TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-363-5p
miRNA Sequence: CGGGUGGAUCACGAUGCAAUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr8112521 2489 2081 2031 2020 1609 1559 674 665 575 547 --32071 1837 1703 --
NM_000038chr531362 438 272 --11847 --
NM_000055chr31348 ------
NM_000074chrX4895 849 798 76 --1782 --
NM_000084chrX116199 5385 4531 4421 4299 2590 2143 1471 1336 1248 923 25188 5126 27014 1819 14345
NM_000088chr1731205 495 286 2517 35 31132 1121 400 --
NM_000092chr223000 2821 ----12803
NM_000093chr992535 2199 1749 737 731 320 247 199 119 22097 1864 ----
NM_000103chr153443 277 23 --166 --
NM_000109chrX52619 1996 1938 933 596 ------
NM_000112chr545268 3366 1854 798 13971 14255 --
NM_000118chr94876 658 309 220 --3329 88 25 122
NM_000125chr643634 2885 2717 1455 --11476 --
NM_000129chr6--2993 386 2459 214 --
NM_000134chr421152 1096 --177 --
NM_000138chr153299 169 105 --12452 11852
NM_000141chr1031220 556 95 11356 ----
NM_000151chr1731831 1294 590 31731 1413 109 11623 --
NM_000165chr621671 1477 ----2655 32
NM_000168chr7103295 3254 3102 2697 2619 2158 1067 964 280 241 --12108 --
NM_000176chr543252 3120 2988 2794 ----13417
NM_000192chr123992 545 252 ----1120
NM_000208chr1953804 3235 1740 292 96 --33181 1538 833 --
NM_000214chr2041588 1562 1392 1160 ------
NM_000216chrX43393 3221 2852 838 --1341 11027
NM_000217chr1295206 4421 3853 3523 1962 1813 1790 1333 987 14238 15178 --
NM_000227chr183311 272 32 ------
NM_000232chr443002 2628 2482 283 ------
NM_000245chr751969 1673 1383 1365 653 1408 1601 2742 490
NM_000260chr11299 71 --2505 207 1204
NM_000264chr93638 57 51 23227 861 1248 1783
NM_000267chr1763481 3447 3046 2670 2648 125 --13295 --
NM_000278chr10132137 1895 1845 1835 1734 345 316 249 230 165 131 120 72 --1843 --
NM_000298chr14464 96 45 32 2690 246 ----
NM_000314chr1073274 3012 2670 2447 2073 917 409 --11181 --
NM_000330chrX32008 1955 454 21514 199 22273 654 --
NM_000332chr656130 5667 2624 2586 2214 16392 --16155
NM_000333chr31332 ----165
NM_000335chr361707 1575 1551 1467 1396 48 1565 ----
NM_000337chr586126 6077 5406 1337 1307 952 290 262 25489 682 35753 5567 276 --
NM_000361chr204716 604 426 53 11320 11314 --
NM_000362chr2293416 3175 3121 2781 1451 376 356 186 21 12814 32794 2412 226 --
NM_000368chr944372 3742 3506 1608 13689 24269 204 13221
NM_000376chr12122711 2623 2522 2460 2353 932 881 591 477 302 126 95 32703 1940 1169 12560 21030 140
NM_000399chr103322 84 57 ----1154
NM_000402chrX8519 509 198 154 135 125 53 38 --123 --
NM_000408chr252607 2184 1200 541 80 ------
NM_000435chr194994 733 638 112 21007 210 ----
NM_000445chr85902 868 295 239 212 1248 21001 880 --
NM_000448chr1112421 22537 108 11100 --
NM_000449chr151410 1135 1082 1066 990 1139 ----
NM_000461chr374098 2891 1431 722 428 376 294 ----1383
NM_000476chr951134 1128 1079 293 38 --189 --
NM_000482chr113129 56 27 ------
NM_000489chrX53342 3272 3196 2569 2359 --13318 --
NM_000503chr831837 1335 107 --11390 1539
NM_000530chr16405 364 285 209 201 48 --2447 370 --
NM_000533chrX1350 ----1588
NM_000539chr351179 1031 199 73 44 11103 11517 --
NM_000544chr6_cox_hap143115 2403 1146 987 12480 --12636
NM_000546chr1751191 472 327 152 40 --21111 1008 --
NM_000550chr93739 360 43 ------
NM_000554chr1993070 2888 2804 992 901 637 523 156 27 --2836 682 13325
NM_000555chrX157658 6982 6787 5760 5497 5167 5116 4997 2743 2687 2408 2199 835 714 229 17416 45600 4991 2578 1623 26004 2168
NM_000575chr2----1937 1292
NM_000599chr2154109 4065 3881 3801 3555 3493 3474 3316 3219 3193 3160 1400 1390 39 29 33644 3107 88 21307 74 13648
NM_000602chr74969 534 518 320 --2304 208 --
NM_000609chr1072336 1244 660 554 495 285 147 ----1508
NM_000610chr1162814 2040 2003 989 696 446 2833 823 22102 926 --
NM_000612chr11143619 3570 3294 2923 2848 1535 846 819 708 663 503 182 72 39 13463 23747 83 --
NM_000615chr1172944 1841 1076 1032 946 561 55 32874 932 814 ----
NM_000618chr12115170 4702 2130 2110 2009 1692 1311 1258 1094 589 494 35984 5971 1026 15377 14230
NM_000618chr12115170 4702 2130 2110 2009 1692 1311 1258 1094 589 494 35984 5971 1026 15377 14230
NM_000627chr24872 825 780 90 ------
NM_000635chr1961404 1021 1005 388 80 71 ------
NM_000682chr231466 451 51 2506 424 2754 225 --
NM_000719chr12146567 6347 6253 6020 5989 5268 5242 4251 4201 4141 2318 2148 568 161 25949 4067 22352 2004 32607 2268 668
NM_000723chr1791253 1223 1203 687 680 477 284 234 158 --21230 610 --
NM_000738chr113947 804 247 --128 --
NM_000750chr153666 597 335 1792 ----
NM_000757chr14113 87 73 66 --1880 1852
NM_000761chr1551361 1228 952 559 357 1403 2973 449 --
NM_000795chr115944 723 268 65 38 --1115 --
NM_000800chr531655 1196 28 ------
NM_000808chrX2782 114 ------
NM_000813chr535108 1987 1277 14319 11818 --
NM_000814chr1523198 1670 11292 13644 --
NM_000827chr52500 54 21763 456 31838 573 202 --
NM_000829chr1142125 1746 775 373 ------
NM_000831chr1146040 5892 5515 5059 5003 4113 3982 3835 1630 1619 1304 769 490 112 46047 6012 5610 5123 24866 3888 --
NM_000832chr98873 756 725 711 333 109 89 21 1863 1131 --
NM_000833chr162576 559 --21214 1161 1176
NM_000836chr197942 925 766 745 323 310 25 1198 1639 --
NM_000838chr692683 1869 1860 1117 1018 811 637 509 432 1649 ----
NM_000868chrX32597 1969 1791 ------
NM_000875chr15156665 6580 6412 5853 4775 4603 4316 2623 1932 1716 1559 1489 1477 977 513 1431 65864 4963 4629 1857 1331 711 11694
NM_000876chr641314 940 483 167 --173 --
NM_000891chr1723488 1232 23380 1156 ----
NM_000899chr1234105 950 806 2630 139 ----
NM_000901chr432450 1934 212 ------
NM_000922chr113220 167 84 ------
NM_000926chr11128964 7717 7696 7509 7386 7293 7115 2501 2283 2068 1400 986 --38867 8343 1432 28064 7121
NM_000933chr201521 ----11591
NM_000934chr172712 514 --1525 153
NM_000944chr431992 1695 1558 --12217 --
NM_000945chr221687 46 123 ----
NM_000950chrX53153 3038 685 513 348 --11460 --
NM_000964chr1791378 1316 1269 1214 1198 1049 362 97 62 --139 --
NM_000966chr125818 684 435 421 110 --21049 759 --
NM_000984chr174443 175 167 52 ------
NM_001001323chr1232674 1978 209 --1166 --
NM_001001331chr392307 2040 1952 1838 1021 460 223 51 26 4307 280 92 71 --2152 75
NM_001001342chr1031342 1303 1069 11237 ----
NM_001001344chrX91997 1902 1835 1634 871 860 581 534 335 12032 ----
NM_001001389chr1162814 2040 2003 989 696 446 2833 823 22102 926 --
NM_001001390chr1162814 2040 2003 989 696 446 2833 823 22102 926 --
NM_001001391chr1162814 2040 2003 989 696 446 2833 823 22102 926 --
NM_001001392chr1162860 2086 2049 1035 742 492 2879 869 22148 972 --
NM_001001396chr174387 3759 738 587 420 106 66 ----148
NM_001001433chr2051995 1045 977 871 570 22635 763 ----
NM_001001481chr833064 2122 497 ------
NM_001001484chr1021493 70 --11742 1579
NM_001001523chr161138 1000 979 946 74 48 --168 --
NM_001001557chr842098 232 184 52 1665 ----
NM_001001668chr1963990 3771 3338 2925 1060 32 13381 ----
NM_001001685chr17122590 2579 2366 1849 1774 969 909 786 108 65 40 28 22245 665 1793 --
NM_001001890chr2151496 1479 1421 1212 264 23918 2904 --13171
NM_001001938chr953537 3453 1140 982 521 12994 23952 3430 --
NM_001001971chr10167 ----132
NM_001002233chr82146 48 1532 ----
NM_001002257chr252924 2497 950 669 607 ----13018
NM_001002258chr221989 251 11310 ----
NM_001002269chr92516 33 187 --1332
NM_001002762chr10102620 2205 2152 2135 2031 1182 960 627 332 246 12801 4527 351 221 55 --
NM_001002814chr883723 3621 3609 3344 3325 978 146 48 1532 ----
NM_001002838chrX2469 347 21761 622 11679 --
NM_001002860chr1463580 3393 3118 1437 1086 407 ------
NM_001002909chr1721913 1620 1266 --21655 587
NM_001003652chr1877612 6987 6349 5813 5718 1762 1537 38500 7724 2372 21611 942 --
NM_001003665chr183503 3451 3352 3153 3091 2500 2251 435 23201 2591 23558 522 1783
NM_001003674chr18126469 6391 4917 4892 4409 2676 2518 2427 1419 1208 652 195 35028 1800 1399 16907 --
NM_001003675chr18126469 6391 4917 4892 4409 2676 2518 2427 1419 1208 652 195 35028 1800 1399 16907 --
NM_001003676chr113706 417 379 ------
NM_001003682chr131254 520 479 ------
NM_001003712chr1233435 2539 740 ------
NM_001003789chr224460 260 104 93 2435 120 11144 --
NM_001003800chr931463 1185 43 ----11127
NM_001003891chr223876 817 310 ------
NM_001003894chrY178 ----1104
NM_001003940chr15103462 3422 3246 2607 963 617 502 430 410 303 11456 43641 2600 2585 896 --
NM_001003942chr15103462 3422 3246 2607 963 617 502 430 410 303 11456 43641 2600 2585 896 --
NM_001003943chr15103466 3426 3250 2611 967 621 506 434 414 307 11460 43645 2604 2589 900 --
NM_001004317chr623238 48 --13495 1932
NM_001004354chr98890 868 788 779 695 433 413 232 1725 ----
NM_001004419chr1244220 3552 1467 581 14347 44301 2789 1804 1623 --
NM_001004722chr25418 358 223 149 124 2820 330 ----
NM_001005271chr1731101 849 98 --2182 89 127
NM_001005273chr1731101 849 98 --2182 89 127
NM_001005404chr1784426 2879 2855 2840 1330 296 133 116 21343 811 11598 197
NM_001005415chr193437 92 78 ------
NM_001005416chr193437 92 78 ------
NM_001005473chr546470 6365 5458 92 14972 25199 4712 --
NM_001005502chr12115009 3968 3929 3413 1928 1884 1851 1715 471 400 34 --11086 --
NM_001005505chr361643 589 322 60 33 21 1388 127 --
NM_001005609chrX63551 2648 2452 2320 1399 607 --23217 3039 13357
NM_001005753chr252236 1865 1686 716 246 22000 1553 11872 --
NM_001005920chr165971 817 763 107 48 --1737 1322
NM_001006115chr392778 2660 2347 1078 725 715 543 402 38 ------
NM_001006617chr941326 295 279 248 21334 272 174 --
NM_001006619chr941326 295 279 248 21334 272 174 --
NM_001006620chr941326 295 279 248 21334 272 174 --
NM_001006621chr941326 295 279 248 21334 272 174 --
NM_001006623chr22240 234 11602 --11984
NM_001006636chr21195 ----1906
NM_001006933chrX------1186
NM_001006944chr112446 121 1593 --1720
NM_001007097chr974699 4592 4324 4185 4045 3372 1333 13603 1902 --
NM_001007156chr1511272 21320 175 11856 11853
NM_001007257chr131033 972 94 ------
NM_001007277chr113190 79 30 1137 ----
NM_001007553chr13377 298 31 ------
NM_001008220chr5143760 3666 3657 3528 3446 3346 2571 1371 889 716 710 604 555 198 11069 53550 3541 877 187 30 11002
NM_001008222chrX41196 1136 1118 562 1132 11222 --
NM_001008223chr125477 456 230 82 65 151 ----
NM_001008239chr1841307 1013 412 41 --12817 --
NM_001008392chr373416 2971 2207 1332 1143 1127 334 ----1679
NM_001008405chr72418 240 ------
NM_001008410chr272069 2009 1630 859 851 498 402 11940 2655 538 --
NM_001008541chr1031495 704 317 --1712 --
NM_001008541chr1031495 704 317 --1712 --
NM_001008563chr94869 369 302 33 ------
NM_001008701chr1962942 2702 2645 1206 328 107 --1336 --
NM_001008738chr542410 1995 1887 104 --12044 1560
NM_001008801chr1931656 741 31 --21711 1701 --
NM_001008897chr62485 128 ------
NM_001009554chr424072 1031 1855 24733 3296 11426
NM_001009554chr424072 1031 1855 24733 3296 11426
NM_001009566chr151320 957 382 235 52 1171 ----
NM_001009571chr731702 1650 1517 ------
NM_001009584chrX1114 ----2544 37
NM_001009899chr376433 6019 5851 4437 2261 2170 1524 46167 5287 2011 1906 45217 5204 1569 1413 12218
NM_001009955chr13531 423 137 1143 ----
NM_001009955chr13531 423 137 1143 ----
NM_001009960chr742839 2385 1760 909 ------
NM_001009992chr121508 378 152 21502 1354 --
NM_001009993chr233519 3467 332 11207 24431 1470 --
NM_001009996chr32440 195 ----1151
NM_001010861chr112666 154 1860 --
NM_001010862chrX33116 2773 546 ----12677
NM_001010888chrX74590 3769 2840 1571 1404 1266 607 --21589 497 1655
NM_001010922chr164004 3333 3087 2817 1013 847 23285 523 1569 --
NM_001010986chrX42135 2089 972 75 ------
NM_001011513chr422889 2771 23547 939 ----
NM_001011666chr776355 4778 4206 2628 621 588 568 --24452 1440 1783
NM_001011885chr151454 11149 ----
NM_001012264chr144660 395 222 27 2741 264 --1304
NM_001012329chr191982 1928 1916 1659 1548 774 670 134 98 1115 31541 734 698 --
NM_001012393chr1174652 3244 2079 1800 1748 629 208 2865 489 11459 21166 877
NM_001012426chr6203184 3112 2991 2860 2785 2452 1301 1117 1087 972 933 902 716 687 641 625 510 462 375 187 1748 63167 1197 1182 681 546 498 11194
NM_001012427chr6203184 3112 2991 2860 2785 2452 1301 1117 1087 972 933 902 716 687 641 625 510 462 375 187 1748 63167 1197 1182 681 546 498 11194
NM_001012732chr411031 --11298 1961
NM_001012755chrX95025 4602 3794 3159 1075 940 492 485 99 14517 31268 1044 204 11428
NM_001012968chrX11909 ----1390
NM_001012979chrX------1186
NM_001013031chr1083501 2976 1109 933 670 660 461 392 22960 2652 22949 1337 --
NM_001013620chr12108001 7869 7294 7242 5997 5464 3020 1468 1368 1073 --43067 2909 2767 2729 --
NM_001013624chr1771156 1133 986 348 231 178 41 ----1300
NM_001013690chr1282495 2420 1913 1670 1583 912 497 441 11952 4518 490 378 252 32376 918 659
NM_001013693chr1112643 2448 2255 2160 1931 1921 1881 1861 959 887 797 51981 894 838 776 242 ----
NM_001013693chr1112643 2448 2255 2160 1931 1921 1881 1861 959 887 797 51981 894 838 776 242 ----
NM_001013839chr1762369 2342 2202 1600 939 29 2804 489 1615 --
NM_001014380chr1385307 5147 4745 4554 4330 4226 4108 552 1798 11057 --
NM_001014796chr14159 152 146 79 161 ----
NM_001014796chr14159 152 146 79 161 ----
NM_001014797chr10147661 7451 7302 7202 6284 2854 2823 2408 2228 1752 1055 1005 787 102 37892 5399 2815 31836 1804 1794 18142
NM_001014809chr43761 309 297 --2222 53 --
NM_001015053chr1751527 1488 498 454 31 11177 2513 166 --
NM_001015881chrX41195 914 392 151 --1161 --
NM_001017368chr1772012 1841 1719 803 360 354 143 --1331 --
NM_001017371chr221326 1277 ------
NM_001017392chr1921371 1337 --11342 2918 906
NM_001017395chr352648 2565 2432 2286 30 1536 13014 11224
NM_001017424chr141496 541 370 206 ------
NM_001017425chr141496 541 370 206 ------
NM_001017440chr7115947 5937 5596 5048 3237 3136 3014 2542 2461 1687 697 57285 6006 5895 2174 333 36185 493 387 36670 6521 518
NM_001017535chr12122711 2623 2522 2460 2353 932 881 591 477 302 126 95 32703 1940 1169 12560 21030 140
NM_001017970chr1431891 619 235 183 ----
NM_001017999chr152128 1601 1456 546 198 21529 932 11433 --
NM_001017999chr152128 1601 1456 546 198 21529 932 11433 --
NM_001018000chr152128 1601 1456 546 198 21529 932 11433 --
NM_001018000chr152128 1601 1456 546 198 21529 932 11433 --
NM_001018001chr152128 1601 1456 546 198 21529 932 11433 --
NM_001018050chr22103303 2831 1238 1230 1186 1133 613 227 200 158 43273 2376 2245 724 33188 2749 2407 --
NM_001018052chr22103303 2831 1238 1230 1186 1133 613 227 200 158 43273 2376 2245 724 33188 2749 2407 --
NM_001018054chr141248 1092 978 441 1249 ----
NM_001018057chr1131191 274 242 --1507 --
NM_001018064chr931799 1466 223 ------
NM_001018067chr121450 875 24005 1748 14051 14280
NM_001018068chr121450 875 24005 1748 14051 14280
NM_001018069chr121450 875 24005 1748 14051 14280
NM_001018074chr543252 3120 2988 2794 ----13417
NM_001018075chr543252 3120 2988 2794 ----13417
NM_001018076chr543252 3120 2988 2794 ----13417
NM_001018077chr543252 3120 2988 2794 ----13417
NM_001018089chr1532698 2466 1025 --33710 867 187 --
NM_001018108chr15101931 1884 1761 1606 1503 1404 910 514 245 189 ------
NM_001018111chr782998 2526 1619 1205 931 590 563 53 1903 ----
NM_001020825chr52463 269 ----1892
NM_001024094chr543252 3120 2988 2794 ----13417
NM_001024226chr12913 722 ----1883
NM_001024227chr12913 722 ----1883
NM_001024228chr12913 722 ----1883
NM_001024380chr852255 1834 1620 686 614 11841 ----
NM_001024381chr852255 1834 1620 686 614 11841 ----
NM_001024401chr16132807 2635 2264 1854 1801 1083 865 782 479 458 434 86 45 ------
NM_001024455chrX92346 2067 1986 1945 683 458 309 198 54 124 22405 366 1414
NM_001024596chr1953138 3094 2415 847 123 ----32437 2433 1358
NM_001024649chr542183 2177 861 755 --11888 --
NM_001024660chr321151 178 --11419 --
NM_001024666chrX2658 562 ----1165
NM_001024688chr851949 798 668 307 300 --12153 --
NM_001024808chr1282816 2730 2178 1981 846 598 521 386 12401 ----
NM_001024809chr1791378 1316 1269 1214 1198 1049 362 97 62 --139 --
NM_001024845chr13956 35 29 1990 ----
NM_001024858chr1492972 2650 2210 2098 1822 913 447 310 82 22293 1150 12953 --
NM_001024912chr195700 684 477 184 88 21648 749 138 --
NM_001024948chr122878 2321 ------
NM_001024957chr11368 55 48 --2223 30 --
NM_001024959chr3--143 1334 --
NM_001024960chr3--143 1334 --
NM_001025076chr1085670 5640 5400 4771 4194 4123 4075 1345 24960 4145 15026 11447
NM_001025077chr10127028 6998 6758 6129 5552 5481 5433 2703 1176 1014 553 458 46318 5503 170 157 36384 1197 437 12805
NM_001025107chr132107 636 628 12197 21016 778 1261
NM_001025107chr132107 636 628 12197 21016 778 1261
NM_001025266chr364539 4030 3909 3335 3283 1776 --34743 3954 1489 33752 1819 98
NM_001025366chr6--2522 346 1702 --
NM_001025366chr6--2522 346 1702 --
NM_001025367chr6--2522 346 1702 --
NM_001025367chr6--2522 346 1702 --
NM_001025368chr6--2522 346 1702 --
NM_001025368chr6--2522 346 1702 --
NM_001025369chr6--2538 362 1718 --
NM_001025369chr6--2538 362 1718 --
NM_001025370chr6--2522 346 1702 --
NM_001025370chr6--2522 346 1702 --
NM_001025580chrX63846 3407 3264 3192 3151 2706 ----13793
NM_001025603chr151410 1135 1082 1066 990 1139 ----
NM_001025616chr421749 715 1635 21675 348 --
NM_001029858chr632831 1276 1026 --2491 190 12376
NM_001029859chr1182403 2291 1522 986 881 360 324 188 11547 22128 154 --
NM_001029861chr194793 739 172 23 285 55 2120 49 --
NM_001029863chr652467 932 805 747 37 12065 ----
NM_001029864chr2051954 1569 1009 825 343 --1263 52182 2135 2091 719 200
NM_001030006chr1792336 2249 1882 1727 1059 861 518 227 217 22526 110 ----
NM_001030007chr1642753 1536 969 191 22560 35 1261 --
NM_001030059chr102298 49 ------
NM_001031679chr1282855 2603 2482 1291 1225 949 758 658 2444 161 12381 --
NM_001031690chr742861 1991 1972 36 13052 42735 952 838 30 --
NM_001031695chr2264961 4937 4473 3376 2048 2022 25067 3973 --24425 1647
NM_001031702chr31138 ----1583
NM_001031711chr561829 1213 1190 1132 629 583 ----11285
NM_001031717chr35678 672 403 203 95 1223 --1912
NM_001031740chr131495 687 240 31213 677 433 ----
NM_001031804chr16104241 2997 2968 718 551 339 114 108 100 29 14394 22906 569 --
NM_001032280chr671587 1234 1103 450 231 56 21 ------
NM_001032288chr2041447 1332 588 403 --2621 582 --
NM_001032296chr132121 94 1970 ----
NM_001032380chr1051913 1693 432 134 53 ------
NM_001032394chr642221 1807 882 32 ----1496
NM_001033025chr111169 21555 571 --11143
NM_001033044chr161772 1703 1347 1325 200 50 1739 ----
NM_001033045chr223332 3141 ----11565
NM_001033056chr161772 1703 1347 1325 200 50 1739 ----
NM_001033059chr62460 230 ------
NM_001033081chr121855 618 11320 11590 --
NM_001033082chr121855 618 11320 11590 --
NM_001033087chr2022637 2265 11090 --1942
NM_001033117chr364807 4736 3462 1945 1922 785 13032 31712 817 795 11337
NM_001033503chr5------1404
NM_001033507chr11360 11667 11970 1618
NM_001033551chr17133461 3382 3213 3200 3123 2547 1439 1187 1093 599 366 313 73 23629 3600 44041 3937 3648 333 14038
NM_001033561chr173838 601 99 2321 40 ----
NM_001033578chr81871 ----1326
NM_001033583chrX------136
NM_001033602chr1322560 2505 --32371 959 53 1523
NM_001033756chr6--2456 280 1636 --
NM_001033756chr6--2456 280 1636 --
NM_001034025chr123910 153 57 2124 47 ----
NM_001034915chr83387 378 368 ------
NM_001035chr151048 985 374 168 39 1358 ----
NM_001035003chr43986 544 49 ------
NM_001035004chr43986 544 49 ------
NM_001035254chr94698 516 499 396 41843 617 410 173 ----
NM_001037131chr24434 411 144 119 1131 ----
NM_001037132chr721703 384 --11913 --
NM_001037133chr721703 384 --11913 --
NM_001037164chr741916 1664 604 207 ------
NM_001037171chrX------136
NM_001037317chr112666 154 1860 --
NM_001037332chr582561 2087 2078 1809 1568 545 525 141 31634 368 318 2304 293 12007
NM_001037333chr582561 2087 2078 1809 1568 545 525 141 31634 368 318 2304 293 12007
NM_001037334chr182144 108 22286 420 1508 1332
NM_001037335chr2081145 1079 1017 852 338 79 73 61 --1962 --
NM_001037582chr431419 1146 592 1242 1447 1289
NM_001038493chr261251 426 305 190 52 43 --2463 245 1242
NM_001038707chr13915 784 344 11884 2714 524 --
NM_001038707chr13915 784 344 11884 2714 524 --
NM_001039348chr22345 219 21005 120 ----
NM_001039349chr22345 219 21005 120 ----
NM_001039459chr74812 242 209 186 --1298 1755
NM_001039479chr1432275 1734 190 ------
NM_001039538chr253148 2637 1072 751 321 12963 ----
NM_001039547chr357650 7459 2167 1859 1212 45448 2854 1079 343 ----
NM_001039570chr2284391 4126 4011 3337 3331 1751 1660 1436 13872 24236 3592 13792
NM_001039571chr2284391 4126 4011 3337 3331 1751 1660 1436 13872 24236 3592 13792
NM_001039577chr174220 4122 3011 940 865 842 81 --13390 13769
NM_001039590chrX33128 1387 26 23950 449 ----
NM_001039591chrX33128 1387 26 23950 449 ----
NM_001039615chr811760 --1101 --
NM_001039618chr1135932 300 86 14724 1434 --
NM_001039690chr1641597 908 381 62 1125 ----
NM_001039711chr12919 164 142 2907 82 --
NM_001039712chr12919 164 142 2907 82 --
NM_001039771chr144817 328 226 114 --1835 1197
NM_001039802chr121315 543 1128 1378 --
NM_001039840chrX31709 1554 45 22318 1702 11670 --
NM_001039937chr132507 146 --23100 1146 --
NM_001040002chr1771349 1341 477 380 70 59 53 2318 46 176 --
NM_001040056chr165759 586 310 70 39 ------
NM_001040101chr421298 532 1167 ----
NM_001040110chr731401 562 176 1491 --1449
NM_001040144chr1641597 908 381 62 1125 ----
NM_001040146chr1641597 908 381 62 1125 ----
NM_001040151chr11124130 4041 3580 3029 3003 2992 2953 2911 789 265 194 174 34530 3016 1241 24345 157 34102 3808 3214
NM_001040152chr7115049 4371 3582 2045 1729 1482 1301 1256 1132 1108 500 1968 11396 1593
NM_001040157chr421984 641 --12142 --
NM_001040181chr341079 852 144 69 ------
NM_001040182chr341079 852 144 69 ------
NM_001040183chr341079 852 144 69 ------
NM_001040199chr341079 852 144 69 ------
NM_001040200chr341079 852 144 69 ------
NM_001040214chr632068 1995 196 1571 ----
NM_001040272chr941669 919 112 58 21625 1533 3147 141 28 --
NM_001040284chr1635922 4675 2163 1998 11199 --
NM_001040402chr452693 862 842 626 304 23162 52 11298 --
NM_001040429chr1342551 1349 1267 162 ------
NM_001040439chr16121326 1318 1221 1108 1070 586 432 407 126 94 60 49 --2330 205 --
NM_001040446chr572087 1859 705 690 653 594 562 --1576 --
NM_001040624chr842641 2165 525 398 1337 ----
NM_001040625chr842641 2165 525 398 1337 ----
NM_001040626chr842641 2165 525 398 1337 ----
NM_001040627chr842641 2165 525 398 1337 ----
NM_001040628chr842641 2165 525 398 1337 ----
NM_001040629chr842641 2165 525 398 1337 ----
NM_001040630chr842641 2165 525 398 1337 ----
NM_001040661chr791076 1062 1000 437 267 260 155 129 81 2398 336 11046 --
NM_001040709chr1102225 2203 2157 905 779 601 577 541 363 52 32429 1565 757 ----
NM_001040712chr923341 1124 11155 33321 2700 1148 --
NM_001040715chr1641026 819 811 422 ------
NM_001042351chrX8519 509 198 154 135 125 53 38 --123 --
NM_001042368chr94659 302 192 87 ------
NM_001042371chr1661862 1404 1312 603 579 571 ----11517
NM_001042388chr182921 789 ------
NM_001042413chr961625 758 712 428 356 53 --31108 933 876 11074
NM_001042424chr492622 2561 2530 1270 1097 687 433 294 164 11083 1579 --
NM_001042425chr671587 1234 1103 450 231 56 21 ------
NM_001042440chr531868 1427 201 ------
NM_001042441chr531868 1427 201 ------
NM_001042442chr531868 1427 201 ------
NM_001042443chr531868 1427 201 ------
NM_001042444chr531868 1427 201 ------
NM_001042445chr531868 1427 201 ------
NM_001042446chr531868 1427 201 ------
NM_001042453chrX31510 537 221 ------
NM_001042454chr163357 246 119 1103 2381 235 --
NM_001042481chr1452364 2323 1989 1793 398 --1100 --
NM_001042492chr1763481 3447 3046 2670 2648 125 --13295 --
NM_001042494chr1541443 915 909 82 189 12757 --
NM_001042495chr1541443 915 909 82 189 12757 --
NM_001042496chr1541443 915 909 82 189 12757 --
NM_001042497chr1541443 915 909 82 189 12757 --
NM_001042537chrX12476 12410 ----
NM_001042599chr287608 6129 6063 6034 5520 2309 1056 54 --42459 1758 860 87 41948 1944 1940 1936
NM_001042601chr333002 2444 515 22048 412 ----
NM_001042603chr1264650 4500 4386 3728 465 83 --25330 1375 --
NM_001042604chr343824 1746 312 41 ------
NM_001042669chr421749 715 1635 21675 348 --
NM_001042681chr182479 2377 2285 2128 2080 1621 865 377 ----11674
NM_001042682chr182479 2377 2285 2128 2080 1621 865 377 ----11674
NM_001042682chr182479 2377 2285 2128 2080 1621 865 377 ----11674
NM_001042724chr196585 579 303 181 146 132 ------
NM_001042728chr125818 684 435 421 110 --21049 759 --
NM_001043318chr14103435 3291 3277 2689 2539 1276 1059 744 284 101 43363 1428 865 412 23455 2855 --
NM_001043351chr151590 1479 400 127 52 --21638 710 --
NM_001044305chr641295 1199 367 36 11153 ----
NM_001092chr1772121 763 632 536 367 211 163 --1481 --
NM_001094chr171312 ----1641
NM_001095chr1271673 1621 1217 714 666 547 331 11356 21374 660 --
NM_001100108chr1168040 7847 6729 6669 6655 6515 5999 5920 5520 5495 3122 2204 1568 1178 1111 296 11236 26406 5124 --
NM_001106chr3109036 8642 7747 7289 6467 6182 2956 2152 418 306 18235 29226 1143 --
NM_001111chr132107 636 628 12197 21016 778 1261
NM_001113490chrX53642 2651 2599 2264 588 13386 ----
NM_001116chr1692805 2196 1036 1021 1011 771 605 587 547 22253 1128 --1786
NM_001117chr18--12299 --11671
NM_001127chr227991 398 391 170 146 38 21 1112 ----
NM_001128chr1642753 1536 969 191 22560 35 1261 --
NM_001146chr831738 761 233 --11853 --
NM_001148chr462035 857 490 430 326 284 ------
NM_001149chr1021443 89 1173 ----
NM_001157chr103578 109 31 --2208 138 --
NM_001167chrX75674 4894 4839 2238 2049 1936 1444 11891 12096 --
NM_001175chr123141 33 24 ----1194
NM_001177chr1222207 1515 ------
NM_001186chr2142761 2165 896 729 --1983 --
NM_001191chr2071411 1170 491 449 112 50 34 --41135 485 26 21 --
NM_001202chr14--181 --185
NM_001204chr246935 5100 2444 114 ------
NM_001206chr942814 1973 1215 538 ------
NM_001222chr1051698 1459 1303 1255 170 1361 1338 --
NM_001249chr143432 416 313 1162 ----
NM_001259chr786257 4872 4389 1728 1315 1200 1114 564 16313 26153 1511 --
NM_001271chr1542946 2195 215 194 13072 ----
NM_001282chr1792336 2249 1882 1727 1059 861 518 227 217 22526 110 ----
NM_001286chr172792 2585 1914 742 282 271 247 52343 2324 864 631 110 1711 22251 783
NM_001289chrX41454 571 351 166 ------
NM_001290chr42847 23 ------
NM_001304chr1753589 3350 3152 1529 582 ------
NM_001310chr1231143 399 137 1236 --11896
NM_001313chr43761 309 297 --2222 53 --
NM_001329chr1031404 1384 394 --11490 --
NM_001331chr1192016 1761 1106 928 738 665 560 154 21 11835 11850 --
NM_001346chr372176 2005 1909 1014 859 342 143 12103 22860 1954 --
NM_001356chrX4256 250 123 23 ------
NM_001364chr1164489 3621 3450 3150 1629 299 --23259 627 --
NM_001365chr175314 277 271 105 40 ------
NM_001387chr542567 2179 2036 1228 --32613 1210 678 --
NM_001390chr1883302 2811 2805 2551 2464 2334 1163 185 --13189 --
NM_001397chr182518 2089 2028 1002 941 509 225 97 21903 62 --11799
NM_001399chrX63551 2648 2452 2320 1399 607 --23217 3039 13357
NM_001402chr622007 25 ------
NM_001406chr1771618 1602 1569 1285 577 342 149 1312 31341 631 472 --
NM_001407chr341453 1263 587 130 11447 1435 --
NM_001408chr131292 167 130 1173 21113 301 --
NM_001412chrX63223 3169 3152 2930 1297 27 ------
NM_001417chr1231933 1221 395 --2461 41 --
NM_001419chr19104396 4048 4012 3389 3137 3111 3066 1807 1736 510 11445 23594 3582 --
NM_001420chr19102749 2672 1159 1130 346 336 330 232 213 25 11073 32935 2589 988 1985
NM_001421chrX41664 1291 377 329 11594 11121 --
NM_001424chr162708 563 1246 --1495
NM_001427chr762075 1642 697 679 513 279 1662 ----
NM_001438chr173683 3191 803 510 264 198 27 ------
NM_001439chr111169 21555 571 --11143
NM_001453chr62217 122 ------
NM_001454chr173635 231 22 190 2934 903 --
NM_001460chr143428 3264 2503 415 42749 2406 2313 82 1615 156
NM_001478chr122927 81 2868 835 ----
NM_001493chrX3741 236 111 196 ----
NM_001497chr962164 1979 1108 999 492 255 ------
NM_001543chr5113795 3213 1916 1835 1523 1237 1121 877 690 576 316 21388 338 2624 619 --
NM_001616chr233463 2981 1051 --13521 --
NM_001620chr111638 ----1561
NM_001621chr742058 926 701 565 ------
NM_001621chr742058 926 701 565 ------
NM_001634chr62460 230 ------
NM_001635chr71699 --2967 925 --
NM_001642chr1111286 --1906 11263
NM_001647chr33132 61 30 ------
NM_001649chrX32404 613 264 12447 ----
NM_001650chr18------164
NM_001654chrX3427 337 119 ----1299
NM_001655chr1191774 1768 1589 1501 1401 547 437 304 156 ----1595
NM_001658chr12913 722 ----1883
NM_001659chr12122584 2497 2280 1710 1084 1009 812 722 410 282 73 57 31776 853 33 22173 752 1175
NM_001661chr171266 131 1113 --
NM_001668chr13697 337 112 ------
NM_001678chr1771761 1464 1354 1285 1228 1166 665 31132 353 80 31320 571 301 11683
NM_001683chr392307 2040 1952 1838 1021 460 223 51 26 4307 280 92 71 --2152 75
NM_001689chr221989 251 11310 ----
NM_001690chr332299 814 770 --12505 1862
NM_001693chr841157 1144 970 82 ------
NM_001695chr863964 3313 3301 2986 2953 2736 12908 11217 13831
NM_001701chr931254 447 250 ----11263
NM_001706chr32878 110 ----151
NM_001709chr1132727 2126 1872 ------
NM_001742chr72487 223 --181 --
NM_001746chr542183 2177 861 755 --11888 --
NM_001750chr531868 1427 201 ------
NM_001754chr2151496 1479 1421 1212 264 23918 2904 --13171
NM_001755chr1632014 1971 351 ------
NM_001759chr1274902 3526 3506 3473 3208 1422 559 24459 120 11720 --
NM_001773chr171308 973 950 438 313 89 67 1126 ----
NM_001789chr31648 11095 144 --
NM_001791chr121315 543 1128 1378 --
NM_001810chr202715 47 --2800 550 --
NM_001819chr202301 59 ----190
NM_001854chr121227 451 ----1344
NM_001874chr12115009 3968 3929 3413 1928 1884 1851 1715 471 400 34 --11086 --
NM_001894chr2231000 826 325 3485 319 95 1951 --
NM_001895chr2031169 992 386 11033 149 --
NM_001918chr186935 6717 6377 5606 2750 2714 1699 991 47722 6685 3681 2857 17153 12523
NM_001921chr411031 --11298 1961
NM_001938chr131396 1208 693 ------
NM_001939chrX73583 2331 916 815 567 495 93 33813 3356 945 --31108 410 75
NM_001945chr551061 930 888 261 91 11314 --1545
NM_001949chr64722 684 373 294 --11134 --
NM_001951chr83551 227 31 ------
NM_001954chr64581 565 531 288 2243 155 1274 --
NM_001962chr51197 ----165
NM_001968chr43270 208 115 ------
NM_001981chr141573 561 352 219 12283 1342 --
NM_001987chr12134161 4124 3789 3632 3500 1383 1225 877 654 293 286 280 265 33810 804 181 23145 2732 --
NM_002006chr455490 1727 1508 1078 379 --15429 35361 645 641
NM_002015chr1343148 2045 1285 86 ------
NM_002017chr112176 26 ----1512
NM_002024chrX31934 463 328 ------
NM_002025chrX178925 8878 8586 8487 7575 6552 6499 5696 3558 2822 1398 1362 1318 408 248 49 43 22900 309 --47810 6523 5883 83
NM_002026chr22168 51 1367 11029 --
NM_002028chr144987 947 887 870 21082 34 ----
NM_002035chr1831433 881 167 11256 ----
NM_002045chr33342 63 32 1132 180 --
NM_002065chr161772 1703 1347 1325 200 50 1739 ----
NM_002077chr951834 1774 625 569 420 2550 230 1532 --
NM_002080chr161720 --1661 1956
NM_002081chr261628 1161 699 560 437 76 1487 11508 --
NM_002086chr1761796 1698 1417 627 292 122 ----11841
NM_002092chr465020 4767 3997 3377 3255 462 24188 3937 24609 4235 --
NM_002107chr1------1413
NM_002126chr1763296 3287 2946 1573 656 317 23382 2520 --12804
NM_002134chr163208 84 54 1487 ----
NM_002139chrX--175 --1521
NM_002187chr53954 948 345 ------
NM_002204chr1751291 1104 282 207 29 21110 115 ----
NM_002206chr12--2167 148 2302 40 --
NM_002210chr222574 768 33466 2879 558 ----
NM_002214chr735342 4822 1309 11201 22128 1404 13553
NM_002221chr132223 1878 353 1616 12767 --
NM_002222chr3------180
NM_002227chr161283 1176 1026 970 822 305 ------
NM_002235chr1241289 675 197 72 21621 233 11281 --
NM_002245chr1--1460 --1225
NM_002247chr1031633 1558 168 144 11835 --
NM_002253chr441020 1014 317 79 ------
NM_002254chr261675 775 670 536 530 402 21546 27 1935 1381
NM_002264chr354898 3684 3554 1773 226 2609 45 21005 612 13310
NM_002267chr134739 615 440 244 ------
NM_002270chr545088 4840 4589 2170 11385 --14649
NM_002274chr17144 --1316 --
NM_002290chr621379 353 ------
NM_002293chr152088 1106 609 490 99 1566 12418 --
NM_002309chr2273017 2926 2477 2415 2215 2157 642 22958 2448 62781 2521 2345 2166 155 150 --
NM_002333chr1941051 885 432 264 --168 --
NM_002334chr112142 118 --2306 252 --
NM_002336chr1254949 4469 4298 1644 407 11401 14292 --
NM_002355chr1241194 1105 574 99 ------
NM_002356chr621960 1754 --1867 --
NM_002359chr1784184 3830 3019 2813 1673 1526 1421 112 13355 43672 3053 2818 390 --
NM_002360chr742571 2453 2139 229 22597 2216 1405 --
NM_002372chr52696 591 --1519 1516
NM_002373chr1561356 1260 1124 945 936 493 --21282 33 --
NM_002374chr253148 2637 1072 751 321 12963 ----
NM_002375chr352002 893 550 238 170 --12157 --
NM_002390chr1742015 1942 1926 1655 31613 222 70 21891 278 --
NM_002398chr241191 1071 225 137 1198 ----
NM_002399chr151188 2230 198 ----
NM_002401chr1752346 1886 1007 292 146 --31975 1766 1689 12364
NM_002402chr73377 123 62 --1198 --
NM_002403chr13381 332 84 ------
NM_002409chr2272806 2524 2119 2101 1268 935 902 --33185 2875 602 12969
NM_002442chr12121709 1359 1346 1272 1171 713 669 336 285 232 226 98 11263 21595 303 --
NM_002444chrX101760 1753 1693 1504 1325 744 683 571 502 291 1171 21353 801 --
NM_002445chr851574 386 252 229 58 1321 ----
NM_002473chr2271358 1271 951 515 443 142 87 --1129 --
NM_002481chr1177748 7685 7611 7234 6803 5350 4919 4881 2322 2131 2047 1695 722 556 433 127 54 --47675 7668 7481 361 22692 1422
NM_002485chr851949 798 668 307 300 --12153 --
NM_002499chr1541758 604 589 167 1429 1929 --
NM_002501chr19193781 3660 3536 3528 3458 3420 3378 3224 3016 2519 1228 1107 942 760 668 658 470 449 369 23666 173 64061 3940 3114 975 566 443 --
NM_002508chr141614 614 282 230 --2224 198 --
NM_002509chr202141 45 ----1194
NM_002515chr1451748 1478 1257 704 610 21345 1335 21508 1360 --
NM_002519chr112566 495 ----11347
NM_002522chr17103852 3292 3070 2530 2443 2391 1240 1233 839 27 22547 942 22496 735 --
NM_002524chr13912 757 289 ------
NM_002526chr631381 431 317 ------
NM_002545chr1174652 3244 2079 1800 1748 629 208 2865 489 11459 21166 877
NM_002556chr1161995 1722 1590 841 675 334 ------
NM_002558chr172215 104 1888 ----
NM_002569chr1591413 601 581 432 207 158 150 133 58 2954 385 31358 978 459 --
NM_002586chr661405 616 527 521 405 226 ------
NM_002588chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_002596chr171333 1320 1073 1005 949 544 292 --41340 1037 849 380 11299
NM_002599chr1141231 381 51 35 --21111 990 --
NM_002608chr2241485 249 175 148 11498 21385 168 --
NM_002609chr541501 1347 759 415 21486 1272 --1457
NM_002611chr175862 721 679 179 76 1629 2746 249 --
NM_002613chr16174974 4776 4214 4133 4042 3948 3588 3468 3295 2162 2136 1785 1531 465 371 87 67 24104 307 23934 1515 --
NM_002634chr173733 200 84 --2726 217 --
NM_002641chrX2797 543 1232 11892 --
NM_002645chr1122062 900 1318 1922 --
NM_002651chr14900 861 638 359 2104 92 --1108
NM_002655chr821228 356 --1841 13946
NM_002657chr20223689 3505 3463 3407 3054 2911 2873 2599 2480 2451 1508 1380 1363 1349 1303 1152 1050 1036 611 397 358 59 33070 1551 523 23613 3247 --
NM_002662chr31756 --134 21921 538
NM_002698chr1992719 2710 2610 2528 1211 1038 640 226 163 1872 --12752
NM_002699chr171262 1059 520 299 281 243 56 --2608 420 --
NM_002709chr23893 492 337 22689 82 13097 --
NM_002714chr63914 860 357 --2902 61 --
NM_002718chr322231 1787 --1983 11653
NM_002725chr1134392 4317 4197 3766 3334 1445 912 893 501 419 321 314 124 44369 3468 3120 1060 1940 1200
NM_002730chr1971272 1229 1155 1116 1106 404 126 31094 410 393 2210 120 --
NM_002731chr112172 1765 --1167
NM_002734chr1721667 1487 --1262 --
NM_002737chr17136071 4873 4242 4232 4053 2089 1656 1566 1086 1047 879 868 335 35751 5313 4094 14763 2823 410
NM_002739chr197714 667 642 576 294 79 42 --168 --
NM_002745chr2244400 4132 484 108 44381 3053 1774 222 13436 --
NM_002746chr164590 417 198 141 ------
NM_002753chr43647 539 59 --126 --
NM_002768chr1681585 1479 1273 1233 562 535 401 117 1491 --1287
NM_002773chr162406 97 ------
NM_002776chr1991978 1854 1774 1580 1359 646 322 137 69 3301 271 182 2606 77 31923 1332 723
NM_002819chr1971499 1122 972 370 171 161 45 --1528 --
NM_002821chr66731 628 552 510 244 169 ------
NM_002823chr22137 64 2165 119 158 --
NM_002824chr125354 155 123 84 78 1317 2202 180 --
NM_002827chr2091537 1332 1303 1172 1154 1147 205 175 39 1312 31720 392 23 130
NM_002829chr91856 --21109 469 --
NM_002833chr1531184 360 48 21347 1313 11264 --
NM_002837chr1253522 3238 3130 2916 375 11150 --13286
NM_002839chr923341 1124 11155 33321 2700 1148 --
NM_002847chr781350 1205 1198 559 429 383 279 36 --11324 --
NM_002849chr1231013 860 731 160 ----
NM_002855chr11163665 3602 3547 3439 2827 2687 1481 1393 1293 1278 876 356 271 83 76 69 22940 855 41095 973 890 204 --
NM_002859chr1261702 1660 1555 594 546 233 --51667 271 240 175 75 2495 491
NM_002866chr195541 195 123 58 44 2569 237 ----
NM_002868chr1272251 2183 1911 1582 884 203 68 --162 --
NM_002869chr1131777 1465 489 ------
NM_002886chr331824 1231 197 14302 1164 --
NM_002890chr53900 855 262 ------
NM_002903chr173322 265 250 139 1119 132
NM_002918chr1991116 836 804 723 717 327 278 37 24 ------
NM_002941chr321470 515 ------
NM_002956chr123898 305 210 ------
NM_002959chr194013 3656 3254 3155 3065 1119 505 420 128 23312 3245 ----
NM_002996chr16121635 1508 1328 1245 683 484 457 448 399 281 224 70 177 1189 11540
NM_003010chr172505 133 --1823 --
NM_003011chr911598 11232 1209 --
NM_003025chr196800 397 358 246 118 24 1791 1921 --
NM_003026chr961276 1120 960 918 349 325 ------
NM_003028chr973279 1222 1087 483 229 223 211 23824 3638 23772 3592 11557
NM_003042chr3287 35 ----11886
NM_003045chr13134909 4180 3194 3159 1419 1319 1295 1150 1100 497 161 100 73 13571 14187 23287 668
NM_003047chr161431 1067 962 523 145 47 2536 386 11340 --
NM_003070chr91706 ----163
NM_003074chr332147 154 142 ------
NM_003076chr1251360 1327 1197 556 192 --1177 --
NM_003079chr173917 847 270 --1690 --
NM_003099chr15116287 5879 5753 4182 2530 2413 1467 1241 558 501 26 1852 21256 65 --
NM_003107chr65889 465 227 206 199 12467 22470 1931 --
NM_003108chr267210 6818 6733 4412 2904 1823 11883 11862 --
NM_003110chr177861 855 692 350 343 111 43 ------
NM_003111chr221326 1277 ------
NM_003120chr113369 315 134 1325 ----
NM_003131chr671921 1899 1422 895 876 326 213 21930 1513 1182 --
NM_003137chr652004 1800 1571 1529 346 --147 --
NM_003150chr1752205 2190 1764 673 62 1426 1847 --
NM_003153chr122211 45 21037 121 1182 1388
NM_003155chr852430 2098 1999 1046 294 ------
NM_003156chr1151228 1161 1152 388 250 1470 2464 296 --
NM_003161chr1753247 2247 1138 1065 910 12342 ----
NM_003164chr115445 373 190 171 154 ------
NM_003165chr981511 1480 1400 1278 602 166 135 37 ------
NM_003173chrX41210 1132 1122 121 1232 21328 111 --
NM_003178chr33569 454 437 --21486 589 --
NM_003179chrX51378 1192 1128 199 72 11472 41238 390 187 93 --
NM_003180chr194344 307 122 87 --1129 --
NM_003185chr203482 353 91 --1533 --
NM_003194chr62399 31 --1484 --
NM_003199chr1821840 1614 --15112 11788
NM_003200chr1941839 1657 67 29 21671 212 --12179
NM_003202chr561280 1179 587 256 119 35 ----1575
NM_003204chr1721587 232 --2537 183 --
NM_003214chr671260 1150 1090 1034 1025 252 98 31274 341 140 ----
NM_003215chr421203 1006 ----11561
NM_003217chr1251897 1565 1325 625 374 --21748 46 2663 344
NM_003220chr671587 1234 1103 450 231 56 21 ------
NM_003221chr6133767 3390 3198 3118 2883 2840 2585 1660 501 486 475 469 251 1612 33869 3466 2656 --
NM_003223chr163600 586 578 1171 1626 --
NM_003236chr282371 1344 1281 910 593 577 374 270 12820 ----
NM_003240chr12681 671 1165 196 --
NM_003243chr131142 258 156 --1169 11020
NM_003247chr631958 1461 136 ------
NM_003253chr2151761 1525 1307 317 61 1154 ----
NM_003255chr1751814 1783 735 727 207 1750 ----
NM_003257chr15165 ------
NM_003259chr191120 ----1134
NM_003270chrX21057 33 --2478 253 --
NM_003289chr9123 1155 1196 --
NM_003292chr132235 1798 498 ------
NM_003320chr1153811 3732 1585 264 101 23042 1616 11619 --
NM_003336chrX3821 147 124 --1156 1891
NM_003337chr531351 1182 489 ------
NM_003339chr521618 631 ----2519 365
NM_003342chr1722945 711 23025 2030 12482 183
NM_003349chr2041447 1332 588 403 --2621 582 --
NM_003359chr441380 851 341 296 ------
NM_003369chr1152072 1967 659 440 239 --22011 554 --
NM_003370chr197748 558 241 208 128 121 54 ------
NM_003376chr6--2522 346 1702 --
NM_003376chr6--2522 346 1702 --
NM_003387chr252921 2505 1865 1102 299 1429 --124
NM_003392chr333597 1721 1095 --11016 11302
NM_003399chrX51008 932 759 67 31 1385 1900 --
NM_003404chr2062020 1671 1659 1642 1628 1621 ------
NM_003405chr222490 41 ----135
NM_003406chr811210 ----11571
NM_003411chrY21638 134 11783 ----
NM_003412chr332476 1161 268 ----11042
NM_003458chr3113750 3461 2964 2806 2646 1493 1483 991 984 774 294 33770 2750 2652 11266 --
NM_003459chr23718 128 21 --1656 1625
NM_003466chr242252 1932 684 632 22384 489 1556 1813
NM_003468chr253321 1164 953 504 352 --11064 --
NM_003472chr621204 467 ------
NM_003480chr1222046 1437 ----1156
NM_003482chr12102416 2404 2042 929 830 761 500 494 488 174 2310 40 22655 584 --
NM_003483chr1262708 2467 482 472 102 25 ------
NM_003502chr161216 1119 1135 --
NM_003507chr241651 1639 1338 29 --12021 --
NM_003574chr1865061 4967 4738 1374 902 655 1410 24861 1746 --
NM_003576chr132121 94 1970 ----
NM_003590chr242755 1619 1569 552 ------
NM_003607chr162819 2665 1576 1492 1014 45 13694 33779 3118 78 1900
NM_003615chr342551 857 809 506 12961 12573 --
NM_003624chr1951212 1097 927 386 71 31136 473 372 2318 53 --
NM_003629chr112890 12443 12764 --
NM_003633chr552356 2217 2169 1030 43 --11762 --
NM_003637chr151510 1226 623 433 223 --1406 --
NM_003644chr17196492 6477 6341 6119 5352 4030 4006 1796 1747 1468 1381 1360 1266 1183 1035 953 912 773 88 1967 36383 4077 732 --
NM_003663chr32587 156 --12145 13254
NM_003671chr953209 2305 558 399 146 ----2964 116
NM_003680chr12482 31 176 --169
NM_003713chr121486 1217 --1443 --
NM_003735chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_003736chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_003740chr661675 1567 498 147 51 21 11751 11283 --
NM_003743chr272012 1906 1629 481 439 378 372 ------
NM_003760chr11675 ------
NM_003763chr2051995 1045 977 871 570 22635 763 ----
NM_003768chr13468 60 47 31784 646 458 1321 2738 98
NM_003822chr132183 579 351 ----12819
NM_003861chr142421 381 12881 22436 2329 --
NM_003872chr252458 2400 2318 524 481 --12230 --
NM_003873chr103796 658 179 ------
NM_003885chr1792708 1826 990 984 806 647 575 492 447 2907 218 ----
NM_003887chr242189 2061 1729 468 ----1501
NM_003888chr1551526 1329 1275 1142 203 21242 406 11318 --
NM_003893chr102326 46 122 1117 1114
NM_003895chr212700 349 1327 --11380
NM_003913chr611672 --23494 1055 --
NM_003922chr15------1319
NM_003932chr2241473 1348 528 137 ------
NM_003936chr26885 779 760 475 32 25 ------
NM_003938chr195877 260 180 133 27 ------
NM_003942chr112446 121 1593 --1720
NM_003949chr1791838 1647 1618 1574 1304 1267 485 418 55 ----1180
NM_003955chr1741194 644 584 209 1503 11472 --
NM_003968chr31127 1474 ----
NM_003987chr10132137 1895 1845 1835 1734 345 316 249 230 165 131 120 72 --1843 --
NM_003988chr10142214 1972 1922 1912 1811 422 393 326 307 242 208 197 149 27 --2920 42 --
NM_003989chr10122073 1831 1781 1771 1670 281 252 185 166 101 67 56 --1779 --
NM_003990chr10122073 1831 1781 1771 1670 281 252 185 166 101 67 56 --1779 --
NM_003994chr1234105 950 806 2630 139 ----
NM_004006chrX52619 1996 1938 933 596 ------
NM_004007chrX52619 1996 1938 933 596 ------
NM_004009chrX52619 1996 1938 933 596 ------
NM_004010chrX52619 1996 1938 933 596 ------
NM_004011chrX52619 1996 1938 933 596 ------
NM_004012chrX52619 1996 1938 933 596 ------
NM_004013chrX52619 1996 1938 933 596 ------
NM_004014chrX52619 1996 1938 933 596 ------
NM_004015chrX52619 1996 1938 933 596 ------
NM_004016chrX52533 1910 1852 847 510 ------
NM_004017chrX52619 1996 1938 933 596 ------
NM_004018chrX52533 1910 1852 847 510 ------
NM_004020chrX52619 1996 1938 933 596 ------
NM_004021chrX52533 1910 1852 847 510 ------
NM_004022chrX52533 1910 1852 847 510 ------
NM_004023chrX52533 1910 1852 847 510 ------
NM_004028chr18------164
NM_004035chr17104501 3786 3734 3704 3620 3593 3452 1792 1392 429 23792 3236 24871 3213 34547 4344 3958
NM_004041chr113561 462 112 1688 4549 233 213 39 --
NM_004050chr1432558 2040 864 1878 12029 --
NM_004067chr73607 375 168 140 ----
NM_004078chr13320 176 32 11110 31009 974 969 --
NM_004083chr12171 142 ----
NM_004089chrX41195 914 392 151 --1161 --
NM_004090chr1752847 2372 913 448 162 22872 2763 12550 13024
NM_004093chr1352814 2714 2633 2362 1241 --1550 --
NM_004094chr142953 863 32339 875 829 12939 --
NM_004105chr22345 219 21005 120 ----
NM_004114chrX------180
NM_004117chr642122 1950 661 204 22038 1867 ----
NM_004119chr132668 118 1531 --139
NM_004169chr173618 67 27 --2654 597 --
NM_004171chr1168887 8492 7821 3807 3715 845 --22181 2026 --
NM_004185chr11640 --292 85 --
NM_004186chr35930 818 649 311 293 --1373 --
NM_004193chr103387 367 348 ------
NM_004200chr11183198 2791 2738 2694 2617 2561 2539 2153 2111 2086 1212 1202 1170 902 769 459 381 180 32309 2238 2135 52928 2070 1108 1100 1085 --
NM_004227chr772674 2523 2480 2025 1175 662 313 11987 ----
NM_004229chrX21381 173 11568 --11492
NM_004230chr1982203 1655 956 868 541 429 332 106 11614 51818 1661 913 749 586 --
NM_004242chr61397 ------
NM_004274chr14102940 2871 2763 2609 2180 1261 365 289 107 85 --1344 --
NM_004283chr192730 312 2699 24 ----
NM_004296chr1462676 2533 2444 1616 1404 522 43916 3692 3290 2827 41608 1174 629 268 --
NM_004302chr1252630 2621 2525 867 838 12400 32576 2506 2407 --
NM_004309chr1741063 975 130 121 3857 759 188 ----
NM_004311chr10133027 2890 2835 2823 2751 2497 2265 2047 2016 1173 1018 673 93 1679 ----
NM_004319chr1112791 2461 2234 2160 2107 1112 1042 774 446 181 57 11130 11197 --
NM_004321chr293099 2933 2927 2543 2457 742 519 451 41 63259 3128 2680 1405 1315 79 21282 457 --
NM_004326chr121209 1020 ------
NM_004338chr18126469 6391 4917 4892 4409 2676 2518 2427 1419 1208 652 195 35028 1800 1399 16907 --
NM_004386chr1952339 2069 1658 933 813 ------
NM_004391chr371919 1866 1516 1430 647 97 66 --21479 372 --
NM_004392chr1331842 904 183 ------
NM_004393chr362311 2116 1528 1493 949 152 ------
NM_004395chr55589 522 110 98 25 2153 41 1265 --
NM_004397chr1154104 2975 2879 1415 197 13860 --1610
NM_004399chr123773 361 337 --2667 270 --
NM_004411chr74640 192 177 34 ------
NM_004420chr11152226 2177 2164 2116 2067 2054 1949 1821 1524 1506 953 544 299 248 29 21630 434 --11562
NM_004426chr1231706 705 45 --1688 --
NM_004428chr15808 555 210 204 108 ------
NM_004429chrX51292 932 925 334 98 21259 1065 21262 919 --
NM_004430chr862588 1845 1027 948 905 627 1346 1700 --
NM_004437chr193273 3254 2795 2784 2772 2422 1384 750 737 32694 1168 43 ----
NM_004440chr631791 1408 197 ------
NM_004441chr32998 122 ----11248
NM_004442chr191595 1359 1275 1163 527 443 99 83 42 ------
NM_004454chr332027 622 576 ------
NM_004458chrX22047 2033 ----12685
NM_004468chr13438 138 70 --1245 --
NM_004481chr172621 2384 2376 2133 2121 1662 118 --2894 550 12181
NM_004494chr171177 348 327 183 139 103 30 1859 ----
NM_004500chr1431639 125 75 11705 ----
NM_004501chr133431 2956 893 23593 927 1485 --
NM_004505chr1731815 1310 256 1804 ----
NM_004514chr1783005 2617 1064 377 368 248 221 106 --2870 675 12862
NM_004516chr194475 376 313 122 ------
NM_004527chr1771349 1341 477 380 70 59 53 2318 46 176 --
NM_004529chr941409 554 512 229 ------
NM_004543chr23317 139 74 ------
NM_004575chr431180 374 256 ------
NM_004578chr12977 822 ------
NM_004583chr174622 536 122 38 --3612 173 63 --
NM_004586chrX21928 579 2442 283 ----
NM_004588chr11143832 3767 3228 3062 2765 2627 2513 1396 1195 851 249 176 155 118 --4968 344 186 52 --
NM_004598chr532862 2820 2592 33009 2946 1238 ----
NM_004599chr221457 1132 128 --
NM_004602chr2031470 526 210 ------
NM_004603chr7101129 1045 960 928 838 298 163 66 40 21 --126 --
NM_004608chr165338 160 88 78 28 2421 124 ----
NM_004631chr141248 1092 978 441 1249 ----
NM_004655chr1751167 1113 939 398 242 ------
NM_004657chr23397 193 22 192 ----
NM_004660chrY2254 24 ------
NM_004686chr82234 218 --21731 344 --
NM_004709chrX31359 601 581 --2569 546 --
NM_004711chr22123534 3516 3503 2431 2398 2270 895 862 826 681 494 26 22261 668 23113 3052 23593 843
NM_004714chr192280 70 1105 ----
NM_004716chr112704 687 --1271 1115
NM_004717chr741246 587 290 125 1403 1347 --
NM_004719chr121604 --21116 200 12764
NM_004725chr101295 ----11220
NM_004730chr551718 1700 698 600 36 ------
NM_004737chr2241267 1159 1039 52 1230 ----
NM_004738chr2052041 1942 1024 447 43 ------
NM_004745chr8156780 6726 6101 5805 5423 5254 5029 2634 2509 2423 2194 1970 871 417 69 26039 5989 22030 1463 --
NM_004748chr15--1406 11327 14041
NM_004750chr193103 70 22 ------
NM_004758chr1771165 1094 1066 879 818 771 227 --41087 1082 839 761 --
NM_004763chr2------5796 740 404 348 292
NM_004766chr3165 ------
NM_004772chr521242 385 --1321 --
NM_004774chr1732437 2231 1159 --12291 --
NM_004776chr2063166 3074 2775 2377 940 285 --12363 13125
NM_004788chr111339 --1261 --
NM_004791chr13183 ----1256
NM_004796chr141304 21624 865 --1947
NM_004798chr2031124 860 740 ----13045
NM_004807chr292326 2265 2023 1771 1672 1644 1026 566 471 3846 684 535 --173
NM_004808chr1012370 12848 22691 294 --
NM_004815chr154363 4110 3021 935 490 --1742 --
NM_004821chr53748 732 40 1769 2325 237 --
NM_004824chr631288 904 103 ------
NM_004831chr193806 726 305 ------
NM_004834chr253408 2749 2187 1193 249 ------
NM_004849chr641592 317 199 62 ------
NM_004850chr231624 397 359 ------
NM_004857chr1443773 3590 1675 171 14387 23599 1564 --
NM_004863chr1474139 1448 805 788 743 441 137 31683 454 40 35231 527 143 --
NM_004884chr1551715 1189 689 404 398 --21471 1168 --
NM_004890chr173105 94 81 ------
NM_004898chr432790 2783 2011 12154 1684 --
NM_004904chr776355 4778 4206 2628 621 588 568 --24452 1440 1783
NM_004922chr103971 763 169 --1216 --
NM_004924chr1921056 816 --179 --
NM_004925chr95161 132 70 51 25 --2126 97 --
NM_004926chr145604 595 587 494 43 2178 78 1577 11649
NM_004932chr551331 1323 665 271 72 --1100 21399 568
NM_004943chr1981228 1217 1169 1133 1015 399 312 130 1213 31022 948 931 --
NM_004947chr372004 792 693 541 127 87 29 --1675 1557
NM_004948chr1821303 1105 ------
NM_004956chr773519 3216 1644 1557 1424 735 412 11803 --14210
NM_004959chr951480 1408 1382 1004 267 --1604 11012
NM_004973chr631483 1110 633 11431 ----
NM_004976chr11124639 4468 4203 3760 3579 1439 1384 1098 787 645 638 493 14320 11486 11106
NM_004977chr196549 464 414 407 398 71 ----1528
NM_004978chr171275 1222 1214 1197 655 226 50 1376 21288 358 --
NM_004979chrX51173 784 479 282 194 ------
NM_004985chr1254419 4362 4162 2786 558 ------
NM_004992chrX198270 8142 7848 7787 7744 7487 7365 6714 6674 6432 6179 6012 5894 2966 1541 1401 553 453 444 57593 7338 6541 2881 332 45875 2526 1563 1279 17438
NM_004992chrX198270 8142 7848 7787 7744 7487 7365 6714 6674 6432 6179 6012 5894 2966 1541 1401 553 453 444 57593 7338 6541 2881 332 45875 2526 1563 1279 17438
NM_004995chr142559 24 21332 1323 2379 154 --
NM_005010chr721703 384 --11913 --
NM_005011chr731401 562 176 1491 --1449
NM_005016chr12258 41 149 1140 --
NM_005028chr1051525 1457 790 739 301 --2856 600 11791
NM_005044chrX73987 3734 3191 1511 1331 615 117 --23504 1141 --
NM_005056chr1274894 4744 4630 3972 709 327 187 --25574 1619 --
NM_005060chr161138 1000 979 946 74 48 --168 --
NM_005065chr1444835 4794 1843 1354 54767 2087 1986 1947 759 24035 1989 13578
NM_005068chr611278 ----1926
NM_005069chr2161715 511 385 364 210 146 --11263 --
NM_005078chr1551769 1761 1382 1247 1241 11632 1551 --
NM_005080chr221124 1964 ----
NM_005094chr94651 577 569 473 --3467 114 58 1136
NM_005096chrX41210 432 356 24 1129 ----
NM_005099chr151112 967 860 399 229 --11014 --
NM_005110chr53665 252 31 ----2589 149
NM_005116chr2084003 3955 3024 2895 2791 1282 694 353 42885 995 811 328 14136 13367
NM_005121chr1733325 3189 1309 --11501 --
NM_005134chr182921 789 ------
NM_005135chr1541443 915 909 82 189 12757 --
NM_005144chr871206 1071 417 393 290 227 126 --31154 974 956 1938
NM_005151chr182144 108 22286 420 1508 1332
NM_005156chr9--13707 23523 1685 23381 1383
NM_005187chr1661639 1622 1549 1356 1312 332 150 11650 --
NM_005188chr11187658 7266 6976 6793 6731 6613 6491 6449 6152 5730 5627 5044 3120 3082 3058 2927 1388 494 22388 2149 25718 2621 15091
NM_005197chr1445381 5342 5157 2404 12093 24251 452 24243 2242
NM_005206chr172926 433 --1552 --
NM_005211chr54563 554 228 26 ------
NM_005215chr181623 2124 111 1652 --
NM_005219chr54580 569 114 105 --11399 --
NM_005220chr1741436 1405 1135 552 173 1246 --
NM_005229chrX51214 946 341 230 24 ----145
NM_005231chr1111415 21111 514 ----
NM_005235chr287608 6129 6063 6034 5520 2309 1056 54 --42459 1758 860 87 41948 1944 1940 1936
NM_005257chr1841118 249 213 34 --152 --
NM_005263chr12392 70 --192 --
NM_005277chr421272 24 268 60 ----
NM_005308chr10----1134 1178
NM_005312chr982136 982 952 934 908 748 719 292 ----1316
NM_005324chr1731386 703 120 ------
NM_005334chrX61649 1428 566 507 80 71 31623 1318 260 41228 575 319 104 --
NM_005347chr941204 314 253 105 11685 21366 541 --
NM_005349chr42543 424 1493 ----
NM_005359chr18126408 5971 5724 5500 4653 2479 1837 1747 1457 886 410 253 --12324 12321
NM_005370chr193820 368 89 3493 250 104 1518 --
NM_005375chr6------1176
NM_005376chr131090 785 402 ------
NM_005386chr204852 679 613 325 ------
NM_005397chr782998 2526 1619 1205 931 590 563 53 1903 ----
NM_005398chr1031127 282 96 1189 1933 --
NM_005399chr153482 1749 1397 674 283 23085 1740 ----
NM_005402chr721818 187 ------
NM_005407chr142535 405 11303 1523 --
NM_005413chr24393 170 59 46 --1105 --
NM_005417chr2051785 1603 462 384 76 1478 --1666
NM_005430chr1291052 903 780 649 642 354 313 207 92 --1807 --
NM_005431chr732135 1395 417 1822 1333 1465
NM_005434chr271263 1253 1096 614 501 299 108 --1659 1487
NM_005436chr1053091 2564 1630 1265 207 --11647 11070
NM_005440chr17113239 2994 2854 2767 2662 2536 1285 1021 594 538 490 23258 2530 1328 --
NM_005443chr41209 --124 --
NM_005458chr951954 1708 838 758 130 1647 1468 12214
NM_005465chr162058 1751 1728 717 144 134 --1151 --
NM_005474chr1751527 1488 498 454 31 11177 2513 166 --
NM_005475chr1262748 2642 2601 2395 808 440 11236 1195 --
NM_005497chr1775872 4072 2424 1588 1453 1423 1394 --21722 455 11650
NM_005501chr1741104 917 408 95 1923 ----
NM_005503chr1561132 841 722 404 391 47 1145 ----
NM_005507chr112317 156 --2182 131 --
NM_005523chr71298 2613 370 1599 --
NM_005527chr61108 1146 ----
NM_005529chr15960 916 685 158 128 4777 755 741 301 ----
NM_005542chr741868 1196 725 145 ------
NM_005578chr334213 3972 3930 --34836 412 256 --
NM_005584chr131540 1155 188 --
NM_005586chr62666 188 2464 128 1422 --
NM_005591chr1131789 682 157 ------
NM_005595chr11269 --1881 --
NM_005604chr62673 379 12312 1848 --
NM_005607chr83781 59 29 1942 ----
NM_005620chr13115 99 32 ------
NM_005634chrX6551 243 55 49 43 37 --124 --
NM_005638chrX21337 173 --11229 --
NM_005647chrX63375 3365 3165 2743 784 236 23233 2335 62671 2600 2329 774 676 299 --
NM_005652chr163917 460 281 1124 --1327
NM_005665chr133877 691 579 34020 1068 534 1738 --
NM_005668chr574141 3029 853 741 396 223 98 13940 1898 --
NM_005678chr156928 901 862 743 722 53 1783 3881 767 716 --
NM_005716chr194563 538 450 172 1232 ----
NM_005718chr3--143 1334 --
NM_005730chr1252473 2344 1428 355 29 1692 12847 --
NM_005736chr10111392 1360 590 438 398 392 386 365 338 43 21 ------
NM_005737chr272248 2181 520 488 425 388 235 --1329 --
NM_005738chr741916 1664 604 207 ------
NM_005739chr1531962 861 566 1431 ----
NM_005746chr732314 2292 833 12026 ----
NM_005748chr1253383 3369 3095 3083 1283 --12436 --
NM_005759chr274717 3957 3273 1852 1659 692 455 14657 178 --
NM_005768chr123673 664 617 1207 1253 --
NM_005778chr34368 307 151 48 ------
NM_005780chr131851 ----172
NM_005785chr1261849 1647 1362 582 553 255 21414 80 11757 1262
NM_005789chr1751762 1742 1581 1564 1359 32033 1590 1477 12177 1767
NM_005803chr62238 115 1356 1243 --
NM_005808chr373416 2971 2207 1332 1143 1127 334 ----1679
NM_005819chr153332 2795 2627 1357 325 --43060 2536 2295 164 12409
NM_005822chr632339 1886 705 ------
NM_005828chr17124596 4567 4396 3789 3769 1522 1440 968 704 685 161 60 14602 25014 1793 34138 1297 943
NM_005839chr11992 ------
NM_005840chrX107091 6298 5781 5713 4643 955 844 666 544 198 12073 57658 7620 6869 2585 2383 --
NM_005852chr1731101 849 98 --2182 89 127
NM_005853chr162107 69 1566 ----
NM_005859chr53228 219 167 2200 154 ----
NM_005868chr742528 2194 2064 238 ------
NM_005876chr22784 188 1798 1752 --
NM_005877chr2242165 1712 210 55 ----12319
NM_005880chr1621381 1235 --11505 --
NM_005895chr12123575 3229 3146 3053 2943 2632 2559 1604 1117 743 632 491 1852 ----
NM_005898chr1143007 2798 1011 256 --11190 --
NM_005901chr1877612 6987 6349 5813 5718 1762 1537 38500 7724 2372 21611 942 --
NM_005907chr641207 1200 475 211 ----11536
NM_005909chr553800 3516 2693 1594 235 11685 42835 2698 883 842 1830
NM_005910chr17113715 3535 3226 2838 2619 1244 1144 734 664 396 86 --23775 1047 11367
NM_005911chr231504 399 208 1310 ----
NM_005920chr1133668 3513 3203 2827 2751 2517 1263 1245 1193 1126 876 391 58 13688 11484 13079
NM_005933chr1182717 2607 2464 1940 1209 1185 520 362 32050 465 49 22800 2231 12402
NM_005934chr1982254 2195 1811 1711 908 222 179 166 ----22021 434
NM_005935chr4134560 4354 4296 3261 2115 2017 1531 819 803 761 640 548 139 14443 ----
NM_005937chr17134067 3920 3903 3762 3445 2919 2868 1228 1091 925 688 513 188 11278 1270 --
NM_005938chrX21322 532 21369 288 11266 --
NM_005941chr843506 2913 1477 843 --1831 --
NM_005943chr62667 661 --11564 11504
NM_005955chr185319 3993 3402 1930 1203 1041 479 339 --14355 --
NM_005962chr1031495 704 317 --1712 --
NM_005962chr1031495 704 317 --1712 --
NM_005986chr1352697 2550 2002 547 69 31959 760 167 22314 1108 --
NM_005990chr562261 1040 1013 969 559 139 ------
NM_006007chr953842 3711 3117 3077 432 --1449 13888
NM_006011chr15204275 4024 3518 3389 2977 2900 2887 2774 2743 2719 2685 1532 1236 1214 1127 929 876 386 273 248 13641 63802 2939 2813 2634 1291 905 --
NM_006015chr14924 238 184 91 --1170 --
NM_006030chr361643 589 322 60 33 21 1388 127 --
NM_006033chr182871 849 21481 88 ----
NM_006036chr22633 133 22335 1018 ----
NM_006037chr294846 4805 4674 4130 3330 1964 1412 1025 461 24563 159 ----
NM_006038chr2062166 1861 566 550 510 362 --2422 255 --
NM_006054chr1141302 1061 511 145 --11371 --
NM_006058chr53610 545 284 1553 2714 28 1187
NM_006080chr731190 456 139 2559 202 ----
NM_006094chr851936 1650 588 388 28 12056 --1601
NM_006106chr1132162 890 331 ------
NM_006133chr11112232 2196 2101 2017 1757 1706 905 887 818 668 450 32120 789 580 52237 2167 1984 1560 769 --
NM_006134chr212622 312 --11642 --
NM_006135chr11432 ----11425
NM_006141chr1632407 2146 1059 ------
NM_006148chr1772708 1944 791 529 497 431 122 12380 12383 --
NM_006157chr11--149 1134 --
NM_006158chr811815 11534 ----
NM_006160chr1761334 1302 1044 518 85 45 11552 ----
NM_006162chr1841646 1600 1179 43 1144 ----
NM_006180chr931799 1466 223 ------
NM_006182chr14159 152 146 79 161 ----
NM_006187chr1263142 2996 2502 2371 1295 855 1312 21996 392 11058
NM_006191chr125724 673 397 148 130 ----190
NM_006201chrX7891 814 747 740 452 337 118 1178 21103 306 --
NM_006202chr1962007 1934 1868 431 351 65 21353 177 51416 1404 790 783 33 --
NM_006206chr452873 2361 923 41 28 1429 --1438
NM_006224chr1742250 1971 812 770 22148 894 32080 1977 66 --
NM_006237chr1342085 1946 1671 587 1719 1713 1149
NM_006238chr631904 764 371 51833 1446 699 520 60 1319 --
NM_006241chr331528 857 650 ------
NM_006245chr62729 671 1281 ----
NM_006251chr532874 1240 733 23200 532 1578 --
NM_006256chr132529 885 261 ------
NM_006265chr83516 479 447 ------
NM_006266chr94659 302 192 87 ------
NM_006268chr113922 174 53 ------
NM_006275chr2032499 2480 834 ------
NM_006279chr14910 716 661 638 2598 63 ----
NM_006289chr94449 379 352 298 2390 142 1303 --
NM_006293chr152351 185 1160 ----
NM_006306chrX105131 4476 4469 4372 4343 2280 1718 1515 1152 22 1280 1638 --
NM_006315chr4124486 4292 4238 4223 3569 3033 1783 1572 1462 1353 579 232 24118 3744 23666 1404 --
NM_006321chr331841 185 117 1455 11391 --
NM_006359chrX12476 12410 ----
NM_006367chr13887 313 86 ----11037
NM_006371chr384874 4619 4290 3462 781 451 295 191 23926 3889 23456 3291 --
NM_006380chr1753524 3402 963 555 527 12846 --12759
NM_006382chr17----158 1218
NM_006389chr1171287 1276 1269 1004 902 227 119 2552 242 2376 34 --
NM_006390chr1231388 558 174 ------
NM_006393chr1053662 3331 3163 1711 372 ------
NM_006411chr64920 411 235 169 3709 192 57 4361 353 317 222 --
NM_006420chr203918 819 151 42386 1347 1307 430 ----
NM_006424chr461683 1442 1429 1341 1326 84 11707 --11879
NM_006451chr51869 ------
NM_006457chr422889 2771 23547 939 ----
NM_006458chr118411 386 352 315 287 266 151 145 ------
NM_006459chr102532 143 1621 1115 --
NM_006464chr274651 4406 3348 1474 1238 732 380 --31674 1387 286 11671
NM_006465chr1582346 2190 1728 1722 902 730 289 31 32076 1946 793 ----
NM_006483chr192280 70 1105 ----
NM_006484chr192280 70 1105 ----
NM_006489chr1451748 1478 1257 704 610 21345 1335 21508 1360 --
NM_006516chr12488 461 2546 538 21482 305 21318 368
NM_006517chrX51976 1599 248 124 53 51675 1533 750 427 335 1725 --
NM_006521chrX71296 1252 1208 919 285 144 82 31228 207 36 1413 --
NM_006526chr2011972 ----1575
NM_006534chr2072600 1287 1181 852 606 123 92 --1256 --
NM_006539chr163443 353 157 1418 1180 1387
NM_006544chr1455449 5294 5088 4260 4026 12061 12064 --
NM_006546chr17176524 6496 5986 5915 5903 5615 5572 5493 5136 4438 4356 2495 2341 1472 1154 1023 752 25519 191 12365 --
NM_006548chr32626 232 2274 262 1277 1642
NM_006549chr1232707 2239 2042 --32470 2457 1822 12428
NM_006557chr921109 493 --1264 11232
NM_006561chr1085670 5640 5400 4771 4194 4123 4075 1345 24960 4145 15026 11447
NM_006599chr1687458 6263 5708 2226 2117 1402 1374 872 1329 21771 1765 16406
NM_006609chr242110 549 52 29 ------
NM_006614chr333072 2896 2499 --21199 35 --
NM_006620chr621846 739 33705 1933 1855 11509 --
NM_006621chr141806 1768 1496 440 --31550 606 30 --
NM_006624chr1021452 24 --11719 --
NM_006628chr1584687 4024 3998 3979 3629 3581 1876 1162 --13676 --
NM_006629chr1832342 358 171 ------
NM_006650chr5143760 3666 3657 3528 3446 3346 2571 1371 889 716 710 604 555 198 11069 53550 3541 877 187 30 11002
NM_006662chr164299 254 41 31 ------
NM_006675chr1293270 2842 2731 2337 385 369 127 108 25 23026 133 21287 1028 12487
NM_006688chr174445 303 87 36 --1491 124
NM_006690chr2082224 1480 823 579 475 469 406 26 11883 52009 1966 933 349 271 11788
NM_006698chr2021375 265 --2452 302 11309
NM_006713chr51803 1217 ----
NM_006717chr973158 2633 1150 1136 967 400 313 ------
NM_006726chr42256 70 --1911 --
NM_006727chr5159 ----146
NM_006729chrX55582 5529 4916 3912 358 24966 3984 21046 541 24576 4190
NM_006741chr122412 208 11069 ----
NM_006742chr1641678 1647 1434 743 11595 31304 660 567 --
NM_006749chr8--2868 805 21152 148 1163
NM_006750chr16137526 7375 7233 5604 5454 3156 2923 2496 2142 1943 609 521 177 12092 56671 4996 2189 2045 52 11730
NM_006763chr121543 832 11689 31592 1578 621 --
NM_006766chr822340 907 2942 756 1624 --
NM_006772chr6151656 1593 1566 1424 1412 1322 568 438 354 348 303 265 192 143 48 31587 1226 596 11704 --
NM_006777chrX51935 1912 1106 1005 542 ------
NM_006803chr872118 2040 1697 738 646 530 112 ------
NM_006814chr2082393 2364 1977 721 267 250 229 146 ----1185
NM_006823chr8------1417
NM_006827chr1472785 2679 2568 1292 829 796 27 21337 162 --21124 937
NM_006841chr34674 614 193 32 2265 73 ----
NM_006851chr1252602 1972 1949 1836 870 11800 ----
NM_006852chr171223 32845 1029 143 12536 --
NM_006854chr72760 437 21900 1856 1418 --
NM_006856chr1241065 941 772 286 145 11148 --
NM_006857chr2--1703 1358 --
NM_006885chr1673504 3411 3387 2932 1109 1088 1061 13130 23516 412 13044
NM_006888chr1453453 3377 3153 2716 2435 --12449 --
NM_006892chr203956 917 155 1321 ----
NM_006892chr203956 917 155 1321 ----
NM_006896chr71423 --11112 1157
NM_006897chr12------1220
NM_006906chr112292 151 160 --1362
NM_006912chr131997 647 232 11635 --12162
NM_006914chr92385 137 --11454 --
NM_006915chrX32178 1794 1000 --21956 1683 --
NM_006920chr23633 509 352 ------
NM_006922chr242160 1651 1598 835 12278 ----
NM_006924chr1744362 3883 3076 2851 ------
NM_006927chr1672077 1877 1628 843 547 465 295 --1746 --
NM_006930chr542002 1512 651 550 11320 ----
NM_006939chr1421196 176 ------
NM_006940chr1251878 1863 1619 647 567 --31448 1398 559 --
NM_006941chr2271125 847 373 321 168 72 23 4462 432 178 31 ----
NM_006943chr20103110 2473 2373 982 796 525 507 349 197 134 21063 912 11072 --
NM_006946chr116522 502 496 400 235 74 ------
NM_006950chrX3895 734 226 --2286 123 1681
NM_006965chr1831105 1045 120 ------
NM_006990chr1102543 2254 2152 1957 1857 872 709 505 398 23 22187 1670 ----
NM_006999chr541457 773 163 31 --11319 --
NM_007006chr162319 128 1560 12876 --
NM_007011chr15106187 4407 4400 4360 4171 2127 1641 985 433 59 --1950 12006
NM_007030chr5164532 4524 4317 4305 4235 4213 3286 2072 2041 1948 1886 1466 1306 1214 1142 547 11101 24240 1630 13254
NM_007033chr182218 2126 1672 1465 1400 921 517 401 12224 1866 --
NM_007036chr51716 1829 ----
NM_007047chr641595 849 658 250 12204 22388 65 --
NM_007050chr20168023 7724 7641 6240 6129 6090 6082 5366 5341 2767 1845 1182 1038 778 566 301 27150 6215 47596 7417 6650 5078 16145
NM_007064chr321151 178 --11419 --
NM_007067chr1771275 1150 1075 1036 516 371 122 ------
NM_007081chr224460 260 104 93 2435 120 11144 --
NM_007114chr342998 2809 2260 809 ----22598 632
NM_007118chr53662 631 34 2656 645 ----
NM_007124chr631615 1604 1597 ----11257
NM_007144chr1781179 1082 1059 1053 523 359 103 51 --3965 75 43 --
NM_007158chr13377 298 31 ------
NM_007159chr311549 1386 ----
NM_007174chr1251624 953 790 134 106 --12382 --
NM_007185chr15724 704 421 415 162 11104 1363 --
NM_007192chr1431025 998 423 ------
NM_007195chr1883623 3264 3136 3044 2611 1360 1249 550 --11410 --
NM_007197chr1211012 1350 ----
NM_007207chr12802 193 ------
NM_007214chr61996 ----1499
NM_007232chr207818 768 300 283 243 146 79 1832 ----
NM_007236chr1562472 1669 1585 677 344 66 11513 282 76 1286
NM_007249chr13128429 8414 7065 6982 6666 6632 6202 3358 2664 1513 407 108 11475 37672 7031 3254 26053 5710
NM_007260chr14689 672 184 101 1308 ----
NM_007271chr641291 1177 706 508 ----1540
NM_007275chr35933 909 847 253 240 1780 1821 --
NM_007282chr311020 1357 1382 --
NM_007286chr541931 1310 566 22 --2752 612 --
NM_007292chr17104501 3786 3734 3704 3620 3593 3452 1792 1392 429 23792 3236 24871 3213 34547 4344 3958
NM_007327chr991188 1071 1040 1026 424 404 336 257 148 21178 775 3750 446 176 --
NM_007347chr1572932 2181 1140 1123 890 652 28 11216 12255 --
NM_007350chr1274324 3991 3082 2910 1623 1372 137 12937 1106 --
NM_007353chr773021 2289 2019 1116 742 707 556 1846 ----
NM_007365chr182049 1605 1498 850 795 592 507 186 21993 1622 12121 --
NM_012069chrX42062 2016 638 236 21860 485 11906 --
NM_012074chr144896 167 135 36 11135 1155 --
NM_012081chr563337 3247 3177 2986 2363 200 --1605 13650
NM_012090chr141134 946 824 33 ------
NM_012095chr1053106 2773 1233 454 415 12305 ----
NM_012102chr182479 2377 2285 2128 2080 1621 865 377 ----11674
NM_012104chr11113470 2893 2793 2784 2684 2456 1393 1225 893 841 303 43494 3297 661 121 ----
NM_012104chr11113470 2893 2793 2784 2684 2456 1393 1225 893 841 303 43494 3297 661 121 ----
NM_012121chr1731471 514 58 --1305 --
NM_012129chr731972 758 554 --1967 --
NM_012134chr1101718 1612 1459 1388 1364 1260 1244 753 664 81 --1360 11598
NM_012137chr152804 629 510 165 66 --32833 992 567 1960
NM_012141chr132507 146 --23100 1146 --
NM_012153chr1132429 1779 267 ----1959
NM_012156chr20123376 3176 2996 2924 2831 2730 2178 2123 746 677 412 349 --32546 2402 760 12933
NM_012157chr34616 389 169 77 185 1308 --
NM_012158chr1321316 181 ------
NM_012164chr9136363 6288 6257 6030 2565 2559 2401 2290 2046 1038 865 518 493 --26229 2448 --
NM_012193chr1175211 5032 4894 4870 3809 2093 149 13965 ----
NM_012199chr183621 1097 1058 661 622 615 226 219 21103 66 43251 3150 1434 757 --
NM_012200chr112355 26 --1159 --
NM_012214chr231840 1342 136 --35475 2435 2333 --
NM_012218chr19113062 2944 2699 2492 2093 1871 596 151 112 106 26 12778 12005 --
NM_012232chr1741899 554 392 23 1345 21575 137 --
NM_012234chr333098 3085 1150 --31500 402 59 21042 948
NM_012244chr1491522 1434 1376 1263 1195 540 466 221 195 21510 1169 21172 629 --
NM_012252chr72392 236 23750 3411 ----
NM_012262chr155239 4314 3888 1785 53 ------
NM_012264chr22112078 2066 1774 1727 1711 1612 1513 679 495 489 60 1605 21893 468 --
NM_012264chr22112078 2066 1774 1727 1711 1612 1513 679 495 489 60 1605 21893 468 --
NM_012266chr96989 883 770 444 262 85 ----160
NM_012282chrX4748 225 172 68 --3219 205 75 --
NM_012288chr6115678 5338 4901 4686 2250 2223 2171 1948 1115 365 239 14913 44452 4127 4098 1269 --
NM_012296chr1173962 3037 2828 881 822 317 201 43155 2967 1582 92 32912 1484 95 33023 2836 247
NM_012297chr432383 2315 759 12166 ----
NM_012301chr731505 572 26 --21459 585 1549
NM_012306chr1293495 3135 2666 2343 2256 2245 2232 2170 214 21197 1131 42266 844 786 131 1771
NM_012308chr1152488 2404 656 646 461 31685 766 357 1737 --
NM_012309chr1153972 1388 978 419 105 34183 885 274 34635 4158 1415 --
NM_012316chr194886 3947 3716 3549 2147 1868 1862 1794 1341 45334 2168 2134 1554 1147 --
NM_012325chr2021110 227 11328 11609 --
NM_012326chr27780 767 723 702 306 289 227 1643 160 --
NM_012329chr1721540 218 ------
NM_012334chr584754 4535 3936 3520 1854 1671 900 46 14048 34746 3083 1700 11295
NM_012338chr72368 182 ------
NM_012347chr662813 2682 1110 757 507 412 11009 ----
NM_012382chr574497 4244 4164 4151 4048 3709 3404 24391 4189 14232 --
NM_012384chr2052175 2053 2001 621 251 21714 1513 11645 --
NM_012396chr14625 545 487 42 2589 36 ----
NM_012398chr19182884 2775 2677 2644 2623 2589 2522 2403 2314 2208 1074 1002 923 655 224 113 72 37 42929 805 749 614 12788 1497
NM_012402chr1151413 1212 512 275 245 1519 ----
NM_012408chr20--2741 26 --1200
NM_012421chr1------1474
NM_012448chr1771945 1853 1724 1698 703 553 39 32230 1710 724 ----
NM_012464chr432112 1151 576 --12907 --
NM_012470chr73366 178 124 130 ----
NM_012478chr174743 329 321 27 1182 141 --
NM_013233chr2393 48 22 ------
NM_013236chr22162 1829 1467 --
NM_013246chr112182 168 2851 326 ----
NM_013253chr1131191 274 242 --1507 --
NM_013257chr81871 ----1326
NM_013261chr452881 2526 2391 919 589 --33678 2318 1364 --
NM_013262chr6----11121 1912
NM_013269chr1244147 3479 1394 508 14274 34228 1731 1550 --
NM_013279chr1171959 1760 1670 722 417 240 124 ------
NM_013293chr7------1165
NM_013316chr72836 44 172 ----
NM_013333chr192156 98 2266 130 130 --
NM_013336chr341601 1393 716 132 21675 1537 ----
NM_013372chr1562703 2320 1074 890 490 275 --13361 --
NM_013382chr1441972 604 450 75 --11737 12015
NM_013411chr162729 2590 2533 2029 1745 41 1666 ----
NM_013433chr1962023 1939 1555 702 469 173 11885 21427 166 21453 1424
NM_013434chr281983 1753 1493 1303 617 464 385 35 21430 648 258 41 11515
NM_013434chr281983 1753 1493 1303 617 464 385 35 21430 648 258 41 11515
NM_013446chr731331 1194 499 11360 11095 --
NM_013448chr14------1302
NM_013449chr1282942 2356 2125 837 568 561 71 44 12998 ----
NM_013951chr242252 1932 684 632 22384 489 1556 1813
NM_013952chr242329 2009 761 709 32461 566 48 1633 1890
NM_013953chr242329 2009 761 709 32461 566 48 1633 1890
NM_013958chr81330 ----158
NM_013959chr81330 ----158
NM_013960chr85702 572 260 237 44 --2739 118 --
NM_013961chr81330 ----158
NM_013962chr81330 ----158
NM_013992chr242329 2009 761 709 32461 566 48 1633 1890
NM_013993chr64581 565 531 288 2243 155 1274 --
NM_013994chr64581 565 531 288 2243 155 1274 --
NM_013999chr1771386 1378 514 417 107 96 90 2355 83 1113 --
NM_014001chr1731130 483 206 --127 --
NM_014016chr311446 ------
NM_014023chr1042293 1939 1054 787 ------
NM_014030chr1791128 1048 864 818 751 369 155 82 63 ------
NM_014042chr112237 52 --1217 --
NM_014048chr1664588 4242 3892 3661 1368 1171 --11417 21042 405
NM_014056chr332038 1923 1838 --31728 1424 270 --
NM_014079chr34351 116 45 32 ----1936
NM_014106chr153908 809 764 ------
NM_014112chr825252 1583 13972 ----
NM_014155chr1136920 1397 888 --26871 5030 --
NM_014157chr1643937 3256 1390 550 1119 22474 868 13144
NM_014166chr1321183 815 ----11027
NM_014190chr451538 669 537 466 47 --1748 --
NM_014217chr141496 541 370 206 ------
NM_014231chr1242160 2074 1578 786 51965 1912 126 89 38 21696 693 --
NM_014232chr1761640 1182 644 447 389 93 --2257 66 --
NM_014232chr1761640 1182 644 447 389 93 --2257 66 --
NM_014233chr1772031 2025 1715 1421 434 273 64 1279 11522 --
NM_014234chr6242 31 ------
NM_014240chr393512 3456 3369 2978 2670 2589 1432 1188 489 12831 --13344
NM_014268chr1851436 1354 329 309 243 1205 ----
NM_014289chrX41281 1239 1187 39 1550 11268 1463
NM_014292chr2261813 1684 753 295 184 68 ------
NM_014299chr1952163 1821 843 396 105 21926 219 ----
NM_014309chr2264951 4927 4463 3366 2038 2012 25057 3963 --24415 1637
NM_014317chr101197 ------
NM_014331chr455981 5031 1619 1189 819 ----15126
NM_014333chr11----2999 367 1996
NM_014338chr221154 186 ----
NM_014368chr951964 1339 780 533 119 41875 1865 1666 787 2451 110 195
NM_014372chr121380 390 ----11757
NM_014376chr582561 2087 2078 1809 1568 545 525 141 31634 368 318 2304 293 12007
NM_014382chr321387 285 ------
NM_014392chr421298 532 1167 ----
NM_014415chr321159 1077 11236 11628 --
NM_014418chr1441420 1389 706 332 1155 21914 1883 --
NM_014423chr524914 4674 24589 83 ----
NM_014445chr332140 1843 792 11555 ----
NM_014458chr12410 151 1462 --1398
NM_014489chr114612 255 149 79 1303 1177 --
NM_014491chr731060 791 58 ------
NM_014494chr1651853 801 672 334 123 1680 11804 --
NM_014550chr226661 587 228 196 138 78 ------
NM_014554chr1232205 1640 593 1750 11587 --
NM_014571chr1132954 2765 2713 2670 2423 2299 1120 847 667 642 594 542 23 11951 23003 1175 32398 282 191
NM_014591chr1081198 1052 840 353 299 292 228 70 ----11111
NM_014613chr5112711 2660 2196 2024 1889 1198 765 395 299 249 29 1312 --12979
NM_014616chr342643 713 63 34 1128 22223 1326 --
NM_014622chr113714 613 137 --1954 --
NM_014630chr1553849 3306 2748 2733 950 11430 154 1961
NM_014633chr11------1228
NM_014634chr22122744 2596 2447 2375 2313 2208 1228 1074 586 572 105 38 --22558 2525 --
NM_014636chr984202 4006 3013 1490 617 274 164 150 23408 3315 1180 --
NM_014661chr1093836 3368 2691 2535 1209 1191 995 147 54 22911 1074 22950 2587 --
NM_014665chr8183398 3339 2941 2483 2415 1087 1052 852 839 709 657 623 608 584 486 470 124 32 2641 479 1925 --
NM_014666chr52431 86 ------
NM_014670chr21255 11229 ----
NM_014682chr821602 544 --11656 --
NM_014683chr1731478 203 78 --1415 --
NM_014686chr1941938 1819 121 70 2666 43 1986 --
NM_014690chr742861 1991 1972 36 13052 42735 952 838 30 --
NM_014701chr1541372 1283 957 473 1687 1370 11358
NM_014702chr63484 202 122 13255 --13300
NM_014707chr731858 180 93 ------
NM_014721chr6107252 6909 6556 6228 5672 2637 2611 1410 923 571 24898 2557 16233 --
NM_014723chr2093136 2763 2598 2157 2014 827 586 436 391 33047 2367 1061 ----
NM_014726chr1771235 1140 1115 1021 406 122 48 1172 21131 498 1991
NM_014729chr8252 26 21486 146 --11824
NM_014730chr12125234 5218 5207 5054 4958 3623 3203 1972 904 826 594 175 --15041 --
NM_014730chr12125234 5218 5207 5054 4958 3623 3203 1972 904 826 594 175 --15041 --
NM_014731chr2071767 1577 1360 1287 373 154 75 --11605 --
NM_014732chr16155399 4982 4628 3869 3817 1799 1345 1332 1224 1095 890 704 449 118 75 3483 426 198 13707 --
NM_014739chr623833 2976 24242 2861 ----
NM_014742chr2081555 1483 1288 639 482 416 359 51 11494 21095 390 11342
NM_014746chr293398 3358 3307 3263 3094 1620 1251 543 390 23269 2762 13973 --
NM_014747chr195413 2317 2181 1868 1284 819 562 418 327 31337 1307 630 54765 3986 3862 1589 474 --
NM_014755chr233608 1252 226 131 ----
NM_014758chr1152007 1845 460 370 314 1746 1705 12060
NM_014765chr132537 2529 119 --1816 --
NM_014766chr752835 1272 678 72 43 11361 1153 1903
NM_014767chr10113594 3584 3569 3174 3107 3061 2742 2344 1161 1090 569 42944 2692 1306 280 41064 458 436 111 --
NM_014770chr1251027 493 128 108 28 185 1260 --
NM_014772chr1883573 2962 2387 1389 677 594 541 307 12937 22630 587 13059
NM_014774chr142802 2197 2173 122 2979 871 --11180
NM_014784chr13817 292 35 4968 925 797 273 --1915
NM_014786chr1141098 1070 517 279 134 ----
NM_014797chr622419 1143 11071 22543 786 1156
NM_014798chr17101638 1600 1396 1390 1284 676 613 478 201 55 41429 573 503 456 ----
NM_014800chr74812 242 209 186 --1298 1755
NM_014803chr1042695 2689 871 367 ------
NM_014810chr142522 1090 782 194 ------
NM_014820chr332082 1422 1408 11314 21365 603 --
NM_014824chr11--11726 11393 11908
NM_014826chr162819 2665 1576 1492 1014 45 13694 33779 3118 78 1900
NM_014827chr141505 1439 1431 1248 1472 ----
NM_014828chr143740 629 561 31729 951 517 1129 --
NM_014830chr1273696 3690 2669 2629 1365 1342 290 --23683 1259 --
NM_014832chr13--1108 --1717
NM_014836chr1051913 1693 432 134 53 ------
NM_014838chr2232658 478 209 ----11910
NM_014839chr132227 107 56 ------
NM_014847chr15554 173 167 127 113 ------
NM_014848chr1532334 1760 204 32507 2302 1025 22533 505 --
NM_014849chr151267 1221 273 108 80 ----1933
NM_014850chr364807 4736 3462 1945 1922 785 13032 31712 817 795 11337
NM_014860chr262175 2096 947 707 654 208 ------
NM_014872chr942213 2076 2045 926 11790 11793 --
NM_014873chr194315 3268 3048 1447 1396 881 864 584 421 11240 ----
NM_014876chr2221949 375 --2656 383 --
NM_014877chr17147579 6123 6099 5987 5595 5579 5285 4944 2669 2492 1859 1702 1218 1127 16449 12068 1606
NM_014893chrY22143 740 ----11535
NM_014897chr1763287 2966 2657 2547 109 103 ----12703
NM_014898chr1921992 284 1608 12038 --
NM_014901chr571569 1472 1436 1429 606 377 223 12326 ----
NM_014903chr1271994 889 703 695 626 488 408 ----12187
NM_014904chr1023720 3196 --21231 1182 --
NM_014906chr1763605 3566 3260 802 302 264 13086 ----
NM_014909chr1453720 3697 3217 2670 921 33202 2876 30 153 --
NM_014914chr24434 411 144 119 1131 ----
NM_014917chr12941 159 1107 --1379
NM_014920chr631235 582 73 23005 1453 --11053
NM_014921chr1962942 2702 2645 1206 328 107 --1336 --
NM_014926chr33805 759 122 --1104 --
NM_014933chr4------123
NM_014935chr1123482 3259 3167 2718 2591 1066 923 593 505 283 100 80 32942 2405 1136 11300 11362
NM_014939chr18--11450 11287 --
NM_014944chr151320 957 382 235 52 1171 ----
NM_014947chr142498 1107 996 794 ----12489
NM_014948chr2082455 2387 2052 1594 553 357 274 233 --12058 12161
NM_014952chr151631 3696 428 29 1678 --
NM_014953chr1353904 3178 3145 478 230 13875 33815 3357 3168 1998
NM_014964chr1792242 1914 1869 1735 1692 1490 537 371 211 42362 1849 1564 23 ----
NM_014977chr144481 150 82 36 --1493 --
NM_014978chr1021791 28 ------
NM_014982chr1433522 1762 900 --31444 188 164 23703 1509
NM_014988chr421026 962 --32666 2029 1883 --
NM_014989chr631378 506 488 11590 ----
NM_014990chr141211 134 11122 147
NM_014991chr452751 2568 1145 786 663 --12653 12650
NM_014994chr1582244 2147 2115 1976 1959 832 456 450 --31532 795 621 --
NM_015002chr1251690 1590 1502 197 115 21760 1523 ----
NM_015008chr352648 2565 2432 2286 30 1536 13014 11224
NM_015015chr1982003 1862 814 754 712 666 337 113 1229 ----
NM_015017chr11416 1261 1307 1464
NM_015020chr1643092 2408 590 302 --1349 --
NM_015024chr831128 1098 933 1281 11341 --
NM_015026chr1244671 3767 3636 1662 ------
NM_015027chr163816 776 286 --11362 --
NM_015033chr9133289 2448 2427 2385 2219 1323 1151 771 259 218 187 115 99 1174 42226 1198 1041 326 --
NM_015035chr2066023 5917 5044 1478 1156 166 22193 1636 21448 331 14275
NM_015039chr183241 2903 1517 673 356 317 83 39 --33106 1293 941 11160
NM_015042chr15124256 4134 4045 3874 3856 3297 3106 2669 920 405 164 126 23074 385 ----
NM_015044chr1663237 2812 2750 2472 2455 660 --2792 393 12869
NM_015045chr1021970 140 11530 --11514
NM_015049chr232457 2366 528 1654 ----
NM_015051chr932721 957 238 ------
NM_015063chr1981339 1251 1145 441 323 310 246 31 21219 357 3414 285 133 --
NM_015064chr1293124 2986 2721 2673 2492 1415 1089 625 157 12637 ----
NM_015068chr783901 3223 2434 897 581 334 153 108 --1248 --
NM_015071chr545359 2321 1249 1104 34969 2487 697 1463 11089
NM_015075chrX152106 1771 838 814 747 738 564 430 408 382 364 340 328 43 31 51812 1777 1734 776 667 2802 37 1848
NM_015076chr644361 2977 1581 787 12775 22932 2821 --
NM_015082chr562110 1796 1635 808 779 456 --12409 --
NM_015084chr521008 23 1413 --1100
NM_015086chr1231437 1025 51 11198 41325 960 612 40 --
NM_015090chr1165847 5807 5789 5515 4807 4640 4353 2329 1498 1132 1057 1005 548 294 281 97 64786 4311 1564 1475 1307 163 35924 5173 307 15295
NM_015092chr1674039 3265 2849 1596 1262 638 48 1402 24374 360 --
NM_015094chr22224623 4338 4257 4251 4139 4122 3771 3644 3608 3434 3275 3253 1867 1861 1791 1630 1509 776 382 224 215 33 44308 3663 3198 230 44302 3840 1337 672 --
NM_015100chr151704 1570 744 701 128 21558 822 1825 --
NM_015103chr32405 201 2935 287 2191 74 --
NM_015107chrX102218 1594 1561 936 487 436 280 212 154 26 ----1443
NM_015113chr1741673 1656 909 121 11823 31912 701 413 21972 404
NM_015115chr452693 862 842 626 304 23162 52 11298 --
NM_015133chr16121326 1318 1221 1108 1070 586 432 407 126 94 60 49 --2330 205 --
NM_015137chr841802 1667 860 272 12535 ----
NM_015138chr1572779 2699 2322 2208 816 307 54 52828 993 804 412 217 12416 --
NM_015144chr1663624 3601 3594 2796 856 248 13161 1396 --
NM_015149chr132166 664 80 ------
NM_015155chr1032896 2291 622 166 --32958 1273 533
NM_015156chr1473627 1387 795 787 762 207 150 1482 ----
NM_015171chr164420 348 64 43 --1190 --
NM_015191chr1112713 22097 126 ----
NM_015192chr2042991 2360 667 38 ------
NM_015193chr891292 1267 1092 1040 1025 943 444 253 218 ----1212
NM_015194chr17101681 1470 1463 1363 767 491 418 396 265 127 41416 596 543 231 1613 --
NM_015199chr332543 2506 2116 --22092 899 --
NM_015208chr1833886 3390 1007 13572 ----
NM_015209chr152128 1601 1456 546 198 21529 932 11433 --
NM_015215chr132696 2219 743 1933 ----
NM_015219chr1762369 2342 2202 1600 939 29 2804 489 1615 --
NM_015225chr982406 2140 2082 1998 1981 333 97 62 --22496 454 --
NM_015229chr1731004 463 120 --1943 --
NM_015230chr441485 1266 702 448 ------
NM_015233chr1322560 2505 --32371 959 53 1523
NM_015254chr873179 3149 2856 2480 630 533 481 22287 435 11252 --
NM_015267chr1261876 1761 856 847 277 201 --1230 --
NM_015271chr474034 3173 1587 1562 1250 657 183 12986 ----
NM_015282chr282695 2639 2454 2418 2263 694 678 69 ------
NM_015284chr151779 1314 654 381 183 1215 11717 12049
NM_015286chr1541791 1586 1535 263 ------
NM_015288chr5133792 3014 2828 1295 1157 1130 1110 633 625 454 398 250 115 22822 2572 12527 --
NM_015299chr1453515 3188 3030 1017 28 --31431 1276 307 --
NM_015310chr897793 7555 6816 5267 2963 2771 2460 1989 857 27970 2755 --1885
NM_015313chr1174820 4381 3664 3396 1649 690 123 11674 ----
NM_015315chr553162 1242 992 646 384 22826 837 33267 1064 750 --
NM_015327chr141301 1194 860 85 2498 380 ----
NM_015328chr752679 2092 756 120 58 --22482 2292 --
NM_015335chr122696 108 2797 523 ----
NM_015338chr2041400 616 393 346 ------
NM_015346chr1431590 377 243 21357 753 172 --
NM_015349chr662303 780 728 54 41 23 1251 ----
NM_015355chr1731767 1271 735 ------
NM_015360chr5142 ------
NM_015365chrX63846 3407 3264 3192 3151 2706 ----13793
NM_015367chr2251594 1264 671 599 581 ----1334
NM_015382chr142118 88 1189 ----
NM_015387chr231920 763 183 --1707 --
NM_015393chr463593 3251 3029 1382 990 688 --31422 1292 449 --
NM_015397chr931341 742 332 11392 11608 --
NM_015443chr171317 1581 21024 948 --
NM_015455chr523353 936 11197 --23570 270
NM_015460chr32577 200 --21507 96 --
NM_015475chr21369 ----1731
NM_015477chr152714 129 1727 ----
NM_015481chr1211936 897 807 750 691 422 257 213 122 75 37 11064 --1305
NM_015488chr251162 619 395 94 30 41434 546 480 413 ----
NM_015493chr193603 530 89 195 2630 481 --
NM_015509chr124671 607 446 138 11111 ----
NM_015511chr2051126 1055 1011 189 80 1730 ----
NM_015526chr1951235 1133 510 291 74 2350 200 ----
NM_015527chr164795 686 629 76 --1702 --
NM_015537chr951166 754 462 220 38 1769 1829 --
NM_015550chr783547 3512 2973 2778 2564 2523 1006 824 2434 419 --23556 2463
NM_015557chr193394 2673 1018 1009 276 205 121 100 66 11282 ----
NM_015564chr553317 3277 2872 2344 2310 12883 22424 397 --
NM_015568chr2074004 3654 3493 3147 2973 2903 1186 21313 723 21196 1179 --
NM_015569chr1104708 4519 4048 3808 1736 1427 970 798 439 326 ------
NM_015575chr242321 1273 1093 25 23104 1309 158 --
NM_015576chr34924 215 134 127 ----1814
NM_015584chr1741228 1152 332 240 ------
NM_015609chr1122925 2919 2606 2097 2018 2000 1839 1129 1089 827 429 58 62671 2587 2146 1908 673 407 11882 1146
NM_015640chr121450 875 24005 1748 14051 14280
NM_015649chr193362 354 96 146 --1128
NM_015651chr9112125 2112 2079 1618 910 866 730 549 539 527 403 11728 ----
NM_015678chr133661 639 116 --11424 --
NM_015686chrX162375 2252 2224 2212 2080 1872 1807 947 739 610 518 408 307 153 147 28 22201 349 22204 2175 --
NM_015691chrX42648 2628 2343 824 21978 1036 21981 36 --
NM_015726chr15660 556 511 496 420 11344 21420 582 --
NM_015840chr132107 636 628 12197 21016 778 1261
NM_015841chr132107 636 628 12197 21016 778 1261
NM_015848chr12264 29 141 1153 --
NM_015850chr851957 1889 938 77 32 32433 160 53 41813 191 180 154 1381
NM_015866chr131033 972 94 ------
NM_015872chr151795 1781 1212 577 378 21300 687 31235 713 593 --
NM_015874chr42543 424 1493 ----
NM_015878chr821453 233 ----1391
NM_015881chr1131191 274 242 --1507 --
NM_015889chr223876 817 310 ------
NM_015896chr3--2196 30 --149
NM_015898chr19142263 2021 1851 1839 1816 1785 1709 828 822 802 642 585 262 72 166 12488 1838
NM_015906chr154212 2992 1360 1351 1240 13764 13375 --
NM_015927chr163357 246 119 1103 2381 235 --
NM_015949chr731010 285 275 ------
NM_015955chr2127 1480 ----
NM_015981chr5172770 2689 2635 2590 2358 2144 2114 2078 1952 1256 1214 675 302 219 213 206 114 22232 1273 32346 654 47 --
NM_015982chr173393 324 133 178 ----
NM_015986chr1731421 1242 291 ------
NM_015995chr1584898 4644 4547 3812 3772 1742 121 33 45220 3931 3563 187 34361 2042 627 --
NM_016009chr154872 4686 4207 3760 3308 24438 3076 ----
NM_016021chr652503 2095 2080 1855 656 12757 --1990
NM_016022chr171070 918 383 295 239 44 33 --1116 --
NM_016025chr1651938 1753 1410 756 237 ----11889
NM_016032chrX41196 1136 1118 562 1132 11222 --
NM_016038chr71657 ------
NM_016041chr171255 ------
NM_016045chr201371 --1334 --
NM_016047chr2153 ------
NM_016057chr1231278 948 387 ------
NM_016061chr231549 1064 21 ----1184
NM_016076chr112794 1715 3967 604 222 1669
NM_016077chr17132 ----187
NM_016079chr252236 1865 1686 716 246 22000 1553 11872 --
NM_016081chr422131 1820 ------
NM_016083chr6--13226 23112 1268 --
NM_016103chr5------1404
NM_016125chr173439 165 143 ------
NM_016131chr231891 808 69 2130 30 ----
NM_016147chr1111101 197 21078 91 11087
NM_016151chr161255 ----199
NM_016156chr1132349 2264 1690 ------
NM_016174chr93346 127 112 1166 1353 --
NM_016206chr3108257 7801 7774 7581 7214 6972 3203 3076 2288 319 42817 1124 956 887 47471 3081 2326 2156 21919 1612
NM_016210chr351425 1367 1146 152 65 2614 456 11152 1578
NM_016211chr4------123
NM_016231chr1731275 1120 46 1545 ----
NM_016248chr1393715 2972 1407 1331 1324 1278 1091 1024 630 11102 13371 --
NM_016257chr17993 456 443 223 172 151 47 22617 119 23441 3076 --
NM_016260chr275027 2394 2180 2162 318 271 76 22173 645 ----
NM_016261chr171124 --2774 94 --
NM_016272chr2272438 1850 1763 703 568 541 191 41981 1961 509 483 ----
NM_016284chr163718 712 706 ------
NM_016287chr131906 1317 502 11410 1800 11363
NM_016320chr115845 839 371 222 147 --3850 315 113 --
NM_016339chr1761666 1262 1244 588 389 336 --1632 --
NM_016376chr17114241 4209 3370 3310 3120 2936 2907 2856 1335 1177 555 24175 79 33176 3009 347 --
NM_016418chr22153620 3387 3074 2913 2411 2398 2325 1312 1281 1247 1034 1003 800 467 78 73712 1375 836 591 473 400 143 23424 1421 11210
NM_016424chr171394 ----1733
NM_016436chr2012424 --1613 22502 760
NM_016441chr22545 501 ------
NM_016453chr32495 133 1553 3556 462 273 --
NM_016496chr193437 92 78 ------
NM_016507chr1793057 2599 2413 2407 2285 2121 660 560 235 12943 144 153
NM_016510chr22656 23 7650 302 288 274 260 246 232 1353 1691
NM_016513chr631235 582 73 23005 1453 --11053
NM_016522chr1141477 1311 380 22 ------
NM_016529chr1361019 915 823 783 375 302 ------
NM_016531chr423273 2838 138 ----
NM_016532chr1761089 1017 836 293 169 62 ------
NM_016542chrX31510 537 221 ------
NM_016548chr921423 361 21484 347 ----
NM_016574chr115944 723 268 65 38 --1115 --
NM_016577chr394438 4363 2761 1471 1064 999 959 694 516 34388 3865 891 11149 --
NM_016588chr61281 2353 33 ----
NM_016591chr51459 21208 419 ----
NM_016598chr341107 1082 192 62 126 ----
NM_016603chr532193 1745 818 --21544 226 --
NM_016604chr53956 475 140 ----1101
NM_016605chr572588 2517 2353 2080 1058 939 716 --32050 1692 828 --
NM_016607chrX1386 --159 --
NM_016621chr11154316 4308 4263 4085 4079 3755 3563 3114 3105 3075 2823 1630 1528 693 509 --23382 886 --
NM_016626chr1831444 1261 714 ------
NM_016652chr2031796 1785 89 21572 396 --11339
NM_016829chr31655 --2548 251 --
NM_016834chr17113715 3535 3226 2838 2619 1244 1144 734 664 396 86 --23775 1047 11367
NM_016835chr17113715 3535 3226 2838 2619 1244 1144 734 664 396 86 --23775 1047 11367
NM_016841chr17113715 3535 3226 2838 2619 1244 1144 734 664 396 86 --23775 1047 11367
NM_016929chr674329 3415 3205 785 176 47 22 --31828 378 226 --
NM_016952chr1183748 3601 3231 2924 2491 1395 678 521 --22934 669 --
NM_017412chr82466 126 1280 ----
NM_017415chr574567 4213 4165 3149 2781 1058 180 ----11604
NM_017420chr1421082 607 12344 ----
NM_017424chr2252000 1904 1624 527 416 11782 31580 1424 574 --
NM_017444chr851568 1531 1262 236 51 11337 ----
NM_017447chr2134067 1418 298 ----1520
NM_017449chr191595 1359 1275 1163 527 443 99 83 42 ------
NM_017452chr2031470 526 210 ------
NM_017453chr2031470 526 210 ------
NM_017454chr2031470 526 210 ------
NM_017459chr13381 332 84 ------
NM_017514chrX8791 759 374 338 278 241 218 125 155 ----
NM_017515chr1131189 1056 24 ------
NM_017522chr141248 1092 978 441 1249 ----
NM_017548chr341707 713 545 111 11399 --11423
NM_017550chr1951035 1028 420 236 92 2329 208 ----
NM_017551chr1052446 2090 825 405 27 136 12498 --
NM_017582chr161830 1571 1515 546 501 228 21613 1582 --11603
NM_017586chr9101651 1621 1507 1420 765 700 693 629 500 379 21669 239 ----
NM_017594chr953315 2274 597 579 555 21326 176 --12800
NM_017596chr1144324 4126 4032 3729 3681 2925 1740 1614 1454 951 571 500 363 343 --43757 3458 513 374 12977
NM_017602chrX7921 842 781 250 230 155 62 ------
NM_017607chr193350 342 175 2558 480 ----
NM_017610chr1531485 544 42 ------
NM_017626chr1021458 393 21639 172 ----
NM_017628chr4104395 4323 4309 4152 3755 3278 1953 1566 1419 1109 13254 --15154
NM_017629chr141868 1674 333 110 ----11359
NM_017637chr9109178 8241 7767 6852 6826 6488 5917 3043 2265 521 --28355 7995 --
NM_017644chr344897 4132 3939 1359 11191 13750 13893
NM_017650chr795693 4810 4124 1521 1404 1256 536 206 50 24009 330 ----
NM_017670chr115787 770 684 600 244 --3688 676 98 --
NM_017684chr153605 204 154 1220 11359 --
NM_017686chr11117 1968 ----
NM_017697chr83387 378 368 ------
NM_017709chr113274 13356 ----
NM_017724chr31121 ------
NM_017730chr31682 ------
NM_017737chr141587 820 584 427 ------
NM_017740chr1631474 1457 189 1409 --11185
NM_017742chr1821324 760 --3550 500 424 --
NM_017744chr14975 952 874 350 1645 ----
NM_017754chr6155045 4926 3912 3810 1981 1926 1896 1508 1307 1174 1033 842 387 319 155 2400 61 11468 --
NM_017762chr1522049 294 ----1279
NM_017772chr631207 153 99 1129 11094 --
NM_017779chr162638 2500 2458 2393 953 500 1847 ----
NM_017793chr155878 712 259 195 43 2344 23 156 --
NM_017797chr196900 868 849 171 135 23 1918 2665 125 --
NM_017811chr942904 2876 2225 236 --12895 --
NM_017813chr865738 5685 4968 4901 590 104 35354 1309 1085 25525 5388 22185 1575
NM_017822chr121303 1182 1734 --
NM_017826chr13--2513 36 1814 198
NM_017831chr1863139 1899 1853 1745 1198 814 14158 12996 --
NM_017848chrX114493 4458 3348 3000 2974 1146 539 518 488 139 21 13583 13762 --
NM_017849chr292810 2472 2311 2055 1113 727 497 486 190 12723 12640 12520
NM_017893chr1061326 1143 527 399 102 82 1460 21332 315 11313
NM_017902chr1085689 5129 4386 3969 3564 1894 1673 1006 --45386 4211 1267 176 24277 3773
NM_017911chr2231523 597 549 1440 --11192
NM_017938chrX31440 417 367 --1283 --
NM_017954chr731702 1650 1517 ------
NM_017966chr1141389 1292 965 397 139 1978 --
NM_017990chr16103703 3493 3359 1655 1151 630 558 295 235 80 --1191 11241
NM_017994chr752917 2645 2362 326 238 --22869 790 --
NM_018027chr1022010 193 32983 956 518 ----
NM_018030chr1821098 801 ----2995 139
NM_018045chr182918 2746 2634 2426 2329 1196 795 764 32532 2157 1221 12753 11243
NM_018061chr131744 1668 664 ----21510 185
NM_018070chr13531 423 137 1143 ----
NM_018084chr233070 2676 2323 ------
NM_018086chr261582 1572 1516 1509 1406 1315 11589 21563 1341 --
NM_018092chr1611070 ----1578
NM_018107chr145861 804 724 142 101 ------
NM_018110chr164891 288 282 179 11266 1381 --
NM_018114chr32440 195 ----1151
NM_018128chr1761468 480 406 223 178 109 ----1373
NM_018145chr152497 138 1129 ----
NM_018150chr1142 2769 217 ----
NM_018155chr363167 2709 2691 584 323 262 13152 ----
NM_018157chr1243128 3002 2491 961 --1796 --
NM_018171chr123890 882 735 1190 1848 --
NM_018178chr1----1204 1280
NM_018179chr12----292 42 --
NM_018181chr1821659 141 11595 --11428
NM_018182chr17102209 2153 1966 1778 1428 820 412 401 236 43 21712 291 22143 264 --
NM_018184chr311629 ----1839
NM_018192chr331024 662 420 1728 2946 861 --
NM_018205chr1052042 1854 1684 838 475 123 ----
NM_018206chr161215 1614 ----
NM_018207chr181697 1665 1627 1569 1352 653 532 44 ------
NM_018211chr152146 1889 721 587 200 12044 ----
NM_018225chr9125308 4248 4079 3678 3348 1676 1519 992 584 470 385 162 --1631 --
NM_018227chr412711 13179 ----
NM_018234chr272069 2009 1630 859 851 498 402 11940 2655 538 --
NM_018239chr1052042 1854 1684 838 475 123 ----
NM_018243chr463633 3566 3088 2657 2529 34 --11203 --
NM_018246chr83615 526 108 42657 2255 708 121 22003 927 --
NM_018263chr252279 2112 1921 1746 727 11733 12125 --
NM_018286chr17--160 1291 169
NM_018299chr833064 2122 497 ------
NM_018302chr41460 1518 ----
NM_018312chr1131823 864 422 31919 276 50 21913 1871 --
NM_018320chr11130 2400 118 1283 --
NM_018327chr203520 431 394 11643 21413 1309 1446
NM_018340chr1675011 4728 3869 1639 849 783 295 13797 14006 34778 4717 826
NM_018351chr12104087 3590 3413 3208 1837 1549 1334 1212 758 536 --13795 --
NM_018362chr1183365 3319 3247 2923 2478 1577 1186 1086 --12769 --
NM_018374chr745068 2071 1648 1418 --1168 14674
NM_018381chr196878 805 740 717 610 371 ------
NM_018383chr241804 1743 1417 453 11275 21464 205 --
NM_018400chr11124130 4041 3580 3029 3003 2992 2953 2911 789 265 194 174 34530 3016 1241 24345 157 34102 3808 3214
NM_018403chr343191 1600 1027 410 --13022 --
NM_018416chr1232230 955 417 12553 21657 306 22482 1019
NM_018440chr898452 7969 7695 7284 6476 6415 5541 1018 929 47978 7390 5612 262 27981 1910 15771
NM_018452chr6_random63024 3017 2689 2503 852 644 13732 ----
NM_018464chr10287 73 ------
NM_018469chr171152 ----1296
NM_018471chr2------176
NM_018482chr862138 1581 666 230 176 122 11653 ----
NM_018489chr181467 914 871 462 430 312 230 99 ------
NM_018553chr1741353 484 234 120 1549 ----
NM_018566chr151388 1100 481 374 113 1259 ----
NM_018602chr1531455 1262 1069 --21689 1275 --
NM_018638chr1253954 3495 3469 1998 1686 ------
NM_018644chr1161939 1843 1653 1516 1469 108 1843 152 1211
NM_018652chr15146 1186 ----
NM_018667chr16132554 2442 2362 2158 1883 1123 1110 1036 848 581 199 72 51 32300 2096 462 ----
NM_018691chr52791 51 --11103 --
NM_018717chr432908 182 78 --1706 --
NM_018718chr73517 404 173 ----1836
NM_018841chr133503 3081 217 21227 1207 1899 --
NM_018844chr72660 482 ------
NM_018898chr54729 616 596 267 --1214 --
NM_018899chr54729 616 596 267 --1214 --
NM_018900chr54729 616 596 267 --1214 --
NM_018901chr54729 616 596 267 --1214 --
NM_018902chr54729 616 596 267 --1214 --
NM_018903chr54729 616 596 267 --1214 --
NM_018904chr54729 616 596 267 --1214 --
NM_018905chr54729 616 596 267 --1214 --
NM_018906chr54729 616 596 267 --1214 --
NM_018907chr54729 616 596 267 --1214 --
NM_018908chr54729 616 596 267 --1214 --
NM_018909chr54729 616 596 267 --1214 --
NM_018910chr54729 616 596 267 --1214 --
NM_018911chr54729 616 596 267 --1214 --
NM_018912chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_018913chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_018914chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_018915chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_018916chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_018917chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_018918chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_018919chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_018920chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_018921chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_018922chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_018923chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_018924chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_018925chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_018926chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_018927chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_018928chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_018929chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_018970chr742293 1020 492 151 ----12383
NM_018976chr1232190 75 32 ------
NM_018979chr1221604 451 22178 433 12078 --
NM_018982chr13427 148 56 ----1212
NM_018999chr1054516 4422 3261 1104 309 1359 2995 528 --
NM_019001chr343824 1746 312 41 ------
NM_019007chrX1114 ----2544 37
NM_019008chr2263115 2847 1512 1371 222 122 11208 1601 23160 1030
NM_019027chr441909 772 757 244 ----11686
NM_019032chr14669 647 455 65 3696 653 50 ----
NM_019050chr4------21531 564
NM_019072chr543525 3491 2706 1687 --11410 --
NM_019074chr155855 838 751 638 367 --1628 --
NM_019084chr1012476 11753 ----
NM_019096chr64849 843 835 448 1868 --1300
NM_019098chr841704 742 426 196 ------
NM_019106chr2283194 3015 2807 2518 2391 2191 658 72 22997 2566 33211 2178 618 22970 689
NM_019116chr1642764 2307 1445 166 ----23303 3140
NM_019593chr2022061 569 32772 2720 2681 11278 --
NM_019859chr1021112 1000 21119 592 ----
NM_019860chr1021160 1048 21167 640 ----
NM_019884chr196499 439 166 139 31 25 ------
NM_019885chr261860 760 696 688 546 216 1151 11114 --
NM_019895chr341079 852 144 69 ------
NM_020039chr1271673 1621 1217 714 666 547 331 11356 21374 660 --
NM_020122chr256014 5401 2151 1559 167 25881 1114 1614 --
NM_020141chr132391 718 536 ------
NM_020142chr123580 258 99 151 2157 63 --
NM_020147chr152848 210 1183 ----
NM_020150chr1022005 657 --11444 --
NM_020177chr542729 1238 884 759 ------
NM_020178chr172274 27 --1995 1390
NM_020182chr2082997 2318 2308 2259 1420 1401 1165 126 --12927 --
NM_020184chr271630 1551 1519 1459 861 770 29 12107 ----
NM_020198chr17134 --11025 --
NM_020205chr132592 2358 2231 1293 12422 --
NM_020214chr15245 25 --2230 205 --
NM_020235chr3142 1321 ----
NM_020239chr13915 784 344 11884 2714 524 --
NM_020248chr191982 1928 1916 1659 1548 774 670 134 98 1115 31541 734 698 --
NM_020251chr113561 462 112 1688 4549 233 213 39 --
NM_020309chr1921093 863 --2699 239 149
NM_020310chr17152520 2507 2229 1961 1833 1819 1793 707 659 568 342 291 241 176 58 32173 113 67 12020 --
NM_020336chr2033165 1042 767 ----12706
NM_020337chr422731 1111 11023 22725 784 --
NM_020338chr10183299 3135 2823 2764 2420 1426 1413 1400 1337 1319 1040 913 381 272 223 96 45 23 41353 538 528 51 32735 764 71 --
NM_020341chr202767 188 ------
NM_020346chr111188 ----1670
NM_020348chr10102693 2671 2637 2348 2133 1845 1717 1019 307 126 --2135 62 --
NM_020390chr354249 4211 3608 1115 952 --11162 --
NM_020416chr442044 809 715 240 21038 30 ----
NM_020418chr34432 409 146 136 171 185 --
NM_020429chr782778 2566 2339 2181 2175 2150 2034 414 52729 2416 229 216 183 --11024
NM_020440chr1113145 3093 2873 2491 2324 1209 776 735 714 526 459 --1466 12307
NM_020443chr1116962 6939 6745 6286 5975 5818 4917 4397 2716 465 23 15773 1777 25584 2048
NM_020444chr531326 1260 49 ------
NM_020455chr642221 1807 882 32 ----1496
NM_020456chr1342231 1825 853 149 11669 11870 --
NM_020473chrX2797 543 1232 11892 --
NM_020475chr8102458 2426 2018 1968 1957 1546 611 602 512 484 --32008 1774 1640 --
NM_020476chr8102458 2426 2018 1968 1957 1546 611 602 512 484 --32008 1774 1640 --
NM_020477chr8102458 2426 2018 1968 1957 1546 611 602 512 484 --32008 1774 1640 --
NM_020478chr8112521 2489 2081 2031 2020 1609 1559 674 665 575 547 --32071 1837 1703 --
NM_020480chr8102458 2426 2018 1968 1957 1546 611 602 512 484 --32008 1774 1640 --
NM_020526chr1101659 1338 1250 1148 708 660 634 564 200 40 11527 31806 721 389 --
NM_020676chr34302 251 72 47 ------
NM_020689chr2041181 566 180 166 1200 --11388
NM_020698chr12103149 3000 2928 2002 1952 1232 911 664 603 256 --1486 --
NM_020699chr1204241 4221 4117 3895 3881 3874 3826 3784 3765 3441 3433 3414 3408 3369 1556 1331 952 744 180 28 23797 417 11164 --
NM_020702chr981702 1584 1556 1523 1349 1137 395 99 31611 1168 111 1228 --
NM_020704chr742400 1943 873 66 --12301 --
NM_020708chr2061663 992 865 780 469 370 11707 ----
NM_020713chr20123094 3056 2591 2466 630 624 602 456 375 142 104 45 1574 197 1474
NM_020715chr1451999 1778 1627 512 288 1398 11744 11904
NM_020717chrX114766 4393 3631 3291 1229 989 764 752 701 466 140 2492 347 34933 605 121 23072 201
NM_020718chr1654788 1941 1237 705 529 15976 ----
NM_020728chr712455 --33075 50 44 --
NM_020739chr15--1406 11327 14041
NM_020742chrX52212 2010 274 164 38 ------
NM_020748chr1731425 1338 249 ------
NM_020750chr661148 492 439 314 102 91 ----11141
NM_020753chr174720 183 76 40 1139 ----
NM_020766chrX63859 3434 3373 3245 3069 933 13132 ----
NM_020768chr542463 940 354 159 --1922 13014
NM_020769chrX2390 138 --1107 1177
NM_020770chr131159 191 73 --1428 1485
NM_020772chr17106858 6522 3422 2648 2446 1879 1760 1287 487 401 17834 11566 --
NM_020778chr15114242 4020 3280 1838 1787 1730 1724 824 775 558 251 43907 3589 1574 221 --21914 29
NM_020783chr1811665 22259 938 11697 --
NM_020794chr131099 350 147 ------
NM_020795chr1781981 1678 1332 570 427 415 346 50 1113 --11759
NM_020796chr552918 1163 1154 325 313 --22828 715 --
NM_020804chr6142520 2506 2415 2215 2191 2148 962 579 436 349 275 180 60 46 --3505 354 325 1980
NM_020805chr182360 112 11338 1648 --
NM_020807chr1641504 1390 706 228 1108 ----
NM_020810chr1433213 3148 455 11112 ----
NM_020821chr153605 204 154 1220 11359 --
NM_020841chr1233435 2539 740 ------
NM_020845chr12112458 2360 2326 2278 2251 2215 1732 653 501 366 347 41771 767 356 254 12031 --
NM_020850chr16102931 2842 2836 2554 2388 1251 1081 846 175 36 12917 2855 113 --
NM_020858chr1542048 2023 944 405 --11504 --
NM_020888chr171476 1401 1367 683 424 215 35 --21634 482 --
NM_020899chr1741612 1604 38 27 1502 21022 258 --
NM_020921chr1442691 1333 1205 601 ----11240
NM_020922chrX2469 347 21761 622 11679 --
NM_020935chr253946 1871 1647 427 56 ------
NM_020940chr1042752 1910 1176 51 ----173
NM_020943chr21199 1175 ----
NM_020946chr971585 1417 673 419 229 79 50 21350 325 1589 11308
NM_020947chr1641749 1527 600 236 --11965 11951
NM_020948chr142501 2241 1367 246 ----23496 3492
NM_020951chr1921824 603 --21718 1567 --
NM_020956chr1994057 3475 3210 2921 1391 1181 1121 1047 125 24430 145 54638 3185 1014 537 69 --
NM_020962chr152915 377 1971 11715 --
NM_020964chr1884296 4088 3699 3454 3152 727 346 264 23409 282 23612 3319 23565 628
NM_020971chr195734 615 543 228 222 1216 ----
NM_020972chr43414 365 30 ------
NM_020975chr1041877 798 291 65 ------
NM_020977chr462035 857 490 430 326 284 ------
NM_020987chr1021443 89 1173 ----
NM_020993chr1282816 2730 2178 1981 846 598 521 386 12401 ----
NM_021020chr872889 2636 2483 2276 1207 763 105 13307 11218 --
NM_021033chr1362439 756 690 245 194 71 ------
NM_021035chr203859 528 433 1448 ----
NM_021064chr651453 1394 1350 1238 642 171 1571 --
NM_021079chr1753246 3065 2542 2394 865 23030 2553 22673 751 --
NM_021090chr2263541 3069 3059 1123 800 112 158 23927 201 14703
NM_021097chr272577 2568 2390 1884 1210 863 832 1417 1856 --
NM_021103chr2268 22 ------
NM_021120chrX42717 1232 934 283 --12302 13190
NM_021159chr431317 1133 84 ----2211 57
NM_021168chr1651590 1567 1467 1183 1063 ----11096
NM_021188chr142415 130 ------
NM_021189chr14992 946 750 97 1123 ----
NM_021202chr20113000 2331 1124 1099 953 923 904 392 379 318 279 12881 6909 856 298 258 194 187 --
NM_021238chr1231656 382 271 --11972 --
NM_021239chr1441241 424 418 47 ------
NM_021242chrX6857 709 703 691 672 48 1759 ----
NM_021249chr1471528 1268 1234 1212 442 325 222 ------
NM_021252chr1021331 290 1148 ----
NM_021253chr661463 1354 1138 1131 1010 257 --2246 92 --
NM_021255chr1443590 2589 1212 1011 --23597 2892 --
NM_021267chr19111254 1009 912 528 384 307 205 134 117 74 37 --182 --
NM_021569chr991188 1071 1040 1026 424 404 336 257 148 21178 775 3750 446 176 --
NM_021637chrX4972 912 873 196 ------
NM_021638chr484466 3598 3527 3313 1451 1391 1338 316 43901 3861 3811 3767 34921 3983 1701 --
NM_021647chr424072 1031 1855 24733 3296 11426
NM_021813chr6105455 5251 5051 3565 2205 1877 1681 1091 1079 203 142 34665 1508 1466 11277
NM_021905chr672039 1916 1463 1444 699 500 161 21966 896 11418 --
NM_021911chr535108 1987 1277 14319 11818 --
NM_021912chr1523198 1670 11292 13644 --
NM_021914chr143810 360 108 ------
NM_021940chr641295 1199 367 36 11153 ----
NM_021943chr671888 1827 1796 1630 756 434 139 ----21638 675
NM_021945chr663322 3253 2910 2865 2386 695 33034 2700 970 22317 1280 --
NM_021946chrX81351 1338 1312 1058 1008 1002 943 56 11396 1935 11189
NM_021947chr171276 1881 ----
NM_021949chrX122292 2197 2130 1929 1762 1166 1155 876 829 630 206 160 12327 ----
NM_021951chr92869 52 ------
NM_021954chr1353323 3316 3227 2319 1457 ------
NM_021961chr1196405 5875 5276 4858 2411 2138 1722 1692 134 15286 36416 5936 736 12240
NM_021962chr1772121 763 632 536 367 211 163 --1481 --
NM_021964chr376340 4558 4054 2362 2057 622 513 --11763 1256
NM_021966chr144218 195 117 87 --135 1165
NM_021977chr652854 2596 2531 2524 350 --21390 610 --
NM_021988chr2041447 1332 588 403 --2621 582 --
NM_022048chr1594349 4193 3876 3852 2355 1922 364 237 193 15175 11307 --
NM_022060chr1451322 1314 1039 509 214 2251 70 41196 442 430 258 1464
NM_022062chr1171941 1832 1524 1441 1343 1264 579 21293 324 21904 1272 11826
NM_022075chr12243 52 1146 ----
NM_022131chr361458 1270 1100 326 244 137 11018 11277 --
NM_022140chr5112274 1904 1763 1554 1474 931 885 785 566 384 227 --1910 1907
NM_022152chr21389 1263 123 --
NM_022166chr16235597 5180 5064 4936 4855 4618 4521 4412 4084 2175 1964 1949 1833 1763 1710 1516 1391 1351 1304 1011 790 294 87 25158 3889 65161 5033 4865 4250 2405 1756 --
NM_022169chr1161459 1448 1274 1224 612 466 11178 21064 545 11517
NM_022171chr341438 1371 1219 1045 21532 175 21572 337 --
NM_022334chr2------5796 740 404 348 292
NM_022343chr941339 1204 840 498 --1329 --
NM_022351chr81991 --23451 480 --
NM_022367chr15662 556 237 201 103 ------
NM_022369chr153413 60 23 ----1184
NM_022442chr2041447 1332 588 403 --2621 582 --
NM_022459chr1354190 2184 1511 1459 542 14543 25426 5271 11385
NM_022463chr1751571 1446 1015 520 197 21398 107 21062 70 --
NM_022465chr12132888 2815 2249 2166 1890 1054 789 447 346 322 314 115 28 --21150 993 --
NM_022469chr173031 2817 712 672 376 342 216 1283 ----
NM_022473chr1541744 899 745 72 11665 1976 11705
NM_022474chr1422378 293 ------
NM_022477chr2031289 164 52 --21336 37 --
NM_022497chr322720 1417 1724 ----
NM_022572chr251162 619 395 94 30 41434 546 480 413 ----
NM_022574chr762126 1939 1933 1793 1620 569 1159 12137 --
NM_022648chr2114599 4460 4401 3674 1542 1480 1390 1059 563 447 75 14444 1633 24091 287
NM_022650chr53900 855 262 ------
NM_022716chr162213 842 744 737 582 553 1308 ----
NM_022728chr7134 --2785 747 --
NM_022730chr25732 229 219 132 83 1174 1918 --
NM_022733chr14836 828 211 80 --21105 67 --
NM_022737chr1951206 304 261 120 104 2956 325 1948 --
NM_022745chr172635 2449 2387 2362 1994 60 24 --1665 --
NM_022758chr673136 3062 2634 2618 2602 2125 607 ------
NM_022781chr932955 1092 368 --1672 --
NM_022802chr1031404 1384 394 --11490 --
NM_022817chr241664 1511 690 86 1887 --21559 905
NM_022821chr1--2182 29 1397 182
NM_022824chr531823 553 24 ------
NM_022831chr121251 292 144 2546 81 --
NM_022841chr1522294 2216 11085 ----
NM_022845chr1631968 1925 305 ------
NM_022893chr242663 84 51 33 ------
NM_022898chr1494080 3372 3212 3203 3172 1262 1116 1068 92 --23548 327 --
NM_022900chr72880 733 ------
NM_022912chr22380 207 --12843 --
NM_022970chr1031220 556 95 11356 ----
NM_022977chrX22047 2033 ----12685
NM_023079chr172675 62 131 11262 --
NM_023105chr851957 1889 938 77 32 32433 160 53 41813 191 180 154 1381
NM_023106chr851957 1889 938 77 32 32433 160 53 41813 191 180 154 1381
NM_023110chr851957 1889 938 77 32 32433 160 53 41813 191 180 154 1381
NM_023111chr851957 1889 938 77 32 32433 160 53 41813 191 180 154 1381
NM_023929chr82985 398 1408 ----
NM_023940chr43778 330 216 1970 ----
NM_024007chr533026 604 266 12678 ----
NM_024046chr331320 886 264 --1919 --
NM_024085chr24946 307 295 58 1954 ----
NM_024103chr19131849 1838 1667 1576 1509 1391 1341 1301 1282 348 299 223 34 --31823 1380 1346 1733
NM_024117chr941326 295 279 248 21334 272 174 --
NM_024294chr673136 3062 2634 2618 2602 2125 607 ------
NM_024306chr166802 350 341 200 168 61 --1761 --
NM_024494chr11640 --292 85 --
NM_024511chr443378 2941 2344 511 --12331 --
NM_024551chr1222415 742 12087 ----
NM_024551chr1222415 742 12087 ----
NM_024594chr511345 21864 523 11266 11548
NM_024595chr121058 938 --1832 --
NM_024602chr16699 623 590 349 237 205 --1734 1651
NM_024611chr1532698 2466 1025 --33710 867 187 --
NM_024612chr171987 --2843 820 --
NM_024617chr91188 2578 35 ----
NM_024626chr1167 11041 11322 --
NM_024631chr113548 505 72 ------
NM_024640chr13773 628 58 ------
NM_024659chr21195 ----1906
NM_024665chr354219 1074 549 208 108 ------
NM_024689chrX81750 1305 1293 540 287 246 166 153 ------
NM_024704chr2041051 414 381 141 ------
NM_024742chr1641503 599 469 50 2547 429 21459 559 1645
NM_024749chr11123 --11593 --
NM_024757chr92739 183 ------
NM_024761chr974692 1327 1081 1067 746 379 76 2571 155 --12079
NM_024762chr192843 626 --1666 --
NM_024779chr1221350 1064 --31333 1171 143 1130
NM_024784chr117979 922 871 339 127 77 37 1181 2715 403 1394
NM_024786chr55303 200 86 62 56 1111 143 --
NM_024787chr81270 1234 2305 147 --
NM_024798chr1531002 654 607 22336 138 1701 --
NM_024811chr1151885 1643 1637 755 85 11670 ----
NM_024816chr165144 97 51 27 21 ------
NM_024874chr161280 1265 1116 976 864 851 ------
NM_024875chr10101637 712 682 464 457 451 168 150 76 66 ----1276
NM_024884chr1433983 3956 2853 --11165 --
NM_024887chr141592 1431 425 313 11571 52088 721 564 539 54 1399
NM_024909chr691482 1387 620 556 464 433 381 264 77 1497 11318 --
NM_024913chr731609 426 49 --11331 --
NM_024922chr1681621 1512 1466 762 428 178 105 38 41547 1321 782 437 31598 585 352 --
NM_024939chr164503 449 416 159 21398 555 1153 --
NM_024947chr358246 8161 7495 3830 833 28089 2485 58135 7542 7385 2653 397 39023 8294 920
NM_024949chr444432 4015 3365 1230 --21777 508 13100
NM_024954chr104444 421 241 54 ------
NM_024979chr1371595 1360 1050 1039 486 280 100 21023 107 11032 --
NM_024989chr267555 6537 5974 2372 1371 74 --12262 17804
NM_025054chr833682 3367 1479 13650 14244 13420
NM_025057chr1431179 497 316 1224 2335 323 --
NM_025079chr14551 539 226 100 --1621 --
NM_025083chr154781 775 634 473 --21759 241 --
NM_025099chr171126 --21256 417 --
NM_025106chr171840 1810 744 648 579 360 35 --1709 --
NM_025126chr122729 30 --1146 --
NM_025134chr16--32604 1750 460 --11945
NM_025138chr133423 359 246 ------
NM_025146chr342388 1963 900 75 --1486 12209
NM_025151chr82146 48 1532 ----
NM_025164chr1161829 1716 1672 522 440 243 --21572 476 1107
NM_025176chr201265 --1129 --
NM_025179chr1114719 4683 4490 3743 3707 1270 772 742 463 411 123 --21983 212 14362
NM_025182chr97926 914 708 427 259 53 44 1858 ----
NM_025187chr1651297 516 474 191 75 ------
NM_025191chr122541 248 --21258 924 --
NM_025208chr1112328 ----12037
NM_025221chr43986 544 49 ------
NM_025222chr362749 2557 2245 2039 972 440 22893 1967 1371 --
NM_025224chr20112300 2097 2043 1883 1867 1775 1610 447 134 95 71 11998 2787 45 --
NM_025235chr1031876 1498 28 ------
NM_025237chr172545 317 21276 1134 ----
NM_025248chr1772827 2713 2251 2124 552 326 262 53043 2901 1183 613 159 43046 2080 347 79 12215
NM_025261chr6_qbl_hap23401 159 33 --1150 --
NM_025263chr63537 441 125 21900 131 1335 --
NM_030576chr17112593 2106 2028 2000 694 665 528 467 405 257 223 --42210 970 412 21 --
NM_030594chr1531292 491 70 ------
NM_030621chr1453833 2616 1273 1156 413 ----11701
NM_030623chr251548 1435 1429 517 142 ------
NM_030625chr1052528 2193 2034 977 738 22160 102 --12078
NM_030627chr533033 1651 1513 --23308 513 --
NM_030629chr16121853 1457 1280 1234 1220 1198 647 641 633 620 442 92 ------
NM_030634chr142106 1816 523 331 --12074 --
NM_030647chr755090 3837 2274 1305 706 1168 --11448
NM_030648chr444969 4635 4538 4365 13473 1559 11806
NM_030650chr234283 3889 2893 --23701 3668 --
NM_030651chr63275 135 25 ----2707 564
NM_030653chr123773 361 337 --2667 270 --
NM_030661chr721536 590 31638 1495 44 2288 129 --
NM_030664chr1021493 70 --11742 1579
NM_030674chr1264584 4018 3849 1501 1159 965 22313 648 15640 --
NM_030752chr62485 128 ------
NM_030756chr103225 75 69 ------
NM_030761chr192652 2639 2559 2497 2283 2219 742 705 653 52229 719 276 78 33 ----
NM_030763chrX3867 776 706 1805 1873 --
NM_030767chr992832 2646 2539 2297 2095 1837 930 769 440 22838 624 22841 2486 --
NM_030806chr1159265 8612 8120 7980 7755 6440 3263 2270 2106 1948 1011 976 899 881 295 18354 28363 6627 28214 2114
NM_030816chr123215 2409 33681 3163 2633 ----
NM_030884chr352002 893 550 238 170 --12157 --
NM_030885chr312353 --1565 --
NM_030915chr231943 963 678 --12410 1551
NM_030918chr1115401 4877 3615 3299 1939 1933 1647 1098 854 187 136 1815 34998 4436 848 24170 3991
NM_030927chr1061287 1001 659 642 455 363 11054 11319 1227
NM_030937chr121184 1086 --1354 --
NM_030940chr931418 988 583 ----1426
NM_030957chr195559 531 467 405 43 --3510 413 210 --
NM_030962chr1131606 1422 431 2312 292 ----
NM_030964chr593538 2845 2542 2298 2281 1375 1000 129 122 --43586 2492 521 376 --
NM_030981chr1131063 847 322 1945 --1919
NM_031226chr153443 277 23 --166 --
NM_031268chr16174974 4776 4214 4133 4042 3948 3588 3468 3295 2162 2136 1785 1531 465 371 87 67 24104 307 23934 1515 --
NM_031305chr421749 715 1635 21675 348 --
NM_031309chr8162262 2165 2139 2102 1976 1796 1761 1643 1627 1475 780 630 622 393 203 138 --1762 --
NM_031314chr1431639 125 75 11705 ----
NM_031411chr54729 616 596 267 --1214 --
NM_031442chrX32498 2381 398 2431 39 1544 --
NM_031444chr2251667 522 203 46 40 51803 1734 922 582 531 11607 --
NM_031445chr233031 671 27 --11150 --
NM_031453chr1032248 573 33 --1519 --
NM_031459chr131207 1201 92 ----1471
NM_031468chr7115947 5937 5596 5048 3237 3136 3014 2542 2461 1687 697 57285 6006 5895 2174 333 36185 493 387 36670 6521 518
NM_031478chr163559 39 33 1252 ----
NM_031483chr2033163 2499 262 12198 11305 --
NM_031844chr133431 2956 893 23593 927 1485 --
NM_031845chr253148 2637 1072 751 321 12963 ----
NM_031847chr253148 2637 1072 751 321 12963 ----
NM_031849chr54729 616 596 267 --1214 --
NM_031857chr54729 616 596 267 --1214 --
NM_031860chr54729 616 596 267 --1214 --
NM_031890chr22102543 2083 1158 1106 782 578 427 284 233 61 2676 303 2510 290 --
NM_031892chrX3779 747 658 ----1165
NM_031918chr1982005 1896 1310 531 478 467 392 301 21653 47 11904 --
NM_031936chr13602 304 62 --1610 --
NM_031940chr852255 1834 1620 686 614 11841 ----
NM_031954chr12102770 2662 2101 2052 1924 889 691 43 37 23 12804 2842 491 12257
NM_031989chr12258 41 149 1140 --
NM_031990chr1971499 1122 972 370 171 161 45 --1528 --
NM_031991chr1971499 1122 972 370 171 161 45 --1528 --
NM_032012chr934988 1983 297 --24535 503 --
NM_032013chr2031289 164 52 --21336 37 --
NM_032017chr161475 677 613 527 325 263 11528 ----
NM_032041chr842641 2165 525 398 1337 ----
NM_032042chr572714 2463 2419 497 404 44 30 ------
NM_032052chr2221027 519 1540 ----
NM_032088chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_032092chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_032104chr15689 566 260 187 39 --1494 --
NM_032105chr1187881 7818 7744 7367 6936 5483 5052 5014 2455 2264 2180 1828 855 689 566 260 187 39 --47808 7801 7614 494 22825 1555
NM_032109chr591205 306 294 236 196 164 104 52 40 2377 254 2150 28 --
NM_032116chr1385307 5147 4745 4554 4330 4226 4108 552 1798 11057 --
NM_032124chr1831164 850 457 ------
NM_032139chr191319 ----1407
NM_032153chr342143 1945 1082 1017 --21098 1064 22554 2207
NM_032160chr1853854 3805 3694 3349 795 ------
NM_032181chr22577 205 ------
NM_032192chr176542 476 213 165 75 64 ----1239
NM_032199chr1043880 2418 1506 1490 ------
NM_032208chr242874 2621 1235 1218 31421 1313 465 3451 407 401 12253
NM_032217chr411375 ----11326
NM_032221chr203287 199 78 1312 ----
NM_032236chr1------11015
NM_032242chr382811 2767 2264 884 605 594 561 149 --53046 2102 1163 929 646 --
NM_032246chr1521069 59 ----1916
NM_032271chr16101516 1295 1168 1158 1024 500 302 264 251 238 --41342 1316 258 245 --
NM_032281chr19102749 2672 1159 1130 346 336 330 232 213 25 11073 32935 2589 988 1985
NM_032283chr151580 1353 1238 130 23 31815 1256 260 21734 1243 21448 78
NM_032287chr2274020 3178 3005 1382 405 305 180 41671 1508 1039 37 2945 629 --
NM_032294chr17111748 1708 1171 461 301 224 122 116 81 63 26 ------
NM_032325chr1161343 766 601 534 469 24 --3760 574 92 21638 675
NM_032373chr1055899 5249 5133 4165 630 --25231 283 --
NM_032382chr162405 108 ------
NM_032403chr591707 1400 1277 700 588 534 367 318 169 31429 342 225 1345 --
NM_032408chr73913 165 57 1308 ----
NM_032434chr22599 372 ------
NM_032435chr131932 833 65 ------
NM_032440chr1012529 1652 ----
NM_032444chr164887 370 48 22 1218 11080 --
NM_032445chr152535 124 1205 1796 --
NM_032446chr573386 3207 3139 2369 786 773 387 11528 166 --
NM_032452chr142347 232 --3618 555 48 --
NM_032457chr463341 2585 756 707 257 196 13417 ----
NM_032482chr1992750 2550 1806 1732 587 461 253 130 93 --32696 624 405 --
NM_032486chr1642630 1961 834 105 ------
NM_032491chr123528 444 72 11234 ----
NM_032499chr1541354 1196 530 379 1223 ----
NM_032512chrX31134 816 292 --2716 353 --
NM_032538chr6142776 2499 2436 2388 1085 928 469 339 265 130 111 51 38 32 22699 1904 52791 2109 1761 664 301 --
NM_032547chr431244 913 391 ------
NM_032569chr1631767 473 24 1101 ----
NM_032575chr16111714 1577 1562 1525 1366 1294 718 685 644 314 253 21693 343 21436 690 --
NM_032582chr1741827 1397 1329 268 ----1689
NM_032590chr1221112 155 ------
NM_032594chr144900 690 382 149 ----1807
NM_032595chr17101477 1364 1336 1198 1166 1000 552 451 123 78 11265 31410 586 131 --
NM_032663chr1241748 1597 824 364 --1139 --
NM_032682chr321085 781 12378 --12382
NM_032689chr1941502 1489 1118 445 11062 ----
NM_032711chr1784184 3830 3019 2813 1673 1526 1421 112 13355 43672 3053 2818 390 --
NM_032717chr43849 842 128 --1856 --
NM_032741chr64920 411 235 169 3709 192 57 4361 353 317 222 --
NM_032772chr102453 204 1214 1152 --
NM_032781chr112292 151 160 --1362
NM_032800chr142568 1760 356 80 --32399 1770 571 1291
NM_032804chr104781 359 352 45 --2277 70 1389
NM_032808chr156818 181 167 99 88 63 1217 ----
NM_032826chr774773 4485 3716 3684 1787 1208 94 --14020 11924
NM_032828chr19134148 4082 3710 3177 3102 3065 1981 1857 1833 1434 1306 1078 921 34037 761 172 44238 3355 1880 1722 23223 376
NM_032833chr141888 1678 706 629 1157 11837 --
NM_032836chr194926 769 656 380 ----133
NM_032837chr171688 11900 32026 1998 816 --
NM_032840chr1231161 267 39 1761 1740 --
NM_032842chr731209 575 351 ----1623
NM_032859chr1323354 426 ----13257
NM_032873chr1112966 14242 13004 13361
NM_032876chr1431569 383 28 ------
NM_032900chr1063740 3561 2646 1407 761 319 1163 11198 --
NM_032924chr72898 781 --1910 --
NM_032926chrX------1186
NM_032932chr1755346 4283 877 494 348 45084 4131 1638 697 31150 1020 398 --
NM_032961chr43995 473 318 193 ----
NM_032968chrX32658 1692 591 ------
NM_032969chrX32658 1692 591 ------
NM_032971chrY2717 687 --1957 --
NM_032972chrY2717 687 --1957 --
NM_032975chr1883302 2811 2805 2551 2464 2334 1163 185 --13189 --
NM_032980chr1883302 2811 2805 2551 2464 2334 1163 185 --13189 --
NM_032982chr772364 2185 1974 1818 1759 833 800 1586 32565 1965 435 --
NM_032998chr12919 164 142 2907 82 --
NM_033008chr34432 409 146 136 171 185 --
NM_033009chr34432 409 146 136 171 185 --
NM_033010chr34432 409 146 136 171 185 --
NM_033016chr2241485 249 175 148 11498 21385 168 --
NM_033018chrX7891 814 747 740 452 337 118 1178 21103 306 --
NM_033020chr154212 2992 1360 1351 1240 13764 13375 --
NM_033027chr36938 769 750 737 422 389 1106 ----
NM_033044chr141134 946 824 33 ------
NM_033055chr1152 ----185
NM_033119chr166733 656 349 126 45 23 ------
NM_033121chr1231727 540 456 1169 ----
NM_033129chr20132019 2008 1994 1532 1340 1317 785 772 675 564 527 498 230 42075 723 620 473 1584 --
NM_033131chr1111786 1727 1657 1588 1550 1307 1245 1168 1100 710 413 182 --11257
NM_033133chr1763594 3565 2395 1113 697 496 23335 2665 32659 2606 170 1933
NM_033135chr1112328 ----12037
NM_033136chr541836 1377 1212 209 ------
NM_033137chr541836 1377 1212 209 ------
NM_033143chr434091 2915 2851 24428 245 --24355 165
NM_033181chr6--13226 23112 1268 --
NM_033201chr165812 297 164 71 44 21099 416 1419 --
NM_033211chr531899 1865 816 --12029 --
NM_033224chr797238 6789 6179 2574 1543 1336 977 459 42 --17551 27136 32
NM_033225chr82970 81 --193 --
NM_033226chr164459 288 252 173 2451 118 ----
NM_033244chr15131163 1149 1084 826 491 439 324 282 225 181 115 100 85 ------
NM_033274chr563434 3407 3140 591 466 111 1370 12210 13533
NM_033278chr118411 386 352 315 287 266 151 145 ------
NM_033285chr821574 1148 22872 1476 21479 821 --
NM_033300chr141248 1092 978 441 1249 ----
NM_033315chr1772036 1891 1695 1660 1652 772 440 1671 42110 2077 2043 488 1402
NM_033326chr1131947 972 872 --143 --
NM_033331chr953209 2305 558 399 146 ----2964 116
NM_033360chr1254540 4483 4283 2907 679 ------
NM_033375chr1791427 1142 574 556 545 180 144 133 119 21305 356 ----
NM_033387chr992553 2361 2344 2013 1653 1046 958 831 570 --52367 936 769 464 104 32572 2120 1013
NM_033389chr1754819 4782 4648 3480 306 23829 3338 ----
NM_033396chr113368 168 25 --1123 --
NM_033405chr2081145 1079 1017 852 338 79 73 61 --1962 --
NM_033429chr153899 589 422 --12192 11006
NM_033449chr581850 1573 1476 811 344 326 314 174 2781 285 1119 --
NM_033480chr662813 2682 1110 757 507 412 11009 ----
NM_033481chr662813 2682 1110 757 507 412 11009 ----
NM_033503chr15103462 3422 3246 2607 963 617 502 430 410 303 11456 43641 2600 2585 896 --
NM_033505chr266340 5647 5287 4502 461 61 1683 ----
NM_033512chr852824 2506 2442 857 575 ------
NM_033542chr2051767 1737 659 647 276 ------
NM_033551chr553162 1242 992 646 384 22826 837 33267 1064 750 --
NM_033624chr1251690 1590 1502 197 115 21760 1523 ----
NM_033626chrX81757 1678 1570 1491 1265 1149 422 399 21359 1352 21385 328 --
NM_033631chr183719 3177 3050 1520 581 423 255 54 1201 2994 831 --
NM_033642chrX------180
NM_033656chr2185776 4937 4732 4673 4258 3753 1354 1043 12132 14532 --
NM_044472chr13679 122 86 ------
NM_052832chr822530 761 ----1739
NM_052840chr1541641 586 578 152 --11465 --
NM_052845chr1283160 2632 2121 2094 1995 1229 807 158 42934 2147 548 99 ----
NM_052864chr432029 1915 732 11363 ----
NM_052875chr1142200 777 553 51 31648 568 36 1601 11946
NM_052879chr1253709 3327 2972 2820 2690 1902 ----
NM_052880chr2251257 1154 374 107 53 --1209 --
NM_052882chr192513 56 ------
NM_052897chr125859 208 200 155 78 1118 1187 --
NM_052898chr821675 1628 --1205 11827
NM_052900chr83679 467 303 ------
NM_052904chr641142 1096 580 173 ------
NM_052905chr241699 1577 425 333 11391 ----
NM_052907chr12126 14048 13574 11143
NM_052910chr1381988 1734 1435 1377 1359 621 600 561 11722 22000 1366 --
NM_052918chr1083700 3175 1308 1132 869 859 660 591 23159 2851 13148 --
NM_052928chr1761517 1415 644 452 346 311 --11342 --
NM_052934chr141679 601 237 206 1295 31758 289 244 --
NM_052938chr11924 135 --1483
NM_052948chr193329 261 102 --139 --
NM_053002chr33859 480 205 ------
NM_053016chr977139 6831 5715 5595 3045 2753 2034 47200 5602 2734 51 ----
NM_053023chr1142716 615 438 168 12286 1160 --
NM_053025chr331298 424 327 --1551 --
NM_053026chr331298 424 327 --1551 --
NM_053027chr331298 424 327 --1551 --
NM_053028chr331298 424 327 --1551 --
NM_053031chr331298 424 327 --1551 --
NM_053032chr331298 424 327 --1551 --
NM_053042chr442993 2907 804 63 --12959 --
NM_053056chr1182886 2841 813 804 723 641 165 32 2752 737 1402 1924
NM_053064chr1432437 2156 1047 --2510 498 --
NM_054016chr11170 ------
NM_054016chr11170 ------
NM_054016chr11170 ------
NM_054025chr1161939 1843 1653 1516 1469 108 1843 152 1211
NM_054033chr23175 94 68 ------
NM_057175chr432287 2133 860 1267 --1836
NM_057178chr1772012 1841 1719 803 360 354 143 --1331 --
NM_058172chr421178 1144 ------
NM_058240chr1451211 1107 647 635 326 --2261 255 1136
NM_078469chr1041180 1103 1017 516 ------
NM_078470chr1052626 2501 1908 799 689 ----21047 847
NM_078471chr1771160 1110 1082 760 503 94 31 --1259 --
NM_078473chr852255 1834 1620 686 614 11841 ----
NM_080391chr12585 128 ------
NM_080491chr1173962 3037 2828 881 822 317 201 43155 2967 1582 92 32912 1484 95 33023 2836 247
NM_080597chr1821098 801 ----2995 139
NM_080629chr121227 451 ----1344
NM_080630chr121227 451 ----1344
NM_080664chr1421483 492 11607 2380 218 1538
NM_080676chr2022637 2265 11090 --1942
NM_080679chr66843 660 278 218 75 44 ------
NM_080680chr66843 660 278 218 75 44 ------
NM_080681chr66843 660 278 218 75 44 ------
NM_080717chr123992 545 252 ----1120
NM_080723chr621395 1222 --11154 --
NM_080738chr141941 593 515 475 11379 ----
NM_080759chr1331842 904 183 ------
NM_080760chr1331842 904 183 ------
NM_080867chr1474703 4221 3802 1926 1464 980 515 ------
NM_080872chr864015 3061 2492 1355 1151 418 22959 807 31196 673 644 --
NM_080881chr55589 522 110 98 25 2153 41 1265 --
NM_080927chr34846 663 536 528 ------
NM_130385chr1172815 2711 2227 973 788 241 52 1100 ----
NM_130386chr181154 ----1625
NM_130391chr923341 1124 11155 33321 2700 1148 --
NM_130392chr923341 1124 11155 33321 2700 1148 --
NM_130393chr923341 1124 11155 33321 2700 1148 --
NM_130438chr2132486 1001 246 ----1213
NM_130439chr1031495 704 317 --1712 --
NM_130439chr1031495 704 317 --1712 --
NM_130442chr74812 242 209 186 --1298 1755
NM_130446chr3101682 1512 1304 1197 1028 960 627 456 404 62 1251 ----
NM_130459chr951500 1391 1366 1105 203 --11548 --
NM_130766chr1761089 1017 836 293 169 62 ------
NM_130830chr341532 1380 1059 298 23646 2665 43786 3377 899 74 13137
NM_130846chr1231013 860 731 160 ----
NM_130850chr14--181 --185
NM_130851chr14--181 --185
NM_133170chr20168023 7724 7641 6240 6129 6090 6082 5366 5341 2767 1845 1182 1038 778 566 301 27150 6215 47596 7417 6650 5078 16145
NM_133171chr2031158 216 146 31079 322 157 ----
NM_133264chr17113775 3395 3286 3229 1151 1117 757 600 592 374 157 1810 1229 --
NM_133265chrX53642 2651 2599 2264 588 13386 ----
NM_133328chr194745 216 47 28 --175 --
NM_133330chr492622 2561 2530 1270 1097 687 433 294 164 11083 1579 --
NM_133331chr492622 2561 2530 1270 1097 687 433 294 164 11083 1579 --
NM_133335chr492622 2561 2530 1270 1097 687 433 294 164 11083 1579 --
NM_133372chr542410 1995 1887 104 --12044 1560
NM_133445chr953777 3524 1093 809 293 43513 3433 1106 976 1617 --
NM_133452chr1961182 973 834 824 753 456 21056 759 21154 771 --
NM_133457chr741274 1073 228 222 ------
NM_133478chr232545 194 72 --12274 --
NM_133496chr163929 3645 3096 1436 870 350 --22986 919 --
NM_133499chrX6965 804 623 296 80 29 --2356 193 1751
NM_133507chr122828 43 1125 1128 --
NM_133631chr321470 515 ------
NM_133633chr223947 291 75 3801 392 125 ----
NM_133642chr2241267 1159 1039 52 1230 ----
NM_133647chr1541443 915 909 82 189 12757 --
NM_134268chr1761149 1107 957 925 396 230 --1845 --
NM_138270chrX53342 3272 3196 2569 2359 --13318 --
NM_138286chr1914323 --11193 11350
NM_138338chr22103303 2831 1238 1230 1186 1133 613 227 200 158 43273 2376 2245 724 33188 2749 2407 --
NM_138357chr1051588 1553 1206 1130 360 1538 11139 11570
NM_138409chr631358 941 73 1916 ----
NM_138415chr2251339 1262 581 389 268 ------
NM_138444chr13104538 784 729 472 296 263 245 160 80 24 24492 257 --1147
NM_138457chr6203184 3112 2991 2860 2785 2452 1301 1117 1087 972 933 902 716 687 641 625 510 462 375 187 1748 63167 1197 1182 681 546 498 11194
NM_138468chr285638 5310 4901 4482 4270 1441 1266 705 11808 15773 15666
NM_138473chr1235000 4993 290 ----14556
NM_138479chr161981 1555 1402 552 462 200 --1503 1331
NM_138494chr742839 2385 1760 909 ------
NM_138565chr1111415 21111 514 ----
NM_138576chr1494080 3372 3212 3203 3172 1262 1116 1068 92 --23548 327 --
NM_138578chr2071411 1170 491 449 112 50 34 --41135 485 26 21 --
NM_138619chr1731130 483 206 --127 --
NM_138620chr92408 113 --1327 --
NM_138638chr143810 360 108 ------
NM_138694chr633346 1374 1008 1356 12379 --
NM_138713chr1687458 6263 5708 2226 2117 1402 1374 872 1329 21771 1765 16406
NM_138714chr1687458 6263 5708 2226 2117 1402 1374 872 1329 21771 1765 16406
NM_138727chr14975 952 874 350 1645 ----
NM_138728chr14975 952 874 350 1645 ----
NM_138730chr61422 ------
NM_138731chr1432793 1243 406 ------
NM_138771chr721591 1456 ----132
NM_138774chr195753 631 220 200 31 ------
NM_138795chr161524 1254 1190 287 216 94 4588 244 105 68 ----
NM_138931chr32878 110 ----151
NM_138961chr114365 352 336 125 ------
NM_138969chr821220 116 1491 1450 --
NM_138970chr141304 21624 865 --1947
NM_138971chr11113470 2893 2793 2784 2684 2456 1393 1225 893 841 303 43494 3297 661 121 ----
NM_138971chr11113470 2893 2793 2784 2684 2456 1393 1225 893 841 303 43494 3297 661 121 ----
NM_138972chr11113470 2893 2793 2784 2684 2456 1393 1225 893 841 303 43494 3297 661 121 ----
NM_138972chr11113470 2893 2793 2784 2684 2456 1393 1225 893 841 303 43494 3297 661 121 ----
NM_138973chr11113470 2893 2793 2784 2684 2456 1393 1225 893 841 303 43494 3297 661 121 ----
NM_138973chr11113470 2893 2793 2784 2684 2456 1393 1225 893 841 303 43494 3297 661 121 ----
NM_138981chr43647 539 59 --126 --
NM_139014chr651961 906 872 479 53 12044 21510 337 --
NM_139045chr91706 ----163
NM_139057chr15112524 2456 2334 2254 2222 2020 959 742 671 514 91 22299 53 22379 894 --
NM_139071chr1251360 1327 1197 556 192 --1177 --
NM_139132chr115845 839 371 222 147 --3850 315 113 --
NM_139135chr14924 238 184 91 --1170 --
NM_139182chr441485 1266 702 448 ------
NM_139208chr11140 ----1108
NM_139246chr962136 1989 1754 1446 512 175 --2432 354 --
NM_139276chr1752205 2190 1764 673 62 1426 1847 --
NM_139280chr1741414 1390 1114 1038 ------
NM_139283chr1211791 1958 ----
NM_139316chr71699 --2967 925 --
NM_139321chr2093620 3248 3115 1077 1066 743 737 556 175 21341 949 --13462
NM_139323chr2062020 1671 1659 1642 1628 1621 ------
NM_144567chr152488 2471 1803 901 559 --21963 657 1989
NM_144571chr456597 6052 4304 4295 89 --12676 16143
NM_144578chr1465514 5082 3861 3417 931 925 ------
NM_144582chr2112490 2375 2102 2081 2055 1721 1626 716 144 138 100 11782 ----
NM_144586chr2164 1419 2345 239 --
NM_144590chr1052867 2401 2220 237 187 ------
NM_144599chr1565187 4591 3905 1701 621 551 31654 917 558 14151 --
NM_144609chr1731388 988 237 ------
NM_144617chr197903 829 822 762 698 261 178 1116 1144 175
NM_144628chr20103030 2979 2374 1058 921 527 355 257 123 45 1998 ----
NM_144631chr24261 209 203 49 ------
NM_144635chr351036 467 461 389 207 ------
NM_144667chr122760 41 --2978 69 --
NM_144691chr194474 152 87 56 --2480 103 --
NM_144723chr54758 351 331 245 ------
NM_144728chr12802 193 ------
NM_144729chr12802 193 ------
NM_144778chr1322593 2540 22746 898 ----
NM_144963chr812381 --2792 761 --
NM_144973chr1263985 3974 1894 1474 962 896 2944 455 14820 --
NM_144994chr271363 1140 1084 1067 995 377 61 2464 346 149 --
NM_145008chr114596 146 137 93 --1349 --
NM_145013chr1152687 2680 790 465 183 --12071 --
NM_145055chr1841307 1013 412 41 --12817 --
NM_145056chr193695 134 79 ------
NM_145065chr113415 53 33 142 1185 --
NM_145071chr351040 798 680 316 24 131 2700 295 --
NM_145113chr146605 464 315 279 136 82 ------
NM_145117chr1151236 1207 689 675 68 1490 33156 1041 50 --
NM_145176chr653255 2506 1053 333 275 ----22767 1078
NM_145185chr19111869 1783 1555 801 500 453 422 376 191 182 160 3148 114 73 --11774
NM_145206chr1062856 2583 2168 994 937 377 ----1212
NM_198511chrX31243 197 161 --1568 --
NM_198560chr373849 2698 1139 1001 579 498 124 ----11307
NM_198595chr484466 3598 3527 3313 1451 1391 1338 316 43901 3861 3811 3767 34921 3983 1701 --
NM_198597chr103971 763 169 --1216 --
NM_198679chr982136 982 952 934 908 748 719 292 ----1316
NM_198686chr1472565 2548 2501 2420 1015 760 427 --41049 707 681 343 22530 881
NM_198841chr94799 167 87 50 ------
NM_198859chr3184933 4245 4211 3959 3798 3782 3265 3259 3152 1614 1601 1266 845 729 711 697 558 517 --33685 3294 1558 --
NM_198880chr31682 ------
NM_198889chr411375 ----11326
NM_198896chr1131777 1465 489 ------
NM_198900chr12197252 7233 6592 6578 6413 6027 5847 5358 5262 4988 4949 4928 2531 1977 1680 1660 818 667 627 45465 1396 1373 1300 77648 6423 2772 2333 1742 118 30 17698
NM_198904chr52822 72 11350 ----
NM_198990chr742967 2320 2027 97 22234 1311 12174 --
NM_198993chr1751509 1503 1186 1133 372 --4561 547 500 88 1266
NM_198995chr182149 85 ------
NM_199000chr751954 1623 823 701 551 1590 ----
NM_199050chr2173759 3330 3289 2803 601 81 53 13279 --12572
NM_199054chr1961816 1699 817 494 294 33 1583 2615 190 11597
NM_199129chr205966 490 283 218 141 ------
NM_199132chr1931656 741 31 --21711 1701 --
NM_199141chr195717 635 183 171 59 1726 3920 876 268 --
NM_199144chr2041447 1332 588 403 --2621 582 --
NM_199160chr951905 1280 721 474 60 41816 1806 1607 728 2392 51 136
NM_199168chr1031082 575 38 ------
NM_199169chr2082997 2318 2308 2259 1420 1401 1165 126 --12927 --
NM_199170chr2082997 2318 2308 2259 1420 1401 1165 126 --12927 --
NM_199171chr2082997 2318 2308 2259 1420 1401 1165 126 --12927 --
NM_199188chr1253709 3327 2972 2820 2690 1902 ----
NM_199190chr1253709 3327 2972 2820 2690 1902 ----
NM_199203chr2041447 1332 588 403 --2621 582 --
NM_199245chr1252566 2480 1984 1668 419 52371 2318 532 495 444 22102 329 --
NM_199324chr433003 2545 743 --23106 1323 --
NM_199415chr2082455 2387 2052 1594 553 357 274 233 --12058 12161
NM_199421chr1474703 4221 3802 1926 1464 980 515 ------
NM_199461chr1093261 1311 1294 1185 1092 888 556 261 38 33402 3109 23 2963 741 --
NM_199478chrX1350 ----1588
NM_199482chr231920 763 183 --1707 --
NM_201266chr252458 2400 2318 524 481 --12230 --
NM_201278chr1132349 2264 1690 ------
NM_201279chr252458 2400 2318 524 481 --12230 --
NM_201281chr1132349 2264 1690 ------
NM_201348chr1134392 4317 4197 3766 3334 1445 912 893 501 419 321 314 124 44369 3468 3120 1060 1940 1200
NM_201378chr85902 868 295 239 212 1248 21001 880 --
NM_201379chr85902 868 295 239 212 1248 21001 880 --
NM_201380chr85902 868 295 239 212 1248 21001 880 --
NM_201381chr85902 868 295 239 212 1248 21001 880 --
NM_201382chr85902 868 295 239 212 1248 21001 880 --
NM_201383chr85902 868 295 239 212 1248 21001 880 --
NM_201384chr85902 868 295 239 212 1248 21001 880 --
NM_201428chr1141302 1061 511 145 --11371 --
NM_201429chr1141302 1061 511 145 --11371 --
NM_201430chr1151228 987 636 437 71 --11297 --
NM_201432chr17196492 6477 6341 6119 5352 4030 4006 1796 1747 1468 1381 1360 1266 1183 1035 953 912 773 88 1967 36383 4077 732 --
NM_201433chr17196492 6477 6341 6119 5352 4030 4006 1796 1747 1468 1381 1360 1266 1183 1035 953 912 773 88 1967 36383 4077 732 --
NM_201434chr174622 536 122 38 --3612 173 63 --
NM_201520chr1761796 728 594 510 463 169 31629 717 493 11247 --
NM_201545chr151070 1035 575 508 226 ------
NM_201548chr23958 227 86 --1160 --
NM_201567chr31648 11095 144 --
NM_201568chr141689 293 191 137 11778 11832 --
NM_201569chr141689 293 191 137 11778 11832 --
NM_201591chr421272 24 268 60 ----
NM_201592chr421272 24 268 60 ----
NM_201599chrX41210 432 356 24 1129 ----
NM_201624chr11416 1261 1307 1464
NM_201632chr561280 1179 587 256 119 35 ----1575
NM_201634chr561379 1278 686 355 218 134 ----1674
NM_202467chr194563 538 450 172 1232 ----
NM_202468chr194563 538 450 172 1232 ----
NM_202469chr194563 538 450 172 1232 ----
NM_202470chr194563 538 450 172 1232 ----
NM_202494chr194563 538 450 172 1232 ----
NM_203283chr42543 424 1493 ----
NM_203284chr42543 424 1493 ----
NM_203305chr94698 516 499 396 41843 617 410 173 ----
NM_203318chr1771160 1110 1082 760 503 94 31 --1259 --
NM_203327chr2084003 3955 3024 2895 2791 1282 694 353 42885 995 811 328 14136 13367
NM_203342chr193273 3254 2795 2784 2772 2422 1384 750 737 32694 1168 43 ----
NM_203343chr193273 3254 2795 2784 2772 2422 1384 750 737 32694 1168 43 ----
NM_203351chr1752346 1886 1007 292 146 --31975 1766 1689 12364
NM_203394chr1262449 2128 1849 453 365 77 ------
NM_203413chr1731004 754 74 --1254 1286
NM_203446chr2131159 732 136 11137 1711 22190 787
NM_203454chr13931 878 322 --21035 910 --
NM_203459chr121988 256 --12522 --
NM_203504chr432383 2315 759 12166 ----
NM_203505chr432383 2315 759 12166 ----
NM_203506chr1761796 1698 1417 627 292 122 ----11841
NM_205848chr162793 2380 2314 1091 111 41 --11775 --
NM_205860chr132183 579 351 ----12819
NM_205861chr141592 1431 425 313 11571 52088 721 564 539 54 1399
NM_205864chr6143 ------
NM_206594chr173683 3191 803 510 264 198 27 ------
NM_206595chr173683 3191 803 510 264 198 27 ------
NM_206853chr623651 3232 --1795 --
NM_206854chr624912 4493 1988 12056 --
NM_206855chr675877 5458 3951 313 304 283 177 11953 ----
NM_206866chr2142761 2165 896 729 --1983 --
NM_206876chr23893 492 337 22689 82 13097 --
NM_206907chr532874 1240 733 23200 532 1578 --
NM_206909chr897793 7555 6816 5267 2963 2771 2460 1989 857 27970 2755 --1885
NM_206914chr1242184 1853 378 164 --12139 --
NM_206943chr24872 825 780 90 ------
NM_207012chr1053106 2773 1233 454 415 12305 ----
NM_207111chr742336 902 818 136 21043 520 ----
NM_207116chr742336 902 818 136 21043 520 ----
NM_207119chr1052042 1854 1684 838 475 123 ----
NM_207171chr151704 1570 744 701 128 21558 822 1825 --
NM_207304chr1332480 2427 1057 22633 785 ----
NM_207306chr194604 4368 3587 3471 2941 1704 421 190 62 23665 2785 22986 407 13218
NM_207313chr175971 820 813 717 663 1866 --11006
NM_207317chr52364 37 ------
NM_207343chr111490 1426 ----
NM_207344chr1261311 1301 1076 998 433 404 1200 1309 --
NM_207362chr23623 544 31 ------
NM_207366chr731684 426 211 12297 ----
NM_207372chr1062249 1769 651 548 461 103 --12289 --
NM_207444chr151948 11296 --11195
NM_207518chr1971272 1229 1155 1116 1106 404 126 31094 410 393 2210 120 --
NM_212460chr741916 1664 604 207 ------
NM_212464chr1551937 761 251 183 137 21724 38 21620 1371 1798
NM_212467chr1552514 1830 912 269 186 12301 22197 1948 --
NM_212471chr1721667 1487 --1262 --
NM_212472chr1721667 1487 --1262 --
NM_212474chr22168 51 1367 11029 --
NM_212475chr22168 51 1367 11029 --
NM_212476chr22168 51 1367 11029 --
NM_212478chr22168 51 1367 11029 --
NM_212482chr22168 51 1367 11029 --
NM_212502chr171333 1320 1073 1005 949 544 292 --41340 1037 849 380 11299
NM_212503chr171333 1320 1073 1005 949 544 292 --41340 1037 849 380 11299
NM_212551chr13761 422 120 --2770 111 --
NM_213589chr244849 4584 1892 1544 14560 --33753 2225 746
NM_213594chr123528 444 72 11234 ----
NM_213609chr32782 748 ------
NM_213648chr561280 1179 587 256 119 35 ----1575
NM_213662chr1752299 2284 1858 767 156 1520 1941 --