168 ------
NM_170732chr1152731 2629 2503 303 168 ------
NM_170733chr1152731 2629 2503 303 168 ------
NM_170734chr1152731 2629 2503 303 168 ------
NM_170735chr1152731 2629 2503 303 168 ------
NM_170775chr51253 ------
NM_171825chr523016 793 ----1108
NM_171998chrX2685 27 --1756 1237
NM_171999chr181661 --1277 --
NM_172127chr421767 127 --1641 143
NM_172128chr421723 83 --1597 --
NM_172159chr31255 ------
NM_172160chr31255 ------
NM_172206chr1721408 70 ------
NM_172216chr1242854 825 817 80 1295 1978 --
NM_172226chr1242952 923 915 178 1393 11076 --
NM_172230chr11159 ------
NM_172240chr1221398 103 1433 ----
NM_172315chr152531 317 154 ----
NM_172316chr152531 317 154 ----
NM_172337chr141275 ------
NM_172344chr231859 1620 617 ------
NM_172375chr1411073 ----1870
NM_173054chr7----1997 --
NM_173065chr123110 1118 --12217 12534
NM_173076chr21786 1236 1673 --
NM_173157chr12153 145 ----
NM_173163chr16125 ------
NM_173171chr211300 --1358 --
NM_173173chr211300 --1358 --
NM_173191chr1031378 1190 896 --142 --
NM_173192chr1031378 1190 896 --142 --
NM_173193chr1031378 1190 896 --142 --
NM_173194chr1031378 1190 896 --142 --
NM_173195chr1031378 1190 896 --142 --
NM_173207chr181352 ------
NM_173208chr181352 ------
NM_173209chr181352 ------
NM_173210chr181352 ------
NM_173211chr181352 ------
NM_173214chr1687509 6122 5735 5333 3091 2480 1419 158 15443 12447 --
NM_173355chr21908 1110 ----
NM_173469chr1521486 468 ------
NM_173475chr1611186 ------
NM_173476chr1621395 375 --31855 1623 767 21883 1707
NM_173491chr531396 373 56 --11431 --
NM_173508chr11135 ------
NM_173517chr71418 ------
NM_173552chr3--21715 899 --1714
NM_173557chr181739 ------
NM_173576chr101222 22062 1777 1307 --
NM_173582chr1176081 5247 5112 4987 4066 1546 581 26096 4968 --12414
NM_173595chr1265260 4890 4694 1783 1504 988 --24860 4778 --
NM_173602chr1223563 2551 13067 13421 --
NM_173609chr15--1538 1692 --
NM_173623chr17----1732 --
NM_173632chr1942984 1133 697 468 23370 568 23120 2443 --
NM_173642chr188767 7679 6118 5950 3322 2555 1881 1387 22922 1942 28608 2393 --
NM_173681chr732075 1910 537 --31529 1403 810 1159
NM_173683chr82515 471 ----11620
NM_173694chrX32126 582 148 11579 ----
NM_173797chr51378 1328 ----
NM_173808chr124383 3565 ------
NM_173814chr15----1162 1121
NM_173833chr821607 292 --192 --
NM_173834chrX1429 ------
NM_173851chr832720 59 52 1108 ----
NM_173872chr41625 ------
NM_174856chr202328 257 ------
NM_174858chr13876 264 180 1944 ----
NM_174886chr181352 ------
NM_174890chr101244 ------
NM_174893chr17188 ------
NM_174916chr1532234 1513 462 --1115 --
NM_175038chr121236 ------
NM_175056chr32804 541 31923 213 87 ----
NM_175061chr731465 773 120 --1460 --
NM_175607chr331351 611 377 --1576 --
NM_175610chr152914 154 1181 ----
NM_175612chr331351 611 377 --1576 --
NM_175623chr1286955 5287 5152 2878 2746 2105 1850 163 --34917 1488 21 --
NM_175624chr1287050 5382 5247 2973 2841 2200 1945 258 --35012 1583 116 --
NM_175625chr1287050 5382 5247 2973 2841 2200 1945 258 --35012 1583 116 --
NM_175629chr211112 ------
NM_175634chr821230 1178 ------
NM_175635chr821230 1178 ------
NM_175636chr821230 1178 ------
NM_175736chr1257638 7612 7318 2227 1154 12618 44993 2851 2778 113 25259 490
NM_175744chr1126 --191 --
NM_175767chr541677 1632 359 243 ------
NM_175854chr13--1544 ----
NM_175859chrX31749 1300 386 --11432 11668
NM_175863chr631035 437 315 ------
NM_175866chr131377 334 226 ------
NM_175873chr51933 11368 ----
NM_175876chr12514 439 ------
NM_175907chr1832676 2337 998 1886 ----
NM_176081chr1085136 5068 4357 4307 3976 3728 1363 155 35422 4958 3928 15944 1809
NM_176083chr1085136 5068 4357 4307 3976 3728 1363 155 35422 4958 3928 15944 1809
NM_176787chr1831380 616 353 ------
NM_176814chr721401 1180 ------
NM_176863chr1731997 1712 1524 11782 --11623
NM_177398chr121770 279 --1321 --
NM_177399chr121770 279 --1321 --
NM_177405chr2272121 2079 2073 2004 1450 531 83 11936 41841 1715 1495 623 --
NM_177438chr1444165 4114 3425 2842 13599 12916 --
NM_177538chr2158497 7767 7494 6843 6436 6300 5363 2841 2706 1992 1866 1525 1219 952 536 37988 5937 2297 17449 1262
NM_177553chr111835 ------
NM_177559chr201799 21029 942 ----
NM_177560chr201799 21029 942 ----
NM_177947chrX11669 ------
NM_177948chrX11669 ------
NM_177966chr32736 481 --11528 --
NM_177969chr2--1236 ----
NM_177972chr1152968 1314 1052 966 921 --13436 1240
NM_177974chr1541986 1809 633 157 --1564 --
NM_177977chr1741904 1370 688 630 ----11634
NM_177989chr31344 ------
NM_177996chr2033389 3021 2944 --13367 --
NM_178006chr1322041 549 11774 1840 --
NM_178007chr1322041 549 11774 1840 --
NM_178042chr31344 ------
NM_178120chr2----11217 --
NM_178126chr171636 --3915 586 363 11482
NM_178135chr421096 216 --11185 1393
NM_178140chr522192 1898 ------
NM_178151chrX57727 5120 4844 1484 967 26563 1490 15211 --
NM_178152chrX57727 5120 4844 1484 967 26563 1490 15211 --
NM_178153chrX57727 5120 4844 1484 967 26563 1490 15211 --
NM_178270chrX1740 1102 ----
NM_178313chr242196 2183 1798 1353 --1828 --
NM_178423chr72260 78 ------
NM_178425chr72260 78 ------
NM_178426chr11674 --2855 27 --
NM_178439chr21199 ------
NM_178450chr5169 ------
NM_178454chr11649 --1212 --
NM_178539chr1221951 1753 1194 ----
NM_178554chr343608 3328 2450 1387 --3726 474 402 --
NM_178557chr42479 453 --11256 --
NM_178565chr811633 1274 ----
NM_178566chr9--11779 137 11433
NM_178585chr442890 2714 2673 2526 11103 ----
NM_178812chr821213 1204 11581 ----
NM_178830chr191226 ------
NM_180976chr62846 194 1991 1677 --
NM_180977chr62846 194 1991 1677 --
NM_181054chr1411045 ------
NM_181077chr1531561 1439 352 1517 ----
NM_181332chrX12272 ------
NM_181349chr722068 302 --22467 2041 2777 403
NM_181354chr81216 196 ----
NM_181358chr113761 11115 ----
NM_181442chr20131 ------
NM_181453chr231074 408 230 11526 ----
NM_181457chr231241 532 317 ------
NM_181458chr221374 450 ------
NM_181459chr231140 431 216 ------
NM_181460chr231187 478 263 ------
NM_181481chr1896008 5824 4779 2595 2105 1803 1729 1306 958 36670 4830 4815 ----
NM_181482chr1896008 5824 4779 2595 2105 1803 1729 1306 958 36670 4830 4815 ----
NM_181483chr1896008 5824 4779 2595 2105 1803 1729 1306 958 36670 4830 4815 ----
NM_181491chr91447 2597 175 52585 912 832 608 110 --
NM_181492chr22288 46 ----21085 99
NM_181504chr532965 2834 809 ------
NM_181507chr113953 363 53 ------
NM_181508chr113953 363 53 ------
NM_181521chr1655836 4561 1040 86 38 12374 --1481
NM_181523chr532965 2834 809 ------
NM_181524chr532965 2834 809 ------
NM_181534chr17183 128 ----
NM_181571chr102433 296 ------
NM_181645chr11--1197 ----
NM_181656chr171876 ------
NM_181671chr17----1294 --
NM_181689chr201745 ----1350
NM_181701chr921481 238 ----160
NM_181704chr2121322 1010 11059 ----
NM_181705chr575823 5706 5503 3967 1993 813 362 32166 1800 454 13833 --
NM_181706chr1151555 1498 822 766 310 --2913 778 12262
NM_181726chr42165 47 ------
NM_181746chr11966 ------
NM_181762chrX21113 915 ------
NM_181777chrX21113 915 ------
NM_181782chr631915 349 173 11546 ----
NM_181784chr22617 311 --11870 --
NM_181807chr111101 1140 ----
NM_181825chr223806 155 73 1241 ----
NM_181836chr532514 1801 596 ------
NM_181839chr811130 11400 ----
NM_181876chr452154 1053 857 575 39 1941 1431 --
NM_181886chr43969 347 153 1564 ----
NM_181887chr43969 347 153 1564 ----
NM_181888chr43969 347 153 1564 ----
NM_181889chr43969 347 153 1564 ----
NM_181890chr43969 347 153 1564 ----
NM_181891chr43969 347 153 1564 ----
NM_181892chr431016 394 200 142 ----
NM_181893chr43969 347 153 1564 ----
NM_182481chr2111227 1844 ----
NM_182482chr2111227 1844 ----
NM_182484chr2121322 1010 11059 ----
NM_182485chr413177 --13554 --
NM_182488chr131202 ------
NM_182509chr1431509 1023 304 --1214 11430
NM_182526chr1462727 2683 2277 2061 2023 84 ------
NM_182527chr2222094 602 11844 ----
NM_182537chr31281 ------
NM_182641chr1711534 ------
NM_182646chr413177 --13554 --
NM_182648chr14169 ------
NM_182666chr3--1523 ----
NM_182678chr22527 411 ------
NM_182685chr12796 640 ------
NM_182691chr731352 951 243 ------
NM_182692chr731352 951 243 ------
NM_182715chr72893 784 ------
NM_182717chr102973 70 ------
NM_182718chr102433 296 ------
NM_182719chr102433 296 ------
NM_182720chr102973 70 ------
NM_182721chr102973 70 ------
NM_182722chr102973 70 ------
NM_182723chr102973 70 ------
NM_182724chr102433 296 ------
NM_182725chr102433 296 ------
NM_182728chr1411217 --1208 --
NM_182729chr1241792 1432 464 271 --155 --
NM_182742chr1241792 1432 464 271 --155 --
NM_182743chr1241792 1432 464 271 --155 --
NM_182758chr151167 23759 3303 ----
NM_182767chr1222087 736 11442 ----
NM_182769chr102433 296 ------
NM_182770chr102433 296 ------
NM_182771chr102433 296 ------
NM_182772chr102433 296 ------
NM_182796chr52682 177 ------
NM_182797chr20----1535 21282 547
NM_182850chr102433 296 ------
NM_182853chr102973 70 ------
NM_182898chr731714 1054 48 --24613 1484 --
NM_182899chr731714 1054 48 --24613 1484 --
NM_182907chr632442 1581 933 ------
NM_182920chr311097 ------
NM_182947chr121214 ------
NM_182948chr123104 1977 --11170 --
NM_182964chr1133259 2683 608 ----23268 486
NM_182970chr2034290 3095 1379 --1366 --
NM_182972chr122060 1899 32716 743 504 ----
NM_182976chr1198 ------
NM_182983chr191201 ------
NM_183004chr1422616 1270 1110 ----
NM_183006chr2011353 --2967 404 --
NM_183011chr102973 70 ------
NM_183012chr102973 70 ------
NM_183013chr102973 70 ------
NM_183060chr102433 296 ------
NM_183237chr32965 426 ------
NM_183353chrX----1770 --
NM_183377chr173290 195 121 --1654 --
NM_183393chr32956 52 --2197 102 --
NM_183394chr32956 52 --2197 102 --
NM_183397chr2045056 4313 3635 270 ------
NM_183415chr1231184 713 480 194 1507 --
NM_183416chr111415 1804 --11918
NM_183421chr82919 865 ------
NM_183422chr132284 247 1134 ----
NM_194071chr765237 5076 4168 3335 2180 1758 33842 3604 3528 34512 3458 187 --
NM_194247chr224124 1156 14279 12882 --
NM_194271chr122589 274 --1173 --
NM_194277chrX2213 39 ------
NM_194282chr41199 11090 11097 11232
NM_194285chr1142202 1226 1058 272 12637 --12983
NM_194301chr14179 ------
NM_194313chr94760 410 206 124 ------
NM_194314chr134952 4758 392 33476 1358 906 ----
NM_194317chr222451 1837 12702 ----
NM_194356chr1231997 1958 28 --1690 --
NM_194449chr18--1966 ----
NM_194454chr711133 ------
NM_194455chr711133 ------
NM_194456chr711133 ------
NM_197941chr532948 1002 817 ------
NM_197966chr22--190 1899 --
NM_197967chr22--190 1899 --
NM_197968chr134629 292 140 51 ------
NM_197977chr91843 ----1369
NM_198042chr82150 59 --1116 --
NM_198043chr102437 129 ------
NM_198044chr102437 129 ------
NM_198045chr102437 129 ------
NM_198046chr102437 129 ------
NM_198081chr662901 2094 1925 924 437 318 11093 ----
NM_198086chr1431423 336 224 ----12062
NM_198123chr81557 11599 ----
NM_198124chr81557 11599 ----
NM_198151chr71252 --1547 --
NM_198158chr331931 344 119 ------
NM_198159chr331931 344 119 ------
NM_198177chr331931 344 119 ------
NM_198178chr331931 344 119 ------
NM_198181chr1522803 966 --1439 --
NM_198215chr10------1238
NM_198240chr1221255 341 ----11218
NM_198243chr153850 206 83 ------
NM_198264chr11373 ------
NM_198268chr113761 11115 ----
NM_198269chr113761 11115 ----
NM_198270chrX33231 3095 831 21189 1109 ----
NM_198291chr2031896 1536 701 ------
NM_198317chr12112 38 ------
NM_198334chr111358 ------
NM_198335chr111358 ------
NM_198381chr111116 ----1296
NM_198390chr161503 11850 21564 1513 11630
NM_198395chr51944 ------
NM_198400chr1551945 1876 1104 863 210 11965 ----
NM_198446chr11159 ------
NM_198450chrX21629 701 22053 143 11588 --
NM_198484chr394936 4388 4049 2054 1977 1715 1478 882 33 16135 ----
NM_198503chr122255 1762 1708 ----
NM_198513chr81618 ----11474
NM_198581chr266609 5337 5127 5037 4672 2373 35949 4987 293 ----
NM_198597chr101178 ------
NM_198686chr1432447 1023 492 157 --12088
NM_198700chr11178 ------
NM_198718chr12297 101 ------
NM_198793chr312885 11599 ----
NM_198794chr1421464 368 ----1953
NM_198829chr721071 997 ------
NM_198834chr1721910 1829 1903 ----
NM_198836chr1721910 1829 1903 ----
NM_198837chr1721910 1829 1903 ----
NM_198838chr1721910 1829 1903 ----
NM_198839chr1721910 1829 1903 ----
NM_198859chr322055 406 44111 1933 1137 602 25108 3194 --
NM_198880chr3----1577 --
NM_198883chr1142 ------
NM_198896chr1111977 ------
NM_198900chr1257638 7612 7318 2227 1154 12618 44993 2851 2778 113 25259 490
NM_198904chr531749 833 732 ------
NM_198935chr2032258 408 145 12873 ----
NM_198947chr112987 195 132 ----
NM_198968chr1363771 3178 3096 2431 1508 1347 1247 13821 23302 1216
NM_198990chr732940 2619 185 2845 233 12554 --
NM_198992chr1211237 1363 ----
NM_198993chr1751534 1477 1077 438 381 --140 11500
NM_198995chr182196 140 --1419 --
NM_199000chr721937 1416 1684 ----
NM_199040chr1263841 2610 775 203 111 30 12732 21522 1390 --
NM_199072chr712973 ------
NM_199076chr10----1100 --
NM_199138chr131368 ----135
NM_199160chr932052 1899 1779 ------
NM_199167chr18--1318 ----
NM_199168chr1021148 616 11002 1224 --
NM_199188chr1234026 1465 1398 ------
NM_199189chr511013 ------
NM_199190chr1234026 1465 1398 ------
NM_199245chr1242374 1956 454 234 --11926 --
NM_199320chr4--12381 ----
NM_199320chr4--12381 ----
NM_199324chr433366 1372 806 11406 12703 --
NM_199355chr162713 698 ------
NM_199436chr231992 1899 1183 ------
NM_199437chr1122542 40 ------
NM_199438chr1122542 40 ------
NM_199439chr1122542 40 ------
NM_199454chr142946 942 742 242 --14343 --
NM_199462chr134013 1877 844 1929 ----
NM_201269chr111101 11109 ----
NM_201274chr172533 25 ------
NM_201432chr1775993 5903 5424 5372 4941 2418 325 --52482 1455 613 246 69 11387
NM_201433chr1775993 5903 5424 5372 4941 2418 325 --52482 1455 613 246 69 11387
NM_201436chr71612 ----1710
NM_201437chr821279 968 ------
NM_201516chr71668 ----1766
NM_201517chr71612 ----1710
NM_201521chr61384 ------
NM_201522chr61384 ------
NM_201523chr61384 ------
NM_201535chr141114 ------
NM_201536chr141114 ------
NM_201537chr141114 ------
NM_201538chr141114 ------
NM_201539chr141114 ------
NM_201540chr141114 ------
NM_201541chr141114 ------
NM_201591chr421484 325 ------
NM_201592chr421484 325 ------
NM_201599chrX2937 789 --21205 56 1462
NM_201624chr11420 --1377 --
NM_201995chr11--1239 ----
NM_201999chr42835 159 ------
NM_203282chr19--21627 1395 ----
NM_203301chr1421547 422 ------
NM_203305chr982388 2364 2235 2092 863 693 272 124 --3891 177 114 --
NM_203327chr2033708 954 467 --24145 1352 23203 1748
NM_203341chr1----1430 --
NM_203350chr131409 521 114 ------
NM_203351chr1722099 588 --12255 --
NM_203354chr14--1310 ----
NM_203355chr14--1310 ----
NM_203356chr14--1310 ----
NM_203365chr22555 371 ------
NM_203372chr22592 70 11378 ----
NM_203390chr841470 1335 580 217 ----11387
NM_203399chr11825 ------
NM_203401chr11825 ------
NM_203404chr12120 89 --171 1133
NM_203406chr5--11859 12355 --
NM_203434chr91806 ------
NM_203446chr2122557 818 1210 ----
NM_203459chr1--12212 ----
NM_203463chr274764 4610 4466 4192 3268 199 148 --13952 --
NM_203487chr131186 143 195 --
NM_203504chr421859 282 ------
NM_203505chr421859 282 ------
NM_205836chr51533 ------
NM_205846chr541393 1258 991 289 --128 --
NM_205860chr153194 3051 2355 2167 1032 23125 2580 ----
NM_206594chr123642 919 --13446 --
NM_206595chr123642 919 --13446 --
NM_206839chr151475 ------
NM_206853chr644120 2750 1637 1241 11338 ----
NM_206854chr675381 4011 3707 3571 824 551 153 11084 ----
NM_206855chr6116346 4976 4672 4536 4199 3863 1789 1516 1118 945 480 12049 ----
NM_206866chr2153173 2531 2518 2406 216 --11282 --
NM_206876chr233595 1126 869 --12700 --
NM_206909chr896793 6315 6287 6207 3301 2971 2929 2376 1920 ----12073
NM_206914chr1231685 106 79 --11566 --
NM_206937chr132974 702 --1110 --
NM_206944chr9--1572 --1346
NM_206945chr9--1572 --1346
NM_206946chr9--1572 --1346
NM_206947chr9--1572 --1346
NM_207043chr131965 1887 1715 11643 11450 --
NM_207044chr131965 1887 1715 11643 11450 --
NM_207047chr131965 1887 1715 11643 11450 --
NM_207291chr193550 402 88 ------
NM_207292chr31644 2336 27 ----
NM_207293chr31644 2336 27 ----
NM_207294chr31644 2336 27 ----
NM_207295chr31644 2336 27 ----
NM_207296chr31644 2336 27 ----
NM_207297chr31669 2361 52 ----
NM_207299chr911008 1210 ----
NM_207303chr10--24096 1507 11101 1679
NM_207304chr13--22132 361 --1743
NM_207321chr1011069 ------
NM_207325chr1932019 1627 517 ------
NM_207332chr8--1109 ----
NM_207362chr2127 ------
NM_207371chr