TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3646
miRNA Sequence: AAAAUGAAAUGAGCCCAGCCCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000016chr15679 624 446 261 191 2591 559 ----
NM_000051chr1183558 2381 2168 1136 921 882 854 28 --31049 837 61 --
NM_000052chrX83432 3348 3132 3033 3012 2549 656 620 22185 532 23297 314 32817 1368 192
NM_000084chrX106591 6534 5968 5924 5453 5035 2523 1951 1844 1341 --46175 6133 1956 1422 --
NM_000091chr242884 2487 1026 688 32663 1857 73 1698 --
NM_000092chr2114580 3907 3714 3210 3158 3110 1551 1378 338 230 93 14155 54198 3955 3262 1807 1722 11145
NM_000097chr341222 1065 846 233 1216 31070 399 363 --
NM_000108chr71405 --1529 2710 509
NM_000109chrX82571 2402 2366 2243 2016 1759 917 630 --21734 671 --
NM_000112chr585509 4989 4908 4271 3649 1442 1398 1248 23749 2073 45552 4698 2076 1775 --
NM_000139chr1142190 635 601 123 --12425 12158
NM_000151chr1721880 600 --11766 11898
NM_000163chr552273 2059 1889 1463 696 --32393 1497 521 1441
NM_000167chrX61721 1605 1586 1554 1471 588 ----1110
NM_000168chr752876 2317 2217 1104 1058 --43094 2783 2346 493 --
NM_000176chr5123957 3726 3643 2649 2597 1467 1341 583 562 231 104 53 --43828 3485 2768 98 13837
NM_000208chr1954660 3944 3486 282 159 --33840 3249 872 13246
NM_000210chr242131 2062 821 764 --42342 2231 838 438 --
NM_000214chr2041501 638 613 362 1478 1481 2682 354
NM_000216chrX134068 3648 3549 3486 2793 2653 1590 1366 1011 795 713 493 284 43986 3918 3504 780 12669 33935 3508 2800
NM_000217chr1263816 2068 1786 1022 1010 222 14066 75152 4338 3589 3327 978 889 527 14780
NM_000232chr452925 2589 674 184 100 22018 935 22290 579 11966
NM_000237chr841943 1573 1565 154 1692 --11710
NM_000248chr352109 939 690 479 313 --102504 2473 1992 1215 918 893 833 828 753 149 12470
NM_000252chrX41371 1283 572 338 --158 11144
NM_000253chr451053 1004 816 255 190 --1960 1855
NM_000259chr15165737 5725 5494 4568 4082 4032 2177 2157 1692 1598 1571 1425 1025 954 539 61 21875 867 35466 2205 319 22202 2198
NM_000264chr993357 2880 2846 2759 2586 421 326 155 130 --52639 2435 2385 2259 2237 12624
NM_000280chr1151001 873 854 259 241 --2246 222 1733
NM_000289chr122111 96 --1305 1302
NM_000297chr441840 1657 653 381 11469 31856 353 147 11503
NM_000314chr1052269 2196 992 882 289 12909 12435 12512
NM_000321chr1371713 1503 1418 1160 719 388 46 31472 1332 194 31460 1111 568 --
NM_000332chr6207174 7089 7031 6863 6240 5735 5663 5449 5381 5177 2756 2316 1989 1966 1869 1847 1782 1480 1144 43 25691 2379 76619 5751 5740 4346 2140 1701 730 25764 2199
NM_000337chr576177 5320 4634 4157 2281 2209 269 11448 44527 4473 4136 1055 12527
NM_000346chr1761469 1308 758 525 471 385 --1113 21714 1287
NM_000362chr2223632 161 23556 2443 53656 2492 2407 1169 220 --
NM_000390chrX53352 1161 1027 399 204 33319 2492 628 23061 410 --
NM_000393chr232132 1930 1903 1816 41607 415 315 174 --
NM_000397chrX72338 2242 1985 1953 915 478 215 1681 22096 220 --
NM_000408chr293397 3076 2813 2575 2444 2349 1319 302 234 13111 42460 743 182 168 --
NM_000411chr2163129 3074 639 502 279 159 1994 23089 98 --
NM_000430chr1743746 2615 388 320 1688 3874 696 691 --
NM_000435chr193405 335 300 --1341 2383 187
NM_000446chr721003 44 1222 11048 11045
NM_000448chr1173260 3034 3021 2980 2848 1193 591 11275 83167 3066 2372 823 809 461 443 382 --
NM_000449chr141298 1115 358 82 1966 11405 11402
NM_000461chr3103792 3769 3681 3424 1800 1770 594 191 105 50 ------
NM_000462chr1561569 1331 348 249 233 175 --1316 --
NM_000489chrX83349 3229 2937 2652 2159 1300 530 380 22756 2619 63268 3061 2277 1259 719 53 --
NM_000493chr611115 31021 925 751 1109 1929
NM_000503chr861862 1666 1626 1350 1165 522 1481 21893 1761 --
NM_000510chr1131432 1213 230 ----11203
NM_000522chr741128 1058 986 945 --31146 896 888 --
NM_000555chrX187882 7847 7810 7358 7142 6934 6652 6439 6114 5829 5732 5248 5094 5084 4889 1532 1377 127 12192 45644 2209 160 110 --
NM_000574chr161246 1222 915 387 349 120 --21238 937 1107
NM_000586chr42207 71 1191 --148
NM_000588chr5----2354 287 2259 255
NM_000594chr6154 1487 1514 2495 491
NM_000599chr254564 4197 3961 768 91 2878 102 13889 14625
NM_000609chr1032897 2126 2068 --1182 1190
NM_000610chr1192964 2884 2849 2716 2481 2399 2185 2145 101 12438 22157 1847 --
NM_000618chr12136421 6387 5896 5190 5158 4634 4281 2554 2479 2257 711 420 378 24747 1775 75901 4750 2640 1802 814 649 630 --
NM_000618chr12136421 6387 5896 5190 5158 4634 4281 2554 2479 2257 711 420 378 24747 1775 75901 4750 2640 1802 814 649 630 --
NM_000633chr1894959 4901 4809 4374 3945 3443 2055 1893 484 1226 21514 229 2264 260
NM_000706chr124785 177 116 92 --2319 313 --
NM_000719chr12116168 5562 5464 4589 4577 1982 1929 1718 1539 993 115 26692 896 66244 5364 781 120 60 33 11423
NM_000758chr51270 ----4249 245 241 237
NM_000788chr481514 1353 1336 1070 1033 371 224 112 --1509 --
NM_000793chr1452055 2013 1375 520 279 13301 33430 1860 1855 --
NM_000806chr581863 1571 1454 595 465 334 121 85 ----31476 135 51
NM_000809chr4288914 8856 8314 8189 7942 7843 7467 6905 6533 6454 6445 5747 3680 3527 3146 3077 2778 2577 2550 2438 2221 2210 2035 1967 681 407 303 201 27769 3352 88933 8247 6849 6500 6425 3135 2565 2443 2875 699
NM_000813chr575543 5164 3523 2143 1383 1347 341 --65233 4958 4143 3515 1101 631 14140
NM_000814chr1564224 4152 3631 2839 2710 921 --34086 3513 1199 134
NM_000826chr472440 2328 2006 1640 1616 858 220 --22563 2333 --
NM_000838chr6112549 2530 2380 2362 2262 2214 2199 2076 1934 1785 1088 --11816 1721
NM_000861chr332747 1962 642 22182 863 11814 11811
NM_000868chrX82638 2629 2509 2446 2336 838 776 217 --1246 --
NM_000875chr15116931 6000 5986 5657 5504 5152 4886 2808 2635 781 207 15052 56549 5117 4919 2461 2208 16316
NM_000877chr243084 2901 2418 1903 --42323 2168 2030 838 --
NM_000882chr33389 313 31 1399 --2376 328
NM_000885chr232137 669 261 --1407 1522
NM_000891chr1783686 3596 3233 3194 2990 2376 1200 473 12666 73304 2688 2669 1093 937 843 562 --
NM_000899chr1284396 3732 3678 3604 3510 2804 1143 380 21078 275 43829 2939 1551 1375 23919 3116
NM_000902chr353144 2168 561 538 214 1574 42173 577 453 265 --
NM_000910chr461934 1921 1384 1278 492 274 1731 11697 11251
NM_000926chr11229259 9075 8758 8578 7009 6202 6170 3694 3547 3200 2879 2278 2220 1679 1603 1568 1413 1210 1112 384 282 162 13086 43329 2599 1959 1668 13290
NM_000935chr341041 1005 886 860 1347 31228 242 33 1374
NM_000944chr452175 1818 489 364 116 --22360 2311 --
NM_000945chr241914 811 776 711 1583 2457 278 1627
NM_000950chrX123551 3535 3075 2473 2345 1438 1334 882 183 95 86 31 --53447 3179 2717 1309 137 --
NM_000956chr142847 49 ----2955 768
NM_000959chr1113697 3080 2787 2470 1323 1027 902 702 632 433 369 1273 21446 1424 11339
NM_000963chr162115 2092 1760 785 431 215 31775 1641 59 12504 31516 28 24
NM_001001323chr1233153 2188 1205 33193 2329 710 53178 3035 2549 2458 429 --
NM_001001389chr1192964 2884 2849 2716 2481 2399 2185 2145 101 12438 22157 1847 --
NM_001001390chr1192964 2884 2849 2716 2481 2399 2185 2145 101 12438 22157 1847 --
NM_001001391chr1192964 2884 2849 2716 2481 2399 2185 2145 101 12438 22157 1847 --
NM_001001392chr1193010 2930 2895 2762 2527 2445 2231 2191 147 12484 22203 1893 --
NM_001001395chr1282800 2494 2329 1958 1803 1765 337 194 12588 3698 278 249 --
NM_001001419chr5105133 5064 4931 4827 4470 1843 467 304 285 111 32052 1632 718 64613 4399 1890 846 519 314 --
NM_001001420chr5105133 5064 4931 4827 4470 1843 467 304 285 111 32052 1632 718 64613 4399 1890 846 519 314 --
NM_001001433chr2041285 1147 1061 202 42979 2970 1191 703 32982 2870 1990 --
NM_001001436chr161773 2857 133 1569 1703
NM_001001481chr8123361 3141 3010 2985 2118 1211 1029 848 601 386 349 203 12788 52725 1170 784 268 262 62722 2718 2714 2710 945 941
NM_001001556chr1531457 1292 261 --31574 1377 398 11555
NM_001001664chr2134038 3932 3537 2567 1329 1225 1036 654 368 277 263 167 101 13962 53574 3257 2779 559 552 43679 3254 3074 1607
NM_001001890chr2173795 3539 3459 1619 728 486 407 21714 817 43660 3269 3253 547 1645
NM_001001928chr2287973 6959 6532 6106 2432 1773 1440 1268 17216 78209 7392 6634 6629 6624 3178 498 16744
NM_001001933chr12608 171 148 2472 183 197
NM_001001938chr9123677 3086 3070 2895 2754 1342 1318 1209 1112 935 857 638 12510 44056 3367 3332 426 --
NM_001001971chr1041216 1050 1030 1020 --41060 992 464 54 1339
NM_001001974chr1082409 2189 1770 1626 780 720 705 559 22182 363 21890 1632 --
NM_001001995chrX51871 1301 735 490 282 --21435 708 --
NM_001002233chr841817 1658 1474 743 --22111 2013 22194 2117
NM_001002257chr252797 1246 1176 564 119 13337 23462 3430 12681
NM_001002843chr151372 1265 21185 486 11172
NM_001002860chr14103735 3661 3399 3380 1596 1288 615 581 351 148 --43223 471 312 268 14540
NM_001002926chr772671 2627 2100 943 850 589 282 --3948 683 417 --
NM_001003652chr18178447 8379 6678 6023 6000 3338 3136 3090 2917 2180 1755 1736 1630 1443 976 462 283 27732 513 48419 7535 2843 2252 35394 2890 1317
NM_001003674chr1896750 5376 5367 4590 4525 2431 1600 1051 882 12707 76647 6612 6156 5189 4980 469 222 16741
NM_001003675chr1896750 5376 5367 4590 4525 2431 1600 1051 882 12707 76647 6612 6156 5189 4980 469 222 16741
NM_001003698chr631454 1281 350 --1333 11918
NM_001003699chr631454 1281 350 --1333 11918
NM_001003712chr12103654 3364 2876 2813 1109 905 891 797 511 81 22769 1443 33495 3426 2644 --
NM_001003760chr693637 3511 3400 2634 2613 1355 1205 773 273 2747 41 83143 2881 2607 1371 1008 698 401 241 33543 460 456
NM_001003792chr32220 54 --51261 1230 483 478 208 --
NM_001003793chr32220 54 --51261 1230 483 478 208 --
NM_001003800chr932857 2342 682 --33535 3468 756 11051
NM_001004317chr654458 3521 2813 1435 1023 1962 33962 3824 3538 13034
NM_001004346chr4----5239 178 110 93 48 --
NM_001004419chr1264172 3448 3420 2849 2817 1473 14326 33300 1478 155 1538
NM_001004441chr531279 350 81 21459 1146 21478 1078 --
NM_001005375chrY61539 1485 1336 684 614 258 ----1271
NM_001005386chr251964 917 353 132 52 --32482 771 616 1658
NM_001005463chr1032228 994 213 --42605 2365 1772 1032 1155
NM_001005473chr5116452 5869 5835 5182 4574 4412 2452 2319 2266 1625 176 --66625 6409 4773 4205 1630 194 --
NM_001005609chrX63825 3657 2664 2380 945 741 1133 --1747
NM_001005782chr25878 785 744 167 151 --3790 687 45 --
NM_001005861chr34907 856 691 201 --3781 632 365 1778
NM_001006600chr5102234 2065 2006 1841 1655 1510 628 565 401 42 --31540 926 291 11547
NM_001006641chr931443 1163 1145 11767 31469 1157 1087 --
NM_001006642chr931443 1163 1145 11767 31469 1157 1087 --
NM_001006643chr931443 1163 1145 11767 31469 1157 1087 --
NM_001007023chr1452055 2013 1375 520 279 13301 33430 1860 1855 --
NM_001007024chr1774335 4051 3433 3297 3129 3078 2901 23703 3244 33953 2975 1481 13248
NM_001007025chr1774335 4051 3433 3297 3129 3078 2901 23703 3244 33953 2975 1481 13248
NM_001007097chr9105094 5020 4792 3970 3931 1242 1169 610 384 362 --75035 4121 3921 3844 3533 1484 884 --
NM_001007102chr641355 1308 290 54 31560 299 130 21563 1445 --
NM_001007214chr13721 223 207 --1743 1163
NM_001007246chr2181973 1692 1430 672 666 301 228 149 --1355 --
NM_001007278chr1384743 4620 3920 3680 3615 3244 1564 1089 13691 65046 4912 4626 4010 3374 2116 --
NM_001007466chr6165159 5133 5121 5020 4767 4730 4612 4393 4332 3353 3277 3260 1347 886 290 280 34686 1919 263 31696 317 266 --
NM_001007538chr1361886 1855 1594 1479 346 328 --21633 120 --
NM_001007794chr13732 129 122 --2757 650 --
NM_001008226chr15111789 1753 1731 1715 1357 1162 619 430 296 172 102 1354 11671 --
NM_001008239chr18103697 3067 3022 2985 2962 2569 2524 1453 247 73 --73706 3363 2972 2917 548 363 261 13369
NM_001008272chr3--1255 1274 4271 267 263 259
NM_001008273chr3--1255 1274 4271 267 263 259
NM_001008392chr372352 930 760 747 682 476 417 --12381 --
NM_001008408chr795792 5256 4441 4136 4059 2150 1803 1428 1134 --86356 5087 4953 4885 4052 1849 665 254 15448
NM_001008495chr871720 1649 1469 690 479 307 161 --31812 653 267 41946 1765 1566 327
NM_001008539chr8105130 4522 4398 4334 1840 1789 1656 1339 466 203 23299 1453 34340 1753 1600 13886
NM_001008541chr1062145 2134 1962 568 544 537 --21587 895 --
NM_001008541chr1062145 2134 1962 568 544 537 --21587 895 --
NM_001008564chr1372266 2086 1950 1726 1654 1593 45 11928 --11851
NM_001008660chr1141436 1420 1227 316 --11402 1551
NM_001008727chr192221 95 --9270 265 260 255 250 245 240 235 230 --
NM_001008738chr562673 2569 2120 479 439 385 --11973 12186
NM_001008895chr1331389 1297 931 --11107 11320
NM_001008925chr493550 3331 2985 2845 2437 1094 966 943 924 12515 63280 3227 3104 2976 2405 524 1953
NM_001009554chr4124448 4287 4186 4122 3806 3573 3444 3064 2928 1444 653 643 --44547 4156 3902 3457 34455 3621 1575
NM_001009554chr4124448 4287 4186 4122 3806 3573 3444 3064 2928 1444 653 643 --44547 4156 3902 3457 34455 3621 1575
NM_001009555chr451702 1591 1316 1225 175 --31460 442 359 --
NM_001009571chr761445 1350 1307 1232 1183 86 --2485 55 --
NM_001009894chr122161 84 ----21369 623
NM_001009899chr3146498 6461 5871 5508 4517 4476 4132 4006 2594 2370 1118 1071 877 548 36125 702 672 86380 5692 4251 3995 968 887 222 195 36527 1028 919
NM_001009909chr11123630 3520 3260 2756 1551 1446 1130 591 533 513 497 439 13144 43890 3700 2903 299 12888
NM_001009960chr75818 712 671 505 44 32427 1112 981 2995 805 2968 776
NM_001009993chr284529 3946 1823 1778 1402 879 849 808 --11668 21122 949
NM_001010000chr1853501 2672 2360 2294 2179 22884 1259 1450 --
NM_001010853chr643114 2852 2302 316 --22599 1090 22750 1998
NM_001010861chr152492 1789 1024 493 390 1698 41076 701 530 470 --
NM_001010888chrX43415 2958 1236 870 24651 124 73909 3809 3522 2904 1658 416 396 --
NM_001010923chr641501 1315 1102 286 --11366 21363 258
NM_001010927chr66549 414 167 158 99 37 --2563 453 1395
NM_001010934chr721171 348 1130 1748 1981
NM_001010984chr142131 443 231 70 12252 52317 2064 913 649 202 1783
NM_001010986chrX52376 2235 871 632 106 --2894 626 --
NM_001011513chr473945 2926 2650 1012 927 831 197 13637 53586 3116 2955 2605 1623 --
NM_001011537chr382395 2141 2011 1801 1486 464 307 121 --32357 1883 127 --
NM_001011663chr1041078 927 855 811 --4843 709 704 691 --
NM_001011666chr7126490 6465 5178 4966 4279 4263 4210 4083 4069 2271 798 299 14808 104334 4320 4177 1651 1510 1498 1138 673 652 127 14356
NM_001011708chr282930 2767 2639 1867 938 651 283 129 --42920 2854 1949 135 --
NM_001011713chr1431379 1243 302 1288 61418 1119 1114 1034 454 262 11340
NM_001011720chr871377 572 390 379 171 90 43 21153 565 21018 151 21015 1011
NM_001012393chr1144678 4335 457 230 --65027 4117 4079 351 161 143 21029 789
NM_001012418chr664119 3828 3179 1383 1237 528 14288 13387 24208 639
NM_001012420chr1572662 2514 824 578 458 385 119 --52807 2038 690 149 92 184
NM_001012423chr1572662 2514 824 578 458 385 119 --52807 2038 690 149 92 184
NM_001012751chr1041911 1463 753 123 21796 431 11799 --
NM_001012754chr1352174 1862 1607 337 268 --51945 1848 1639 182 90 --
NM_001012755chrX85045 4927 4918 4861 4820 4453 4423 3831 --24906 4183 --
NM_001012968chrX132666 2653 2542 2394 1927 1905 1763 1085 1044 999 641 123 51 11839 41932 1723 672 659 22360 718
NM_001013031chr1083535 3367 3296 3275 3143 3131 2987 477 --12168 --
NM_001013406chr741741 1552 1411 589 --11724 11221
NM_001013415chr441251 1027 474 297 --31582 1438 305 11456
NM_001013439chr32735 269 --1801 1615
NM_001013615chr131034 814 139 1912 21143 394 2391 387
NM_001013620chr12268397 8299 7631 7576 7377 7344 7185 6850 6707 6553 6532 6246 6189 5655 5486 5340 3355 3299 2224 2173 2144 1674 1269 1034 346 307 28415 7408 38478 8379 3133 25318 5195
NM_001013659chr1965336 4641 1610 1118 937 376 32055 2015 1262 54958 2058 1550 422 405 3419 415 411
NM_001014380chr13225800 5527 5399 4941 4899 4776 4243 2138 1991 1746 1736 1703 1661 1512 1149 1092 971 738 649 636 432 333 14614 74885 4002 2258 2241 2236 2231 2122 32255 2251 2247
NM_001014434chr14685 315 70 48 179 ----
NM_001014797chr1088006 7029 6766 6481 987 772 422 384 1728 58223 7373 3043 2548 731 31224 391 331
NM_001015877chrX63107 3082 2545 2384 2357 127 --43045 2710 920 548 1956
NM_001015882chr961006 340 302 245 64 47 ------
NM_001017371chr281140 1068 524 509 432 87 34 24 --21307 1162 --
NM_001017395chr382811 2768 2672 2621 1396 837 494 218 12261 42842 1363 1307 892 --
NM_001017420chr821374 1209 --41458 1259 1254 937 11393
NM_001017434chr15774 751 584 258 158 1232 1566 2236 208
NM_001017440chr777055 6829 5844 5739 2395 1280 1198 28248 5077 35771 5308 1455 --
NM_001017923chr1431551 515 209 --41704 1574 1368 67 21403 271
NM_001017926chr841372 713 645 498 1513 41795 1354 1337 1235 --
NM_001017992chr561242 1196 1167 1044 970 303 11072 21515 1284 --
NM_001017999chr132345 2091 292 --22159 804 22214 796
NM_001017999chr132345 2091 292 --22159 804 22214 796
NM_001018000chr132345 2091 292 --22159 804 22214 796
NM_001018000chr132345 2091 292 --22159 804 22214 796
NM_001018001chr132345 2091 292 --22159 804 22214 796
NM_001018064chr982133 1973 1967 1891 1871 1548 1320 666 ----1543
NM_001018065chr965163 4913 4650 4213 3678 1558 24977 326 15850 --
NM_001018066chr965163 4913 4650 4213 3678 1558 24977 326 15850 --
NM_001018067chr1134963 4779 4382 3469 3407 1854 1791 1587 1434 1378 1364 1202 664 13314 45391 2145 553 359 --
NM_001018068chr1134963 4779 4382 3469 3407 1854 1791 1587 1434 1378 1364 1202 664 13314 45391 2145 553 359 --
NM_001018069chr1134963 4779 4382 3469 3407 1854 1791 1587 1434 1378 1364 1202 664 13314 45391 2145 553 359 --
NM_001018074chr5123957 3726 3643 2649 2597 1467 1341 583 562 231 104 53 --43828 3485 2768 98 13837
NM_001018075chr5123957 3726 3643 2649 2597 1467 1341 583 562 231 104 53 --43828 3485 2768 98 13837
NM_001018076chr5123957 3726 3643 2649 2597 1467 1341 583 562 231 104 53 --43828 3485 2768 98 13837
NM_001018077chr5123957 3726 3643 2649 2597 1467 1341 583 562 231 104 53 --43828 3485 2768 98 13837
NM_001018080chr1131432 1213 230 ----11203
NM_001020825chr551432 1201 1118 124 72 --31303 960 243 11312
NM_001023567chr1562499 2044 827 501 385 119 --52463 2378 232 149 92 184
NM_001024094chr5123957 3726 3643 2649 2597 1467 1341 583 562 231 104 53 --43828 3485 2768 98 13837
NM_001024647chr1277717 7199 6768 6640 6524 2593 587 --76169 4832 1147 575 491 450 81 --
NM_001024649chr572656 2632 2620 2043 1970 996 498 11989 ----
NM_001024847chr392478 2433 2340 1931 1855 1005 685 418 277 ----1704
NM_001024948chr162864 2743 2724 962 507 296 23027 783 33097 2441 513 13473
NM_001024956chr11125849 5797 5779 5417 5126 4943 4785 4346 3689 1552 362 118 64502 3818 1444 1403 753 740 35131 1618 1524 25301 4561
NM_001025068chr381807 1790 1466 630 544 475 439 381 --11596 --
NM_001025069chr381807 1790 1466 630 544 475 439 381 --11596 --
NM_001025072chr372191 1946 1910 1070 565 340 174 --41088 639 575 137 1636
NM_001025073chr372191 1946 1910 1070 565 340 174 --41088 639 575 137 1636
NM_001025076chr10166206 6137 5351 5297 4477 3878 1673 1666 1284 1165 996 338 299 283 73 31 24526 4517 25372 4529 --
NM_001025077chr10237564 7495 6709 6655 5835 5236 5055 4713 4610 3031 3024 2642 2523 2354 1696 1657 1641 1431 1237 1077 615 128 31 35884 5875 906 66730 5887 842 660 587 299 --
NM_001025079chr3144057 3611 3369 3265 3057 2915 2703 1563 1395 1063 704 681 250 168 13628 33276 3259 1246 13921
NM_001025105chr531468 1403 373 --11084 11474
NM_001025233chr123912 771 392 --11901 22385 1118
NM_001025252chr893030 3007 2801 2748 1282 1046 731 708 593 21261 667 --32928 218 108
NM_001025253chr893030 3007 2801 2748 1282 1046 731 708 593 21261 667 --32928 218 108
NM_001025356chr1282729 2668 2613 2323 1115 943 332 137 --63028 2674 581 390 372 338 --
NM_001025366chr611370 21736 1237 31844 318 271 11740
NM_001025366chr611370 21736 1237 31844 318 271 11740
NM_001025367chr611370 21736 1237 31844 318 271 11740
NM_001025367chr611370 21736 1237 31844 318 271 11740
NM_001025368chr611370 21736 1237 31844 318 271 11740
NM_001025368chr611370 21736 1237 31844 318 271 11740
NM_001025369chr611386 21752 1253 31860 334 287 11756
NM_001025369chr611386 21752 1253 31860 334 287 11756
NM_001025370chr611370 21736 1237 31844 318 271 11740
NM_001025370chr611370 21736 1237 31844 318 271 11740
NM_001025580chrX63912 3751 2982 1027 951 201 24312 701 73782 3637 3583 3527 2937 2839 1488 --
NM_001025595chr431588 1113 632 --21381 436 21628 594
NM_001025603chr141298 1115 358 82 1966 11405 11402
NM_001025616chr42399 277 21658 129 31554 1497 420 11494
NM_001029858chr652458 2250 1000 798 247 --62300 2269 2206 2054 874 445 --
NM_001029875chr552734 2383 2181 1959 959 2539 306 11940 11965
NM_001030055chr14114744 4609 4543 4347 4257 3834 3225 1588 1344 706 403 --54749 4505 4486 2873 1854 --
NM_001031679chr1243545 3521 3447 512 --43052 652 647 642 12764
NM_001031700chr462381 2255 1601 1002 876 805 1606 42191 2135 649 555 12409
NM_001031715chr153202 178 164 ----1184
NM_001031716chr231034 795 101 --2717 221 171
NM_001031732chr473412 2705 823 311 226 129 112 23579 1045 2538 86 22542 1049
NM_001031804chr1684373 4217 4109 3401 2877 1393 1091 1014 --51415 1409 1365 497 473 --
NM_001031812chr562259 2096 1974 1534 1433 728 11468 51823 1699 1575 1471 140 --
NM_001032280chr641707 1442 1390 1126 11576 31733 1728 1094 --
NM_001032283chr125891 786 279 166 130 --3882 284 257 1770
NM_001032284chr125891 786 279 166 130 --3882 284 257 1770
NM_001032363chr152199 1597 1562 896 49 --11691 21688 1684
NM_001032363chr152199 1597 1562 896 49 --11691 21688 1684
NM_001032380chr1031703 1581 281 --52010 1955 1473 1467 402 --
NM_001032394chr672729 2449 1971 1772 697 624 485 --12608 12605
NM_001032395chr662596 2316 1838 564 491 352 --12475 12472
NM_001033047chr422656 1981 22595 2356 32453 2085 570 --
NM_001033057chr352110 1781 382 360 238 21848 73 31968 1851 489 --
NM_001033087chr2092995 2983 2319 2257 2104 1309 973 380 352 --32438 2289 2117 12114
NM_001033578chr882308 1859 1600 947 911 567 221 104 1581 22215 1869 --
NM_001033723chr822792 942 --31822 1800 1730 11797
NM_001033756chr611304 21670 1171 31778 252 205 11674
NM_001033756chr611304 21670 1171 31778 252 205 11674
NM_001034841chr16125540 5508 5259 4976 4708 4361 4193 3885 3650 860 758 701 --35459 5020 485 --
NM_001034845chr421357 912 --61144 1095 1067 1059 553 547 --
NM_001034850chr571638 1550 1523 632 606 368 199 11379 31382 1313 128 --
NM_001034954chr1063271 3197 2984 2561 769 27 13259 13188 33185 2837 941
NM_001034955chr1063271 3197 2984 2561 769 27 13259 13188 33185 2837 941
NM_001034956chr1063271 3197 2984 2561 769 27 13259 13188 33185 2837 941
NM_001034957chr1063271 3197 2984 2561 769 27 13259 13188 33185 2837 941
NM_001037132chr76805 691 569 420 277 205 --21898 1458 --
NM_001037133chr76805 691 569 420 277 205 --21898 1458 --
NM_001037165chr747414 2491 1864 610 --48869 8722 6816 6670 18866
NM_001037317chr152492 1789 1024 493 390 1698 41076 701 530 470 --
NM_001037332chr522567 941 --22284 2193 12431
NM_001037333chr522567 941 --22284 2193 12431
NM_001037334chr18131912 1894 1881 1725 717 614 378 310 258 246 114 57 46 11537 12095 --
NM_001037535chrX91225 996 592 534 516 253 223 91 72 --21180 973 1552
NM_001037536chrX91225 996 592 534 516 253 223 91 72 --21180 973 1552
NM_001037540chrX91225 996 592 534 516 253 223 91 72 --21180 973 1552
NM_001037954chr1193227 2789 2229 2133 1167 1111 995 978 381 22969 1229 --12655
NM_001038603chr5----442 37 32 24 1294
NM_001038640chr151894 --4760 292 225 195 1160
NM_001038702chr5112685 2293 2247 2221 981 680 598 568 397 333 308 1352 4859 835 708 403 --
NM_001039091chrX61336 332 250 205 170 141 1929 ----
NM_001039372chr74627 500 440 429 --2633 478 --
NM_001039395chr962325 2246 1792 919 875 654 22237 1682 1477 --
NM_001039538chr2183427 3159 2518 2490 2351 1323 1301 1184 1156 1057 846 668 490 412 360 276 240 84 1580 22426 1228 12898
NM_001039547chr3158032 7041 6978 6426 5178 2118 1645 1618 1333 948 924 876 737 260 173 1845 73199 2997 2940 2468 1294 1235 962 36850 6783 1596
NM_001039570chr2214665 14616 14493 11081
NM_001039571chr2214665 14616 14493 11081
NM_001039580chr4134774 4643 4409 4241 3922 3172 2042 1893 1087 794 690 295 23 53533 2025 314 79 32 44197 4127 3328 937 52029 934 930 926 565
NM_001039585chr1113954 3337 3044 2727 1580 1284 1159 959 889 690 626 1530 21703 1681 11596
NM_001039590chrX143550 3427 3195 2721 2702 2670 2638 1564 1432 1005 603 592 541 129 23515 2871 11418 13914
NM_001039591chrX143550 3427 3195 2721 2702 2670 2638 1564 1432 1005 603 592 541 129 23515 2871 11418 13914
NM_001039618chr11135680 5370 4855 4435 4177 4079 2342 2253 2083 1877 1564 1213 751 15484 84126 4121 3673 2186 1556 1479 1416 996 25001 4713
NM_001039762chr1052380 2207 786 678 366 --2449 436 --
NM_001039840chrX126054 5226 3776 3717 2266 2010 1961 1521 1401 946 359 38 --65916 5576 5549 5052 1262 844 25374 858
NM_001039937chr13123773 3436 3115 3033 2885 2622 2568 1138 1090 435 150 27 1570 53553 2720 182 172 84 11044
NM_001040100chr33949 800 487 ----1276
NM_001040101chr431557 264 68 1105 --21574 243
NM_001040108chr14112588 2439 2325 2295 2284 1308 1209 1094 581 321 214 1274 1219 12301
NM_001040142chr221904 1733 --51797 1576 1571 1566 753 --
NM_001040143chr221904 1733 --51797 1576 1571 1566 753 --
NM_001040152chr775066 3890 3763 1388 1191 317 155 24823 4684 24586 3816 --
NM_001040181chr321022 112 21068 1000 3935 93 38 31072 820 132
NM_001040182chr321022 112 21068 1000 3935 93 38 31072 820 132
NM_001040183chr321022 112 21068 1000 3935 93 38 31072 820 132
NM_001040199chr321022 112 21068 1000 3935 93 38 31072 820 132
NM_001040200chr321022 112 21068 1000 3935 93 38 31072 820 132
NM_001040202chr4112325 2276 2081 2057 1852 1814 1792 1729 1703 656 374 22460 768 1295 --
NM_001040272chr932088 1855 1776 12396 32015 98 85 32400 95 91
NM_001040284chr16155930 5863 5222 5192 4617 4415 3702 3669 2296 1914 1896 1861 494 265 235 34774 4085 2038 44336 1981 789 784 15973
NM_001040402chr4122955 2918 2876 2672 2093 1181 1155 1142 621 586 537 316 12498 62793 2399 1973 858 652 392 12062
NM_001040429chr13133392 2898 2873 2650 2440 2320 2206 1388 1094 1032 1024 899 642 12798 32607 904 199 22879 2802
NM_001040441chr194842 4325 4315 4048 3528 3432 1394 278 259 44877 4293 1490 1135 --13635
NM_001040450chr1552292 2249 1883 919 781 11787 1119 1562
NM_001040453chr1552292 2249 1883 919 781 11787 1119 1562
NM_001040653chr322332 695 22597 195 52516 2085 2025 787 198 --
NM_001040665chr7134819 4799 3754 3413 3267 3146 1909 1497 1049 1014 678 671 52 --23201 700 33658 3586 1808
NM_001040712chr973529 3395 2792 2344 1045 834 702 12825 83517 3214 3187 3101 2919 630 622 543 1249
NM_001040876chr471890 1556 1381 731 479 415 33 11597 ----
NM_001042355chr1685182 5106 4162 1911 910 712 444 394 24051 1941 55235 5229 4880 4852 1422 34877 4083 4079
NM_001042361chr1041322 1125 356 196 1979 51519 1479 982 368 161 --
NM_001042364chr1041322 1125 356 196 1979 51519 1479 982 368 161 --
NM_001042365chr1041322 1125 356 196 1979 51519 1479 982 368 161 --
NM_001042387chr1041322 1125 356 196 1979 51519 1479 982 368 161 --
NM_001042393chr1041322 1125 356 196 1979 51519 1479 982 368 161 --
NM_001042396chr1041322 1125 356 196 1979 51519 1479 982 368 161 --
NM_001042397chr1041322 1125 356 196 1979 51519 1479 982 368 161 --
NM_001042404chr131971 1958 1907 11941 41944 1913 787 143 31763 140 136
NM_001042412chr1685182 5106 4162 1911 910 712 444 394 24051 1941 55235 5229 4880 4852 1422 34877 4083 4079
NM_001042413chr983710 3339 3277 3243 2865 2641 1642 1316 22950 639 34112 3419 3255 --
NM_001042425chr641707 1442 1390 1126 11576 31733 1728 1094 --
NM_001042453chrX71696 1643 1464 1439 690 187 166 11278 ----
NM_001042473chr1082177 2026 1859 1681 777 744 391 294 32127 1709 846 --11788
NM_001042481chr1422640 2629 22441 1952 42174 958 823 692 --
NM_001042510chr851981 586 478 366 131 1290 31722 1518 1504 --
NM_001042511chr851981 586 478 366 131 1290 31722 1518 1504 --
NM_001042533chr342798 1339 663 483 42073 1204 961 282 33305 2461 1207 1240
NM_001042537chrX52231 1836 610 481 404 --22469 2434 12466
NM_001042555chr1284732 4468 3557 1760 953 879 667 192 14544 53735 1001 466 75 69 11052
NM_001042599chr2177639 7484 7380 7028 6576 6461 6406 5930 5920 5912 5890 5149 3031 2725 2173 1632 1537 23054 1769 57298 2972 1104 654 220 17130
NM_001042601chr343121 3037 2853 1324 --33142 546 535 --
NM_001042603chr1264893 1975 1195 897 524 423 14402 34534 2142 1690 25195 4207
NM_001042604chr3154661 4625 4598 3812 3656 3588 3408 3124 1522 1468 1185 1127 1018 843 606 43473 1480 1004 511 74373 3649 3158 1512 860 463 130 24515 3348
NM_001042646chr331994 1667 593 21441 1349 21760 756 11342
NM_001042669chr42399 277 21658 129 31554 1497 420 11494
NM_001042683chr641425 1143 573 129 --21841 236 11838
NM_001042749chrX61544 1392 1286 436 273 36 11316 --2359 240
NM_001042750chrX61544 1392 1286 436 273 36 11316 --2359 240
NM_001042751chrX61544 1392 1286 436 273 36 11316 --2359 240
NM_001043318chr1464158 3775 3639 1551 1533 107 14121 34038 3889 801 21567 619
NM_001043351chr131423 649 628 --1641 --
NM_001044305chr651511 484 248 193 76 ----1583
NM_001044385chr243787 3682 2622 2517 13818 42865 2737 403 254 --
NM_001044722chr562259 2096 1974 1534 1433 728 11468 51823 1699 1575 1471 140 --
NM_001044723chr562259 2096 1974 1534 1433 728 11468 51823 1699 1575 1471 140 --
NM_001046chr573039 2691 2539 2003 1055 702 122 3922 808 710 32775 817 418 12592
NM_001071775chr1371618 1444 1363 1339 719 642 513 51759 1735 1656 736 272 --1505
NM_001079874chr162132 1598 758 646 400 374 --11848 --
NM_001083620chr472438 2326 2004 1639 1615 857 219 --22561 2331 --
NM_001099678chr386405 5874 4620 4521 2289 1311 625 194 35773 5385 5160 35198 1626 1586 --
NM_001106chr3139561 8894 7825 7038 7016 6828 6003 3298 2485 1741 1489 178 135 --79566 8837 6803 6789 2459 527 327 11747
NM_001113490chrX82833 1349 962 345 339 131 64 51 --33422 907 618 --
NM_001116chr1642887 362 325 123 --2436 167 4892 888 884 880
NM_001117chr1842407 2160 804 55 --11748 32242 1745 1741
NM_001121chr104658 637 546 175 21662 699 2535 349 --
NM_001126chr13961 331 216 --21046 930 169
NM_001146chr842339 1618 1558 304 12155 --21966 782
NM_001148chr421991 1596 11767 11396 11393
NM_001165chr11142 ----2103 99
NM_001167chrX86745 6727 6547 5190 4621 2481 549 334 1217 54730 2590 2027 1845 846 31855 1851 1826
NM_001173chr14114744 4609 4543 4347 4257 3834 3225 1588 1344 706 403 --54749 4505 4486 2873 1854 --
NM_001198chr672163 1778 634 616 371 343 22 22399 241 12297 --
NM_001200chr2031164 975 869 --2939 303 2315 125
NM_001201chr4103993 3963 3936 3346 3324 2456 2407 1351 1257 120 43216 1471 368 359 72978 1286 792 787 652 307 48 23733 882
NM_001204chr2257783 7485 7123 6482 6447 5828 5642 5439 5018 2565 2500 2410 2079 2002 1986 1900 1849 1568 1474 1449 1088 1040 958 821 32 21400 45 67128 6657 2712 905 900 423 77097 7093 6431 6258 5862 941 937
NM_001206chr953064 2554 2449 2002 889 --43035 1118 801 314 --
NM_001219chr752226 1708 1657 857 21 --2260 40 --
NM_001233chr792264 2226 1986 1967 1601 741 676 381 145 --32355 612 85 --
NM_001241chr292466 2299 2288 2179 1789 1771 1534 242 235 1418 1668 22442 1718
NM_001241chr292466 2299 2288 2179 1789 1771 1534 242 235 1418 1668 22442 1718
NM_001256chr1762970 2911 2152 2037 666 138 22133 1865 52294 2104 1821 431 392 --
NM_001259chr7125412 5305 5104 5021 4249 2471 2446 2086 1529 961 830 799 25280 4510 55116 4723 4502 897 209 --
NM_001304chr1773860 3338 3131 2952 2604 1307 700 --23696 1131 --
NM_001310chr12102976 2954 2795 2549 2483 2088 2037 511 487 329 --42207 2181 1913 770 1494
NM_001331chr1162764 2675 2181 2160 1142 250 --32267 468 44 --
NM_001338chr2151251 934 895 394 382 ----2419 415
NM_001351chr351513 1459 588 516 163 --11149 1176
NM_001356chrX52464 1799 1577 293 215 --42520 1823 1708 338 --
NM_001390chr1863645 3473 2637 2448 1005 520 --23170 3043 --
NM_001391chr1841180 1104 1042 961 2944 227 21013 428 --
NM_001399chrX63825 3657 2664 2380 945 741 1133 --1747
NM_001401chr921218 1071 --1395 21172 371
NM_001412chrX83629 3536 2835 2363 1113 1091 330 89 23500 1195 21321 834 22862 2459
NM_001419chr1964676 4356 2954 339 218 82 --64416 4227 4206 3496 2959 1230 21643 1621
NM_001420chr1943161 3102 2490 2142 12956 --12272
NM_001427chr742136 1442 384 329 1154 21773 1493 --
NM_001432chr4113746 3692 2654 2588 2466 1228 1011 1000 942 254 68 --63880 3633 2569 1247 153 142 53877 3573 3260 2575 724
NM_001438chr183186 3108 2673 2520 1086 910 290 274 33294 3116 2645 43556 2338 314 242 11447
NM_001448chrX61779 1701 1146 511 315 292 11798 1320 2663 446
NM_001451chr16----3465 458 431 1960
NM_001453chr681558 1383 1201 692 681 470 411 288 --1515 --
NM_001460chr153367 2388 966 913 217 21136 1105 22220 658 52603 2217 1221 1086 919
NM_001490chr922355 606 43472 3102 2524 1449 33185 3003 1088 --
NM_001491chr621012 260 22495 987 11732 11673
NM_001511chr41253 1493 --2158 154
NM_001530chr1451095 1029 319 254 207 --1284 2281 277
NM_001546chr631379 181 136 11165 11116 1239
NM_001554chr1----1251 2627 533
NM_001558chr1131816 484 321 --11550 41564 1560 1547 1543
NM_001584chr1161188 1129 1094 796 310 154 186 2164 159 --
NM_001604chr1151001 873 854 259 241 --2246 222 1733
NM_001609chr10114346 4154 3998 3631 3623 3498 3052 1806 963 881 611 --34188 3901 431 23002 789
NM_001616chr233342 820 433 33252 3201 689 42706 988 402 81 --
NM_001621chr782499 1922 1007 938 847 676 648 345 1757 32779 2276 1028 --
NM_001621chr782499 1922 1007 938 847 676 648 345 1757 32779 2276 1028 --
NM_001650chr1873002 2795 909 895 395 384 266 33992 3940 3901 32958 1239 598 --
NM_001655chr111363 --4829 659 334 328 --
NM_001656chr562082 2032 1825 1338 605 338 21533 264 21773 1461 --
NM_001677chr13384 366 192 --2999 930 1331
NM_001679chr31642 --2528 51 1771
NM_001682chr1232867 1902 919 32907 2043 424 52892 2749 2263 2172 143 --
NM_001690chr342404 620 134 98 11802 41778 612 605 599 --
NM_001695chr863960 3589 1144 901 833 200 --33864 3508 1311 2264 244
NM_001701chr961370 1290 539 470 424 218 1231 1477 --
NM_001709chr1172753 2562 2294 1053 427 194 159 --22533 577 12186
NM_001714chr122572 127 --3492 433 421 1489
NM_001723chr63617 332 312 1348 --1210
NM_001730chr1341539 1522 582 186 1330 11310 11307
NM_001730chr1341539 1522 582 186 1330 11310 11307
NM_001746chr572656 2632 2620 2043 1970 996 498 11989 ----
NM_001754chr2173795 3539 3459 1619 728 486 407 21714 817 43660 3269 3253 547 1645
NM_001755chr1691870 1609 1592 1475 1415 498 427 307 44 32045 579 376 1479 --
NM_001759chr1294563 4501 3774 1801 1649 1578 1378 1360 727 --24812 648 --
NM_001777chr3144057 3611 3369 3265 3057 2915 2703 1563 1395 1063 704 681 250 168 13628 33276 3259 1246 13921
NM_001789chr351345 541 505 493 438 --2466 461 --
NM_001830chrX83976 3656 3497 3367 2805 973 766 667 2429 47 23871 920 2826 822
NM_001854chr141131 1076 606 385 1988 21473 1340 --
NM_001858chr6145133 5080 4861 4427 4380 4165 4095 3282 2029 1732 1604 1273 808 203 --74962 3974 3630 3186 1776 1719 572 34337 1738 1716
NM_001892chr531468 1403 373 --11084 11474
NM_001894chr2211136 --31040 1035 1030 11081
NM_001931chr113824 105 45 1137 21180 92 --
NM_001935chr26933 879 243 229 55 44 11012 21030 884 --
NM_001949chr632780 2652 2259 12694 12824 12658
NM_001950chr161720 1656 1631 1646
NM_001957chr43767 536 491 2917 547 3749 627 479 12178
NM_001969chr1473407 2994 1493 942 670 480 376 21119 215 22794 828 --
NM_001977chr441541 1531 478 271 --21267 444 11355
NM_001992chr552221 2149 2092 322 86 --12112 21680 1370
NM_001999chr561539 1394 1127 1095 998 983 11196 2398 236 1395
NM_002006chr4135746 5443 5148 5031 4963 4802 4675 4621 1567 1367 398 271 27 12271 44812 3981 3622 1224 14825
NM_002009chr1542406 2310 2284 940 3968 953 345 32563 2059 92 11744
NM_002015chr1363332 3000 2246 2059 698 255 11087 32589 900 690 --
NM_002024chrX32131 516 430 11543 31417 259 146 --
NM_002025chrX168369 8122 7696 7460 6144 6063 6029 5948 3359 1456 1230 1204 748 506 207 195 29298 2472 67437 7187 3335 1422 1286 697 --
NM_002033chr1154059 3046 2907 2829 726 1974 22912 977 --
NM_002040chr21113150 2700 2573 2492 2135 1171 1114 883 706 241 71 22237 553 62835 2536 2168 2163 2140 96 --
NM_002044chr1531457 1292 261 --31574 1377 398 11555
NM_002069chr771860 1706 1241 1218 603 539 317 --11599 1437
NM_002076chr1233216 2251 1986 --33284 1213 1031 12391
NM_002089chr42674 258 1498 2266 169 4166 162 158 154
NM_002092chr4154690 4507 4388 3956 3876 3682 3445 3320 3105 1979 1854 1377 884 338 91 11053 43704 1715 446 49 23847 367
NM_002099chr44752 485 433 143 1611 21660 477 --
NM_002137chr742423 1757 1721 1480 2953 198 1541 12009
NM_002158chr2143811 3433 3334 2783 2348 1415 1325 1273 732 719 639 153 111 74 23546 984 43788 3549 879 361 --
NM_002182chr392679 2667 2639 1940 1914 963 723 422 69 1760 42798 2757 2750 2722 12578
NM_002196chr2021057 820 2974 776 --2791 787
NM_002196chr2021057 820 2974 776 --2791 787
NM_002203chr554090 3402 3288 2814 1529 --24005 3787 21171 565
NM_002210chr2113264 2481 2296 1395 1285 876 828 812 660 252 54 13301 43104 2442 973 349 --
NM_002214chr7165600 5463 5333 5265 5135 4740 4657 4643 4441 4427 4037 3677 1950 1592 843 611 23889 259 45639 5215 3760 3644 21912 912
NM_002243chr211424 --31013 974 553 1377
NM_002247chr1031951 158 47 2749 223 2475 164 1348
NM_002253chr441434 1121 1047 234 11156 1110 1240
NM_002254chr261746 1609 1520 1510 878 812 1191 --22143 177
NM_002264chr363628 3157 1778 1604 1224 125 21727 1306 34168 1229 803 --
NM_002270chr5134920 4739 4585 4300 3999 3873 3650 3438 2227 1753 1604 1377 816 --31584 1579 1051 1963
NM_002293chr132515 2401 881 2632 547 22450 2241 12772
NM_002310chr5195826 5775 5636 5572 4672 4649 4555 4429 4403 4009 2211 2194 2148 2012 967 823 753 720 589 14230 76127 4349 4187 4174 1709 828 436 15303
NM_002336chr1284874 4767 4366 3620 3303 929 767 363 23257 1084 64813 3940 3625 3590 1660 256 13457
NM_002345chr124567 530 84 74 --3245 222 134 --
NM_002349chr221388 470 --41443 1418 524 264 --
NM_002356chr692845 2558 2548 2534 2034 1842 745 738 328 --3284 277 130 22040 656
NM_002360chr732604 2277 895 12492 12495 12309
NM_002374chr2183427 3159 2518 2490 2351 1323 1301 1184 1156 1057 846 668 490 412 360 276 240 84 1580 22426 1228 12898
NM_002387chr595097 4975 4852 3331 1670 1240 1207 411 270 --1702 25133 4823
NM_002395chr671478 1385 1284 1206 492 356 281 21195 206 ----
NM_002408chr142701 286 --1190 1273
NM_002430chr2262519 2256 2031 673 427 394 --32464 1673 461 --
NM_002442chr1231788 1509 426 --31760 1520 263 1260
NM_002451chr983837 3780 2902 1292 1285 1219 1025 50 21006 373 1841 --
NM_002480chr1241370 1172 550 105 --31344 1038 153 --
NM_002499chr154906 665 654 397 --4560 554 402 386 12471
NM_002514chr841219 443 409 248 ----1162
NM_002515chr1462038 1826 1791 1726 1650 667 --21763 1672 21860 1832
NM_002522chr1763767 3662 3537 2980 2953 381 --43953 3918 3157 604 --
NM_002543chr1251449 1406 1141 201 45 1110 31323 1045 259 11498
NM_002545chr1144678 4335 457 230 --65027 4117 4079 351 161 143 21029 789
NM_002547chrX84291 4126 3803 2782 2742 2727 1351 92 11182 33431 3137 1440 --
NM_002577chr373452 3116 1546 1475 1315 977 328 23995 2919 53969 2927 2922 2494 2488 --
NM_002581chr945093 4669 3725 3643 12173 45490 4555 3816 1559 15434
NM_002594chr2051967 1942 1690 316 151 22375 2365 42378 2280 1764 246 --
NM_002595chr1261830 1701 1432 1341 387 76 31352 702 302 51647 1396 1385 705 141 1345
NM_002610chr262772 2374 581 423 399 101 11984 13073 2337 95
NM_002613chr1685262 5155 5093 5076 4682 4403 3999 1603 15133 24126 3402 23555 141
NM_002623chr201776 2284 158 4694 675 161 25 2121 117
NM_002641chrX41767 1339 484 452 31696 1677 202 11699 --
NM_002645chr11103083 2792 2730 2684 2626 2577 2322 1119 879 558 --32966 2374 651 --
NM_002648chr621291 840 --1921 3918 914 910
NM_002655chr8125188 4966 4357 3491 3396 2074 2055 1606 1123 598 126 22 11825 83874 3687 3383 3325 3240 884 332 67 23331 767
NM_002667chr621325 359 11286 1205 1820
NM_002677chr863038 2998 2829 1968 884 866 2167 38 11018 12917
NM_002699chr141537 1474 1419 479 --31424 1342 1230 1565
NM_002709chr2113625 3614 2918 2860 2716 1432 1269 1173 844 503 379 ----1770
NM_002718chr352311 1755 1683 756 72 11039 11688 --
NM_002719chr1452185 2020 1787 908 472 --3805 792 696 --
NM_002731chr173065 2759 2047 456 291 132 107 --1322 11961
NM_002734chr1731960 1947 145 --21420 70 21639 630
NM_002736chr741997 1862 469 261 --42148 1669 1400 741 --
NM_002737chr1795389 4994 4393 2183 1905 1584 814 756 699 1965 24689 794 54686 4682 4678 4674 969
NM_002740chr372668 1815 1802 1013 910 496 388 --22747 2642 11920
NM_002745chr2264002 3842 3696 3677 676 474 34311 3636 1501 43732 3108 1533 1074 12766
NM_002748chr155941 386 195 79 60 1106 41191 977 852 178 --
NM_002765chrX61336 332 250 205 170 141 1929 ----
NM_002833chr1521525 1512 --11530 --
NM_002834chr1293854 3814 3767 3650 3449 3181 3141 3128 215 1478 3510 364 358 13626
NM_002837chr1262903 1670 1614 900 825 118 --24573 4294 --
NM_002838chr181170 1087 999 934 850 756 200 48 ------
NM_002839chr973529 3395 2792 2344 1045 834 702 12825 83517 3214 3187 3101 2919 630 622 543 1249
NM_002869chr1131444 759 63 1197 42152 2026 1963 1396 --
NM_002874chr942442 2337 762 694 22359 1986 21989 256 --
NM_002886chr395189 4896 4476 3864 3353 3339 1468 1312 1201 24829 2063 65162 4660 4196 1442 1270 74 --
NM_002890chr53842 835 650 --1630 1963
NM_002892chr143659 460 453 --31570 469 254 --
NM_002906chr1172392 2049 2024 1685 1567 1459 904 1663 ----
NM_002940chr471890 1556 1381 731 479 415 33 11597 ----
NM_002941chr391590 1564 1384 1326 1140 170 159 146 120 11653 3635 624 480 11491
NM_002942chr341297 1092 1037 167 --21196 449 196
NM_002955chr631454 1281 350 --1333 11918
NM_002956chr123479 273 102 2467 322 31168 891 872 --
NM_002958chr34907 856 691 201 --3781 632 365 1778
NM_002959chr153920 2750 1231 1098 245 13292 31773 1533 1488 --
NM_002977chr273259 3080 1056 649 555 396 174 2851 386 31354 631 48 --
NM_002994chr44752 740 551 250 1708 41957 1464 1314 116 --
NM_002998chr831873 602 96 --31838 596 331 --
NM_003010chr1772293 2224 2149 2133 1805 785 87 --2312 128 --
NM_003014chr741435 1393 1150 393 --11133 1946
NM_003046chr8105130 4522 4398 4334 1840 1789 1656 1339 466 203 23299 1453 34340 1753 1600 13886
NM_003048chr262707 2449 2326 1759 274 234 ----1362
NM_003051chr151754 800 713 431 135 --41688 1682 1610 1591 --
NM_003071chr342097 1290 465 361 1386 1545 1812
NM_003082chr144439 376 358 124 --2488 427 21439 344
NM_003099chr15116604 6370 6071 5256 2626 2220 1905 1748 1515 762 162 --12443 24794 168
NM_003108chr2135961 5714 5485 5471 5458 5442 5218 4965 4778 4603 1423 1230 330 17114 25706 2135 25507 4505
NM_003111chr281140 1068 524 509 432 87 34 24 --21307 1162 --
NM_003112chr783043 2788 2755 2474 2249 592 352 109 12926 42673 2239 1204 1075 22145 853
NM_003118chr542075 2061 1440 1423 --31547 392 387 11349
NM_003133chr13673 248 124 ----1196
NM_003137chr662201 2107 1668 845 771 353 22262 1565 31986 794 144 --
NM_003155chr852843 2756 2743 814 43 12663 22748 849 1401
NM_003161chr1773581 2664 2414 2377 788 692 366 --42701 2532 2392 722 --
NM_003182chr7123 191 3495 137 34 195
NM_003182chr7123 191 3495 137 34 195
NM_003184chr83888 833 695 1161 1981 1132
NM_003185chr2051351 1010 928 397 330 --31205 411 406 1403
NM_003199chr1874155 4018 3821 3765 1921 796 29 12042 95558 5028 4671 4612 4607 4133 3666 2081 696 --
NM_003203chr282484 2002 1784 768 671 605 433 90 --21673 786 1391
NM_003211chr1251702 1466 1132 463 91 21376 1367 31733 1548 1335 1253
NM_003220chr641707 1442 1390 1126 11576 31733 1728 1094 --
NM_003221chr664172 3553 2764 2747 981 862 14047 --13991
NM_003234chr341767 1748 880 723 1632 1398 1889
NM_003242chr392478 2433 2340 1931 1855 1005 685 418 277 ----1704
NM_003247chr631991 1730 66 21856 754 --11932
NM_003262chr384332 3194 1715 1555 1425 706 580 461 22107 779 104337 4125 4120 1610 996 986 759 455 248 155 --
NM_003274chr2172925 2781 2174 2117 1050 1008 849 --12749 11868
NM_003298chr366177 5631 5529 2195 1926 642 25182 555 12112 --
NM_003337chr541291 445 328 177 --1592 1507
NM_003338chr1091966 1614 1494 673 393 306 227 201 93 --31937 1922 724 --
NM_003342chr1772990 2797 1146 741 505 403 33 --23160 3011 --
NM_003344chr761757 1688 359 177 95 37 11595 ----
NM_003348chr1261617 1455 1383 1343 1179 260 --6366 361 356 351 346 265 1490
NM_003352chr25878 785 744 167 151 --3790 687 45 --
NM_003369chr111916 12709 32822 2228 1119 22205 299
NM_003372chrX2785 227 ----2137 133
NM_003376chr611370 21736 1237 31844 318 271 11740
NM_003376chr611370 21736 1237 31844 318 271 11740
NM_003387chr282734 2673 2513 2304 1892 657 328 193 12013 22562 2016 12580
NM_003392chr374366 3342 3050 1518 863 185 163 24327 47 64330 4104 3906 1194 224 97 --
NM_003406chr851448 733 650 631 603 --1655 --
NM_003407chr19------2513 498
NM_003410chrX32358 904 392 32527 642 495 22428 56 1294
NM_003411chrY61607 1330 656 594 294 151 11364 41633 1367 556 53 1284
NM_003419chr1991201 500 470 436 374 362 293 200 192 1253 --1380
NM_003423chr1972600 2557 1940 1011 868 585 340 11885 ----
NM_003439chr783318 2881 2592 1318 1224 813 434 51 ----12907
NM_003442chr114877 703 200 147 3863 827 642 1830 --
NM_003463chr6113058 2129 1314 1104 952 784 592 486 453 440 240 --12815 --
NM_003468chr284259 4135 3857 3716 3146 1588 1494 1055 14293 24011 3680 --
NM_003469chr24481 359 350 30 --1156 1432
NM_003471chr362332 1737 1724 1548 892 649 11479 21820 876 --
NM_003473chr1051099 1009 909 833 65 --2826 431 --
NM_003477chr112501 312 ----2122 118
NM_003478chr1182922 2870 2808 2754 2360 2067 912 892 12223 43349 3328 3167 89 12790
NM_003483chr1242806 2550 1071 626 --62626 2491 2029 777 659 591 --
NM_003489chr2183349 2626 2615 2568 2328 2125 1333 345 --3553 359 118 12955
NM_003558chr92639 208 ----2671 480
NM_003566chr12103260 3143 2722 2687 2344 2130 1385 913 317 200 13245 22146 979 --
NM_003569chr62126 84 --2581 516 2288 277
NM_003574chr18105082 4822 4784 4513 4004 3914 1327 1083 335 78 --44730 3919 1913 1495 21243 392
NM_003583chr1273903 3394 2714 2681 2425 1356 112 --43412 1247 157 91 --
NM_003589chr1331389 1297 931 --11107 11320
NM_003590chr2144060 4044 3499 3229 3137 2913 2525 2463 1552 1399 1371 1165 697 25 43873 2861 2508 488 53399 2488 1264 798 339 43396 3235 1250 804
NM_003597chr232156 1540 431 12270 --11453
NM_003603chr432155 1764 415 ----1849
NM_003607chr1124195 4123 3489 3299 2956 1686 1488 1228 1081 950 738 234 --34200 4059 4037 --
NM_003615chr393761 3671 3542 3353 3309 1154 957 394 223 13367 73370 2998 1267 1055 1041 975 491 63905 3770 3292 2588 2584 1146
NM_003617chr1114421 4098 3602 3433 3335 2004 1741 1548 1500 458 39 31537 807 536 43865 3376 3055 1540 --
NM_003618chr251122 992 469 207 121 --11271 11268
NM_003622chr1272552 2111 2057 2025 1857 1817 486 --52153 2142 1705 1669 545 12618
NM_003626chr1151262 1186 1000 389 136 11363 --1236
NM_003629chr173185 2643 2350 2318 2306 255 54 12896 22295 1098 1530
NM_003630chr64703 615 534 499 --2154 133 137
NM_003663chr373366 3030 2669 2179 913 853 429 --63347 3119 743 518 86 74 42485 1387 945 92
NM_003672chr161990 1546 1301 583 298 271 21288 666 ----
NM_003714chr573088 2526 2352 2343 2317 1015 610 --32727 2401 2221 1732
NM_003743chr251859 1794 865 797 283 1829 11799 12219
NM_003749chr1331768 882 297 12458 --11800
NM_003758chr1541568 1317 1266 1149 31158 1133 130 21204 1136 --
NM_003758chr1541568 1317 1266 1149 31158 1133 130 21204 1136 --
NM_003759chr4104060 4039 3808 3713 3703 1272 958 861 187 108 --44095 1482 227 213 --
NM_003762chr12279 22 --21443 1427 11433
NM_003763chr2041285 1147 1061 202 42979 2970 1191 703 32982 2870 1990 --
NM_003774chr1293394 3148 3103 2816 2686 2579 2505 2404 906 32949 2223 856 73215 2511 2429 2393 484 143 88 22653 2426
NM_003822chr173011 2962 2625 2103 2090 1078 825 --42468 2461 2456 2451 21938 942
NM_003825chr1531343 1324 1253 128 31486 1030 367 --
NM_003829chr961195 1102 1068 940 248 184 --2999 254 --
NM_003861chr1462705 2307 2274 2244 1938 620 --32085 2080 2061 11003
NM_003873chr1032390 2054 774 --42314 869 277 223 12008
NM_003885chr1762660 2561 2156 1929 560 54 --22670 1922 12667
NM_003887chr292319 2245 2185 1935 672 390 255 212 45 ----11623
NM_003888chr152506 314 21538 1380 21710 376 11384
NM_003909chr862993 2672 2141 1014 752 159 --33024 704 683 12423
NM_003913chr6143769 3619 3549 3529 3425 3265 1690 1468 1445 1009 1000 954 575 67 34276 3931 1743 54079 1109 993 656 343 23176 863
NM_003930chr782500 2260 2106 1924 524 390 131 103 1535 32416 2247 538 1259
NM_003932chr2291865 1632 1545 1423 1273 738 415 310 194 --1504 11875
NM_003934chr951172 501 212 199 189 --31282 1266 340 1456
NM_003941chr772450 2097 1835 1728 816 699 258 1159 32455 920 454 --
NM_003948chr441632 902 652 108 21967 1032 --22123 447
NM_003958chr673517 2838 2825 2612 690 449 273 --41581 1318 891 842 --
NM_003980chr641240 1052 135 121 1944 21130 1106 --
NM_003994chr1284396 3732 3678 3604 3510 2804 1143 380 21078 275 43829 2939 1551 1375 23919 3116
NM_004006chrX82571 2402 2366 2243 2016 1759 917 630 --21734 671 --
NM_004007chrX82571 2402 2366 2243 2016 1759 917 630 --21734 671 --
NM_004009chrX82571 2402 2366 2243 2016 1759 917 630 --21734 671 --
NM_004010chrX82571 2402 2366 2243 2016 1759 917 630 --21734 671 --
NM_004011chrX82571 2402 2366 2243 2016 1759 917 630 --21734 671 --
NM_004012chrX82571 2402 2366 2243 2016 1759 917 630 --21734 671 --
NM_004013chrX82571 2402 2366 2243 2016 1759 917 630 --21734 671 --
NM_004014chrX82571 2402 2366 2243 2016 1759 917 630 --21734 671 --
NM_004015chrX82571 2402 2366 2243 2016 1759 917 630 --21734 671 --
NM_004016chrX82485 2316 2280 2157 1930 1673 831 544 --21648 585 --
NM_004017chrX82571 2402 2366 2243 2016 1759 917 630 --21734 671 --
NM_004018chrX82485 2316 2280 2157 1930 1673 831 544 --21648 585 --
NM_004020chrX82571 2402 2366 2243 2016 1759 917 630 --21734 671 --
NM_004021chrX82485 2316 2280 2157 1930 1673 831 544 --21648 585 --
NM_004022chrX82485 2316 2280 2157 1930 1673 831 544 --21648 585 --
NM_004023chrX82485 2316 2280 2157 1930 1673 831 544 --21648 585 --
NM_004028chr1873002 2795 909 895 395 384 266 33992 3940 3901 32958 1239 598 --
NM_004035chr1754194 4167 2062 2031 326 --44917 4271 3381 3371 11688
NM_004040chr23902 875 855 1538 31267 1062 514 --
NM_004050chr14----42725 2714 2393 1919 12688
NM_004067chr751107 1002 517 456 281 --21510 433 --
NM_004080chr751474 1388 1334 504 170 11038 21230 1111 --
NM_004081chrY61539 1485 1336 684 614 258 ----1271
NM_004094chr1462053 1125 1084 1011 957 228 12153 3840 494 115 1813
NM_004109chr1152372 2224 2206 700 57 --21848 179 1489
NM_004124chr1483296 3230 3143 2821 774 699 684 577 33467 2417 74 43540 1394 429 135 2738 385
NM_004133chr8102614 2600 2565 2337 1830 928 336 301 153 106 --52581 2315 2029 366 293 --
NM_004136chr1563284 2871 2733 2348 1008 784 33162 1019 454 ----
NM_004162chr361190 1176 998 865 240 140 1426 31145 1140 463 --
NM_004171chr11168237 8147 7926 7384 5902 3739 3710 3137 2136 1454 994 956 912 874 702 233 36916 3796 2798 46050 2801 1858 1828 35960 2787 826
NM_004229chrX41811 1541 1495 386 ----1311
NM_004232chr1873916 3527 3324 1387 1367 607 74 12589 31392 666 180 23304 525
NM_004253chr96826 753 743 707 389 328 --2734 701 1372
NM_004261chr12961 715 1974 1926 1945
NM_004274chr1463216 2507 1990 770 476 129 12155 31256 692 587 32128 593 584
NM_004279chr782388 1628 941 687 533 494 303 270 --21935 853 --
NM_004311chr1032784 220 195 --12982 2402 398
NM_004326chr131066 1042 232 --2400 218 1186
NM_004329chr1051331 1215 957 485 194 1987 31013 426 218 --
NM_004331chr842190 437 155 67 --52386 1805 894 886 879 --
NM_004337chr84798 654 288 275 1299 2622 133 2619 243
NM_004338chr1896750 5376 5367 4590 4525 2431 1600 1051 882 12707 76647 6612 6156 5189 4980 469 222 16741
NM_004360chr1632022 1257 201 ----21729 1269
NM_004379chr251504 1392 1307 1170 143 --2148 83 --
NM_004384chr562259 2096 1974 1534 1433 728 11468 51823 1699 1575 1471 140 --
NM_004392chr1332594 1770 734 --11036 11777
NM_004393chr332412 2020 1598 --52333 840 264 215 209 --
NM_004397chr11104043 3593 3061 2864 1702 1555 575 447 55 35 12919 33533 1327 99 --
NM_004402chr151621 1530 452 155 53 11247 31582 1250 89 --
NM_004412chr10125473 4572 4163 2412 2352 2323 2228 1827 846 653 141 107 25331 1287 85334 4674 4376 3736 667 466 386 45 --
NM_004420chr1132282 1701 147 ----2136 132
NM_004432chr91156 11920 42304 1909 889 521 1497
NM_004438chr282772 2719 2380 2342 1162 708 222 197 23240 2949 13002 23244 1141
NM_004440chr661869 1828 1293 608 434 425 --11845 21591 1277
NM_004447chr1251084 1005 966 270 172 11063 191 --
NM_004457chr231227 626 396 11061 2620 195 11272
NM_004458chrX72616 2298 1751 1019 782 722 215 --11057 --
NM_004459chr1771910 1782 618 452 437 424 262 11944 1122 1397
NM_004464chr4174204 3875 3227 3163 2807 2764 1726 1367 1352 1214 945 860 590 541 501 470 130 12940 63241 3218 1555 888 600 358 --
NM_004496chr1471343 1189 1177 1149 1142 197 178 1351 2133 128 --
NM_004500chr1481583 1301 831 705 594 340 145 37 21562 391 21401 693 --
NM_004501chr1103952 3634 3071 3047 3010 2800 1372 1133 678 333 --11060 --
NM_004504chr2113061 2787 2667 2549 2526 2503 2019 763 480 431 269 ------
NM_004505chr1751790 1332 1316 438 105 11250 21253 525 21699 1338
NM_004506chr62537 71 --2490 58 1519
NM_004535chr2021536 1340 31544 1360 1109 1243 31185 1172 488
NM_004540chr214722 568 314 289 1863 1866 --
NM_004566chr1022415 2331 --32324 2255 355 22364 2360
NM_004571chr2183334 3240 2929 2142 2097 1161 1088 620 --32899 544 65 --
NM_004575chr471632 1608 1583 1516 1405 556 358 --11557 11533
NM_004580chr152632 309 21316 1200 11565 11298
NM_004586chrX85033 4702 4461 4106 1305 1111 694 321 --23995 699 --
NM_004598chr542834 2748 2682 2372 --3998 604 224 --
NM_004600chr161277 1217 1195 1176 1155 381 --41564 1023 618 604 --
NM_004612chr963684 3345 3185 1111 800 253 1740 33952 3722 247 --
NM_004622chr27832 650 611 488 467 338 329 12130 1114 12259
NM_004654chrY51393 1122 966 563 333 11183 21090 141 --
NM_004655chr1731392 1257 226 --11008 11339
NM_004657chr241526 1156 558 337 ----11175
NM_004660chrY82324 2161 1729 1641 1584 1442 774 291 --11753 --
NM_004666chr621282 349 11111 127 2187 122
NM_004673chr141325 606 496 215 --21066 97 2415 342
NM_004681chrY2724 202 --2149 126 193
NM_004685chr13103017 2759 2740 2721 2385 1102 1084 845 712 170 22610 757 52480 2213 2089 1193 862 --
NM_004687chr1751829 1759 1543 1500 717 ----11662
NM_004725chr1051497 1207 518 494 72 --21087 938 --
NM_004726chrX55235 4940 4811 988 619 1325 45582 2309 2259 1000 21491 329
NM_004731chr1221688 177 --5547 401 394 232 60 11845
NM_004736chr171866 1506 1473 1412 816 564 524 32111 2054 630 2799 231 --
NM_004742chr351821 1747 1662 354 88 11398 11287 1386
NM_004744chr493420 2809 1068 884 861 696 541 454 406 21520 1156 13534 --
NM_004745chr8176989 6938 6860 6838 6114 5759 5657 5602 5334 4819 4562 4279 2732 2390 2297 2240 344 16043 36658 4314 824 --
NM_004748chr15124212 3522 3480 2823 1650 1636 1587 962 321 296 257 154 --32939 1308 605 13876
NM_004755chr1451238 1201 1143 484 40 --2840 834 --
NM_004768chr15862 841 753 364 324 1154 1967 --
NM_004774chr1762837 892 636 576 513 376 --33090 809 589 13159
NM_004775chr1872396 2328 2279 2175 1785 923 422 11750 72119 2018 2002 1909 1772 447 318 1964
NM_004795chr1341690 1680 1535 23 --41643 1492 1446 28 --
NM_004796chr1432418 2330 41 --32211 1665 620 12355
NM_004801chr251384 1312 1076 1005 630 173 2976 45 1244
NM_004808chr1042851 1268 1183 39 13279 12254 12393
NM_004815chr1164423 4069 3972 3943 3904 3432 1854 1661 1610 1274 1133 1116 1032 918 529 43 1399 31615 755 367 33169 1075 992
NM_004824chr661385 1249 388 340 223 150 ----1969
NM_004834chr252862 2494 1079 697 392 13208 33183 2070 951 --
NM_004842chr641682 1333 1104 239 --21483 1452 21754 516
NM_004857chr14104582 4163 4024 3918 3769 3055 1827 1307 423 302 14120 14691 43749 3284 3280 1840
NM_004859chr1762968 1085 422 231 190 173 --2202 111 --
NM_004863chr1475103 4453 3548 3489 1369 1142 1076 1495 43330 2047 1211 262 --
NM_004866chr5144720 4403 3972 3749 3323 3240 3132 1797 1654 1474 1431 1241 399 269 --54703 4502 3575 3172 1608 13699
NM_004871chr1774335 4051 3433 3297 3129 3078 2901 23703 3244 33953 2975 1481 13248
NM_004898chr432545 1133 879 12338 22846 927 12342
NM_004904chr7126490 6465 5178 4966 4279 4263 4210 4083 4069 2271 798 299 14808 104334 4320 4177 1651 1510 1498 1138 673 652 127 14356
NM_004912chr741741 1552 1411 589 --11724 11221
NM_004921chr172591 2554 2384 2179 1880 647 110 --22367 2284 12036
NM_004926chr1431386 1187 522 21444 1166 21447 1391 11801
NM_004932chr541713 1410 1295 656 11496 41671 1499 471 196 --
NM_004936chr933039 1977 278 1964 32579 1102 36 12714
NM_004949chr18112107 1792 1757 1725 1699 1579 1451 783 682 465 324 --1756 --
NM_004956chr784474 4217 3951 3720 1835 1553 1226 212 31360 910 451 63667 581 362 180 104 84 23444 830
NM_004985chr12114366 3661 3477 3155 2827 1787 1673 1455 951 296 146 --12867 --
NM_004992chrX78528 8432 8321 5516 3017 2893 977 --47044 2950 2736 1248 15441
NM_004992chrX78528 8432 8321 5516 3017 2893 977 --47044 2950 2736 1248 15441
NM_004999chr684441 2930 2822 2791 1537 889 192 124 --11630 11412
NM_005010chr76805 691 569 420 277 205 --21898 1458 --
NM_005026chr122002 1767 21644 145 --21648 149
NM_005036chr2287973 6959 6532 6106 2432 1773 1440 1268 17216 78209 7392 6634 6629 6624 3178 498 16744
NM_005056chr1265137 2219 1439 1141 768 667 14646 24778 1934 25439 4451
NM_005057chr17688 467 360 347 331 71 21 21709 267 11809 --
NM_005065chr1485200 4841 3995 3558 1995 1488 575 333 14348 54187 1330 1130 929 163 11928
NM_005079chr893030 3007 2801 2748 1282 1046 731 708 593 21261 667 --32928 218 108
NM_005087chr32735 269 --1801 1615
NM_005095chr162010 1679 1603 1468 267 22 --41969 887 881 646 --
NM_005099chr121315 318 --1532 2330 309
NM_005116chr2094566 4488 4241 3529 3521 3077 1794 901 413 1194 44383 4377 4258 739 13480
NM_005121chr1783315 2457 2367 2321 1149 611 177 96 33118 2675 446 22328 1091 21357 1353
NM_005151chr18131912 1894 1881 1725 717 614 378 310 258 246 114 57 46 11537 12095 --
NM_005154chr152605 417 --1213 1656
NM_005156chr9145304 4462 4261 3271 1673 1620 1535 1507 1464 1182 942 792 751 362 13333 45143 3473 3468 3458 --
NM_005160chr2296432 5908 5632 5457 5102 4866 1585 1480 1440 45665 5587 2195 1633 35648 4974 2584 --
NM_005171chr1231130 1083 854 ----1102
NM_005180chr1051451 1396 1381 1248 1147 --41674 1605 1334 626 11712
NM_005188chr1197417 7278 6111 5688 2798 2447 1082 717 190 28261 3202 98278 8215 8199 8193 7693 5948 5443 2060 1180 15598
NM_005197chr1465240 4403 1541 1374 1314 261 36137 5545 4666 45353 5314 197 146 --
NM_005229chrX1490 --3959 408 277 2274 270
NM_005233chr332110 892 662 22408 181 42411 2168 642 167 --
NM_005235chr2177639 7484 7380 7028 6576 6461 6406 5930 5920 5912 5890 5149 3031 2725 2173 1632 1537 23054 1769 57298 2972 1104 654 220 17130
NM_005238chr1163591 3509 2802 1178 306 111 --43483 670 575 97 --
NM_005242chr551468 1307 1113 1106 78 ------
NM_005252chr142634 557 --3692 687 491 1652
NM_005259chr241492 1467 1285 1170 --11389 21426 1001
NM_005261chr85978 901 894 713 671 1657 1191 --
NM_005277chr441449 1292 353 178 21574 251 21800 1593 11194
NM_005296chrX3963 236 149 --4806 442 417 412 --
NM_005339chr493740 3665 3520 1725 1207 1066 998 530 65 33920 3013 1442 63323 2903 1739 1510 809 716 --
NM_005358chr1381684 1504 1445 628 468 423 379 347 11462 1555 21315 189
NM_005359chr18125897 5669 5425 5387 5052 4644 2077 1924 1846 1772 833 420 35228 4122 4074 34386 1523 620 15091
NM_005385chr382620 2536 2413 2024 859 534 290 30 --1237 1142
NM_005388chr961598 1329 1288 1198 377 114 11673 163 --
NM_005392chr961760 1750 1445 1395 1206 1196 --11815 --
NM_005399chr163830 1308 1213 1187 1015 566 --1193 11179
NM_005400chr263014 3004 2563 2190 1019 135 --52955 2589 2583 1975 999 --
NM_005433chr1872812 2746 2689 2346 2189 468 304 31981 352 294 22717 2429 --
NM_005436chr1082891 1437 1147 1119 810 580 319 102 14080 43332 2663 1064 879 11130
NM_005455chr131658 406 226 1327 41790 1762 1154 257 1346
NM_005497chr1761284 1277 1264 1201 1081 675 34560 4058 1525 33757 1959 1410 11950
NM_005502chr993181 2754 2700 2661 2379 2211 2183 1050 970 22147 1252 11152 --
NM_005504chr12106576 5616 5600 5051 4251 2244 2191 1703 807 323 42662 2556 2366 2148 55563 4747 4039 2151 862 --
NM_005509chr551693 628 485 404 29 --2734 120 --
NM_005561chr131821 --2833 827 --
NM_005578chr3164999 4817 4706 4546 4176 4123 3716 3396 1857 1626 1299 1287 1130 1008 914 420 --55091 4455 4362 3894 1758 --
NM_005596chr986235 4350 4278 4191 1586 1579 649 457 --34661 2538 990 21127 1123
NM_005598chr121272 219 11246 --71254 1250 1238 1222 1218 1214 1210
NM_005604chr652558 2334 1715 638 120 --82365 1963 1948 1899 1770 1007 930 107 1447
NM_005613chr172073 2023 1914 1855 1662 1506 494 21495 1486 ----
NM_005638chrX61766 1651 547 474 210 181 --21445 244 21442 1251
NM_005659chr22143 ----2378 123
NM_005665chr1104884 4422 4313 3664 3376 1619 1508 1084 894 493 34612 4463 1498 34864 1273 839 23732 33
NM_005668chr5104609 4547 4527 3957 3903 3007 1768 1208 1003 622 14359 53689 3244 1274 1268 975 13610
NM_005711chr531023 948 759 --3956 781 197 1900
NM_005715chr652422 2157 1832 327 180 12605 32673 2475 167 --
NM_005722chr251964 917 353 132 52 --32482 771 616 1658
NM_005739chr1552283 1876 1608 281 49 11514 --1139
NM_005746chr762603 2473 1765 1004 100 49 11053 2914 131 --
NM_005748chr1292999 2637 2401 2391 2217 638 384 245 160 1704 23078 2897 1655
NM_005756chrX196 --2461 220 11484
NM_005759chr2124461 3418 3132 1874 1826 1816 989 935 515 392 197 137 13278 13569 14132
NM_005786chr1831013 472 180 3799 508 288 1215 --
NM_005792chr164419 365 195 126 ----1515
NM_005795chr2112701 2628 2613 2580 2062 1841 1203 943 885 851 623 --62895 2585 2268 2034 1177 948 --
NM_005798chr1384743 4620 3920 3680 3615 3244 1564 1089 13691 65046 4912 4626 4010 3374 2116 --
NM_005808chr372352 930 760 747 682 476 417 --12381 --
NM_005819chr172833 2719 2204 990 981 606 298 --32461 562 465 --
NM_005822chr642352 1864 1723 783 1207 1496 1882
NM_005832chr351345 567 229 173 56 --21047 290 11231
NM_005840chrX177689 7515 6718 5950 5766 5654 5229 5074 4712 4665 3000 1196 765 642 537 507 489 15790 17062 --
NM_005845chr1361525 1383 1078 458 343 294 --41626 1140 180 125 1187
NM_005857chr171393 1225 1171 283 262 144 40 21353 511 51356 985 979 288 169 --
NM_005862chr32897 224 140 3749 674 386 1681
NM_005871chr1051085 1060 438 380 82 --1429 2901 176
NM_005875chr32268 256 ----2108 104
NM_005895chr1244026 3267 3184 986 21564 59 162 1992
NM_005898chr1152910 2841 2263 414 313 --22976 2639 --
NM_005899chr174474 312 89 51 11421 --11348
NM_005901chr18178447 8379 6678 6023 6000 3338 3136 3090 2917 2180 1755 1736 1630 1443 976 462 283 27732 513 48419 7535 2843 2252 35394 2890 1317
NM_005902chr1583403 3191 3174 2883 1586 1487 1395 959 --13257 --
NM_005903chr5105133 5064 4931 4827 4470 1843 467 304 285 111 32052 1632 718 64613 4399 1890 846 519 314 --
NM_005907chr681595 1558 612 524 276 190 145 21 ------
NM_005909chr543494 2633 1554 985 13476 13523 11425
NM_005935chr445116 3337 3288 1391 12080 34010 3716 2059 34762 1901 1619
NM_005941chr8124188 3820 3811 3283 2880 1680 1603 1565 1255 972 916 348 12770 33603 1284 715 --
NM_005955chr195446 5034 4292 3595 1587 1252 1239 553 142 15560 35271 3669 3436 11126
NM_005962chr1062145 2134 1962 568 544 537 --21587 895 --
NM_005962chr1062145 2134 1962 568 544 537 --21587 895 --
NM_005966chr242337 2001 250 227 1296 52236 2188 2128 1583 385 --
NM_005986chr1362852 2555 1965 1935 989 638 --42058 2052 1755 668 --
NM_005999chr131170 173 88 31097 257 68 11521 180
NM_006007chr943067 1510 1331 1300 23563 3281 21674 39 --
NM_006011chr1524261 4197 13253 14147 33257 3246 3222
NM_006016chr672330 2266 2200 799 453 432 232 11877 31523 811 38 11439
NM_006024chr72632 297 1348 --1250
NM_006036chr252225 1957 1753 925 440 --31922 1774 553 12096
NM_006037chr2114331 4158 3981 3889 1701 1442 1083 899 686 482 427 --21713 1433 --
NM_006047chr20143360 2767 2676 2578 2570 2406 2259 2218 2200 1093 597 522 507 467 --32778 2153 659 13044
NM_006055chr263227 2810 2743 1115 561 146 53150 2994 2053 301 169 23015 476 22557 788
NM_006060chr731726 1117 1026 13420 33373 945 193 14235
NM_006080chr742080 1946 637 315 12638 52625 2109 2034 884 787 --
NM_006089chrX61588 1200 700 580 570 293 --41544 1265 1259 1254 11771
NM_006090chr13732 129 122 --2757 650 --
NM_006095chr494424 4181 4161 3872 1651 1291 1102 895 340 23171 847 43774 3285 1405 747 --
NM_006106chr1133420 2828 339 1896 63358 1239 870 600 262 234 11338
NM_006108chr1162354 2094 1998 1746 1593 63 --1106 1669
NM_006113chr162132 1598 758 646 400 374 --11848 --
NM_006135chr121404 419 2983 518 11380 11181
NM_006136chr751282 1260 1131 167 27 1554 41224 1219 871 174 --
NM_006139chr272770 2145 1164 1143 810 616 164 ------
NM_006141chr1672655 2556 2487 2210 1964 608 144 --42286 2281 1954 863 12067
NM_006154chr1582922 2896 2617 2411 2307 1089 517 163 22339 2104 22817 2221 12768
NM_006157chr111287 --2388 342 1385
NM_006166chr12112448 1976 1868 1683 1670 561 524 511 438 321 289 --3887 793 417 11716
NM_006180chr982133 1973 1967 1891 1871 1548 1320 666 ----1543
NM_006197chr841924 590 424 134 --21761 239 12028
NM_006203chr5125359 4900 4111 3738 2001 1781 1227 792 668 600 322 282 1883 94633 4423 4297 4292 4287 4282 1404 1157 351 --
NM_006206chr442254 1917 635 70 1616 --12713
NM_006224chr1731804 1775 1573 --2392 320 12489
NM_006226chr231378 884 365 --11264 21247 343
NM_006237chr13--21812 1454 2733 543 22015 1816
NM_006241chr361994 1612 1509 944 920 380 --22291 342 --
NM_006251chr582680 1275 1179 1087 1013 365 201 190 --43217 2461 2442 861 --
NM_006252chr1157436 7259 7248 7175 7015 6014 4839 3019 1800 1386 1374 1305 1016 963 116 66585 2135 1411 764 480 174 87614 5257 4672 2749 1379 911 817 430 15409
NM_006256chr182753 2534 1788 1724 685 591 570 119 21701 1013 22592 67 --
NM_006267chr241901 1469 1240 1213 31798 470 452 --11219
NM_006275chr2062159 1849 1741 941 634 367 1268 21790 355 11759
NM_006282chr2044383 4129 3816 1672 14291 --13613
NM_006283chr8124976 4739 4212 3937 3789 3759 3581 3408 3310 1786 1763 935 1885 23213 1375 1429
NM_006287chr282609 2477 2167 2089 913 230 203 106 1768 12525 32276 1036 256
NM_006299chr6--1226 1240 1237
NM_006306chrX105920 4498 3986 3711 2029 1460 885 545 534 525 --11292 1551
NM_006313chr122686 590 21461 353 31210 633 356 21712 1465
NM_006315chr464052 2947 2838 1721 622 409 14312 32941 2873 1372 --
NM_006330chr8111560 1528 1241 1201 1158 1131 627 545 413 313 304 21590 1517 31109 612 593 --
NM_006359chrX52231 1836 610 481 404 --22469 2434 12466
NM_006364chr1431007 437 307 --41269 511 201 56 --
NM_006371chr395070 4997 4342 4280 1988 1055 1032 746 686 24512 2038 11709 --
NM_006379chr732001 1730 252 1759 42113 1894 1669 762 21444 242
NM_006380chr17124316 4260 4089 4052 3960 3746 1655 1603 1235 1159 972 776 11276 21164 288 1818
NM_006393chr1073542 3316 1786 1268 611 97 29 11665 63173 3019 1755 1706 1256 604 --
NM_006420chr2052590 2487 2122 292 184 --52655 2548 2336 913 234 22443 890
NM_006425chr551179 1049 645 628 93 --31544 262 238 2259 255
NM_006434chr1063271 3197 2984 2561 769 27 13259 13188 33185 2837 941
NM_006449chr252092 1967 719 671 629 --12166 1403
NM_006451chr53677 212 171 --2734 411 1712
NM_006457chr473945 2926 2650 1012 927 831 197 13637 53586 3116 2955 2605 1623 --
NM_006466chr205828 663 386 224 21 2768 372 --1152
NM_006467chr562127 2071 1872 1737 1707 917 12303 62314 2291 2267 759 448 75 12231
NM_006482chr1273903 3394 2714 2681 2425 1356 112 --43412 1247 157 91 --
NM_006489chr1462038 1826 1791 1726 1650 667 --21763 1672 21860 1832
NM_006496chr131945 1874 430 --52030 1399 413 405 358 --
NM_006526chr2052054 1929 1525 1358 348 1871 32098 2078 1396 22149 515
NM_006534chr2073152 2459 2088 1245 1042 545 148 --33087 2490 579 1725
NM_006538chr242650 1413 900 568 22884 1634 43897 2872 1291 479 --
NM_006544chr14195733 5361 5315 4691 4444 4275 4193 3932 3922 3701 2138 1891 1883 1831 1617 804 756 702 478 14633 75761 4814 4255 2359 2033 1463 971 35055 2091 172
NM_006546chr1756539 2639 1667 1330 498 --56655 2416 2392 1798 390 --
NM_006547chr731592 1406 848 12147 22107 479 1858
NM_006561chr10166206 6137 5351 5297 4477 3878 1673 1666 1284 1165 996 338 299 283 73 31 24526 4517 25372 4529 --
NM_006572chr17103424 3340 3136 2936 2856 2655 2165 1097 1081 1017 23252 2622 22846 1026 --
NM_006577chr231130 894 245 --31043 451 363 1985
NM_006578chr1551829 531 511 342 91 --21270 360 --
NM_006599chr16207953 7907 7631 7587 7424 7067 6904 6761 6474 6090 6031 3049 2915 2761 2402 2171 1431 519 381 275 47012 5049 3072 1884 98167 8015 7133 7128 6651 5060 1948 1536 648 38006 2456 1533
NM_006603chrX61544 1392 1286 436 273 36 11316 --2359 240
NM_006609chr262397 1984 1877 447 309 48 12008 42699 1901 746 611 11890
NM_006614chr373653 3121 2583 2538 1265 1180 494 2523 451 52735 1343 945 821 648 --
NM_006620chr694784 4082 3794 3442 3388 3038 2982 1094 991 24470 606 1812 31331 975 971
NM_006624chr1042053 1325 593 217 ----22126 1308
NM_006626chr9102655 2528 2141 2048 2037 1851 1839 1729 998 646 22396 2387 3803 606 518 42608 2534 811 672
NM_006628chr15114429 4104 4034 4004 2856 1532 1422 319 96 84 42 1359 63761 3432 3427 1026 937 75 --
NM_006646chr1372547 2338 2306 2208 2144 2103 587 --22477 2420 --
NM_006654chr1284732 4468 3557 1760 953 879 667 192 14544 53735 1001 466 75 69 11052
NM_006699chr162562 2442 2355 905 870 625 12093 22737 2418 1959
NM_006710chr24957 836 207 85 --21100 383 21097 911
NM_006717chr962923 1258 1088 715 364 50 22539 276 73274 3256 2915 2731 2725 2376 800 22230 590
NM_006722chr352109 939 690 479 313 --102504 2473 1992 1215 918 893 833 828 753 149 12470
NM_006727chr51139 1121 2534 484 1197
NM_006729chrX95578 5435 5119 4725 4275 3925 2038 1306 247 24362 556 34466 3531 901 32099 857 727
NM_006731chr985790 5566 4796 3588 989 829 607 247 --44510 1839 835 535 24734 1000
NM_006735chr7----4305 91 84 72 --
NM_006738chr1533424 3204 633 --54497 2977 1567 638 371 24596 1613
NM_006746chrX91225 996 592 534 516 253 223 91 72 --21180 973 1552
NM_006750chr16136646 6553 6252 6173 5688 5234 2883 2582 884 841 316 239 232 --117740 6665 5444 5144 2964 2953 2260 799 769 326 272 --
NM_006766chr842208 687 476 402 --72331 1654 465 353 180 142 137 --
NM_006775chr673112 3061 2916 2681 2543 2129 1163 --42553 1119 1045 724 22206 2109
NM_006777chrX82901 2832 2349 2336 2108 1898 1101 630 1233 11020 --
NM_006793chr108727 707 597 588 515 205 84 69 ------
NM_006868chr1833179 2401 852 --22761 2049 1496
NM_006873chr293004 2451 1405 1041 975 959 912 858 617 1543 32690 1364 358 --
NM_006885chr16103496 3428 3342 3144 2580 1238 1175 992 974 499 --21313 1150 11321
NM_006888chr1443319 3085 3076 2839 13104 --23501 99
NM_006915chrX102468 2432 2273 1720 966 918 801 662 396 296 1154 32374 179 123 --
NM_006918chr11125849 5797 5779 5417 5126 4943 4785 4346 3689 1552 362 118 64502 3818 1444 1403 753 740 35131 1618 1524 25301 4561
NM_006920chr261773 1637 1311 764 724 435 11259 42083 1811 1453 1448 21720 1263
NM_006922chr2102007 1742 1702 1682 1645 927 721 681 410 215 --12001 --
NM_006924chr17124357 4118 3810 3398 3009 2823 2704 1586 686 600 430 54 --33389 901 73 --
NM_006931chr1221524 737 --4594 477 241 190 1474
NM_006940chr1261850 1772 1752 1382 1337 666 --2752 493 --
NM_006948chr2152316 2249 1668 822 24 12177 2636 631 22146 2142
NM_006981chr951960 945 660 646 86 --32884 2503 525 --
NM_006996chr1101894 1866 1635 1437 1384 1154 594 577 476 310 3713 646 205 31532 649 192 --
NM_007006chr16113555 3097 3077 2970 2621 2592 2305 2191 701 372 307 33417 1063 659 33544 2821 261 1202
NM_007007chr12124679 4446 4161 3603 3514 3202 1798 1749 1081 957 459 258 --74192 3438 3219 1625 974 210 185 --
NM_007011chr15126801 6764 6118 5992 5843 5180 1904 1324 1167 1139 792 385 --12693 12065
NM_007013chr861005 707 685 337 248 87 ----1178
NM_007023chr23916 817 180 1940 3988 943 245 2994 985
NM_007034chr12742 119 --2216 211 1773
NM_007039chr1451647 806 765 588 516 1740 21865 395 1687
NM_007043chr1272053 1907 1618 1443 1372 569 77 1649 ----
NM_007049chr631078 978 928 --1865 1948
NM_007084chr1341252 1180 974 220 11128 41549 1402 1275 528 --
NM_007106chr1352608 2039 2021 799 382 --31724 1074 198 11747
NM_007111chr133793 738 562 1829 3672 281 251 1225
NM_007114chr383017 2559 1143 1083 1002 801 269 174 32746 1192 1158 83169 3030 2280 1007 626 240 224 197 1745
NM_007124chr621493 761 2793 483 3796 658 445 --
NM_007125chrY51448 1279 1074 377 32 --2983 320 --
NM_007146chr1782773 2400 2357 2329 1029 461 354 105 --12894 --
NM_007157chrX122906 2691 2580 2527 2488 2437 2189 712 548 519 91 41 1228 --22765 992
NM_007159chr321529 195 1309 21521 365 11235
NM_007166chr1141436 1420 1227 316 --11402 1551
NM_007174chr1272339 2327 2129 1510 667 606 495 ----11957
NM_007175chr893567 3281 2877 2442 1202 754 691 538 348 --63522 3310 2587 2545 193 47 --
NM_007185chr12884 872 1989 --1993
NM_007187chr132302 110 1276 1164 1796
NM_007195chr1883595 3555 3331 3094 2563 2484 64 46 --63381 3079 3069 2879 2873 2328 --
NM_007200chr1533424 3204 633 --54497 2977 1567 638 371 24596 1613
NM_007212chr131794 697 556 --1804 1162
NM_007222chr841372 713 645 498 1513 41795 1354 1337 1235 --
NM_007238chr2064429 3541 1410 1266 858 333 ----11218
NM_007249chr13179032 8026 7356 6697 6427 5817 5791 5747 3769 3709 3591 3479 3389 3156 2668 1819 1224 18327 88942 8902 8128 7768 5700 3635 1412 645 --
NM_007287chr353144 2168 561 538 214 1574 42173 577 453 265 --
NM_007288chr353144 2168 561 538 214 1574 42173 577 453 265 --
NM_007289chr353144 2168 561 538 214 1574 42173 577 453 265 --
NM_007292chr1754194 4167 2062 2031 326 --44917 4271 3381 3371 11688
NM_007331chr462693 2529 2504 2378 803 656 --32498 1983 182 --
NM_007345chr1832121 2091 1627 11886 32034 1889 1776 --
NM_007347chr15123193 3163 2906 2549 2532 2044 1115 961 696 663 625 591 23150 61 43172 2966 2192 297 --
NM_007358chr161810 1553 1456 1302 740 558 11437 61945 1815 1485 1318 1258 423 --
NM_007375chr192789 2656 2349 2282 2194 1826 1798 578 550 --22695 710 1528
NM_012073chr531001 266 205 181 11584 21581 1364
NM_012081chr563594 3557 3411 3286 2638 965 22979 45 11228 149
NM_012082chr84271 240 149 114 --1205 1248
NM_012089chr1101510 1384 1302 1235 481 374 291 229 177 103 --11524 21053 1035
NM_012095chr1082954 2496 2464 1340 1290 757 732 205 ----11305
NM_012096chr373671 3543 870 767 685 387 119 32838 2284 345 23679 3313 --
NM_012104chr1172730 2530 1513 1213 1120 899 874 12963 11250 --
NM_012104chr1172730 2530 1513 1213 1120 899 874 12963 11250 --
NM_012120chr6102936 2928 2906 2361 2116 1936 896 316 300 204 21176 1117 ----
NM_012129chr762524 2133 1866 1582 1001 962 32241 1531 253 2978 426 --
NM_012137chr162548 2342 1023 947 892 151 42727 2539 316 285 12792 --
NM_012141chr13123773 3436 3115 3033 2885 2622 2568 1138 1090 435 150 27 1570 53553 2720 182 172 84 11044
NM_012161chr441082 856 741 414 1294 1470 133
NM_012164chr9157444 7042 6543 5884 5778 5196 2921 2893 2638 2621 2208 2201 1704 1208 184 25257 132 46223 2877 1446 230 16411
NM_012193chr111617 --64513 4354 4349 1148 733 30 11677
NM_012214chr2176227 5778 5500 5073 4631 2546 2536 2031 1946 1835 1778 1145 1096 962 454 365 131 26294 5850 66297 5980 5853 5043 4745 77 16050
NM_012219chr373220 2390 1245 830 461 446 306 --1886 --
NM_012223chr251138 366 351 152 78 --21094 68 1973
NM_012224chr481226 1152 1139 998 841 441 238 199 195 21200 847 199
NM_012234chr373706 3333 3166 2429 1425 890 512 1238 13442 1381
NM_012238chr1051777 1603 1371 502 166 --31504 1305 280 11199
NM_012249chr253378 2612 2593 1257 553 --21157 222 23187 2868
NM_012252chr7185281 4827 4412 4310 4118 3738 3418 3385 3375 3275 2012 1979 1162 1078 631 387 287 94 24239 3831 35254 3894 3889 23310 1193
NM_012259chr631134 914 904 --21291 947 11198
NM_012262chr175263 4697 4106 2057 1145 786 491 23967 1079 44215 1712 1448 199 14333
NM_012281chr782386 2316 2189 2129 2004 1874 1597 703 1711 ----
NM_012287chr394405 4136 4119 3001 2912 2898 749 529 205 11824 44221 3725 1028 673 --
NM_012290chr261525 1390 1168 664 578 166 1393 1302 --
NM_012294chr753627 2658 2647 804 359 --33611 3050 1395 --
NM_012297chr472515 2396 2065 2033 663 162 108 --12414 --
NM_012309chr1163666 3317 3094 1871 1549 1542 14989 1704 14272
NM_012316chr154266 4067 3996 1231 396 25576 557 55444 5434 883 345 339 --
NM_012323chr22----11544 21541 1052
NM_012328chr791439 1415 1199 1082 1068 1057 929 584 196 ------
NM_012329chr1751185 622 519 208 35 --21598 1419 11627
NM_012330chr1021755 653 11353 31600 1513 218 1132
NM_012334chr5104777 4612 4425 4269 3526 3452 1450 949 746 171 13493 22987 1250 --
NM_012345chr1321369 1296 1506 31552 1441 258 11780
NM_012347chr652037 790 503 206 162 12235 1429 1216
NM_012382chr5124444 3760 2871 1693 1534 1392 1187 1128 741 502 439 22 13199 41539 843 697 483 --
NM_012388chr1572607 2476 1942 551 423 362 228 1249 23004 2573 --
NM_012399chr2231525 757 488 --21291 634 11299
NM_012405chr163382 3014 1189 997 904 100 --43146 2648 886 481 33805 3401 446
NM_012420chr1091876 1847 1605 1592 769 646 110 92 72 --143 --
NM_012425chr1072703 2641 1686 585 409 400 55 --31996 642 112 1549
NM_012454chr66549 414 167 158 99 37 --2563 453 1395
NM_012463chr1251528 468 332 260 102 ----1349
NM_012464chr4102900 2878 2833 2772 2736 2558 2186 1990 868 567 --21041 1020 --
NM_012465chr1053464 2772 1232 779 468 --33370 3314 2851 12265
NM_013231chr1454416 3413 3279 928 909 11012 23378 1419 --
NM_013233chr261396 503 413 403 266 205 21329 354 1549 --
NM_013246chr111921 1905 1891 1888
NM_013254chr123653 584 495 --2602 500 --
NM_013255chr7177834 6890 6826 6360 6311 6138 3265 2671 2579 2014 1508 1479 1131 1085 1030 504 416 47957 7745 3364 2607 138875 7815 6325 6255 5698 3367 2741 2155 2051 1968 985 942 332 46519 2902 2131 982
NM_013257chr882308 1859 1600 947 911 567 221 104 1581 22215 1869 --
NM_013259chr3--1255 1274 4271 267 263 259
NM_013261chr453710 3020 2670 2435 243 --33032 3026 1109 12358
NM_013269chr1264099 3375 3347 2776 2744 1400 14253 33227 1405 82 1465
NM_013286chr353162 3118 490 110 51 --33795 267 120 --
NM_013293chr74607 597 203 172 1638 --1124
NM_013302chr1654322 2870 1861 1851 1789 21465 80 74683 4466 3486 1518 613 607 138 --
NM_013309chr1542596 645 401 284 22410 33 21716 547 1676
NM_013322chr761731 1652 1473 305 170 144 --11251 --
NM_013341chr282930 2767 2639 1867 938 651 283 129 --42920 2854 1949 135 --
NM_013354chr861444 1423 1370 1127 940 124 --4355 313 27 21 --
NM_013372chr1563013 2483 2447 2417 2178 1064 23230 2745 22944 586 --
NM_013374chr373091 2413 2209 2117 791 551 397 --42984 2913 1248 698 13102
NM_013381chr1282305 1738 1616 1497 619 572 389 180 --2172 145 --
NM_013386chr171659 1652 1509 1274 1199 629 519 --61370 1351 1159 697 590 341 11434
NM_013396chr2131281 1041 241 --1111 1426
NM_013437chr8111417 1312 1282 1086 995 935 507 366 316 305 53 --31032 476 240 11212
NM_013438chr931784 369 229 --5471 300 81 76 36 --
NM_013444chrX61135 360 349 261 197 38 --2434 96 --
NM_013448chr142635 523 ----1540
NM_013449chr1232558 2036 1119 1376 32528 1835 280 --
NM_013450chr231240 979 167 1435 5795 464 401 381 22 11190
NM_013943chr182803 2235 2152 1322 1142 1108 819 185 12998 72896 2723 2474 2130 2108 832 808 12504
NM_013989chr1452055 2013 1375 520 279 13301 33430 1860 1855 --
NM_013996chr7123 191 3495 137 34 195
NM_013996chr7123 191 3495 137 34 195
NM_013997chr7123 191 3495 137 34 195
NM_013997chr7123 191 3495 137 34 195
NM_013998chr7123 191 3495 137 34 195
NM_013998chr7123 191 3495 137 34 195
NM_014005chr532172 374 182 1206 22773 470 41180 1060 210 99
NM_014016chr33392 374 277 21526 357 21684 1297 --
NM_014021chr183507 3253 2993 2897 2620 1083 423 26 --32385 1088 758 --
NM_014023chr1062855 2792 2775 2735 2654 646 ----12485
NM_014028chr6113195 3033 1061 841 790 772 731 706 659 526 273 12434 31187 671 278 23084 1218
NM_014034chr661488 1178 1080 428 252 209 --1214 --
NM_014048chr16124931 2032 1832 1573 1537 1515 1311 1270 1223 1144 579 170 --24137 600 14688
NM_014057chr981520 1502 1458 1392 1230 639 524 109 ------
NM_014089chr1372266 2086 1950 1726 1654 1593 45 11928 --11851
NM_014106chr1562630 2517 1834 565 78 44 52846 2622 2432 1100 63 82215 2187 2099 1182 1103 884 429 314 --
NM_014112chr8115005 4323 3357 2190 1948 1907 1823 1548 1485 1440 1109 14964 105418 5394 5389 5384 2196 2096 1378 1006 795 733 11003
NM_014117chr1662146 1734 1688 912 636 302 --1335 --
NM_014141chr762140 1414 983 716 546 293 11306 25098 4932 25316 1994
NM_014155chr11127442 7203 5542 5491 5364 4727 4720 4693 1776 1190 818 102 15381 117551 7046 5967 5802 4881 4762 2084 1608 1423 1417 438 --
NM_014181chr242721 2420 872 219 42863 2622 1841 534 12726 1538
NM_014212chr122998 47 --470 63 57 52 --
NM_014253chrX62456 2291 2276 2028 792 64 1817 11850 --
NM_014268chr1831392 1237 559 --41350 1309 1303 283 --
NM_014319chr1291995 1845 1814 1388 1212 663 263 195 103 134 1485 --
NM_014331chr4176745 6310 5969 5861 5816 5731 5153 4920 4889 4866 2857 2593 2471 727 695 675 123 36433 2711 1803 87359 6828 6608 5138 2407 2162 478 68 12404
NM_014333chr1132656 2241 1857 12129 61888 1873 474 354 232 209 21979 1826
NM_014344chr112804 635 --3821 798 781 --
NM_014350chr521024 865 --51130 383 165 148 38 11002
NM_014351chr2231071 558 458 11172 2445 380 21397 75
NM_014363chr1371253 1223 1188 467 436 78 68 ------
NM_014368chr922133 528 1357 --22016 390
NM_014372chr191967 1827 1741 1468 1413 786 526 434 348 --11344 1597
NM_014376chr522567 941 --22284 2193 12431
NM_014381chr14112588 2439 2325 2295 2284 1308 1209 1094 581 321 214 1274 1219 12301
NM_014382chr371652 1515 1239 1160 530 419 108 2258 55 51761 674 668 354 22 --
NM_014388chr1114865 4618 3702 2387 1693 1480 1085 1054 722 320 299 1624 1782 11867
NM_014392chr431557 264 68 1105 --21574 243
NM_014393chr84740 179 169 35 31490 1474 123 32245 2186 1638 --
NM_014395chr421934 704 11320 21985 571 11913
NM_014396chr762258 2181 2032 1974 1931 538 1236 22130 239 12175
NM_014415chr341100 579 404 352 11555 3549 434 331 --
NM_014423chr5125062 5030 1841 1819 988 878 861 844 684 560 439 358 33617 2056 202 65285 5046 4018 1539 1392 309 2419 306
NM_014432chr671002 441 408 347 315 283 130 --11068 --
NM_014447chr431587 1112 632 --21380 436 21627 594
NM_014456chr1051681 1343 664 462 273 ----1377
NM_014458chr171329 1077 1032 910 543 382 99 11386 2238 199 1324
NM_014462chr81131 --1121 1304
NM_014504chr73779 765 190 --3554 145 27 21857 214
NM_014548chr1531305 633 97 21045 159 2194 102 --
NM_014572chr1351814 1478 1380 339 272 11768 1510 --
NM_014574chr1441582 1551 1004 496 --31271 1190 973 --
NM_014584chr1431397 559 61 --31351 1325 1185 21568 1416
NM_014606chr441150 576 95 33 11346 31521 991 980 11080
NM_014607chr221690 122 31745 1358 276 22144 1361 --
NM_014615chr1683580 3421 2829 829 651 509 277 55 --21077 518 --
NM_014616chr383156 2897 1372 1358 1113 576 535 447 1590 23188 2159 12279
NM_014630chr1553989 2972 2852 2813 1325 1221 13129 --
NM_014636chr974329 3321 3235 3002 1662 1315 572 --24099 1296 13327
NM_014666chr541351 1283 1078 213 1836 31303 871 866 --
NM_014670chr221073 318 11413 41424 1206 1186 135 1509
NM_014671chr741527 1471 164 122 31561 1178 184 31568 1415 556 11565
NM_014674chr364021 3996 3710 1311 736 388 --43757 2930 575 399 13754
NM_014677chr811299 --21199 950 1354
NM_014682chr862023 1544 745 524 387 253 2760 222 92110 2058 1718 1538 763 396 246 225 137 31986 1784 315
NM_014683chr1771876 1829 1812 1554 1486 845 605 11395 11794 11435
NM_014701chr1543373 3007 643 227 33173 1198 763 11265 23225 2178
NM_014702chr683414 3112 2976 2595 2480 2315 738 653 22881 979 42853 2815 2787 833 1424
NM_014707chr752195 2033 650 304 169 --31939 1874 661 --
NM_014711chr1662048 2025 1593 435 118 32 --32082 2068 243 22005 54
NM_014721chr6167420 7242 6661 4926 2905 2430 2290 2206 1802 1657 1622 1560 1421 1048 602 424 26975 4971 35345 1974 1502 27317 1663
NM_014729chr852016 812 501 176 93 1765 2702 552 12079
NM_014730chr1264226 1794 1669 799 723 294 --24631 1325 11178
NM_014730chr1264226 1794 1669 799 723 294 --24631 1325 11178
NM_014739chr6124072 3508 3387 3230 2933 2831 2790 2568 1006 642 426 355 11658 21298 941 --
NM_014743chr463091 3023 2766 1972 984 153 12527 33201 2420 2099 --
NM_014746chr283586 3551 1590 1572 1458 1057 850 456 13686 43802 3561 1565 1147 --
NM_014755chr233582 1593 368 23061 410 43238 3091 1076 548 --
NM_014757chr562271 1521 615 428 49 32 ----11981
NM_014758chr1162434 2303 2262 1977 980 478 --32485 1983 200 22309 755
NM_014765chr162673 2554 1965 786 255 208 11989 32521 1954 168 1165
NM_014776chr1293128 3076 3031 2770 845 411 283 192 142 1610 1571 --
NM_014779chr31236 --2779 430 3996 442 427
NM_014781chr83999 801 501 31109 828 140 2270 160 --
NM_014783chr151226 11162 31550 168 135 11166
NM_014795chr271172 1127 1093 990 889 869 404 --21181 1014 31011 978 951
NM_014797chr673062 2462 2321 2187 871 431 390 --32958 985 235 12047
NM_014806chr9------3476 472 468
NM_014810chr153361 2975 2482 1170 211 --41011 856 518 513 --
NM_014812chr131971 1958 1907 11941 41944 1913 787 143 31763 140 136
NM_014819chr5102516 2469 2444 2346 2262 2207 2113 1948 1567 410 --12243 --
NM_014820chr32200 127 --21856 1396 11518
NM_014824chr1152009 1798 1553 208 196 --11852 1656
NM_014826chr1124195 4123 3489 3299 2956 1686 1488 1228 1081 950 738 234 --34200 4059 4037 --
NM_014828chr142698 546 12308 --11545
NM_014829chr542210 1893 1770 382 --12085 22082 782
NM_014830chr1253487 2917 1466 740 244 --42785 2751 2746 1506 23921 1503
NM_014836chr1031703 1581 281 --52010 1955 1473 1467 402 --
NM_014838chr2272451 1916 1128 1087 611 339 197 --32890 2474 1079 --
NM_014839chr132296 828 552 --1419 1760
NM_014848chr1542830 2714 2111 1963 --2719 647 11830
NM_014858chr1--1276 31037 998 775 2772 768
NM_014860chr251998 1748 1718 986 682 1572 41644 799 632 451 1438
NM_014864chr133541 3284 949 14226 24229 3873 13108
NM_014873chr194553 4508 4191 4181 3831 3690 683 482 67 --74625 4604 4572 4422 3859 919 837 13354
NM_014877chr17177354 7230 6502 6308 6228 5074 4910 4886 2529 2456 2379 1325 982 700 450 381 180 12248 47595 4829 4800 1727 36876 5464 467
NM_014897chr1783000 2897 2764 2367 1157 1070 943 573 --21173 556 --
NM_014898chr1942300 427 325 223 1358 --21748 128
NM_014899chr562718 2663 2159 1254 134 35 11191 23044 758 13050
NM_014903chr1212387 12486 2769 200 1902
NM_014904chr10113702 2771 2754 1623 1558 1345 1264 1200 811 121 104 23884 195 43297 2609 2495 837 12846
NM_014906chr17104085 4072 3767 3445 2668 1309 1013 692 339 97 1743 21645 1196 --
NM_014912chr10163391 3328 3316 3166 3159 3075 3022 2803 2709 2322 2244 999 977 400 138 104 1155 83381 3372 3226 3221 3034 2307 1190 606 --
NM_014918chr1541542 1114 1106 525 11218 21252 46 21461 1161
NM_014920chr683470 3426 3366 3168 2838 759 240 214 33377 2784 441 63173 2968 2395 1420 1413 1131 13676
NM_014923chr1392342 2229 2210 596 491 478 172 124 60 11925 139 11678
NM_014936chr632854 956 893 22560 971 22778 2259 22219 1899
NM_014937chr103390 241 112 11293 --137
NM_014942chr682389 1935 1866 1746 1635 698 607 228 --1895 1625
NM_014946chr252149 1195 1096 1003 942 --62460 834 628 562 498 485 12160
NM_014947chr183054 2876 913 873 834 823 806 441 22413 533 ----
NM_014950chr1451735 1680 1249 1138 1123 31208 1104 641 11107 --
NM_014951chr1052307 2120 2105 660 188 21850 1815 32436 1818 619 11976
NM_014953chr1384365 4283 3926 3619 3309 626 531 140 41089 342 282 202 22642 368 --
NM_014962chr20112703 2579 2513 2494 2137 1886 909 736 512 389 354 12792 11044 12423
NM_014964chr1722452 759 32428 783 696 1471 1921
NM_014969chr121190 926 11051 31072 1016 976 11069
NM_014977chr142531 215 --2523 517 --
NM_014982chr1494629 4567 4388 4318 4209 4081 3964 1992 706 1637 85444 3877 3515 1779 1253 1166 1130 328 43868 1003 610 409
NM_014988chr452755 2466 1895 774 178 --12281 12744
NM_014989chr62501 392 51838 1828 1485 690 154 41672 678 463 438 11269
NM_014990chr142911 417 31030 522 355 2366 288 --
NM_014991chr4103198 3039 2826 2788 2640 2499 1023 635 346 322 22843 1234 23294 2661 12537
NM_014999chr1231537 1421 90 --21459 1265 2656 629
NM_015000chr12102955 2669 2651 2617 2519 1071 900 828 224 206 1368 32942 2862 1018 12859
NM_015008chr382811 2768 2672 2621 1396 837 494 218 12261 42842 1363 1307 892 --
NM_015011chr1361112 1033 881 459 403 383 1242 1435 --
NM_015017chr1137 1114 41033 126 100 91 --
NM_015020chr1663646 3110 1545 886 783 621 --52456 2383 905 276 99 13157
NM_015025chr272537 2457 2009 1062 700 537 461 12506 62652 2570 2481 1003 554 91 --
NM_015026chr12224572 4404 4290 3505 3453 3325 3284 3253 3224 3089 3000 2978 2923 1879 1749 1654 1431 1268 848 692 591 372 24250 1573 44025 3877 3078 1058 31627 1312 544
NM_015027chr1661630 1616 1376 741 369 253 --31825 1801 1604 --
NM_015032chr1352198 1017 817 474 349 --42511 2152 2123 1784 11842
NM_015039chr124265 947 --33425 2974 495 2969 492
NM_015040chr263026 2300 926 539 531 496 23364 2617 22344 82 --
NM_015045chr1051838 1705 623 473 306 --22150 1677 --
NM_015051chr9113149 3051 2488 2347 2283 2194 1317 1202 1158 932 409 1168 22494 100 --
NM_015057chr131191 1463 1447 1583
NM_015068chr763918 2742 2615 1582 240 43 23675 3536 23438 2668 --
NM_015070chr131106 1121 31353 1185 157 --
NM_015074chr154551 4321 3476 1476 61 14399 34817 4804 4542 1695
NM_015076chr664302 3953 3163 1220 1141 170 --14521 --
NM_015087chr1392687 2403 2268 2262 1880 1086 861 769 113 --32480 2324 225 --
NM_015092chr1674342 4126 3630 3056 3009 1275 853 24046 845 21169 725 --
NM_015093chr621779 688 11862 31702 1350 380 --
NM_015094chr2294703 4688 4371 4188 4175 1816 1775 910 661 --23390 1026 --
NM_015097chr372225 1906 824 764 425 401 269 12189 41694 777 138 133 22339 673
NM_015110chr992457 2314 1825 1624 1596 833 588 491 105 --1775 1781
NM_015115chr4122955 2918 2876 2672 2093 1181 1155 1142 621 586 537 316 12498 62793 2399 1973 858 652 392 12062
NM_015130chr451320 1226 1148 371 104 --21270 237 --
NM_015132chr761691 1602 1481 1316 668 648 1772 130 --
NM_015137chr842409 1814 924 267 --11894 1908
NM_015144chr1663943 3240 3070 2802 2561 172 11051 33275 2769 1427 --
NM_015149chr151468 886 760 225 120 --1504 22075 2071
NM_015155chr1083257 2860 1266 1213 1154 1123 301 208 11230 13242 11299
NM_015156chr1453894 1457 924 907 414 22466 662 23995 3972 12746
NM_015163chr1441992 1887 1692 1470 11663 --41684 737 733 290
NM_015170chr852020 1813 1605 411 309 --21642 840 --
NM_015191chr11102773 2100 1933 1916 1867 1798 944 338 87 60 --12404 11922
NM_015192chr2082261 2239 1938 1078 895 780 587 341 32927 2398 406 22675 928 2925 545
NM_015206chr1573584 3093 2990 2969 2925 2915 539 13621 12882 11210
NM_015208chr18113407 3226 3196 2983 1055 638 522 456 362 169 148 43499 2611 882 215 ----
NM_015209chr132345 2091 292 --22159 804 22214 796
NM_015213chr111244 --1171 2691 687
NM_015215chr192819 2447 2438 2308 1123 1087 546 526 461 --33048 562 57 --
NM_015226chr163877 713 575 --2477 447 1637
NM_015230chr461505 1457 1439 584 496 31 21868 1618 41871 1354 652 192 --
NM_015236chr441338 1301 942 249 --11359 11356
NM_015245chr622737 952 12536 11988 11913
NM_015247chr1685182 5106 4162 1911 910 712 444 394 24051 1941 55235 5229 4880 4852 1422 34877 4083 4079
NM_015251chr1642224 1991 1802 692 12156 --12374
NM_015252chr25903 821 750 342 332 ----2929 198
NM_015265chr252544 2421 2278 1761 315 11072 42313 621 119 57 11026
NM_015271chr464119 3664 3100 1712 335 131 11081 --1417
NM_015272chr1681917 1782 1376 863 686 671 469 441 --3338 175 167 --
NM_015275chr12101772 1696 1669 1558 1503 1378 792 564 361 158 --11966 --
NM_015277chr181540 --2504 402 11272
NM_015278chr673247 3108 2552 2353 746 475 241 --32374 591 247 23382 1139
NM_015288chr573641 3567 2358 1480 1426 367 356 --43592 2936 2463 131 --
NM_015291chr153508 3418 3031 1178 225 --32539 2342 1315 23063 2203
NM_015296chr135954 396 344 264 164 ----11189
NM_015310chr8128320 8238 8121 7801 6638 5807 5560 5165 3229 3097 1179 700 35230 2185 1695 58115 5972 5433 2635 1550 11683
NM_015313chr1194184 3789 3736 3618 3377 3056 1573 886 355 --83975 3652 3008 891 851 387 346 250 11712
NM_015314chr762298 2267 2132 1876 551 493 --42426 655 564 408 --
NM_015317chr252062 1078 450 131 122 1622 22192 880 --
NM_015323chr661636 1403 1078 707 567 258 21748 1464 41591 1395 488 361 --
NM_015328chr752162 1132 786 667 270 2540 138 11015 22649 142
NM_015335chr1232248 2175 169 --52263 2253 644 607 594 32524 2031 604
NM_015336chr1262586 2462 2298 1713 379 155 11943 32548 2492 1794 12565
NM_015339chr201147 --31022 1005 273 1949
NM_015344chr892013 1687 1554 1529 760 645 342 140 43 21430 415 11613 1752
NM_015349chr692622 2572 1924 1151 486 476 377 254 73 --52980 2878 2860 1047 293 1990
NM_015352chr2043836 3786 3427 3254 --13804 13825
NM_015355chr1781694 1654 1505 1266 536 304 197 167 --11990 --
NM_015358chr2141060 959 866 277 --31222 1125 1090 --
NM_015361chr24865 830 741 272 ----1589
NM_015365chrX63912 3751 2982 1027 951 201 24312 701 73782 3637 3583 3527 2937 2839 1488 --
NM_015375chr164948 4749 3498 3371 81 36 13920 24567 3898 --
NM_015385chr1063271 3197 2984 2561 769 27 13259 13188 33185 2837 941
NM_015387chr241916 717 679 62 ----11346
NM_015393chr452623 1329 1122 889 374 13753 32992 1519 365 144
NM_015394chr1242018 1642 1525 704 --3316 169 40 --
NM_015412chr372191 1946 1910 1070 565 340 174 --41088 639 575 137 1636
NM_015423chr1151782 1537 1374 1302 1279 --31632 1394 92 --
NM_015429chr34372 270 187 139 2976 282 1979 174
NM_015435chr861385 1097 543 396 209 108 --21390 494 --
NM_015436chr4103369 3150 2804 2664 2256 1330 913 785 762 743 12334 73099 3046 2923 2795 2224 1309 343 1772
NM_015455chr584052 3961 3459 2685 1398 1378 506 130 22837 1518 1238 --
NM_015458chr884226 3369 3220 1255 933 836 609 240 14210 54317 4287 1604 668 245 --
NM_015469chr93564 521 29 --3685 262 93 1654
NM_015483chr741152 383 365 47 --1122 1309
NM_015484chr15956 855 814 685 263 1607 2924 786 --
NM_015497chr15--1220 31067 462 312 2416 412
NM_015508chr351526 1458 1349 256 26 31382 1269 200 31592 1385 521 2404 400
NM_015520chr362808 2479 1753 1080 1058 936 22546 771 32666 2549 1923 --
NM_015535chr242683 801 521 133 --23595 471 12824
NM_015541chr32962 318 21360 1119 1885 21457 1364
NM_015548chr63947 708 130 145 2870 150 --
NM_015550chr763531 3467 2945 2341 1248 907 12894 73457 3452 3339 3285 3228 3053 537 --
NM_015553chr665048 4792 3508 1419 307 178 22038 1021 55164 4461 3771 1234 967 --
NM_015554chr1522367 865 21795 389 22376 808 11159
NM_015560chr372892 2819 2135 1107 985 918 309 1326 31958 1787 720 22584 842
NM_015565chr2172143 2104 1421 778 674 492 132 1447 12034 --
NM_015571chr682395 2256 964 916 902 894 214 22 --22482 1947 --
NM_015575chr252726 2368 2313 1475 678 1876 23276 926 13485
NM_015576chr362729 2172 2155 1031 350 229 32973 1886 1190 12581 --
NM_015578chr1941869 1512 847 501 --32037 1461 1455 --
NM_015601chr1031011 391 383 --3975 962 399 --
NM_015602chr161706 1694 1655 1429 187 153 11489 11168 --
NM_015605chr1041322 1125 356 196 1979 51519 1479 982 368 161 --
NM_015608chr103138 80 63 --1604 1664
NM_015626chr1721054 784 2834 164 --1108
NM_015635chr942152 1987 699 679 --61513 1508 1503 1498 1478 352 11841
NM_015640chr1134963 4779 4382 3469 3407 1854 1791 1587 1434 1378 1364 1202 664 13314 45391 2145 553 359 --
NM_015678chr1351670 1413 513 271 253 31394 1324 451 11602 11328
NM_015691chrX32920 659 229 --2283 45 1349
NM_015713chr8123557 3512 3401 2849 2562 2548 2505 2290 1164 925 502 458 33371 2745 2207 43337 2906 2790 1375 12336
NM_015878chr852205 1360 763 428 173 1321 --2710 706
NM_015879chr18117814 7244 6779 6519 6230 5306 3110 1735 1348 1137 304 17679 58642 7085 2124 2039 1357 --
NM_015886chr8175608 5310 5074 4825 4812 4783 4237 4065 3974 3795 2295 2082 1604 1437 849 686 619 44712 4197 3761 1965 35433 4715 1399 14722
NM_015888chr173332 3130 2927 2218 1080 1045 924 --43308 2833 2325 1026 --
NM_015891chr641979 1448 469 33 1194 2172 160 --
NM_015906chr1154834 4665 4543 4068 3440 3414 3091 3008 1856 1834 1656 1136 975 698 546 44721 1596 711 653 53836 1599 1423 1408 605 11620
NM_015986chr1741271 1157 923 343 --71345 1285 1280 1256 1199 203 135 --
NM_015995chr1555594 5533 5252 4803 3609 14067 --14605
NM_016009chr1114928 4891 3901 3777 1078 929 713 572 305 229 168 24711 369 54203 3914 3767 1588 412 11417
NM_016018chr892807 2793 2705 2509 2367 1992 1746 614 56 --42598 2252 1046 1027 12386
NM_016021chr672815 2717 2655 2596 110 93 42 --32425 554 517 --
NM_016023chr852098 1918 1767 517 212 --21642 694 2592 269
NM_016027chr82188 72 --130 1378
NM_016061chr241311 1187 595 417 11086 31592 1582 388 --
NM_016072chr124930 744 468 55 31802 44 27 1345 --
NM_016073chr1531084 322 220 --1915 1912
NM_016076chr163223 3009 2033 2026 1050 740 --3809 803 240 --
NM_016078chr1721060 407 --2833 168 2315 130
NM_016083chr663743 3640 2875 2628 736 718 --73881 3606 2963 2921 2401 1018 661 12579
NM_016087chr751665 1644 1359 1204 403 1455 11596 --
NM_016096chr851981 586 478 366 131 1290 31722 1518 1504 --
NM_016107chr561270 1151 298 244 167 62 --2255 250 --
NM_016121chr131041 364 30 1224 --31157 977 117
NM_016131chr231529 471 311 --72230 2008 1625 786 365 227 138 --
NM_016132chr15153420 3389 3256 3125 2424 2370 2309 2240 1197 1136 1123 1090 932 579 63 22932 2574 32803 2728 986 11075
NM_016138chr1611195 --2318 313 11432
NM_016194chr1551829 531 511 342 91 --21270 360 --
NM_016206chr3258742 8164 7897 7805 7070 6782 6707 6267 6158 6047 5936 3570 3408 3267 3127 3066 3035 2946 2381 2282 2137 998 976 771 357 25754 3177 73486 3180 2189 1501 293 207 199 22011 1771
NM_016217chr6123347 2925 2586 2507 2408 1384 1334 906 822 795 50 33 22823 717 43398 3086 2826 578 --
NM_016248chr1383945 3616 3450 2512 998 857 647 637 13483 43777 1478 765 510 43545 3541 3067 206
NM_016252chr24928 720 681 609 --4327 322 317 197 1160
NM_016255chr6113351 3250 3218 3049 2768 2398 2306 2122 1266 1234 1164 --1348 --
NM_016260chr2207038 6177 6010 5941 5718 5708 5467 5187 4920 2497 2361 1999 1872 1620 1103 675 509 429 158 139 17626 67581 6580 2082 1244 240 105 26445 1543
NM_016271chr1882330 2310 1648 873 345 298 284 118 --32349 2196 2067 11580
NM_016275chr362492 2463 2384 2244 1014 772 11735 --1884
NM_016287chr172015 1901 1794 1723 178 101 47 1490 21590 205 --
NM_016289chr22795 222 12135 41684 1449 745 127 --
NM_016308chr152019 2008 1294 1276 511 22054 1411 11414 --
NM_016315chr281676 1626 725 705 609 473 458 344 21330 58 31817 325 176 --
NM_016322chr9133182 3173 2890 2700 2271 2202 2181 2121 2017 1993 703 428 27 --12039 --
NM_016340chr53448 359 123 ----1174
NM_016356chr682599 2270 2222 960 859 341 318 196 --21016 577 --
NM_016374chr131226 1182 992 --1428 1401
NM_016374chr131226 1182 992 --1428 1401
NM_016377chr641682 1333 1104 239 --21483 1452 21754 516
NM_016396chr1562431 2417 1003 581 516 423 --52957 2422 1903 456 359 21857 677
NM_016422chr1163225 3008 2137 1006 565 138 42608 2443 851 226 43119 2486 876 120 --
NM_016436chr2062548 2103 1946 1014 880 449 ----1368
NM_016441chr272209 2202 1973 1878 1857 752 401 --1686 --
NM_016442chr572337 2159 1650 949 934 651 561 42135 2065 1987 1756 52309 1864 1729 1548 747 1644
NM_016472chr1461528 1399 1368 1355 1255 1080 --21412 256 --
NM_016475chr1421006 323 --21279 496 11023
NM_016485chr641406 534 181 146 11394 11978 12159
NM_016507chr1793106 2771 2705 2292 2231 2134 304 296 81 12498 12655 --
NM_016513chr683470 3426 3366 3168 2838 759 240 214 33377 2784 441 63173 2968 2395 1420 1413 1131 13676
NM_016519chr41416 1489 --2505 407
NM_016522chr113658 646 604 11209 41470 1465 1195 1074 --
NM_016530chr15144092 4044 3755 3568 3367 3330 2746 2607 1290 1265 1183 714 254 239 12921 53963 3829 3692 1113 583 1492
NM_016542chrX71696 1643 1464 1439 690 187 166 11278 ----
NM_016544chr253612 2917 1212 125 110 --22922 224 --
NM_016575chr1275421 4114 2172 1892 1793 1244 522 24367 4332 35446 1559 121 --
NM_016599chr46579 512 322 309 214 92 --11549 21456 625
NM_016603chr552227 1730 1406 252 115 --41975 1847 1736 89 --
NM_016607chrX41718 1327 1138 305 11683 150 11347
NM_016613chr462757 2381 2255 1002 876 805 1606 62588 2571 2191 2135 649 555 12409
NM_016626chr1831165 1150 115 --51752 1309 1256 1249 471 --
NM_016652chr2051312 557 462 136 32 --31774 421 379 --
NM_016824chr104658 637 546 175 21662 699 2535 349 --
NM_016952chr1123057 617 32598 176 113 44017 3449 3378 116 --
NM_016953chr2136040 5707 5670 5635 5242 5172 4980 4963 4155 4084 3872 1231 696 --65897 5735 4636 3719 493 368 --
NM_016954chrX2470 256 --2656 54 1569
NM_017412chr851053 912 283 250 52 11184 1461 --
NM_017420chr1493828 3545 3486 3307 2447 2329 1186 1009 789 1275 33801 755 687 2956 938
NM_017423chr432163 1914 286 --2553 358 21638 439
NM_017447chr21144320 3890 3571 3243 3186 2897 950 805 700 544 277 199 189 37 1384 33698 2994 2855 33619 3368 492
NM_017489chr821126 197 11139 --11247
NM_017519chr61938 11306 2922 916 --
NM_017563chr355036 5025 1622 827 348 1494 45228 4762 4592 497 14101
NM_017577chr331307 317 110 --21263 154 31547 522 518
NM_017580chr1041542 541 417 229 11980 31681 712 525 21988 1984
NM_017596chr144529 1237 105 33 24624 1223 11243 --
NM_017599chr1252017 1678 1632 1616 301 21493 1480 41841 1510 443 237 --
NM_017610chr1521644 228 1733 21358 744 12133
NM_017617chr9----1169 3354 196 156
NM_017628chr475179 4653 3768 3390 1093 1070 725 1651 65282 4751 3644 3496 488 148 13641
NM_017633chr653954 2633 1409 879 860 --32797 2654 884 --
NM_017634chr871696 1651 1566 1553 1297 766 401 1212 22003 571 --
NM_017637chr9159406 9278 9053 6653 5952 5740 3431 3362 2422 2150 2131 2039 2012 1306 1213 27426 3646 69245 5773 2760 2469 2307 1995 1663
NM_017641chr124384 295 247 235 ----1810
NM_017643chr1772872 2620 2315 1976 595 555 536 22790 2151 63030 2925 2496 1123 791 611 --
NM_017644chr3115019 4930 4806 4672 4411 3232 2042 1675 591 509 366 21955 410 64767 4691 4035 3654 1788 1276 24920 4856
NM_017650chr7125832 5425 4972 4517 3891 2420 1924 1852 1768 1710 1311 216 45579 5387 5273 2356 --25277 238
NM_017651chr611525 21055 377 31137 1058 1016 1459
NM_017658chr1494618 3796 3575 2907 1808 1525 1487 1427 621 24576 1406 114606 4545 4263 3749 3340 1710 1690 1039 507 474 347 24670 4551
NM_017661chr151372 1265 21185 486 11172
NM_017666chrX42203 543 403 392 --42158 1691 1676 1640 --
NM_017694chr271984 1789 1649 1618 1571 749 398 1389 ----
NM_017705chr1543674 1291 1234 255 --23272 364 13811
NM_017709chr164091 3762 2757 1721 901 548 14339 34049 1064 812 --
NM_017736chr1663117 2953 2913 1029 834 339 1924 32888 2770 98 12344
NM_017737chr141573 1452 1433 152 11736 21806 266 12182
NM_017742chr1841872 1818 1663 1401 --31683 1361 133 --
NM_017754chr674922 4595 4387 4187 4054 3822 1181 34486 1703 710 24638 1482 --
NM_017758chr1731214 367 86 --11455 1332
NM_017762chr1562232 1982 1833 1750 381 170 --21937 1812 22282 1736
NM_017768chr12779 598 --1302 3666 343 196
NM_017769chr1492513 2260 2061 2052 1049 931 408 384 219 33198 2242 987 52245 2145 1197 413 62 1286
NM_017811chr962741 2564 2141 1140 795 532 1510 23095 778 --
NM_017813chr8184709 4281 4232 4202 4039 4013 2317 1943 1823 1723 1646 1320 1255 1211 1016 947 487 145 14439 145186 4740 4507 4448 4442 3860 3766 2221 2215 1948 1428 844 731 211 35183 4504 4258
NM_017824chr1052484 909 868 337 196 --22460 2448 1644
NM_017831chr1884802 4688 4680 4552 4292 4210 4193 134 23236 971 34583 3069 1369 --
NM_017848chrX124518 4368 4112 3928 3901 3258 3050 2906 1879 1623 756 604 --64150 3148 1652 1616 623 616 22860 273
NM_017919chr995702 5668 4405 4369 4126 2216 2136 1545 1486 55856 5801 5359 2020 1374 25793 5090 --
NM_017925chr971801 1750 1496 1422 1322 1193 312 ------
NM_017933chr241613 531 266 257 --11163 1597
NM_017935chr45644 559 244 228 159 1521 ----
NM_017944chr1172971 2166 1167 1155 819 723 310 --53035 2982 580 570 421 1729
NM_017954chr761445 1350 1307 1232 1183 86 --2485 55 --
NM_017987chr1051856 1792 727 627 441 12008 22088 471 --
NM_018003chr1542377 2072 502 191 1871 31917 1874 585 12002
NM_018010chr331061 1023 262 11501 11376 11235
NM_018015chrX61093 802 390 314 185 64 --41010 826 175 142 --
NM_018018chr1241894 1850 1591 1330 --21842 697 11856
NM_018027chr1063244 3061 2944 1242 1232 168 --32892 1168 1162 --
NM_018036chr1494277 4219 3772 3606 3565 3353 1347 521 93 185 13024 11002
NM_018048chr1272025 1509 815 623 615 429 55 163 11943 21828 1824
NM_018061chr171434 1402 1348 1087 697 233 166 --1125 --
NM_018084chr283182 1298 817 588 536 368 187 117 31209 972 953 43268 2393 1156 78 --
NM_018092chr1671608 1187 1167 675 643 448 150 31498 1448 240 3461 406 314 --
NM_018105chr83950 794 382 --11039 2500 76
NM_018115chr43736 262 214 --1155 1220
NM_018120chr851417 1220 1023 344 146 --3575 512 312 1240
NM_018121chr1042290 1124 570 460 --12781 11958
NM_018126chr451334 1217 1175 374 148 --21364 589 --
NM_018133chr361985 1865 1490 729 652 125 --11724 21751 801
NM_018151chr24739 654 604 173 --3679 609 295 --
NM_018155chr362885 1351 1244 1112 497 448 32544 2097 830 62659 2520 2301 2266 1161 943 --
NM_018157chr1233068 679 271 --33198 2228 1048 2997 993
NM_018169chr123483 135 125 --2559 394 1341
NM_018178chr151512 1396 1321 186 94 22042 1634 21968 1641 --
NM_018184chr332009 740 385 --2515 126 11964
NM_018211chr152176 1686 1590 851 74 11356 --1877
NM_018227chr482925 2727 2068 1169 1103 1044 983 108 1567 62895 2627 2562 2253 2073 1029 23228 788
NM_018243chr473958 3866 3809 3282 3242 575 144 13334 6557 532 101 96 91 86 --
NM_018247chr6163143 2656 2628 2435 2394 2292 1219 1196 1010 928 866 739 557 482 257 95 --22402 1201 --
NM_018254chr1102393 2374 2169 2126 2088 1979 1873 1762 1582 92 --2513 316 --
NM_018293chr382952 2877 2260 2089 1991 1816 1085 416 --72747 2735 2579 2221 2063 1865 1024 --
NM_018299chr8123361 3141 3010 2985 2118 1211 1029 848 601 386 349 203 12788 52725 1170 784 268 262 62722 2718 2714 2710 945 941
NM_018312chr1162097 1993 1491 1346 649 500 --31510 833 446 --
NM_018313chr332573 1796 106 21859 585 52117 1884 1879 1866 970 21863 237
NM_018315chr441251 1027 474 297 --31582 1438 305 11456
NM_018325chr921572 1555 21537 1471 1658 11248
NM_018339chr961359 1348 698 665 54 21 --11495 --
NM_018351chr1274615 4401 4257 1806 1238 787 229 1191 33703 995 696 1182
NM_018352chr45854 675 661 159 55 --41014 698 183 127 --
NM_018361chr8123842 3749 3333 971 708 622 590 559 453 373 363 88 --32705 2639 1255 --
NM_018362chr1163524 3008 2863 903 489 130 34053 1524 157 53088 1270 1179 836 27 44022 843 631 362
NM_018364chr1103938 3531 3032 2798 2531 1383 1228 1161 683 87 2620 499 13385 23858 1005
NM_018370chr1281969 1877 768 424 384 318 298 134 --52101 937 831 412 329 --
NM_018373chr1486324 6166 5040 4984 4860 4162 1847 904 1703 35870 4362 1938 1424
NM_018374chr7204814 4763 4373 4098 3973 3460 2097 2041 1816 1808 1721 1684 1631 1577 1544 1456 1376 1256 1031 564 33282 716 297 63414 3306 2111 1727 1263 524 33758 1495 1190
NM_018383chr221933 640 11729 12007 12062
NM_018403chr3143905 3863 3266 3224 2814 2641 1576 1440 1250 1128 979 822 526 128 11400 31232 1184 760 13739
NM_018409chr483232 2771 1251 855 626 383 138 82 62575 902 485 462 371 289 53220 3058 1288 1123 1033 --
NM_018424chr971565 1249 445 435 425 277 43 1307 21525 532 --
NM_018427chr1621389 1133 --21219 473 11235
NM_018429chr592938 2928 2790 2298 2106 2072 1877 186 101 42863 2348 1032 1003 52619 2196 1035 448 410 11051
NM_018439chr1852569 2534 1013 773 207 1447 1508 11950
NM_018440chr886129 5322 3059 2427 2006 1774 1353 678 37759 7114 2718 77552 6757 2320 1680 1054 745 740 18052
NM_018444chr842072 929 562 427 1908 51729 1643 1619 728 477 --
NM_018448chr1221232 938 1381 21003 176 11208
NM_018477chr141695 11034 51057 1049 1044 919 735 --
NM_018482chr852521 2418 2382 1020 522 --12411 11896
NM_018490chr1131417 520 157 --31791 1455 141 31801 1634 1461
NM_018557chr241680 1325 1059 410 11742 21660 153 11258
NM_018566chr174001 3912 3288 1747 1501 1485 1110 --45041 4051 1597 935 15096
NM_018569chr43494 351 128 21399 468 1471 1572
NM_018590chr1041747 1721 1589 1211 11538 1106 152
NM_018638chr12125683 4864 4565 4450 4257 4050 3959 3789 3596 998 951 344 33941 476 293 35599 4216 1214 --
NM_018640chr1282800 2494 2329 1958 1803 1765 337 194 12588 3698 278 249 --
NM_018650chr162287 2254 1822 1693 1665 537 2499 366 22118 246 --
NM_018652chr151894 --4760 292 225 195 1160
NM_018657chr33761 114 108 --4283 250 169 90 2613 309
NM_018682chr75582 476 459 143 128 --2677 203 1296
NM_018689chr1512496 ----22677 2329
NM_018695chr5102234 2065 2006 1841 1655 1510 628 565 401 42 --31540 926 291 11547
NM_018700chr521245 344 21301 670 31720 373 285 11233
NM_018704chr161787 1768 1662 865 363 327 2449 87 190 --
NM_018724chr11244 1135 1425 1262
NM_018841chr1133891 3814 3356 3229 3184 2690 2676 2449 1482 647 372 211 84 22875 1553 22594 562 13584
NM_018898chr552229 2161 2054 1520 786 12002 12349 21673 907
NM_018899chr552229 2161 2054 1520 786 12002 12349 21673 907
NM_018900chr552229 2161 2054 1520 786 12002 12349 21673 907
NM_018901chr552229 2161 2054 1520 786 12002 12349 21673 907
NM_018902chr552229 2161 2054 1520 786 12002 12349 21673 907
NM_018903chr552229 2161 2054 1520 786 12002 12349 21673 907
NM_018904chr552229 2161 2054 1520 786 12002 12349 21673 907
NM_018905chr552229 2161 2054 1520 786 12002 12349 21673 907
NM_018906chr552229 2161 2054 1520 786 12002 12349 21673 907
NM_018907chr552229 2161 2054 1520 786 12002 12349 21673 907
NM_018908chr552229 2161 2054 1520 786 12002 12349 21673 907
NM_018909chr552229 2161 2054 1520 786 12002 12349 21673 907
NM_018910chr552229 2161 2054 1520 786 12002 12349 21673 907
NM_018911chr552229 2161 2054 1520 786 12002 12349 21673 907
NM_018945chr693594 3382 3168 2667 1172 934 721 630 610 23516 3326 ----
NM_018970chr743055 2011 1200 1135 2934 853 12874 22473 719
NM_018976chr1262265 922 800 509 436 252 22661 2315 --11860
NM_018979chr1262390 2245 2238 1962 1732 116 32622 2470 2311 21610 490 12100
NM_018981chr231191 1056 275 ----11001
NM_018999chr10103907 3865 3757 3562 3506 3382 3120 1656 1083 198 23812 3037 84456 3871 3158 3087 1531 1333 1289 884 13003
NM_019000chr571638 1550 1523 632 606 368 199 11379 31382 1313 128 --
NM_019001chr3154661 4625 4598 3812 3656 3588 3408 3124 1522 1468 1185 1127 1018 843 606 43473 1480 1004 511 74373 3649 3158 1512 860 463 130 24515 3348
NM_019004chr752424 2299 910 888 411 --72111 1927 1798 829 425 166 159 --
NM_019008chr2252544 1490 1325 893 699 22466 2444 12954 13046
NM_019027chr472640 2150 904 500 332 239 138 --1127 22559 1844
NM_019035chr452101 779 500 493 178 1602 2571 245 --
NM_019049chr12664 70 --2281 139 1287
NM_019050chr432102 1876 1678 --52144 2107 2051 898 350 1848
NM_019072chr5114217 4155 4133 4031 3321 3154 2728 1248 1131 986 325 24142 3932 44267 4200 3464 3326 13862
NM_019080chr1361541 1501 1288 1153 973 176 31425 1385 558 1199 --
NM_019083chr141588 1448 654 641 --1377 1364
NM_019084chr1072366 2075 1885 1723 959 637 454 --21017 470 --
NM_019087chr571697 541 436 375 218 121 61 --31731 466 72 --
NM_019094chr12113561 3425 3353 2829 2695 2539 1538 835 584 537 260 1876 43555 2451 327 61 --
NM_019098chr881741 1652 1594 1298 482 362 309 214 --21694 1422 --
NM_019114chr971555 821 722 609 429 405 170 11720 21560 489 1445
NM_019117chrX53454 1259 1141 156 129 12612 23018 1392 --
NM_019555chr341649 1460 1383 1119 ----11565
NM_019556chrX51059 393 285 225 180 ----1956
NM_019590chr1051462 1167 469 366 103 1461 2449 167 --
NM_019593chr20122560 2518 2357 2161 1995 1197 1036 905 533 283 220 23 --42363 1189 348 57 11061
NM_019885chr252792 2589 2257 951 771 12723 22030 1846 11843
NM_019895chr321022 112 21068 1000 3935 93 38 31072 820 132
NM_019903chr104658 637 546 175 21662 699 2535 349 --
NM_020116chr451413 1402 1333 1132 334 1289 2355 339 --
NM_020122chr273984 2241 2180 1967 1200 830 162 45242 4327 937 417 52414 2047 1736 1726 1207 35459 1060 853
NM_020144chr762122 2004 1934 1902 617 352 --31992 1339 664 --
NM_020148chr1882907 2634 2613 2163 1911 1215 697 207 --22845 991 194
NM_020150chr1042000 1524 676 499 12220 1839 11709
NM_020159chr481247 1195 1146 450 434 398 329 237 21401 1278 3700 616 492 --
NM_020177chr5123368 3199 2961 2824 2763 2742 2565 2350 2062 1231 417 262 --12455 192
NM_020184chr222001 296 11532 32324 2223 2184 1331
NM_020199chr541266 358 262 248 11301 137 11013
NM_020204chr14685 315 70 48 179 ----
NM_020205chr173449 2959 2866 2838 2822 1184 998 12209 32847 2737 661 12702
NM_020228chr1172500 2229 2084 979 907 694 94 12484 21856 154 --
NM_020240chr5112685 2293 2247 2221 981 680 598 568 397 333 308 1352 4859 835 708 403 --
NM_020245chr6165065 5039 5027 4926 4673 4636 4518 4299 4238 3259 3183 3166 1253 792 196 186 54592 2030 2015 1825 169 31602 223 172 --
NM_020297chr12113588 3539 3530 3026 3011 2287 1380 1049 491 459 185 --53648 860 654 482 134 --
NM_020336chr2063601 2840 1276 902 878 824 32655 1237 840 33006 2810 2795 --
NM_020337chr452367 2092 1145 917 546 --42958 2889 384 206 12084
NM_020338chr1043729 3677 3654 3509 --43254 3092 3065 2881 --
NM_020342chr262599 2578 2528 1669 1636 301 1357 22085 1944 11813
NM_020346chr1161710 1274 618 442 192 48 --31405 1364 24 --
NM_020390chr3103984 3800 3311 3060 1559 1493 1400 1263 518 104 24481 1387 13489 --
NM_020403chr1331472 656 251 11781 1265 1639
NM_020420chrY61539 1485 1336 684 614 258 ----1271
NM_020432chr732020 1921 473 --71598 1593 1422 665 203 183 154 --
NM_020443chr135354 4350 2578 16877 116859 6720 5469 4243 2698 2648 1522 873 848 837 824 --
NM_020455chr672729 2449 1971 1772 697 624 485 --12608 12605
NM_020456chr1362148 2141 2058 1636 863 536 2226 56 2744 479 22211 215
NM_020473chrX41767 1339 484 452 31696 1677 202 11699 --
NM_020474chr1821893 1842 11312 42012 1331 678 642 --
NM_020640chr361564 810 323 310 274 168 ----1743
NM_020647chr81769 3921 830 801 31769 648 624 42270 2220 1955 662
NM_020648chr1872801 2104 2053 1950 1936 1838 192 12656 22739 1096 12589
NM_020651chr271764 1629 1580 1531 1188 423 101 --21800 1536 11816
NM_020654chr341667 1424 1188 1030 1134 31597 1288 647 --
NM_020661chr1251816 1795 1719 383 91 --1396 11780
NM_020666chr52823 103 ----1628
NM_020673chr20166468 6351 6296 6272 5724 5457 4957 4780 3073 2550 2407 2348 2330 2065 1603 555 31229 503 437 87502 6453 4894 2605 2555 1769 1333 960 --
NM_020698chr1263106 2763 2608 2537 1980 187 --32677 2354 42 12938
NM_020699chr163623 3453 2094 1907 918 58 14818 35205 1679 191 --
NM_020704chr762162 1951 1625 977 648 512 11595 22468 818 22072 854
NM_020717chrX94277 3668 3138 1903 1737 1222 892 817 302 --24536 875 1872
NM_020718chr16146622 6479 6335 6207 5857 2585 2539 2291 2159 2135 2045 1835 941 654 36464 1164 809 76542 6467 6422 6341 4051 2509 1688 34117 48 44
NM_020727chr21103979 3892 3226 2581 1615 1607 1262 374 331 238 22687 308 23718 840 13453
NM_020732chr61938 11306 2922 916 --
NM_020734chr1283134 2927 2796 2680 2644 2450 2441 547 --23321 932 23344 182
NM_020738chr261652 1625 1476 1409 1267 248 21431 1283 11523 --
NM_020739chr15124212 3522 3480 2823 1650 1636 1587 962 321 296 257 154 --32939 1308 605 13876
NM_020742chrX92659 2474 2159 2148 1680 888 735 688 525 --22679 1668 --
NM_020748chr1752119 1703 1579 808 653 1771 2793 376 --
NM_020752chr1082437 2389 1924 984 955 882 788 501 --12070 12178
NM_020755chr651575 1510 154 146 45 11143 1422 --
NM_020760chr21785 --51548 1510 1252 771 482 1453
NM_020766chrX74487 3563 3388 2919 1758 866 462 21536 446 43754 1709 1638 1629 13041
NM_020771chr611204 11289 2946 222 11334
NM_020772chr17148616 8540 8182 8074 7595 6244 6092 5623 5467 5451 3250 2931 1629 1184 58520 6404 787 244 171 77477 5288 3231 1875 656 642 220 15577
NM_020773chr432696 1899 379 --1289 12644
NM_020774chr18216025 5995 5179 4589 4416 4362 4355 3822 3805 2477 2461 2360 2280 2228 2201 2100 2069 1350 1275 1055 1042 34965 1662 1137 86167 6123 6000 5909 4011 3827 2239 367 --
NM_020782chr12164646 4571 4531 4421 4315 1911 1863 1828 1734 1637 1503 910 689 455 290 197 1777 54776 4338 4018 1889 1242 24055 695
NM_020783chr1892133 1660 957 912 617 547 526 474 190 --1584 1950
NM_020792chr362680 2593 2395 2188 794 321 21053 772 21039 590 --
NM_020796chr543023 964 516 217 --62148 2013 1951 1944 1939 839 2948 705
NM_020801chr532035 2023 1622 --52554 2319 2102 920 904 2612 511
NM_020802chr1193409 3222 2967 2823 2454 1022 644 397 384 --13184 11146
NM_020803chr43880 464 420 21958 111 32031 1918 694 1972
NM_020805chr1831599 1503 680 --51796 1789 1519 567 551 --
NM_020810chr14113509 2997 1270 1246 1033 1005 952 642 235 208 119 32410 405 65 43397 3188 1450 946 --
NM_020825chr1673833 3699 3616 2908 2372 1341 832 23771 3729 ----
NM_020830chr293011 2969 2835 2619 2536 2353 2289 2191 565 12383 12012 --
NM_020841chr12103654 3364 2876 2813 1109 905 891 797 511 81 22769 1443 33495 3426 2644 --
NM_020854chr1831440 1428 453 --21351 625 11446
NM_020859chr4113517 3490 3469 3407 2463 1419 953 834 782 660 530 32607 478 287 13567 --
NM_020871chrX92341 2296 2242 2181 1865 1611 868 781 262 1415 2884 41 22065 38
NM_020872chr371803 1567 468 392 119 101 37 21630 23 11662 1355
NM_020897chr11853 ----3859 841 837
NM_020909chr233660 2737 93 13071 24074 912 14099
NM_020917chr1953536 2793 1088 295 264 1345 22809 54 --
NM_020918chr1053455 2353 1268 286 275 ------
NM_020935chr2114672 4479 3991 3919 3872 3797 3418 3082 3057 1801 1460 --13215 24066 1218
NM_020937chr142238 188 --183 2137 107
NM_020948chr1123712 3650 3345 2824 2800 2521 1109 1037 497 333 273 255 --42527 1398 818 813 --
NM_020951chr1951990 1960 1930 448 382 --31646 546 28 21643 1639
NM_020962chr1552238 1992 1886 1667 397 12375 22378 1891 --
NM_020977chr421991 1596 11767 11396 11393
NM_021007chr221904 1733 --51797 1576 1571 1566 753 --
NM_021012chr1743154 3120 1982 130 ----32431 2427 2423
NM_021025chr5------2514 500
NM_021033chr1363524 3418 1317 1064 963 267 --22816 2588 23543 3251
NM_021038chr373334 2911 2501 1028 922 699 511 --32211 2151 429 --
NM_021069chr432155 1764 415 ----1849
NM_021072chr582516 2273 2097 890 794 627 429 66 1283 32203 2065 286 --
NM_021083chrX103584 3418 3335 3128 2828 2464 1219 1154 311 36 12620 43134 1421 918 530 --
NM_021090chr2234993 4696 1875 --11978 24391 3876
NM_021097chr272878 2691 2583 2022 912 494 350 22062 695 43067 2883 980 341 --
NM_021116chr788760 7467 6638 6619 6132 5983 5723 876 49088 8539 3515 3444 38987 3447 3413 --
NM_021127chr182617 568 --41227 1203 1150 230 21415 1224
NM_021145chr731036 782 272 ----11042
NM_021148chr782418 2255 2187 2166 1882 1715 1705 1589 11697 21841 279 22503 2499
NM_021167chr732769 2185 262 11054 22296 1057 12302
NM_021183chrX62531 2521 2330 2252 2133 350 31912 1840 755 ----
NM_021191chr1241750 1654 782 675 32062 2048 1724 22144 2074 22066 334
NM_021222chr14479 427 415 95 1225 21442 251 1401
NM_021238chr1231839 1600 308 --11309 21930 1926
NM_021239chr1421223 327 21332 1066 11123 1912
NM_021255chr1483322 3213 2856 2801 711 648 363 29 12731 74057 3188 1633 1236 1231 856 562 11351
NM_021622chr1082409 2189 1770 1626 780 720 705 559 22182 363 21890 1632 --
NM_021627chr341131 367 354 311 1394 3914 851 445 --
NM_021629chr395053 4846 4081 3848 3525 1581 573 555 234 --74666 4448 4348 3691 2042 1008 804 --
NM_021637chrX11211 --21368 81 191
NM_021645chr1372358 2262 2150 2012 1960 1946 1692 32340 2276 2210 --1674
NM_021647chr4124448 4287 4186 4122 3806 3573 3444 3064 2928 1444 653 643 --44547 4156 3902 3457 34455 3621 1575
NM_021813chr6125648 5610 5578 4867 4851 4307 3675 1610 750 614 531 379 2654 539 54928 1970 1298 716 698 15752
NM_021815chr273002 1950 1050 963 758 554 404 --12858 1622
NM_021911chr575543 5164 3523 2143 1383 1347 341 --65233 4958 4143 3515 1101 631 14140
NM_021912chr1564224 4152 3631 2839 2710 921 --34086 3513 1199 134
NM_021914chr1462276 2245 1997 1988 951 599 32293 393 147 22281 1845 1151
NM_021940chr651511 484 248 193 76 ----1583
NM_021954chr1342817 2644 777 545 22966 1111 33149 762 486 13602
NM_021961chr11137343 6548 6540 6268 6202 5272 2690 2107 1545 1442 931 560 169 26380 809 34767 2920 1147 14718
NM_021964chr3116316 6136 4938 4778 4672 4612 4350 4312 2654 2022 1697 24525 2549 75091 4726 2106 1783 1513 554 161 21780 1710
NM_021980chr1041215 1174 976 78 ----11185
NM_022037chr23944 881 213 --1133 2639 121
NM_022041chr1662631 2582 2552 2449 2346 543 12247 12307 --
NM_022048chr1576340 6257 5671 2295 2151 2101 999 25684 1817 45023 4284 4149 1750 --
NM_022063chr1041692 1469 1208 205 --31760 313 262 21599 1501
NM_022079chr1031011 391 383 --3975 962 399 --
NM_022091chr662801 2263 2228 2216 1949 1742 1146 32564 981 894 12706
NM_022114chr144440 1451 578 135 --31712 1456 1439 --
NM_022133chr841903 647 529 434 41829 1649 1598 1190 21193 1170 11892
NM_022140chr531983 1812 737 21572 794 41596 766 544 517 --
NM_022145chr56696 661 500 172 123 88 --1158 --
NM_022166chr1655818 5487 5139 2447 1676 21591 1210 26153 583 26004 350
NM_022173chr23944 881 213 --1133 2639 121
NM_022336chr262372 2157 2030 1558 639 597 22150 1748 --1786
NM_022351chr883712 3456 3365 2983 2850 2726 1137 457 1674 11259 13857
NM_022444chr7101955 1883 1820 1746 1721 1603 1597 1564 436 360 31709 1619 538 31830 731 661 --
NM_022456chr1277717 7199 6768 6640 6524 2593 587 --76169 4832 1147 575 491 450 81 --
NM_022459chr13126172 6127 6009 5911 5540 5497 5420 4844 2466 2211 1138 889 15401 66055 5351 4785 2436 1814 95 24616 3886
NM_022469chr163346 3090 2423 2176 1121 873 13240 12870 --
NM_022474chr1462794 2547 843 416 225 190 12578 --1579
NM_022475chr45687 595 574 114 104 --4750 745 527 44 1701
NM_022482chr2072459 1720 956 844 571 490 217 --32436 1946 849 12495
NM_022491chr1252733 1147 764 720 344 1704 83344 2601 1018 779 285 277 66 50 --
NM_022496chr12--1399 2449 379 1198
NM_022650chr53842 835 650 --1630 1963
NM_022716chr152568 2116 1136 256 71 --1241 12821
NM_022726chr631744 1559 379 11145 2488 193 1179
NM_022753chr162555 1940 1112 906 682 665 11789 3984 487 106 1125
NM_022763chr362521 2511 2063 956 292 57 42442 2166 561 542 12493 --
NM_022771chr123852 671 168 --3928 771 246 --
NM_022776chr321245 1233 --21565 1055 11052
NM_022780chr251861 738 635 362 194 --41312 499 409 213 11155
NM_022781chr993194 3115 3103 3054 3005 2647 2410 820 745 1573 33284 2587 2202 --
NM_022787chr142078 1904 1888 1051 --22381 467 22763 2522
NM_022824chr571848 1812 1454 503 313 279 171 --21427 781 --
NM_022840chr1851344 1064 908 71 34 11430 179 --
NM_022841chr1562746 2423 2077 930 820 243 12365 2311 291 12645
NM_022843chr1371528 1454 1434 1308 1242 1220 543 --11121 --
NM_022845chr1671824 1563 1546 1429 452 381 261 31999 533 330 1433 --
NM_022893chr2113184 3077 2961 2758 2428 1995 1280 903 708 699 409 --53029 3013 1092 1011 521 13042
NM_022894chr251638 1312 1177 576 537 140 --11090
NM_022898chr14144711 4700 4674 4640 4591 4509 3772 3037 1120 581 523 283 276 235 11170 64788 3747 3645 3639 3584 1298 13592
NM_022900chr73828 444 424 ----11061
NM_022918chr11102037 1912 1784 1704 1624 1574 1500 386 352 101 --31893 1550 125 1838
NM_022977chrX72616 2298 1751 1019 782 722 215 --11057 --
NM_023000chr143659 460 453 --31570 469 254 --
NM_023001chr143659 460 453 --31570 469 254 --
NM_023016chr262653 2542 2140 2019 871 614 22379 885 32010 1063 35 1759
NM_023073chr531129 402 334 31248 1070 1054 11251 --
NM_023074chr193891 407 392 --1416 1178
NM_023914chr341649 232 112 31 ----11088
NM_023929chr842555 2048 637 585 12175 3889 464 449 1263
NM_023931chr1621556 1208 ----21264 1260
NM_024094chr83852 298 153 --2674 81 1266
NM_024295chr852067 2025 1803 1530 1320 1470 11325 --
NM_024345chr9164934 4709 4472 4277 4160 4006 3992 2377 1970 1961 1472 991 913 805 655 269 25852 1897 --16085
NM_024416chr981520 1502 1458 1392 1230 639 524 109 ------
NM_024423chr1884151 3975 3948 3856 3463 3004 1696 184 --43074 2973 1445 713 --
NM_024511chr423008 26 11365 1833 145
NM_024524chr372318 2273 2155 1204 868 221 128 --42703 796 651 490 12359
NM_024546chr134838 492 242 21 1354 3201 195 170 1512
NM_024561chr1351417 1272 284 195 138 ----11309
NM_024563chr551732 1684 1588 1450 1261 21824 1362 21841 1803 1270
NM_024582chr441091 937 925 844 2773 271 1204 11159
NM_024613chr841854 1191 381 257 --41645 1262 321 246 --
NM_024636chr742950 2896 431 235 1876 12051 12068
NM_024638chr322393 796 199 1620 22299 268
NM_024641chr6102651 2171 1867 1076 1007 874 685 598 472 232 12423 2285 61 1606
NM_024646chr154015 3546 3037 1155 903 --23891 1278 11267
NM_024692chr271604 1587 1542 1287 517 446 415 11865 31839 1731 1163 180
NM_024700chr12868 801 ----21167 382
NM_024713chr1551502 1359 422 282 219 11570 --11365
NM_024721chr862627 1853 1808 1656 503 443 --42588 1928 1797 840 --
NM_024740chr1193705 3573 3494 3447 2930 2880 1594 1106 642 33677 3561 298 44129 3784 1665 667 --
NM_024744chr262682 2576 2153 2067 886 197 11802 --21783 129
NM_024749chr142246 1843 1419 89 --31968 1848 110 --
NM_024751chr472043 1844 1813 1605 1444 625 500 1379 31914 1622 367 11451
NM_024770chr276080 4526 2316 608 480 437 231 25832 5187 35213 4336 353 26015 2217
NM_024817chr1545060 2058 1824 502 15153 35864 4860 803 25194 571
NM_024824chr1451563 1523 1250 174 128 21648 696 11606 --
NM_024828chr961508 1411 1175 545 123 95 2411 54 3315 159 76 11104
NM_024831chr82724 79 --1229 1576
NM_024841chr1172242 1945 1715 787 698 551 110 22339 909 52329 1720 1703 960 175 --
NM_024899chr183688 499 87 1627 --1449
NM_024920chr41346 --2221 41 1378
NM_024930chr552590 2457 2030 710 697 2553 450 22735 2212 --
NM_024941chr521019 962 21342 220 2234 229 131
NM_024942chr10101408 1229 983 562 554 296 207 159 47 36 11013 2953 141 1336
NM_024944chr2141167 465 212 164 --2449 324 1170
NM_024945chr931139 956 118 --3902 885 796 --
NM_024947chr3107168 6893 6598 3349 3093 2956 2225 1764 1644 1111 29564 7888 69617 7666 6624 6418 2332 1505 79568 7663 6803 6280 2534 2035 653
NM_024949chr494990 4795 4598 3396 1732 1157 1055 937 23 11941 41911 1508 282 135 64371 3559 1929 1925 1921 1814
NM_024989chr2267788 7769 7426 7286 7276 7228 6972 6826 6758 6635 6329 6117 5801 5788 5747 5252 2714 2147 2040 1930 1820 821 404 371 341 214 47387 5876 2923 2569 42589 1435 1155 1150 --
NM_024991chr1063271 3197 2984 2561 769 27 13259 13188 33185 2837 941
NM_025054chr884239 4092 2960 2945 2768 707 256 35 1485 43285 3255 1141 960 --
NM_025073chr1114724 4704 4686 4578 4222 3572 3013 2937 909 749 289 11442 63873 3867 1527 1522 338 242 --
NM_025106chr121624 611 --21446 1417 1641
NM_025113chr1331243 1183 134 11317 1444 1510
NM_025151chr841817 1658 1474 743 --22111 2013 22194 2117
NM_025160chr174046 3930 3890 3099 2759 1165 893 1490 23067 716 1385
NM_025182chr93360 334 139 --1343 1340
NM_025184chrX6694 301 250 234 78 45 --1855 --
NM_025191chr183411 3223 2794 2774 2404 2175 1387 870 --31401 1392 881 52363 1398 622 562 339
NM_025235chr1031954 1729 1516 32251 1657 657 31505 1412 392 1438
NM_030579chr1663230 3008 2663 2406 1302 996 23551 3088 21381 394 1593
NM_030621chr1474149 4082 3686 3607 3060 2927 1268 21070 62 53913 3706 3246 2789 738 --
NM_030623chr241605 1264 1141 39 --11241 1584
NM_030625chr1052027 1920 1808 448 327 2715 84 12141 --
NM_030627chr5173972 3962 3927 3603 3570 3477 3409 3145 1528 1371 1038 916 653 387 233 57 22 23849 801 64048 3956 3684 3612 1478 727 1805
NM_030634chr161622 1606 901 321 223 202 11863 31591 52 34 --
NM_030637chr143723 550 200 1185 2633 569 1147
NM_030647chr7106273 5359 4704 4678 821 814 729 604 576 460 11119 176084 5618 5281 5039 4173 2352 2243 2213 2063 1562 1411 1233 881 826 609 395 274 21369 338
NM_030648chr485298 5242 3680 2134 669 554 449 341 --23813 1648 13610
NM_030650chr2133893 3239 3189 2914 2907 2838 2645 1585 1367 987 820 419 115 21397 765 43482 1620 856 657 --
NM_030674chr1265705 1831 1148 1132 955 267 35231 4708 4615 55558 4954 4123 2157 449 32274 2259 347
NM_030751chr10121884 1737 1705 1623 1385 1253 1216 1169 474 438 397 48 1630 21855 1258 11402
NM_030751chr10121884 1737 1705 1623 1385 1253 1216 1169 474 438 397 48 1630 21855 1258 11402
NM_030755chr1472941 2606 2432 2246 368 346 59 11977 22956 693 --
NM_030774chr1151105 363 71 54 32 --31570 1480 1259 --
NM_030777chr2072508 2354 2347 1855 1645 748 463 12036 42176 2059 618 183 --
NM_030780chr831290 1246 281 --3503 487 482 41378 1078 500 496
NM_030791chr1461823 1280 1261 1200 733 197 1121 1685 1468
NM_030799chr552029 1950 1747 1619 1591 --32036 1787 155 --
NM_030806chr169417 9304 8715 6540 2139 711 16555 46558 2494 1217 991 28725 8450
NM_030809chr1272373 2121 1661 401 108 51 42 ------
NM_030816chr162680 1161 1126 1094 910 689 33493 2720 1186 13267 --
NM_030817chr1283790 3540 3395 3231 2797 2725 2715 310 --63753 3183 2970 2685 1449 735 21505 1446
NM_030885chr382259 1865 1705 661 336 328 221 106 11645 31994 1845 301 11834
NM_030918chr165470 5378 4886 4823 4415 3374 --25313 5263 13886
NM_030920chr151821 421 340 282 206 21940 349 2736 643 1241
NM_030945chr552667 2657 1917 385 313 --22480 2445 22630 2341
NM_030949chr61162 --21411 476 11501
NM_030953chr561656 1618 1606 1430 1355 1341 --11387 --
NM_031216chr1842179 1602 541 195 1769 52214 2100 1884 1860 367 1661
NM_031243chr742423 1757 1721 1480 2953 198 1541 12009
NM_031268chr1685262 5155 5093 5076 4682 4403 3999 1603 15133 24126 3402 23555 141
NM_031296chr472337 2311 2292 2202 761 747 569 --42543 2378 2238 1963 --
NM_031305chr42399 277 21658 129 31554 1497 420 11494
NM_031314chr1481583 1301 831 705 594 340 145 37 21562 391 21401 693 --
NM_031362chr242810 2413 952 614 22589 1783 1624 --
NM_031365chr242946 2549 1088 750 32725 1919 135 1760 --
NM_031366chr242946 2549 1088 750 32725 1919 135 1760 --
NM_031371chr131226 1182 992 --1428 1401
NM_031371chr131226 1182 992 --1428 1401
NM_031411chr552229 2161 2054 1520 786 12002 12349 21673 907
NM_031418chr1192836 2466 1887 1734 1116 1008 870 822 660 --12316 1849
NM_031427chr14135999 5961 4814 4089 3914 3673 1971 1719 1040 878 721 593 306 35934 1436 33 44839 3755 2142 348 14836
NM_031431chr1361832 1749 1419 1308 492 454 2469 240 11676 --
NM_031435chr12103332 2994 2772 2517 2288 2253 2203 2124 1297 37 188 42904 2433 1364 173 13080
NM_031442chrX113091 3031 2873 2408 2244 2118 1160 1145 758 457 252 22705 973 23170 1208 --
NM_031445chr273249 3135 3026 2192 1293 1180 485 --73299 2873 2225 2220 2215 2210 2197 --
NM_031468chr777055 6829 5844 5739 2395 1280 1198 28248 5077 35771 5308 1455 --
NM_031469chr632614 1414 1243 --31386 1028 698 22853 835
NM_031483chr20113391 2909 2877 2551 1412 1247 1220 714 490 270 40 23365 139 21118 640 --
NM_031844chr1103952 3634 3071 3047 3010 2800 1372 1133 678 333 --11060 --
NM_031845chr2183427 3159 2518 2490 2351 1323 1301 1184 1156 1057 846 668 490 412 360 276 240 84 1580 22426 1228 12898
NM_031847chr2183427 3159 2518 2490 2351 1323 1301 1184 1156 1057 846 668 490 412 360 276 240 84 1580 22426 1228 12898
NM_031849chr552229 2161 2054 1520 786 12002 12349 21673 907
NM_031857chr552229 2161 2054 1520 786 12002 12349 21673 907
NM_031858chr174474 312 89 51 11421 --11348
NM_031860chr552229 2161 2054 1520 786 12002 12349 21673 907
NM_031862chr174474 312 89 51 11421 --11348
NM_031911chr432676 2286 2121 2493 356 32751 2635 1077 --
NM_031935chr131010 317 217 --1782 1223
NM_032012chr9115260 4949 4323 3836 3707 2039 1851 1081 838 574 340 25030 4940 54943 4880 3751 1942 262 11880
NM_032021chr1111155 --21074 45 1323
NM_032047chr331809 858 180 11964 31967 414 194 --
NM_032102chr1183027 2499 1254 1175 727 416 206 172 12949 53084 1199 1064 280 274 1467
NM_032116chr13225800 5527 5399 4941 4899 4776 4243 2138 1991 1746 1736 1703 1661 1512 1149 1092 971 738 649 636 432 333 14614 74885 4002 2258 2241 2236 2231 2122 32255 2251 2247
NM_032121chrX52747 2279 1903 1892 440 1137 11957 12718
NM_032145chr671747 1722 1524 1503 566 105 71 --1332 11943
NM_032153chr342154 2052 289 206 --22387 2175 1296
NM_032154chr1041078 927 855 811 --4843 709 704 691 --
NM_032160chr1894263 4044 3775 2903 2758 1636 1462 709 81 24163 3965 64018 3526 1163 1158 929 186 --
NM_032175chr531294 1270 743 ----21849 1845
NM_032182chr10143 11690 21620 1556 11065
NM_032189chr1344886 4723 1928 1852 24355 4339 74976 4948 4812 4627 4358 1982 1511 21938 1934
NM_032199chr1073651 2926 2686 2625 1523 756 651 13102 23312 483 13106
NM_032221chr2041514 673 243 181 11494 21483 569 21875 1498
NM_032228chr11133548 3113 2932 2735 2514 2319 2305 2204 1171 907 597 561 460 22270 2214 2445 400 22859 1118
NM_032229chr1321091 945 2750 379 31052 950 847 --
NM_032239chr451243 1058 518 432 212 --21267 182 11311
NM_032281chr1943161 3102 2490 2142 12956 --12272
NM_032288chr382395 2141 2011 1801 1486 464 307 121 --32357 1883 127 --
NM_032291chr141771 1460 1239 703 11396 11486 11943
NM_032320chr112650 90 ----2756 694
NM_032321chr243224 1001 983 675 22674 1303 31102 862 537 --
NM_032373chr10184976 4822 4778 4214 3797 3740 2362 2279 2211 1853 1800 1301 1180 1164 882 529 447 392 1867 45781 3667 1239 1123 25224 2186
NM_032380chr53415 390 70 --149 180
NM_032383chr351267 799 510 352 304 --41042 1035 1030 89 11027
NM_032410chr86901 811 361 205 131 91 --1185 21255 1170
NM_032435chr141548 877 710 458 22245 307 42248 2080 966 848 --
NM_032438chr641355 1308 290 54 31560 299 130 21563 1445 --
NM_032439chr1031439 243 150 2498 489 51481 1318 1092 564 365 --
NM_032440chr1082858 2623 2569 2456 2358 1910 978 874 1582 1742 2625 90
NM_032446chr5113588 3478 3000 2924 1202 1120 1045 818 652 491 369 33854 3358 3043 23692 848 --
NM_032457chr493912 3626 3287 3228 2999 2921 2503 1206 668 33778 2394 1411 63044 3007 2775 2559 1011 965 --
NM_032458chrX83437 3412 2875 2714 2687 2163 2088 457 --53375 3040 2140 1250 878 11286
NM_032466chr821575 1130 21047 662 31443 1060 669 1666
NM_032468chr821575 1130 1662 31443 1060 669 1666
NM_032471chr611004 --31104 1071 1065 1311
NM_032505chr352603 2086 1021 994 244 --42546 1918 249 177 --
NM_032509chr821955 809 22334 137 22196 1598 1350
NM_032521chr2063220 3150 2895 2044 1972 307 12139 22736 463 12524
NM_032557chr42159 97 --3931 143 91 1348
NM_032582chr1761802 1351 1335 449 176 105 11269 41272 1226 536 181 21707 1357
NM_032632chr1431810 1776 387 --11252 1670
NM_032682chr363000 2651 969 756 749 728 --12305 23242 2355
NM_032778chr342798 1339 663 483 42073 1204 961 282 33305 2461 1207 1240
NM_032804chr1032140 1807 1745 --2620 381 1964
NM_032813chr1331096 193 105 --2956 758 1441
NM_032828chr19104653 4488 3491 1588 1539 1147 1063 525 433 25 --34812 1812 899 21809 1805
NM_032833chr152132 1988 547 323 303 1857 62538 2054 860 612 475 367 --
NM_032838chr1941258 1071 873 345 1860 2491 108 --
NM_032842chr741705 685 324 268 --21565 1142 1691
NM_032846chr1441544 1229 1129 422 --31167 1067 956 --
NM_032859chr1353832 3721 3461 2542 462 32517 1143 1010 43846 3523 3418 3094 --
NM_032870chr6154 1157 2568 198 1161
NM_032873chr1194303 3694 3398 3179 1135 954 937 315 281 14334 54381 4024 3885 3151 2948 11253
NM_032900chr1083848 3841 3316 2481 2371 1146 830 628 --22550 468 --
NM_032905chr1031294 1007 235 --1154 11251
NM_032918chr1231027 962 940 --31286 1155 523 --
NM_032968chrX73656 3590 3577 2735 1676 1377 386 13189 --13551
NM_032969chrX73656 3590 3577 2735 1676 1377 386 13189 --13551
NM_032973chrY73648 3586 3573 2730 1670 1377 386 13184 --13547
NM_032975chr1863645 3473 2637 2448 1005 520 --23170 3043 --
NM_032978chr1841180 1104 1042 961 2944 227 21013 428 --
NM_032979chr1841180 1104 1042 961 2944 227 21013 428 --
NM_032980chr1863645 3473 2637 2448 1005 520 --23170 3043 --
NM_032981chr1841180 1104 1042 961 2944 227 21013 428 --
NM_032982chr792620 2327 2224 2181 2093 861 702 611 373 11800 32129 950 417 --
NM_033014chr981520 1502 1458 1392 1230 639 524 109 ------
NM_033020chr1154834 4665 4543 4068 3440 3414 3091 3008 1856 1834 1656 1136 975 698 546 44721 1596 711 653 53836 1599 1423 1408 605 11620
NM_033027chr321063 800 --41197 460 447 161 1158
NM_033030chr241062 419 384 344 3567 516 205 31150 395 325 1547
NM_033083chr383410 3292 3108 3099 3026 2951 703 188 22801 609 23308 2934 --
NM_033107chr751834 1655 1364 582 462 --1490 --
NM_033132chr1372251 2162 1570 692 650 375 133 11684 21996 1592 32180 2124 1702
NM_033143chr4164535 4206 3558 3494 3138 3095 1698 1683 1545 1276 1191 921 872 832 801 461 13271 53572 3549 1219 931 689 --
NM_033181chr663743 3640 2875 2628 736 718 --73881 3606 2963 2921 2401 1018 661 12579
NM_033211chr571912 1799 1515 1504 1281 798 357 11767 41323 711 608 482 --
NM_033224chr7167687 7157 7118 7021 6394 6288 5968 5950 5577 3039 2487 1805 1767 1758 1742 1721 25810 1223 67643 7170 6509 6058 5410 2354 --
NM_033225chr852559 942 902 748 204 22448 705 21063 860 --
NM_033260chr64810 748 623 308 1568 2753 736 --
NM_033285chr863274 3264 3168 417 392 225 12879 83467 3384 2821 1113 595 355 350 344 23618 3087
NM_033290chrX63798 2968 2449 1517 1174 764 1239 1335 --
NM_033326chr1182372 2263 2237 1856 1817 947 432 421 --22216 984 12055
NM_033360chr12104487 3782 3598 3276 2948 1794 1576 1072 417 267 --12988 --
NM_033389chr17184803 4673 4260 3915 3857 3325 3167 2943 1775 1631 1242 1155 651 317 252 216 110 82 --34892 1100 994 1224
NM_033394chr231505 607 90 21551 1136 31554 1330 1190 --
NM_033425chr1193227 2789 2229 2133 1167 1111 995 978 381 22969 1229 --12655
NM_033426chr1452757 2738 2167 629 48 --32785 1068 946 12877
NM_033429chr1592574 2537 2394 2343 2033 625 584 324 211 ------
NM_033430chr484161 4033 4002 3438 3286 2797 2753 330 1592 43602 3039 1630 127 --
NM_033437chr484161 4033 4002 3438 3286 2797 2753 330 1592 43602 3039 1630 127 --
NM_033480chr652037 790 503 206 162 12235 1429 1216
NM_033481chr652037 790 503 206 162 12235 1429 1216
NM_033505chr2136548 5520 5490 5412 4837 2625 2325 2131 1825 1555 971 698 591 16742 86009 4824 4175 2056 1473 1254 319 188 11212
NM_033535chr441082 856 741 414 1294 1470 133
NM_033540chr331057 876 69 --21048 852 1413
NM_033632chr441251 1027 474 297 --31582 1438 305 11456
NM_033656chr21195646 5622 5535 5432 5249 4557 4248 3711 2098 2076 1974 1721 1220 1117 682 570 347 154 75 21481 1366 35841 216 160 54774 4418 3639 1909 25
NM_052811chr1384743 4620 3920 3680 3615 3244 1564 1089 13691 65046 4912 4626 4010 3374 2116 --
NM_052832chr892943 2557 2344 2325 2072 1883 288 210 180 --72621 2545 2247 569 303 275 270 --
NM_052879chr1253631 3129 2628 1196 126 11406 83831 3737 3674 3093 2643 2521 1495 1089 22640 669
NM_052885chr12144996 4891 4746 3657 3521 3029 3011 1827 1727 1399 1206 1182 1103 989 44451 4032 1140 30 54569 4314 3532 1188 940 14290
NM_052886chr81175 21823 594 52180 2146 239 203 151 --
NM_052900chr891650 1622 1337 1217 1177 1119 670 482 279 21610 1261 1236 21297 514
NM_052901chr931443 1163 1145 11767 31469 1157 1087 --
NM_052904chr661412 1336 1160 512 339 214 3979 969 403 ----
NM_052905chr261766 1462 1216 712 655 264 ------
NM_052907chr1284304 3856 3801 3605 1464 1398 620 474 --34260 869 127 --
NM_052910chr1342201 1612 1480 682 12171 52174 867 862 857 838 1743
NM_052917chr2113409 2274 2090 1250 1054 963 373 313 279 161 54 22602 2339 53147 3049 969 318 141 --
NM_052918chr1083734 3566 3495 3474 3342 3330 3186 676 --12367 --
NM_052932chr1182490 2463 2043 1883 1633 815 658 65 --11851 1863
NM_052937chr862732 2027 1800 1738 1684 87 --42408 2246 2122 1805 1413
NM_052954chr2151941 635 443 435 397 22216 730 11762 1734
NM_052958chr83649 547 110 196 --179
NM_053002chr341115 825 469 356 --3988 396 101 --
NM_053016chr9146140 5974 5629 2838 2667 2593 2544 2165 1907 1808 1629 1483 194 145 22562 2082 57805 5382 2050 1813 356 --
NM_053025chr341718 1547 498 126 --21567 473 1234
NM_053026chr341718 1547 498 126 --21567 473 1234
NM_053027chr341718 1547 498 126 --21567 473 1234
NM_053028chr341718 1547 498 126 --21567 473 1234
NM_053031chr341718 1547 498 126 --21567 473 1234
NM_053032chr341718 1547 498 126 --21567 473 1234
NM_053042chr462896 2722 2711 2062 1205 42 --32081 1952 934 --
NM_053043chr795792 5256 4441 4136 4059 2150 1803 1428 1134 --86356 5087 4953 4885 4052 1849 665 254 15448
NM_054016chr152008 1448 807 250 21 11766 21719 1485 21243 43
NM_054016chr152008 1448 807 250 21 11766 21719 1485 21243 43
NM_054016chr152008 1448 807 250 21 11766 21719 1485 21243 43
NM_057159chr921218 1071 --1395 21172 371
NM_057168chr751665 1644 1359 1204 403 1455 11596 --
NM_057169chr1293128 3076 3031 2770 845 411 283 192 142 1610 1571 --
NM_057170chr1293128 3076 3031 2770 845 411 283 192 142 1610 1571 --
NM_057175chr442671 2574 2460 1827 --32269 2208 2049 12046
NM_057749chr841221 1046 234 180 --21353 1169 1894
NM_058170chr191348 561 536 493 362 122 99 89 22 --21588 441 1468
NM_058237chr14----4802 684 668 323 1729
NM_058241chr292366 2199 2188 2079 1689 1671 1434 142 135 1318 1568 22342 1618
NM_058241chr292366 2199 2188 2079 1689 1671 1434 142 135 1318 1568 22342 1618
NM_078476chr641886 1786 1736 1367 --11673 11756
NM_078487chr943342 2280 2137 581 11267 22882 339 13017
NM_080546chr962239 1874 539 436 391 196 1255 11879 1347
NM_080617chr206879 833 792 171 97 69 11084 2319 278 --
NM_080629chr141131 1076 606 385 1988 21473 1340 --
NM_080630chr141131 1076 606 385 1988 21473 1340 --
NM_080676chr2092995 2983 2319 2257 2104 1309 973 380 352 --32438 2289 2117 12114
NM_080743chr662595 2391 1769 888 804 583 --11600 1237
NM_080759chr1332594 1770 734 --11036 11777
NM_080760chr1332594 1770 734 --11036 11777
NM_080764chr22103255 2828 2633 2538 2235 1187 948 598 182 158 --32220 465 276 --
NM_080832chrX71430 1260 1167 310 193 149 77 --51453 536 519 510 154 --
NM_080867chr14114745 4184 3883 3508 3210 2020 1858 1521 1013 720 473 13438 65091 5021 4417 3945 603 57 24859 4368
NM_080872chr883926 3442 3313 3306 3241 2874 1377 1076 ----23189 110
NM_080921chr181170 1087 999 934 850 756 200 48 ------
NM_080927chr383354 2745 2639 2291 1358 513 308 31 --33319 1103 858 12698
NM_130387chr321177 790 --21071 824 1821
NM_130391chr973529 3395 2792 2344 1045 834 702 12825 83517 3214 3187 3101 2919 630 622 543 1249
NM_130392chr973529 3395 2792 2344 1045 834 702 12825 83517 3214 3187 3101 2919 630 622 543 1249
NM_130393chr973529 3395 2792 2344 1045 834 702 12825 83517 3214 3187 3101 2919 630 622 543 1249
NM_130439chr1062145 2134 1962 568 544 537 --21587 895 --
NM_130439chr1062145 2134 1962 568 544 537 --21587 895 --
NM_130798chr1531343 1324 1253 128 31486 1030 367 --
NM_130809chr5103059 2758 1093 932 886 767 702 576 334 115 --33080 2144 695 11033
NM_130831chr372892 2819 2135 1107 985 918 309 1326 31958 1787 720 22584 842
NM_130832chr372892 2819 2135 1107 985 918 309 1326 31958 1787 720 22584 842
NM_130833chr372892 2819 2135 1107 985 918 309 1326 31958 1787 720 22584 842
NM_130834chr372892 2819 2135 1107 985 918 309 1326 31958 1787 720 22584 842
NM_130835chr372892 2819 2135 1107 985 918 309 1326 31958 1787 720 22584 842
NM_130836chr372892 2819 2135 1107 985 918 309 1326 31958 1787 720 22584 842
NM_130837chr372892 2819 2135 1107 985 918 309 1326 31958 1787 720 22584 842
NM_130838chr1561569 1331 348 249 233 175 --1316 --
NM_130839chr1561569 1331 348 249 233 175 --1316 --
NM_130847chr1165371 4366 3621 1332 278 204 --35946 5414 722 --
NM_133265chrX82833 1349 962 345 339 131 64 51 --33422 907 618 --
NM_133329chr241781 1424 753 292 11768 31821 589 402 1237
NM_133334chr4115380 5342 5278 5171 4347 4262 4182 1943 719 548 79 25249 3864 46319 4848 1976 1458 53880 3876 3872 3868 3857
NM_133370chr473412 2705 823 311 226 129 112 23579 1045 2538 86 22542 1049
NM_133372chr562673 2569 2120 479 439 385 --11973 12186
NM_133468chr782516 2296 1579 1020 944 782 591 342 32087 1718 165 ----
NM_133473chr1961892 1356 1339 1206 637 559 --31939 1437 1275 11878
NM_133493chr6174656 4627 4494 4478 4096 4076 3901 3580 3514 3494 3428 3410 3341 2983 1461 1272 316 --34102 3346 3322 --
NM_133496chr1134479 4409 4163 3924 3907 3898 3692 3653 3347 1502 1413 1118 439 --54096 1715 686 679 667 --
NM_133631chr391590 1564 1384 1326 1140 170 159 146 120 11653 3635 624 480 11491
NM_133646chr285329 5178 4741 4458 4166 1428 359 349 25139 946 55547 4726 1630 341 165 --
NM_134265chr1721054 784 2834 164 --1108
NM_134442chr251504 1392 1307 1170 143 --2148 83 --
NM_138270chrX83349 3229 2937 2652 2159 1300 530 380 22756 2619 63268 3061 2277 1259 719 53 --
NM_138286chr19124316 4223 4080 4030 3916 3336 2718 1718 1698 1095 836 710 43494 1709 924 815 54407 3214 3161 2846 312 12952
NM_138292chr1183558 2381 2168 1136 921 882 854 28 --31049 837 61 --
NM_138316chr1031168 498 333 --11069 1379
NM_138335chr46794 654 289 219 121 114 --1353 1661
NM_138348chr565053 4655 1815 1656 1463 690 24579 2542 16454 14894
NM_138395chr241155 474 333 300 --3172 62 55 --
NM_138400chr753406 3265 2726 1230 158 --23462 2834 --
NM_138426chr741893 1749 1588 623 12517 22207 1612 --
NM_138444chr1353711 3687 3412 1949 1391 24018 1060 74034 3979 3884 3794 3113 1349 1293 14482
NM_138459chr663472 2802 2740 2730 1234 744 --22254 898 1978
NM_138468chr275974 4229 4032 4025 1065 621 335 34086 1725 1000 26323 593 15648
NM_138473chr1254201 1981 941 533 514 --34833 4265 3325 --
NM_138494chr75818 712 671 505 44 32427 1112 981 2995 805 2968 776
NM_138554chr922131 259 11760 31026 650 629 11844
NM_138576chr14144711 4700 4674 4640 4591 4509 3772 3037 1120 581 523 283 276 235 11170 64788 3747 3645 3639 3584 1298 13592
NM_138621chr242650 1413 900 568 22884 1634 43897 2872 1291 479 --
NM_138633chr641682 1333 1104 239 --21483 1452 21754 516
NM_138638chr1462276 2245 1997 1988 951 599 32293 393 147 22281 1845 1151
NM_138694chr652816 2659 2604 2271 1274 33522 2284 254 23011 558 --
NM_138713chr16207953 7907 7631 7587 7424 7067 6904 6761 6474 6090 6031 3049 2915 2761 2402 2171 1431 519 381 275 47012 5049 3072 1884 98167 8015 7133 7128 6651 5060 1948 1536 648 38006 2456 1533
NM_138714chr16207953 7907 7631 7587 7424 7067 6904 6761 6474 6090 6031 3049 2915 2761 2402 2171 1431 519 381 275 47012 5049 3072 1884 98167 8015 7133 7128 6651 5060 1948 1536 648 38006 2456 1533
NM_138731chr14103962 3638 3474 3348 2864 1284 869 770 250 58 34011 3231 191 33700 3247 980 --
NM_138735chr241366 1294 1076 1005 173 2976 45 1244
NM_138771chr751586 1381 1261 407 179 --21061 335 21202 353
NM_138782chr552376 1952 813 283 232 12302 21556 735 11528
NM_138799chr2------21722 1618
NM_138959chr186728 6281 6266 5602 4548 394 100 24 36110 5695 572 66011 2540 2439 2150 2092 157 15906
NM_138970chr1432418 2330 41 --32211 1665 620 12355
NM_138971chr1172730 2530 1513 1213 1120 899 874 12963 11250 --
NM_138971chr1172730 2530 1513 1213 1120 899 874 12963 11250 --
NM_138972chr1172730 2530 1513 1213 1120 899 874 12963 11250 --
NM_138972chr1172730 2530 1513 1213 1120 899 874 12963 11250 --
NM_138973chr1172730 2530 1513 1213 1120 899 874 12963 11250 --
NM_138973chr1172730 2530 1513 1213 1120 899 874 12963 11250 --
NM_139076chr451445 1276 1252 1076 430 --3197 101 33 --
NM_139182chr461505 1457 1439 584 496 31 21868 1618 41871 1354 652 192 --
NM_139207chr1262032 778 754 458 414 224 164 11890 --
NM_139279chr293530 3424 3416 3319 3017 2923 2730 132 86 --13033 --
NM_139283chr1232062 983 696 22241 2183 42111 1930 1689 240 21666 1590
NM_139319chr1261821 1623 1429 1411 1400 1384 1457 ----
NM_139321chr2053917 3006 1217 1023 481 13962 13973 13450
NM_144571chr4186795 6674 6211 6154 5383 5266 4969 2510 2343 1670 1638 1379 1189 1098 893 485 168 118 24565 1575 56663 6179 4615 2426 2136 36176 4346 741
NM_144578chr1464937 4295 1971 872 366 354 24177 1438 54077 1558 617 577 228 --
NM_144599chr15125541 5506 5271 4315 4307 4145 3489 2102 2036 1244 858 245 1311 45159 4012 1249 251 --
NM_144632chr282294 1615 949 868 627 256 131 73 1829 32274 1673 428 11690
NM_144633chr321407 538 --11491 1566
NM_144642chr361211 1178 478 432 263 134 --11014 1957
NM_144664chr1182402 2214 2200 1648 611 586 512 215 12418 21760 996 2932 706
NM_144721chr431975 1861 1069 31877 92 65 32786 1880 439 1993
NM_144767chr1533424 3204 633 --54497 2977 1567 638 371 24596 1613
NM_144770chr213875 792 253 11052 1853 1850
NM_144775chr1754631 4612 3489 1649 1369 13420 54827 3621 3014 1975 500 --
NM_144778chr1342672 2394 754 370 1478 --32323 2319 1963
NM_144963chr862633 2218 2179 1705 1675 628 --32239 802 754 11711
NM_144973chr1294688 4627 4124 3682 1496 1402 781 771 756 --34343 3758 169 14414
NM_145000chr53417 239 94 ----1256
NM_145052chrX41060 892 272 160 1153 1842 --
NM_145055chr18103697 3067 3022 2985 2962 2569 2524 1453 247 73 --73706 3363 2972 2917 548 363 261 13369
NM_145165chr14122833 2782 2720 2674 2544 2461 2423 2363 2317 1151 1083 75 --12384 --
NM_145176chr663448 3250 2910 2361 581 372 23315 804 23412 2776 21335 751
NM_145185chr1942002 680 670 272 --21747 1731 11738
NM_145206chr1093328 3303 3112 2972 2754 2065 1251 1213 530 --33294 1166 221 1249
NM_145207chr465064 5005 4741 3602 1523 1314 34363 4035 1497 2446 257 --
NM_145212chr241429 1301 1208 70 ----145
NM_145235chr10------2108 104
NM_145246chr1041147 338 315 171 --3409 347 240 --
NM_145259chr2126878 6846 6793 6037 5143 2479 2447 1627 1261 1001 854 817 24975 2300 106949 5273 5072 2813 2144 2116 1797 1761 319 214 56852 2357 2304 649 247
NM_145263chr492381 2292 2237 1948 1558 852 597 389 262 --22101 198 --
NM_145284chrX42017 595 523 212 22173 861 62297 2188 1769 1732 495 450 --
NM_145307chr10164325 4264 4238 3703 3598 3410 3104 3041 1753 1739 1637 1395 986 947 422 264 1814 24338 3772 1803
NM_145320chr763531 3467 2945 2341 1248 907 12894 73457 3452 3339 3285 3228 3053 537 --
NM_145321chr763531 3467 2945 2341 1248 907 12894 73457 3452 3339 3285 3228 3053 537 --
NM_145322chr763531 3467 2945 2341 1248 907 12894 73457 3452 3339 3285 3228 3053 537 --
NM_145341chr1051681 1343 664 462 273 ----1377
NM_145649chr621012 260 22495 987 11732 11673
NM_145655chr621012 260 22495 987 11732 11673
NM_145686chr252862 2494 1079 697 392 13208 33183 2070 951 --
NM_145687chr252862 2494 1079 697 392 13208 33183 2070 951 --
NM_145690chr851448 733 650 631 603 --1655 --
NM_145698chr1082177 2026 1859 1681 777 744 391 294 32127 1709 846 --11788
NM_145799chrX53089 2759 2145 2117 601 --22917 981 1655
NM_145808chr732726 2491 331 12287 23029 896 1684
NM_147166chr74853 825 231 24 ----2559 237
NM_147223chr242042 1977 980 466 --11982 12402
NM_147233chr251859 1794 865 797 283 1829 11799 12219
NM_148174chr852205 1360 763 428 173 1321 --2710 706
NM_148571chr1771501 553 491 351 340 311 100 --1651 --
NM_148894chr461220 1111 972 950 812 793 --51185 483 473 427 197 1424
NM_148921chr1722452 759 32428 783 696 1471 1921
NM_148955chr15116604 6370 6071 5256 2626 2220 1905 1748 1515 762 162 --12443 24794 168
NM_148977chr1031168 498 333 --11069 1379
NM_148978chr1031168 498 333 --11069 1379
NM_152221chr2211136 --31040 1035 1030 11081
NM_152261chr1221941 584 21781 485 32045 1784 477 --
NM_152263chr155202 4699 4521 871 456 --15924 24711 1847
NM_152265chr141567 1383 1280 158 --41572 1555 1458 1237 --
NM_152277chr551666 1652 858 539 63 1636 42002 1997 1828 262 --
NM_152292chr482289 2241 1732 1646 1576 1541 707 98 --4542 298 288 88 12281
NM_152330chr1422640 2629 22441 1952 42174 958 823 692 --
NM_152332chr1452249 2017 1905 893 412 --41913 1084 835 735 12027
NM_152352chr1882961 2539 991 802 742 627 407 83 --12661 12545
NM_152388chr243787 3682 2622 2517 13818 42865 2737 403 254 --
NM_152407chr5113133 2958 2859 2747 2641 2098 927 870 742 716 445 --32740 2734 133 2933 60
NM_152409chr5133579 3101 2634 2482 2435 2219 2207 1226 899 576 541 279 237 43197 2708 2248 1241 63239 2422 2406 1244 472 71 13441
NM_152414chr851674 1330 1260 627 471 11280 175 --
NM_152417chr84961 520 278 230 21230 529 1144 21021 999
NM_152422chr941700 1580 590 297 21381 163 41884 239 166 108 21239 236
NM_152423chrX71382 1192 1092 591 519 120 25 --21435 344 --
NM_152424chrX74546 4405 3860 3776 1580 1246 561 --23789 3536 --
NM_152437chr1292448 2348 2210 2028 1614 971 710 516 399 --2670 582 --
NM_152446chr14124 --2674 219 1671
NM_152470chr1843955 3937 3872 695 13865 24058 700 23913 3909
NM_152519chr272160 1692 1678 1520 714 398 211 1674 32129 1745 1403 --
NM_152522chr23897 646 107 2786 425 1750 --
NM_152527chr282335 2273 1927 1550 778 148 121 30 --11937 12366
NM_152551chr661008 944 917 220 150 120 --33037 2117 261 1847
NM_152556chr782575 2440 2344 2150 653 596 501 165 --22349 572 31685 796 780
NM_152588chr1251758 1318 1273 636 620 --21239 316 21439 1435
NM_152594chr15112369 2181 2001 1893 1756 1544 839 689 655 351 242 21571 460 ----
NM_152608chr182594 2295 2273 1699 1021 1005 848 397 3938 335 264 51858 813 489 484 479 --
NM_152622chr573464 3266 2983 2695 2619 2547 2462 12136 31185 508 164 22793 770
NM_152624chr5157047 6789 6655 6355 5694 5637 5204 4643 2969 2497 1516 1377 964 554 253 36020 2436 1824 56774 5669 2603 1865 276 12093
NM_152629chr983710 3339 3277 3243 2865 2641 1642 1316 22950 639 34112 3419 3255 --
NM_152641chr1262635 1808 1778 954 912 111 1578 12227 --
NM_152673chr394423 3979 3853 3525 3494 3454 3315 694 662 12934 21454 1136 23985 3273
NM_152678chr372334 2215 2103 2080 654 609 529 12190 22402 741 --
NM_152695chrX82220 2100 1589 1472 921 543 520 420 12299 ----
NM_152699chr343122 2418 872 245 --3202 155 138 13708
NM_152705chr1331353 1321 344 ----11381
NM_152724chr1072703 2641 1686 585 409 400 55 --31996 642 112 1549
NM_152745chr731071 934 321 --31140 1013 890 --
NM_152756chr5114201 3666 3232 2825 2690 1385 1268 741 611 370 223 23550 3101 52815 1367 748 660 308 24067 1543
NM_152758chr8102975 2829 2767 1915 1140 1132 1059 886 733 312 12760 22499 2172 12916
NM_152765chr822267 295 --32337 2292 2257 12273
NM_152774chr752299 1934 1864 1022 481 21747 637 1517 --
NM_152787chrX103868 3789 3599 3358 2768 1454 1386 1279 782 333 33730 1297 1152 23044 99 --
NM_152793chr715082 24455 1184 24730 3773 34487 1004 960
NM_152826chr15116604 6370 6071 5256 2626 2220 1905 1748 1515 762 162 --12443 24794 168
NM_152835chr1102918 2721 2574 2224 2097 1965 647 491 173 145 12058 11066 1822
NM_152836chr841903 647 529 434 41829 1649 1598 1190 21193 1170 11892
NM_152837chr841903 647 529 434 41829 1649 1598 1190 21193 1170 11892
NM_152838chr20143360 2767 2676 2578 2570 2406 2259 2218 2200 1093 597 522 507 467 --32778 2153 659 13044
NM_152878chr22----11544 21541 1052
NM_152902chr191941 1933 1843 1831 1701 1626 1420 444 68 --12013 --
NM_152924chr15126801 6764 6118 5992 5843 5180 1904 1324 1167 1139 792 385 --12693 12065
NM_152989chr1261850 1772 1752 1382 1337 666 --2752 493 --
NM_152999chr7134819 4799 3754 3413 3267 3146 1909 1497 1049 1014 678 671 52 --23201 700 33658 3586 1808
NM_153013chr552392 2307 2285 626 396 --22158 616 --
NM_153020chr641494 1417 471 142 21677 1203 21114 306 21404 1270
NM_153035chr192824 2217 2095 2088 2068 1243 1142 866 187 --32050 1231 646 21253 1249
NM_153050chr2234993 4696 1875 --11978 24391 3876
NM_153051chr2234993 4696 1875 --11978 24391 3876
NM_153182chr342798 1339 663 483 42073 1204 961 282 33305 2461 1207 1240
NM_153184chr341571 1523 1445 78 11811 31244 798 772 1714
NM_153188chr5134920 4739 4585 4300 3999 3873 3650 3438 2227 1753 1604 1377 816 --31584 1579 1051 1963
NM_153207chr1293280 3272 1632 1625 1416 1388 852 789 446 --23674 3298 1813
NM_153223chr541232 1183 448 217 2555 159 31566 192 148 1559
NM_153261chr1641359 1333 633 472 1644 11569 11386
NM_153262chr152541 2209 643 559 311 1395 63001 2470 666 659 613 526 --
NM_153267chr93642 286 135 1330 --1849
NM_153332chr882299 2277 2141 1167 1110 903 368 218 --12414 --
NM_153346chrX32005 1612 1422 21698 1449 2560 391 --
NM_153362chr61828 1650 1240 1738
NM_153371chr13112351 2295 2263 2217 2159 2037 1739 1712 1461 776 72 --21679 831 21556 154
NM_153377chr122377 272 ----2124 56
NM_153456chr13186261 6170 6087 6068 6007 5088 4748 4733 4362 4174 4129 3884 2212 1512 1397 1339 1297 762 14893 36196 5988 147 --
NM_153607chr531117 494 68 12221 52613 1217 1180 1063 904 11271
NM_153649chr131423 649 628 --1641 --
NM_153686chr452313 2244 1594 717 135 --62390 1867 875 736 284 30 12477
NM_153689chr231743 830 456 --21939 412 11993
NM_153810chr1084633 4561 4451 4186 3754 3695 3207 1061 --53714 1563 1430 1021 375 --
NM_170665chr1274370 4310 3585 762 624 454 53 44420 4300 1701 738 24360 1179 1742
NM_170696chr152506 314 21538 1380 21710 376 11384
NM_170697chr152506 314 21538 1380 21710 376 11384
NM_170706chr124265 947 --33425 2974 495 2969 492
NM_170709chr882308 1859 1600 947 911 567 221 104 1581 22215 1869 --
NM_170710chr442993 2940 2494 2421 --32539 2117 847 1832
NM_170725chr15774 751 584 258 158 1232 1566 2236 208
NM_170731chr1172753 2562 2294 1053 427 194 159 --22533 577 12186
NM_170732chr1172753 2562 2294 1053 427 194 159 --22533 577 12186
NM_170733chr1172753 2562 2294 1053 427 194 159 --22533 577 12186
NM_170734chr1172753 2562 2294 1053 427 194 159 --22533 577 12186
NM_170735chr1172753 2562 2294 1053 427 194 159 --22533 577 12186
NM_170736chr211424 --31013 974 553 1377
NM_170737chr211424 --31013 974 553 1377
NM_170740chr673401 3115 2870 2380 2134 631 72 --3697 692 669 12697
NM_170751chr661385 1249 388 340 223 150 ----1969
NM_170752chr661385 1249 388 340 223 150 ----1969
NM_171998chrX42248 2127 1973 940 --11892 12509
NM_172058chr861862 1666 1626 1350 1165 522 1481 21893 1761 --
NM_172059chr861862 1666 1626 1350 1165 522 1481 21893 1761 --
NM_172060chr861862 1666 1626 1350 1165 522 1481 21893 1761 --
NM_172069chr292350 2082 2074 2056 1795 1597 755 391 247 --42245 2170 1567 145 21543 73
NM_172070chr262266 846 596 321 234 34 22155 1837 31926 348 51 --
NM_172071chr1187313 7258 7001 6756 6089 6046 5919 4955 4616 2594 2083 1443 1125 1008 745 727 614 577 11615 157394 6475 6465 5944 5658 5539 5224 5029 4642 2756 2538 2137 685 672 274 11744
NM_172127chr482036 2022 1809 1517 1433 817 684 536 --1805 --
NM_172128chr481992 1978 1765 1473 1389 773 640 492 --1761 --
NM_172159chr362332 1737 1724 1548 892 649 11479 21820 876 --
NM_172160chr362332 1737 1724 1548 892 649 11479 21820 876 --
NM_172178chr1241257 435 313 43 1171 11383 21167 218
NM_172193chr1421213 427 ----21302 85
NM_172240chr122361 283 1224 41390 1177 999 21 1303
NM_172344chr241781 1424 753 292 11768 31821 589 402 1237
NM_173082chr631162 545 310 --11578 11575
NM_173083chr131167 388 197 --31018 814 187 --
NM_173198chr951960 945 660 646 86 --32884 2503 525 --
NM_173200chr951960 945 660 646 86 --32884 2503 525 --
NM_173214chr16207953 7907 7631 7587 7424 7067 6904 6761 6474 6090 6031 3049 2915 2761 2402 2171 1431 519 381 275 47012 5049 3072 1884 98167 8015 7133 7128 6651 5060 1948 1536 648 38006 2456 1533
NM_173463chr443972 3273 3113 1098 --43641 3408 3249 765 13894
NM_173468chr4145972 5666 5473 5165 5078 4538 4468 1791 1483 1438 1345 1191 608 142 21806 1728 45923 5542 5387 1714 15129
NM_173470chrX61960 1876 1831 787 599 222 21002 316 4864 709 535 319 22411 235
NM_173475chr1651682 1242 512 198 189 11213 1177 --
NM_173496chr1082940 2812 2655 2397 1005 926 826 160 11968 32821 978 780 --
NM_173510chr2252942 2284 2251 163 147 --12499 12812
NM_173511chr233596 3295 2816 12579 23789 3040 12831
NM_173519chr892054 1910 1709 1289 697 611 585 501 275 11396 11566 --
NM_173531chr19103885 3867 3165 2809 2648 2601 2511 2431 1133 1050 11149 43861 3260 3133 2770 32850 2753 1301
NM_173552chr362444 2305 1985 1627 770 681 1692 12174 1511
NM_173557chr182561 475 --2625 566 1494
NM_173576chr1062288 773 653 203 180 113 1138 42127 1910 1424 907 11538
NM_173582chr11146204 6129 5906 5738 5558 4684 4659 4333 4229 4173 3814 1135 1028 942 21186 928 72451 2207 1968 1905 1037 985 128 --
NM_173602chr1232665 2536 1382 --23709 2518 23706 1501
NM_173607chr1461858 1719 1653 684 519 72 197 21892 146 --
NM_173642chr199177 7695 7586 7494 6885 2304 2147 1501 1323 17553 31158 781 90 11489
NM_173648chr261081 1009 828 294 288 131 2956 391 2756 374 --
NM_173654chr372378 2343 2316 2110 1842 1614 87 --42390 1584 1533 891 --
NM_173683chr831771 644 491 1392 41722 1652 1165 1158 --
NM_173694chrX52442 2301 937 698 172 --2960 692 --
NM_173808chr164214 3977 3729 3509 1445 487 13989 33802 1338 1078 --
NM_173822chr261958 1769 774 564 517 53 ----1116
NM_173825chr352986 2900 2788 1135 475 21250 501 23083 1242 --
NM_173829chr5175835 5762 5745 4989 4189 4112 4051 4001 3969 3899 2032 1660 1106 881 865 308 254 36109 5776 5157 45688 5187 2251 961 1843
NM_173851chr873660 3303 3015 2847 1122 844 610 11606 1632 2576 139
NM_173854chr131907 679 134 12360 22246 417 12438
NM_174900chr431244 1175 340 --2219 194 2229 204
NM_174911chr853861 3620 3129 2756 1208 --43777 3751 3219 524 --
NM_174916chr1582352 2220 2213 2170 663 501 265 242 --42036 1741 275 270 --
NM_175056chr341954 815 673 165 22200 1813 41515 556 290 285 --
NM_175061chr761965 1606 714 667 440 212 11825 --1724
NM_175623chr1277717 7199 6768 6640 6524 2593 587 --76169 4832 1147 575 491 450 81 --
NM_175624chr1297812 7294 6863 6735 6619 4727 2688 682 79 --76264 4927 1242 670 586 545 176 --
NM_175625chr1297812 7294 6863 6735 6619 4727 2688 682 79 --76264 4927 1242 670 586 545 176 --
NM_175709chr22192 --13004 23048 98
NM_175736chr1297838 6706 6151 5412 5085 4899 2204 562 546 25119 1172 36945 2748 226 --
NM_175854chr1342619 2572 2342 944 --22325 225 12333
NM_175856chr5285 65 --5759 687 563 251 113 1799
NM_175863chr61938 11306 2922 916 --
NM_175866chr131442 388 298 1378 --1115
NM_175910chr1972320 2113 2076 2045 2028 1903 917 12129 ----
NM_175921chr5144263 3928 3508 1631 1541 1432 1265 1032 912 621 549 363 314 165 --23968 2851 --
NM_176081chr10125473 4572 4163 2412 2352 2323 2228 1827 846 653 141 107 25331 1287 85334 4674 4376 3736 667 466 386 45 --
NM_176083chr10125473 4572 4163 2412 2352 2323 2228 1827 846 653 141 107 25331 1287 85334 4674 4376 3736 667 466 386 45 --
NM_176814chr741509 1456 1134 541 --41123 557 418 39 --
NM_176815chr362867 2770 1177 312 129 109 --22910 547 --
NM_176823chr143880 3408 2504 75 13867 22489 1490 13871
NM_176894chr341649 232 112 31 ----11088
NM_177424chr131889 634 185 2454 117 21303 466 --
NM_177438chr1474149 4082 3686 3607 3060 2927 1268 21070 62 53913 3706 3246 2789 738 --
NM_177538chr2168888 8753 8063 7701 5954 5693 3434 3026 3008 2553 2358 995 327 268 206 168 26462 2564 58471 8072 6109 2380 239 36106 6102 6098
NM_177947chrX41718 1327 1138 305 11683 150 11347
NM_177948chrX41718 1327 1138 305 11683 150 11347
NM_177968chr271761 1414 1406 886 504 279 150 2878 519 1475 11467
NM_177995chr941700 1580 590 297 21381 163 41884 239 166 108 21239 236
NM_178010chr1261850 1772 1752 1382 1337 666 --2752 493 --
NM_178011chr10113253 2967 2598 2187 1996 1173 959 804 547 434 75 --22698 2615 22164 1096
NM_178140chr53703 436 229 --32550 2321 302 12637
NM_178151chrX187882 7847 7810 7358 7142 6934 6652 6439 6114 5829 5732 5248 5094 5084 4889 1532 1377 127 12192 45644 2209 160 110 --
NM_178152chrX187882 7847 7810 7358 7142 6934 6652 6439 6114 5829 5732 5248 5094 5084 4889 1532 1377 127 12192 45644 2209 160 110 --
NM_178153chrX187882 7847 7810 7358 7142 6934 6652 6439 6114 5829 5732 5248 5094 5084 4889 1532 1377 127 12192 45644 2209 160 110 --
NM_178313chr252120 1886 1621 229 196 1603 32211 1535 1340 2508 208
NM_178450chr5133 ----3657 599 243
NM_178470chrX61628 1300 620 528 319 313 21465 682 21151 669 --
NM_178505chr1043649 2588 632 575 23065 2632 42855 2270 1104 1083 --
NM_178509chr1783840 3255 3068 3002 2634 2567 1175 607 1394 54075 3173 2939 1629 397 12752
NM_178566chr921694 1642 --2306 142 1361
NM_178585chr4103198 3039 2826 2788 2640 2499 1023 635 346 322 22843 1234 23294 2661 12537
NM_178586chr1452185 2020 1787 908 472 --3805 792 696 --
NM_178815chr1092572 2500 2438 2051 875 759 611 251 33 --32165 1057 712 1640
NM_178842chr1572155 2063 1979 1904 1648 1516 377 --1764 --
NM_180989chr1342303 2235 2192 1815 21906 127 31897 812 556 --
NM_181054chr1461241 1175 465 400 353 165 --2848 430 2427 423
NM_181077chr1562192 2042 1513 827 501 119 --3232 149 92 184
NM_181265chr442993 2940 2494 2421 --32539 2117 847 1832
NM_181332chrX92659 2474 2159 2148 1680 888 735 688 525 --22679 1668 --
NM_181354chr831533 536 132 11443 2282 157 1370
NM_181358chr1114094 3920 3455 2608 1323 1196 901 808 615 545 224 --42684 510 393 388 --
NM_181361chr351345 567 229 173 56 --21047 290 11231
NM_181442chr201147 --31022 1005 273 1949
NM_181443chr20112703 2579 2513 2494 2137 1886 909 736 512 389 354 12792 11044 12423
NM_181481chr1896750 5376 5367 4590 4525 2431 1600 1051 882 12707 76647 6612 6156 5189 4980 469 222 16741
NM_181482chr1896750 5376 5367 4590 4525 2431 1600 1051 882 12707 76647 6612 6156 5189 4980 469 222 16741
NM_181483chr1896750 5376 5367 4590 4525 2431 1600 1051 882 12707 76647 6612 6156 5189 4980 469 222 16741
NM_181504chr5114124 3609 3540 2714 2606 2567 1621 1129 838 826 499 13943 31236 930 504 --
NM_181521chr1636770 6497 762 26097 2225 47148 6906 2799 126 25750 4471
NM_181523chr5114124 3609 3540 2714 2606 2567 1621 1129 838 826 499 13943 31236 930 504 --
NM_181524chr5114124 3609 3540 2714 2606 2567 1621 1129 838 826 499 13943 31236 930 504 --
NM_181659chr2073152 2459 2088 1245 1042 545 148 --33087 2490 579 1725
NM_181659chr2073152 2459 2088 1245 1042 545 148 --33087 2490 579 1725
NM_181670chr1241380 1366 1320 1309 1495 21449 316 --
NM_181702chr85978 901 894 713 671 1657 1191 --
NM_181705chr5125817 5787 5316 4462 4210 1393 1312 1174 1087 992 772 502 24826 1221 35142 2248 222 22245 2241
NM_181706chr1172019 1811 492 266 257 106 90 21617 174 1177 --
NM_181714chr661748 1618 1396 589 315 62 11759 21976 334 11485
NM_181723chr892233 1864 1812 1423 494 436 353 321 260 11494 21853 650 22253 330
NM_181782chr652149 1732 902 400 377 1426 1306 22271 500
NM_181787chr853862 3541 1529 1180 295 31103 983 388 43646 1397 1333 21 13186
NM_181794chr611004 --31104 1071 1065 1311
NM_181795chr611004 --31104 1071 1065 1311
NM_181836chr532479 2159 204 11882 21010 174 22631 2498
NM_181897chr352311 1755 1683 756 72 11039 11688 --
NM_182485chr4123597 3340 3270 3135 3045 3011 2572 2357 555 448 349 258 --93615 3526 3489 3325 3214 3209 3003 2630 2466 --
NM_182487chr974329 3041 1646 1544 787 752 92 --44390 4369 2849 758 --
NM_182488chr136944 922 754 300 53 38 1675 2678 187 --
NM_182493chr1675328 4395 2074 1092 585 437 116 --14348 14708
NM_182501chr273260 1036 501 363 108 102 56 12117 2460 305 --
NM_182515chr19126401 6371 6301 6241 5635 5578 5493 2041 2026 1638 1494 38 12522 85542 5036 5023 4423 4304 2506 1561 1113 12202
NM_182524chr47616 598 580 162 153 96 87 ------
NM_182551chr252797 1246 1176 564 119 13337 23462 3430 12681
NM_182607chrX41719 695 312 297 --2719 343 --
NM_182641chr1771910 1782 618 452 437 424 262 11944 1122 1397
NM_182646chr4123597 3340 3270 3135 3045 3011 2572 2357 555 448 349 258 --93615 3526 3489 3325 3214 3209 3003 2630 2466 --
NM_182648chr142635 523 ----1540
NM_182697chr761757 1688 359 177 95 37 11595 ----
NM_182756chr22555 122 --1578 1575
NM_182757chr642577 1419 1071 264 11230 33429 2589 2583 --
NM_182758chr1533453 3361 68 --23154 2725 12532
NM_182765chr1042101 1573 802 600 22069 1997 42028 1806 1643 615 12025
NM_182767chr1221883 766 --51916 1836 1459 37 28 11365
NM_182789chr53677 212 171 --2734 411 1712
NM_182830chr1452192 1911 1538 621 611 1566 1466 11571
NM_182848chr1331257 362 180 11060 --2517 219
NM_182896chr351810 1714 1565 1254 542 21218 1205 --11635
NM_182898chr7126490 6465 5178 4966 4279 4263 4210 4083 4069 2271 798 299 14808 104334 4320 4177 1651 1510 1498 1138 673 652 127 14356
NM_182899chr7126490 6465 5178 4966 4279 4263 4210 4083 4069 2271 798 299 14808 104334 4320 4177 1651 1510 1498 1138 673 652 127 14356
NM_182907chr672163 1778 634 616 371 343 22 22399 241 12297 --
NM_182931chr75582 476 459 143 128 --2677 203 1296
NM_182943chr341041 1005 886 860 1347 31228 242 33 1374
NM_182948chr173065 2759 2047 456 291 132 107 --1322 11961
NM_182962chr11142 ----2103 99
NM_183004chr1473407 2994 1493 942 670 480 376 21119 215 22794 828 --
NM_183078chr673423 2744 2731 2518 596 355 179 --41487 1224 797 748 --
NM_183234chr152632 309 21316 1200 11565 11298
NM_183235chr152632 309 21316 1200 11565 11298
NM_183236chr152632 309 21316 1200 11565 11298
NM_183323chr53677 212 171 --2734 411 1712
NM_183376chr1582543 2327 2252 2111 2046 1934 1734 588 1790 22623 2396 --
NM_183380chr63947 708 130 145 2870 150 --
NM_183416chr151744 1435 1421 760 614 1101 11795 --
NM_183419chr861385 1097 543 396 209 108 --21390 494 --
NM_194071chr7105353 4576 4492 4257 4173 3938 3799 1386 739 252 --23804 1472 14609
NM_194247chr294533 4445 3967 3942 3500 3476 1494 1344 311 11041 34404 3919 2980 13948
NM_194278chr1464158 3775 3639 1551 1533 107 14121 34038 3889 801 21567 619
NM_194282chr452518 2428 1107 927 225 1601 11896 --
NM_194283chr5103770 2638 2621 1039 793 478 441 308 266 122 --33027 2899 341 --
NM_194285chr1193456 2277 1138 1115 802 314 148 134 86 12140 53209 3174 3018 943 776 --
NM_194286chr1245641 4788 4577 2243 35017 4767 2154 65438 4778 4238 2109 2084 1240 52158 2106 2094 2090 2081
NM_194291chr892877 2465 965 776 581 509 358 318 197 42870 2078 1069 276 --11083
NM_194298chr1061642 1502 1361 589 547 141 --11482 11479
NM_194301chr142739 245 3858 350 183 2194 116 --
NM_194314chr1125229 4705 4314 4126 3591 3541 1779 1703 1361 1346 630 325 1231 43988 3982 1138 816 1922
NM_194318chr1382596 2475 2265 2091 1884 495 343 289 --21676 701 --
NM_194328chr993194 3115 3103 3054 3005 2647 2410 820 745 1573 33284 2587 2202 --
NM_194329chr993194 3115 3103 3054 3005 2647 2410 820 745 1573 33284 2587 2202 --
NM_194330chr993194 3115 3103 3054 3005 2647 2410 820 745 1573 33284 2587 2202 --
NM_194332chr993194 3115 3103 3054 3005 2647 2410 820 745 1573 33284 2587 2202 --
NM_194356chr12102389 2360 1514 1488 1480 957 877 196 67 60 ------
NM_194434chr18105082 4822 4784 4513 4004 3914 1327 1083 335 78 --44730 3919 1913 1495 21243 392
NM_194454chr741741 1552 1411 589 --11724 11221
NM_194455chr741741 1552 1411 589 --11724 11221
NM_194456chr741741 1552 1411 589 --11724 11221
NM_197941chr5122974 2941 2875 2777 2197 898 584 575 339 186 161 34 ----11109
NM_197948chr1241539 1429 612 255 --41709 1573 328 313 2325 321
NM_197970chr241062 419 384 344 3567 516 205 31150 395 325 1547
NM_198123chr891650 1622 1337 1217 1177 1119 670 482 279 21610 1261 1236 21297 514
NM_198124chr891650 1622 1337 1217 1177 1119 670 482 279 21610 1261 1236 21297 514
NM_198128chr1882330 2310 1648 873 345 298 284 118 --32349 2196 2067 11580
NM_198151chr74627 500 440 429 --2633 478 --
NM_198158chr352109 939 690 479 313 --102504 2473 1992 1215 918 893 833 828 753 149 12470
NM_198159chr352109 939 690 479 313 --102504 2473 1992 1215 918 893 833 828 753 149 12470
NM_198177chr352109 939 690 479 313 --102504 2473 1992 1215 918 893 833 828 753 149 12470
NM_198178chr352109 939 690 479 313 --102504 2473 1992 1215 918 893 833 828 753 149 12470
NM_198181chr1572862 2828 2282 1147 837 546 471 --7703 248 218 188 160 130 77 169
NM_198189chr24957 836 207 85 --21100 383 21097 911
NM_198212chr792226 2188 1948 1929 1563 703 638 343 107 --32317 574 47 --
NM_198215chr1041216 1050 1030 1020 --41060 992 464 54 1339
NM_198225chr1031703 1581 281 --52010 1955 1473 1467 402 --
NM_198240chr123479 273 102 2467 322 31168 891 872 --
NM_198268chr1114094 3920 3455 2608 1323 1196 901 808 615 545 224 --42684 510 393 388 --
NM_198269chr1114094 3920 3455 2608 1323 1196 901 808 615 545 224 --42684 510 393 388 --
NM_198270chrX53440 2644 2518 2342 742 11260 33414 3005 2390 --
NM_198273chr583137 2030 1983 1059 964 941 327 271 32733 1112 812 22917 300 12676
NM_198317chr1--2153 144 --3136 132 120
NM_198399chr381807 1790 1466 630 544 475 439 381 --11596 --
NM_198400chr1582922 2896 2617 2411 2307 1089 517 163 22339 2104 22817 2221 12768
NM_198401chr81531 11208 4700 624 419 162 2442 416
NM_198428chr73727 670 529 ----1818
NM_198465chrX1559 12170 52495 2311 1878 1017 95 12806
NM_198468chr694596 4526 3956 3690 3247 1516 1213 977 674 33463 3099 1723 64357 4260 3800 3062 384 377 --
NM_198485chr372643 2594 2435 1822 472 382 99 1876 ----
NM_198503chr182432 2371 2221 2146 1976 620 548 147 12238 12017 --
NM_198513chr851544 1485 1450 768 173 21819 1752 --12053
NM_198569chr662596 2316 1838 564 491 352 --12475 12472
NM_198578chr1251424 1197 1143 237 135 --2349 62 11290
NM_198581chr2217246 7029 6911 6247 6041 5922 5007 4867 4757 2216 2018 1866 1551 1440 1148 1134 604 557 538 416 247 25459 2198 65773 5476 5462 5149 2271 92 55473 5469 5146 2068 89
NM_198715chr1185680 5618 5513 4949 4672 4356 4246 3957 2407 2248 2233 1902 1787 1413 1223 1011 418 390 25314 1913 34031 1239 1200 33915 1982 1290
NM_198793chr3144053 3607 3365 3261 3053 2911 2699 1559 1391 1059 700 677 246 164 13624 33272 3255 1242 13917
NM_198844chr176990 973 967 674 244 226 2785 418 2421 347 --
NM_198859chr363655 3369 3279 1956 373 195 1400 44947 3911 3273 745 --
NM_198896chr1131444 759 63 1197 42152 2026 1963 1396 --
NM_198900chr1297838 6706 6151 5412 5085 4899 2204 562 546 25119 1172 36945 2748 226 --
NM_198904chr561872 1638 1608 1313 755 716 1433 1638 --
NM_198935chr2093198 3157 3130 2550 953 847 396 305 140 --43121 2426 2230 943 12489
NM_198990chr782865 2515 2262 2226 2192 2106 1266 286 --52474 2333 2326 1333 44 1255
NM_198992chr1241386 521 146 89 --31075 402 137 --
NM_199000chr721778 1460 1478 21870 818 1560
NM_199040chr12113561 3425 3353 2829 2695 2539 1538 835 584 537 260 1876 43555 2451 327 61 --
NM_199072chr743095 2094 1232 345 11143 62823 2513 2204 2177 770 377 23119 3115
NM_199136chr7--192 2429 76 2145 54
NM_199160chr922074 469 1298 --21957 331
NM_199188chr1253631 3129 2628 1196 126 11406 83831 3737 3674 3093 2643 2521 1495 1089 22640 669
NM_199190chr1253631 3129 2628 1196 126 11406 83831 3737 3674 3093 2643 2521 1495 1089 22640 669
NM_199229chr271572 1375 1255 1171 233 205 120 --11707 --
NM_199320chr472652 2591 2303 1807 184 162 151 --32838 2109 431 --
NM_199320chr472652 2591 2303 1807 184 162 151 --32838 2109 431 --
NM_199321chr176990 973 967 674 244 226 2785 418 2421 347 --
NM_199324chr4113524 3298 3235 3221 2512 1330 1264 1250 1216 465 206 12855 83645 3051 3040 3025 2772 2672 2432 1297 --
NM_199328chr2131116 1030 296 1262 1943 1390
NM_199355chr1671787 1667 1640 1621 1454 1329 578 --1558 --
NM_199421chr14114745 4184 3883 3508 3210 2020 1858 1521 1013 720 473 13438 65091 5021 4417 3945 603 57 24859 4368
NM_199436chr252149 1195 1096 1003 942 --62460 834 628 562 498 485 12160
NM_199437chr1172500 2229 2084 979 907 694 94 12484 21856 154 --
NM_199438chr1172500 2229 2084 979 907 694 94 12484 21856 154 --
NM_199439chr1172500 2229 2084 979 907 694 94 12484 21856 154 --
NM_199454chr144440 1451 578 135 --31712 1456 1439 --
NM_199461chr1043012 839 712 471 --22917 365 22669 298
NM_199462chr164948 4749 3498 3371 81 36 13920 24567 3898 --
NM_199482chr241916 717 679 62 ----11346
NM_201567chr351345 541 505 493 438 --2466 461 --
NM_201591chr441449 1292 353 178 21574 251 21800 1593 11194
NM_201592chr441449 1292 353 178 21574 251 21800 1593 11194
NM_201624chr1137 1114 41033 126 100 91 --
NM_203282chr1971788 1753 1720 1711 1564 1557 1262 --21582 461 --
NM_203327chr2094566 4488 4241 3529 3521 3077 1794 901 413 1194 44383 4377 4258 739 13480
NM_203341chr121034 788 11047 1999 11018
NM_203349chr1561839 762 751 620 499 217 --21739 1598 --
NM_203350chr131553 301 121 1222 31685 1657 152 1241
NM_203371chr1121866 264 31346 534 210 11515 11383
NM_203372chr231227 626 396 11061 2620 195 11272
NM_203390chr851600 1416 703 429 263 11209 2268 111 --
NM_203391chrX61721 1605 1586 1554 1471 588 ----1110
NM_203394chr1262580 2405 1978 983 604 580 22612 481 1484 22763 862
NM_203403chr921242 488 --31253 180 87 2926 209
NM_203406chr592956 2235 2166 2056 804 607 538 327 48 42732 2380 2340 407 32961 2765 526 12200
NM_203446chr2162911 2603 2466 2008 886 279 179 1621 --
NM_203451chr134899 591 424 274 --3685 349 162 1848
NM_203458chr1113428 3036 2836 2820 2566 2549 2466 1247 818 477 116 23527 938 63737 2379 1161 828 823 761 --
NM_203459chr182155 2104 2077 1994 1025 621 430 98 --62624 2431 1873 1051 454 354 --
NM_203463chr254900 3395 3127 1811 1767 31695 1328 258 53423 1816 1069 650 261 --
NM_203487chr1331472 656 251 11781 1265 1639
NM_203504chr472515 2396 2065 2033 663 162 108 --12414 --
NM_203505chr472515 2396 2065 2033 663 162 108 --12414 --
NM_205860chr173011 2962 2625 2103 2090 1078 825 --42468 2461 2456 2451 21938 942
NM_206594chr183186 3108 2673 2520 1086 910 290 274 33294 3116 2645 43556 2338 314 242 11447
NM_206595chr183186 3108 2673 2520 1086 910 290 274 33294 3116 2645 43556 2338 314 242 11447
NM_206853chr6154162 3796 3710 3447 3359 2695 2666 2623 2532 1661 1478 1434 1126 1062 266 23370 408 33216 3183 1596 22994 2713
NM_206854chr6175423 5057 4971 4708 4620 3956 3927 3884 3793 3677 3489 1527 1198 1113 1036 367 274 24631 1669 34477 4444 972 34255 3974 3760
NM_206855chr6216388 6022 5936 5673 5585 4921 4892 4849 4758 4642 4454 3920 3887 2492 2163 2078 2001 1332 1239 538 167 25596 586 65442 5409 1937 339 328 117 35220 4939 4725
NM_206876chr2113625 3614 2918 2860 2716 1432 1269 1173 844 503 379 ----1770
NM_206907chr582680 1275 1179 1087 1013 365 201 190 --43217 2461 2442 861 --
NM_206909chr8128320 8238 8121 7801 6638 5807 5560 5165 3229 3097 1179 700 35230 2185 1695 58115 5972 5433 2635 1550 11683
NM_207012chr1082954 2496 2464 1340 1290 757 732 205 ----11305
NM_207170chr15956 855 814 685 263 1607 2924 786 --
NM_207292chr373334 2911 2501 1028 922 699 511 --32211 2151 429 --
NM_207293chr373334 2911 2501 1028 922 699 511 --32211 2151 429 --
NM_207294chr373334 2911 2501 1028 922 699 511 --32211 2151 429 --
NM_207295chr373334 2911 2501 1028 922 699 511 --32211 2151 429 --
NM_207296chr373334 2911 2501 1028 922 699 511 --32211 2151 429 --
NM_207297chr373359 2936 2526 1053 947 724 536 --32236 2176 454 --
NM_207303chr1054182 3996 2633 801 639 22984 1236 11558 --
NM_207304chr1342559 2281 641 257 1365 --32210 2206 1850
NM_207352chr442720 2575 1882 1827 32542 2302 65 3511 201 45 11843
NM_207372chr1042451 1875 1838 447 21951 632 42314 2309 2304 32 --
NM_207396chr131711 717 698 --2101 94 21814 1362
NM_207406chr4176506 6475 6387 6208 5233 5058 5043 4988 4283 4198 2335 1944 1520 1314 1212 675 669 14115 --25432 4655
NM_207411chr853688 3500 2430 1454 1339 --11399 13514
NM_207445chr1592128 1377 767 754 658 635 525 342 208 1352 ----
NM_207481chr261368 1066 1039 457 422 87 --11395 --
NM_207491chr431044 281 178 --11319 11400
NM_207578chr1--1213 154 3587 583 264
NM_207647chr972455 2288 2153 894 724 559 269 1410 42415 2188 1580 511 --
NM_207660chr1451563 1523 1250 174 128 21648 696 11606 --
NM_207661chr1451563 1523 1250 174 128 21648 696 11606 --
NM_207662chr1451563 1523 1250 174 128 21648 696 11606 --
NM_212471chr1731960 1947 145 --21420 70 21639 630
NM_212472chr1731960 1947 145 --21420 70 21639 630
NM_212554chr1041279 1127 1064 573 --11614 11523
NM_212558chr9103715 3257 1678 1563 1362 1101 1013 796 773 716 23340 3305 63343 3106 2955 2902 1691 1148 1704
NM_213589chr2125571 5471 5323 5297 5199 4841 4802 4793 2137 1067 566 243 1373 35619 4941 3451 25559 1235
NM_213590chr1384743 4620 3920 3680 3615 3244 1564 1089 13691 65046 4912 4626 4010 3374 2116 --
NM_213606chr1072757 2731 2695 2139 1747 584 200 --22494 82 --
NM_213651chr171659 1652 1509 1274 1199 629 519 --61370 1351 1159 697 590 341 11434