TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3658
miRNA Sequence: UUUAAGAAAACACCAUGGAGAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr521250 1238 11148 ----
NM_000016chr14627 272 189 173 ----1548
NM_000024chr51141 --1150 --
NM_000037chr832392 747 524 --22449 2422 1398
NM_000038chr551719 1356 1325 196 117 21655 302 11767 11895
NM_000045chr61399 --166 --
NM_000051chr11133478 2510 2337 2259 2166 1146 1139 1133 1079 906 694 181 138 33419 925 442 5897 886 874 652 65 --
NM_000052chrX53481 2194 2134 590 311 33352 2541 1223 23423 3288 23118 703
NM_000055chr3169 ----1370
NM_000081chr151723 1587 1146 481 241 1406 1621 21645 275
NM_000084chrX216704 6345 6158 5922 5901 5883 5223 5165 4414 4329 4280 2690 2684 2172 2024 1959 1893 1880 1847 1476 593 36015 5985 4773 36527 2359 289 24796 277
NM_000088chr172991 174 --11359 1267
NM_000089chr71734 --177 1586
NM_000090chr22628 215 1708 ----
NM_000091chr252845 1821 1140 1101 1083 1768 --22237 670
NM_000092chr284103 3379 1762 1725 1470 1280 1015 342 24355 1270 34173 3947 1780 21829 551
NM_000093chr932431 2233 578 12460 2867 486 --
NM_000096chr3------2958 725
NM_000097chr321000 969 --21025 935 1353
NM_000108chr741932 1794 1208 754 2700 562 21546 409 11713
NM_000109chrX62541 2512 2378 2287 318 121 1921 --52578 2178 1750 971 764
NM_000110chr131232 799 457 161 ----
NM_000112chr5144831 4715 4701 3815 3661 1700 1689 960 673 542 495 240 221 103 54760 3837 1282 1211 915 85349 4630 4420 4216 3881 3509 2080 1796 11938
NM_000115chr1382517 2302 1972 1951 1638 267 240 140 41877 729 445 412 12556 22100 356
NM_000125chr653711 2613 806 761 646 13838 21606 161 1391
NM_000127chr8----1306 --
NM_000138chr153938 912 615 11873 22334 2201 1245
NM_000139chr1182818 2690 2465 2346 2285 1958 384 213 --2394 366 --
NM_000141chr1021449 533 2971 463 31227 548 507 --
NM_000161chr1452007 1868 1750 526 195 21630 1210 21889 1713 31542 763 628
NM_000163chr562398 1962 1569 700 437 261 21993 222 31816 549 312 31895 799 422
NM_000165chr671716 1553 1290 1104 574 568 427 ----11502
NM_000167chrX61759 709 700 447 74 40 21686 1419 11394 21408 217
NM_000168chr7123350 3109 2857 2836 2610 2359 1177 979 496 490 288 83 1435 --33149 3121 251
NM_000176chr5133770 3724 3651 2870 2708 2416 1525 1079 749 581 569 523 102 43667 3150 1345 130 --11031
NM_000179chr2------188
NM_000189chr282398 2057 2045 1806 1521 840 787 733 154 1817 12110
NM_000192chr1231394 1281 203 1188 1457 --
NM_000194chrX--1562 ----
NM_000202chrX73432 3419 3220 3039 1241 934 643 33859 1388 562 1226 1242
NM_000208chr1961891 1855 803 766 327 146 11164 --33454 2917 1027
NM_000210chr262228 2117 1880 1806 1441 324 21685 665 21733 1522 --
NM_000214chr2041472 678 611 371 1339 21208 488 --
NM_000216chrX124048 3521 3385 3129 2916 2796 2512 1580 863 731 717 496 32570 1408 977 22612 929 21199 514
NM_000217chr1274686 4366 4341 4114 3891 3341 524 11180 65374 5157 4121 4098 1500 335 23950 362
NM_000218chr111921 ------
NM_000222chr442018 1890 1877 1449 11558 1825 31863 1607 612
NM_000227chr181293 1338 ----
NM_000232chr4113093 2592 2512 2463 2130 2050 1980 103 72 50 37 32913 1956 651 43027 2854 2275 928 23106 275
NM_000237chr821922 370 1598 1676 --
NM_000240chrX2681 318 22062 1736 11684 --
NM_000242chr1082632 2545 2344 2132 2085 1831 436 35 12146 22668 219 32711 2241 1881
NM_000245chr721505 158 1513 32055 1524 341 1280
NM_000248chr371218 1016 890 825 340 311 152 1993 53056 2896 1997 85 46 32763 2236 898
NM_000252chrX21041 283 41107 342 134 126 11496 1952
NM_000254chr1102960 2694 1959 1174 1084 992 937 452 328 26 22184 374 133 --
NM_000255chr63399 326 307 1444 --1273
NM_000259chr15135966 5923 5639 5589 5463 5452 5190 4344 4281 2526 2155 732 38 41491 1383 630 323 76081 5288 1906 1636 1441 1019 958 46194 2082 656 91
NM_000264chr963346 3262 2432 2270 2226 1160 31220 451 335 --22691 2278
NM_000267chr1762463 1115 1034 784 692 282 --63493 3031 3007 791 627 508 2321 24
NM_000268chr2243775 2944 1257 237 12330 23081 1454 --
NM_000278chr1022022 1469 ------
NM_000280chr11--1908 11019 2820 359
NM_000283chr42442 132 ------
NM_000288chr6----1336 --
NM_000291chrX4827 760 647 218 ----1836
NM_000297chr451838 1483 780 645 463 21634 317 12062 --
NM_000304chr173889 235 204 ------
NM_000314chr1043300 3258 2640 749 22716 2695 177 32583 1237 669
NM_000321chr1331583 621 386 11794 21117 411 21686 1423
NM_000325chr41270 ------
NM_000328chrX3433 393 304 --1177 --
NM_000329chr13890 297 106 1246 1351 1906
NM_000330chrX32187 626 250 12134 21420 148 --
NM_000332chr6186833 6680 6379 6105 5760 5499 5027 4844 2770 2486 2360 2231 2064 1742 1712 1576 740 640 67143 5586 5357 5137 1754 1517 75486 4774 4737 4549 4388 1503 103 86947 5890 5060 2396 2056 1957 1834 701
NM_000333chr32909 153 1983 4900 764 424 307 1969
NM_000337chr5116271 6166 4818 4680 4087 2648 1980 1710 1094 1019 77 26455 1516 --45091 4406 2244 1060
NM_000338chr152147 27 --1340 --
NM_000340chr351401 1160 398 264 113 --3496 327 165 21441 59
NM_000345chr441003 382 370 105 --2951 27 --
NM_000346chr17101710 1646 1306 1283 576 549 502 448 390 110 21763 440 11263 31816 1686 297
NM_000351chrX44268 3183 3063 854 33658 3483 334 12940 --
NM_000362chr2273616 3240 2750 1172 1048 306 104 --1724 23399 3048
NM_000367chr671448 892 850 761 547 402 140 22209 202 --193
NM_000368chr964773 3084 1896 1542 1483 189 --14633 14816
NM_000369chr1441812 1683 1572 718 11835 2594 267 157
NM_000378chr111333 --21076 935 --
NM_000387chr34753 719 578 210 1230 ----
NM_000389chr651188 609 233 110 92 --11524 --
NM_000390chrX83304 2847 2674 2101 1025 594 570 319 43441 2684 2301 208 --32626 1063 1044
NM_000393chr272129 1442 812 747 537 197 139 61969 1457 609 580 208 97 11418 31371 679 622
NM_000405chr531426 503 468 11305 21782 215 11332
NM_000406chr4132970 2379 2124 2064 2032 2004 1975 1875 1150 1101 1042 839 273 12935 22079 1057 --
NM_000408chr293319 3079 2628 2269 1298 914 809 572 209 --33188 1375 114 12942
NM_000411chr21123326 3147 3127 3077 2965 2879 2485 2301 878 500 296 139 --2714 335 23094 1277
NM_000415chr121987 3771 231 197 1348 1820
NM_000426chr61164 ------
NM_000428chr1432507 2354 866 ----32697 2559 1702
NM_000430chr1763425 2802 1431 1271 887 705 23660 1033 ----
NM_000439chr5196 32345 2285 601 22546 2217 11960
NM_000441chr732257 785 776 22334 517 12218 --
NM_000448chr11123246 3238 3071 2983 2977 2938 2375 2091 1165 812 641 464 1872 --1515
NM_000449chr111424 21541 311 11032 --
NM_000450chr131166 656 98 31776 1595 1187 21236 639 21807 629
NM_000452chr1371932 1652 1569 1345 664 485 338 22105 498 --42030 1692 571 45
NM_000459chr92752 204 ----1265
NM_000461chr384570 3954 3827 3684 3422 3298 1675 597 14527 24300 1778 --
NM_000462chr1551572 1463 653 601 319 31797 540 69 31823 1364 510 --
NM_000474chr72642 135 1193 ----
NM_000480chr1151562 1495 1284 511 25 2274 124 41268 1065 1038 496 31667 1145 525
NM_000489chrX122940 2449 2162 1167 1017 826 716 641 488 305 208 58 23462 2184 21267 464 52526 1141 598 415 152
NM_000492chr751487 1236 1214 1137 184 21403 1175 1406 1136
NM_000493chr671053 971 949 747 704 220 106 1200 --1390
NM_000495chrX71036 1008 940 849 836 827 805 31054 727 30 1422 21125 1047
NM_000503chr83666 419 136 --11750 2554 500
NM_000509chr4------133
NM_000510chr1131158 309 239 31322 1141 280 11219 --
NM_000521chr51104 ------
NM_000522chr72962 464 1184 21114 417 11231
NM_000523chr241169 828 224 198 11068 3751 305 253 2362 239
NM_000527chr19--11584 --22496 2435
NM_000533chrX41931 1551 112 77 ------
NM_000534chr21135 173 ----
NM_000544chr6_cox_hap1103351 2936 2851 2451 2232 2180 1224 886 610 284 22088 269 1658 23411 3141
NM_000550chr931056 928 190 1766 1651 --
NM_000555chrX217686 7310 6937 6741 6352 6223 5935 5288 5234 5097 5082 4805 2710 2418 2212 1283 1270 1004 953 928 107 45139 2522 2136 1247 57147 6927 5695 2043 1189 16065
NM_000574chr131169 1146 1135 2523 209 1190 31333 921 60
NM_000594chr6------1655
NM_000596chr71119 ------
NM_000598chr731486 1115 239 --11414 1131
NM_000599chr243929 3897 3886 788 ----24536 3840
NM_000600chr73396 302 129 1418 1139 1353
NM_000601chr71385 --1351 --
NM_000602chr7--21526 1474 ----
NM_000610chr1152888 2520 2402 1205 115 ----1624
NM_000615chr1122920 467 12089 22585 796 --
NM_000618chr12206419 6400 6290 5861 5603 4926 4854 4485 4421 4398 2644 2637 2459 2285 1494 1365 894 811 714 284 55626 4754 4616 1558 729 45470 4609 4449 1932 35703 5103 1953
NM_000618chr12206419 6400 6290 5861 5603 4926 4854 4485 4421 4398 2644 2637 2459 2285 1494 1365 894 811 714 284 55626 4754 4616 1558 729 45470 4609 4449 1932 35703 5103 1953
NM_000619chr12186 133 ----
NM_000627chr22628 309 1273 1641 1753
NM_000633chr1885071 4312 3729 3719 3702 1918 1910 233 14969 65056 4913 3892 1843 1215 722 34041 3984 2097
NM_000663chr1672859 2813 2509 2487 2474 2318 713 11903 --13122
NM_000675chr221854 ------
NM_000681chr1031032 225 180 ----21370 429
NM_000684chr1051184 1174 1164 1108 526 11036 --11010
NM_000686chrX3624 348 77 21178 366 31591 326 67 --
NM_000693chr1541740 1644 1178 536 ----1544
NM_000700chr9------1185
NM_000701chr12303 230 ------
NM_000719chr12106671 6247 5503 5451 4593 2256 1687 1110 887 30 35996 5547 1468 26742 730 21619 771
NM_000721chr11398 12233 --21904 1875
NM_000724chr1071507 1374 653 598 447 374 313 --1391 --
NM_000726chr241477 1179 557 73 11221 21289 211 --
NM_000740chr11166 ------
NM_000756chr81106 --1487 --
NM_000758chr5------1226
NM_000767chr1931200 396 227 2579 536 ----
NM_000783chr101209 --155 --
NM_000788chr451445 1419 1209 1087 121 51477 1364 1044 1014 513 31258 528 106 3389 195 139
NM_000793chr1465136 5128 4661 4429 3886 3665 21521 33 1212 43114 1866 1792 1555
NM_000800chr531695 1512 1253 ------
NM_000801chr205905 808 429 409 35 ------
NM_000806chr531771 755 393 3617 449 99 --21852 508
NM_000807chr42720 669 ----1222
NM_000808chrX3819 250 104 ----1883
NM_000809chr4209214 8696 7846 6749 6497 6470 6214 6141 5955 5717 3725 3402 3326 2562 2299 2197 1824 1784 1648 586 118976 8576 8566 3314 2946 2894 2754 2652 1322 334 205 78811 7049 6991 3214 2376 1293 444 69086 9004 7033 5707 67 57
NM_000811chr5137 1680 2534 301 163
NM_000812chr41338 --153 --
NM_000813chr5144936 4450 4147 4136 3783 3634 2032 1777 1725 1666 1259 922 470 225 35168 4862 981 125378 5226 4606 4130 3990 3547 1841 1545 1370 1208 1106 376 45619 5550 3981 315
NM_000814chr1593634 3628 3478 3426 2929 1056 980 552 72 --53343 2979 2641 457 325 22731 1399
NM_000820chr131251 ------
NM_000824chr43961 934 926 1826 1868 1628
NM_000826chr4112633 2382 2326 2116 1896 1889 1700 1634 561 462 210 51691 966 591 302 253 11620 32568 1965 282
NM_000827chr592556 2522 2491 2341 1980 438 383 362 340 ----12357
NM_000829chr1161882 1583 735 711 644 349 11804 1592 --
NM_000836chr191984 --1269 1250
NM_000838chr6112770 2720 2391 2384 2319 1997 1910 1886 1813 1767 1761 22203 2050 --22445 220
NM_000839chr32380 373 ------
NM_000840chr73111 32 24 ------
NM_000844chr34971 899 850 729 --1817 --
NM_000857chr42426 193 ------
NM_000859chr541575 1492 1329 1293 --11339 2399 334
NM_000861chr361994 1763 646 438 246 123 11656 1150 12396
NM_000866chr32466 142 --11311 --
NM_000868chrX62229 1866 640 462 118 82 12392 2949 719 --
NM_000872chr1021389 74 11039 11628 11160
NM_000875chr15196759 5990 5790 5590 5554 5507 2639 2454 2211 2119 1778 1459 1365 1226 573 498 393 205 76 26400 5134 86779 6365 4728 4432 2586 1835 1772 1291 15303
NM_000876chr631210 487 370 --1961 11382
NM_000877chr282898 2775 2764 2736 2127 2091 910 762 22375 215 22984 973 32931 2790 2019
NM_000880chr82816 215 --1790 --
NM_000882chr3134 1317 2426 172 --
NM_000885chr23724 674 462 41926 336 293 228 --11600
NM_000891chr17103669 3272 3231 3166 2718 1421 940 934 693 241 33000 906 454 1345 23075 2458
NM_000895chr121110 ----142
NM_000899chr12104350 3323 3275 3250 3112 1393 1365 1323 249 132 53788 2910 2723 1404 1275 13958 24323 4123
NM_000901chr452209 2027 966 603 317 52419 1798 1577 386 357 183 11563
NM_000902chr373194 3101 750 687 580 495 444 2591 531 13240 12266
NM_000908chr53732 304 110 2558 133 --2282 94
NM_000909chr451089 842 372 140 128 21295 1236 1970 --
NM_000917chr102712 70 2990 175 4943 767 680 644 3919 904 725
NM_000919chr51577 --1407 2537 475
NM_000921chr122498 154 --1231 --
NM_000922chr112997 798 1742 --2825 205
NM_000926chr11229455 8736 8348 7949 7426 7272 6056 5991 5974 5802 3723 3550 3491 3471 2236 1832 1607 1509 1028 631 82 75 59019 8776 7345 3452 1422 63480 2829 2701 2033 516 308 69296 9046 2484 1546 694 220
NM_000934chr171704 ------
NM_000935chr351014 823 370 343 151 --41207 1175 903 176 1892
NM_000941chr7--1336 ----
NM_000944chr462320 2178 1816 725 400 96 4733 548 264 236 4941 851 702 457 --
NM_000945chr231968 735 677 21633 1419 1271 --
NM_000949chr51682 --2273 134 1593
NM_000950chrX193623 3596 3554 3182 3131 3114 2975 2849 2759 2706 2541 2343 1219 1208 1059 988 980 759 156 32728 729 330 63451 3208 3067 1194 720 548 43665 3170 3022 36
NM_000956chr1421014 356 1874 124 --
NM_000958chr521300 439 2948 875 ----
NM_000959chr183701 3083 2890 2865 2589 747 598 341 13750 12796 23916 3738
NM_000961chr20103971 3389 3160 3096 3001 2960 2565 1605 1591 367 21152 957 12753 23523 3208
NM_000962chr9112759 2437 2067 2003 1246 1114 829 707 602 381 360 32643 973 82 1260 --
NM_000963chr182151 1938 1637 982 739 349 258 213 42062 818 766 415 --42361 2161 600 521
NM_000964chr172524 518 --1547 --
NM_000965chr32815 76 1204 21136 998 --
NM_000983chr121462 494 1307 --21082 38
NM_000989chr8--178 ----
NM_000996chr3----151 --
NM_001001132chr211932 31160 585 332 31063 1005 364 1344
NM_001001323chr1243185 3067 2455 381 22359 2147 12840 42859 1101 1055 436
NM_001001330chr103481 330 149 1900 31191 1180 1140 --
NM_001001342chr1041364 1050 958 371 31405 1097 537 2356 38 --
NM_001001344chrX22484 1017 --1362 --
NM_001001389chr1152888 2520 2402 1205 115 ----1624
NM_001001390chr1152888 2520 2402 1205 115 ----1624
NM_001001391chr1152888 2520 2402 1205 115 ----1624
NM_001001392chr1152934 2566 2448 1890 161 ----1670
NM_001001395chr1292810 2523 2342 2333 2167 939 760 726 618 31752 686 445 42831 2076 1807 916 12247
NM_001001396chr173919 3412 3249 2985 2834 1170 889 24416 1080 34334 2774 1112 23159 557
NM_001001419chr5125195 4842 4547 4396 4121 3981 3936 3816 3735 872 302 46 54935 4310 1286 262 198 44686 4109 1660 1075 54998 4892 4578 4569 677
NM_001001420chr5125195 4842 4547 4396 4121 3981 3936 3816 3735 872 302 46 54935 4310 1286 262 198 44686 4109 1660 1075 54998 4892 4578 4569 677
NM_001001433chr2073083 2447 2074 1981 1129 359 282 2967 674 1428 23148 3033
NM_001001436chr163803 572 559 --1793 1690
NM_001001481chr8113080 2932 2728 2220 2206 1167 1145 1054 265 259 139 33166 2405 1174 33014 2895 274 43470 3367 2909 1376
NM_001001484chr1052087 2026 1982 381 213 22301 1967 21636 363 11516
NM_001001502chr5----1418 --
NM_001001520chr19----1189 --
NM_001001521chr22270 44 2243 220 --1122
NM_001001556chr154558 412 303 239 2278 189 21579 1462 21383 386
NM_001001557chr842165 2061 495 480 11642 --42089 2042 1967 1342
NM_001001567chr211208 1195 --1183
NM_001001568chr211208 1195 --1183
NM_001001571chr211208 1195 --1183
NM_001001572chr211208 1195 --1183
NM_001001573chr211208 1195 --1183
NM_001001574chr211208 1195 --1183
NM_001001575chr211208 1195 --1183
NM_001001576chr211208 1195 --1183
NM_001001577chr211208 1195 --1183
NM_001001579chr211208 1195 --1183
NM_001001580chr211208 1195 --1183
NM_001001581chr211208 1195 --1183
NM_001001582chr211208 1195 --1183
NM_001001584chr211208 1195 --1183
NM_001001585chr211208 1195 --1183
NM_001001664chr2103976 3651 3541 3347 3178 2789 949 930 597 261 33900 3208 2882 64042 2783 2502 1489 1390 737 23262 2572
NM_001001668chr1944269 3866 1314 1271 23741 171 --11158
NM_001001701chr4111958 1565 889 866 706 659 504 498 400 340 332 31448 652 570 21508 39 3467 207 72
NM_001001715chr132530 390 ----2462 411
NM_001001852chr221911 1741 ----
NM_001001890chr21133686 3531 3428 3266 3250 2880 1617 1031 777 596 550 544 483 11728 83731 3609 1020 870 810 732 490 393 14022
NM_001001928chr22187970 7784 7573 7285 6575 6472 5436 5323 5148 3191 3008 2316 1776 1654 1444 1275 267 167 68352 8187 7148 1252 868 576 67001 6641 5394 1170 554 426 48371 7271 6098 1899
NM_001001936chr1031132 1126 885 1957 21027 847 21195 312
NM_001001938chr982500 1567 1340 1316 1110 636 397 369 63772 3102 3090 1381 491 89 1409 --
NM_001001971chr10--1389 1131 1274
NM_001001974chr10112211 1893 1856 1768 1649 1561 753 547 414 119 94 62193 2080 1943 1540 1513 655 1293 21792 1639
NM_001001992chr211194 ------
NM_001001994chrX2485 415 ------
NM_001001995chrX31720 711 521 21875 219 1743 11496
NM_001001996chrX2485 415 ------
NM_001002009chr72381 206 1437 ----
NM_001002010chr72381 206 1437 ----
NM_001002032chr17--1631 2212 156 --
NM_001002033chr17--1731 3545 312 256 --
NM_001002243chr21302 1828 ----
NM_001002255chr61364 ------
NM_001002257chr273171 2749 2280 1170 1099 764 104 33501 2296 694 43470 3207 2223 176 2831 302
NM_001002258chr261280 712 656 520 420 279 22009 1956 1428 --
NM_001002294chr1--2341 316 ----
NM_001002296chr841299 849 546 274 --1924 11409
NM_001002759chr104510 495 242 132 1532 ----
NM_001002814chr853159 2613 2592 463 327 41330 1291 390 212 33892 1316 1281 --
NM_001002838chrX31392 1372 512 21428 1411 31547 1360 373 21629 259
NM_001002843chr1551188 1091 836 825 230 11248 --31217 1197 211
NM_001002860chr14114536 4354 3692 3378 3353 3320 3064 1618 1541 449 265 24115 1318 53304 590 476 241 188 44517 4421 3041 1579
NM_001002909chr1741958 1899 1644 892 22158 360 31422 792 774 --
NM_001003407chr1074809 4362 4059 3971 3825 3180 1134 33244 1633 1069 54277 3380 1221 1020 600 23467 497
NM_001003408chr1074809 4362 4059 3971 3825 3180 1134 33244 1633 1069 54277 3380 1221 1020 600 23467 497
NM_001003652chr18198632 8590 8422 8416 8297 7993 7624 7297 6939 6676 6249 5967 3244 2459 1734 1515 1503 1329 362 37519 1292 232 107549 6004 5371 5312 2752 1787 1364 683 479 401 57167 6607 6558 1226 1022
NM_001003656chr10------1581
NM_001003674chr18196748 6615 6153 5926 5370 5364 5088 4977 4969 4498 4474 4311 2382 1954 1604 1573 1263 904 592 76983 6704 5975 2064 1558 576 478 27046 6845 46953 5736 5325 1373
NM_001003675chr18196748 6615 6153 5926 5370 5364 5088 4977 4969 4498 4474 4311 2382 1954 1604 1573 1263 904 592 76983 6704 5975 2064 1558 576 478 27046 6845 46953 5736 5325 1373
NM_001003679chr1102128 1878 1812 1614 1590 1517 1383 785 476 76 --12194 --
NM_001003681chr2272033 2024 1723 1655 420 183 110 1104 12148 22060 1431
NM_001003688chr43961 789 779 1464 --11087
NM_001003698chr631457 760 378 --31872 1808 727 31416 528 287
NM_001003699chr631457 760 378 --31872 1808 727 31416 528 287
NM_001003712chr1283765 3093 2897 2509 1596 1552 1236 1107 11318 53509 1353 1127 810 634 34083 612 542
NM_001003790chr85811 689 304 211 128 --1250 --
NM_001003791chr85811 689 304 211 128 --1250 --
NM_001003792chr39982 962 946 783 475 459 453 166 131 --3904 363 226 21244 492
NM_001003793chr39982 962 946 783 475 459 453 166 131 --3904 363 226 21244 492
NM_001003800chr963393 3365 2670 268 230 90 23539 2329 12401 --
NM_001003810chr43789 658 573 --2336 214 --
NM_001003940chr1543502 2347 559 119 --33878 2476 129 13778
NM_001003942chr1543502 2347 559 119 --33878 2476 129 13778
NM_001003943chr1543506 2351 563 123 --33882 2480 133 13782
NM_001004019chr3185 1396 --1383
NM_001004023chr12220 42 ------
NM_001004051chrX----1104 --
NM_001004065chr9144011 3754 3609 3128 3050 3042 2955 2902 2806 1429 906 826 620 78 --1576 --
NM_001004304chr1263199 3171 946 505 380 214 23159 2228 11233 13106
NM_001004317chr6154215 3923 3812 3519 3415 3342 3290 3230 2741 1021 852 839 814 277 104 54103 3672 2921 752 415 1554 64348 4254 3967 598 440 134
NM_001004329chr1241435 1176 1064 536 ----2939 485
NM_001004342chr186082 5791 4512 4030 1561 940 513 153 34126 1487 633 24237 906 34657 4267 914
NM_001004346chr431138 991 188 --1412 --
NM_001004360chr241927 1860 1216 326 31905 1817 1511 21892 1795 1528
NM_001004419chr12144526 4447 4213 3536 3455 3312 3297 3117 1741 1638 1510 990 466 159 1136 34536 4519 4056 33306 3286 1608
NM_001005158chr31404 ----2499 490
NM_001005159chr31404 ----2499 490
NM_001005207chr17--1241 ----
NM_001005242chr1231242 1089 542 31452 1194 343 21632 1313 21521 574
NM_001005266chr151302 --279 28 --
NM_001005267chr151302 --279 28 --
NM_001005268chr151302 --279 28 --
NM_001005269chr151302 --279 28 --
NM_001005335chr19--1231 --1126
NM_001005375chrY41611 1601 381 238 11221 1582 3569 422 360
NM_001005386chr262432 2307 1765 1608 958 613 52217 2191 1940 1897 1743 22209 528 22265 781
NM_001005404chr1793960 3778 3758 3542 3429 3264 3212 3045 1118 34057 4033 3225 23984 3312 54126 3253 3165 1509 1126
NM_001005463chr1042634 2032 1658 823 21996 949 32191 1948 798 --
NM_001005473chr5146502 5872 5179 4654 4083 4044 2473 2153 1729 1609 1153 865 853 744 85791 4962 4448 4308 2376 1767 761 459 36603 4192 391 46586 4909 2585 2271
NM_001005474chr321192 652 21633 1028 11312 21498 1431
NM_001005526chr21111 ------
NM_001005732chr211634 ----1560
NM_001005733chr211591 ----1517
NM_001005739chr22813 780 --1678 --
NM_001005743chr1431263 1227 933 1901 --1869
NM_001005744chr1431263 1227 933 1901 --1869
NM_001005745chr1431263 1227 933 1901 --1869
NM_001005746chr241477 1179 557 73 11221 21289 211 --
NM_001005747chr241477 1179 557 73 11221 21289 211 --
NM_001005753chr262253 2188 2044 337 197 165 --22333 869 --
NM_001005781chr22385 121 --1525 2549 132
NM_001005782chr23834 793 42 1718 1974 3998 225 50
NM_001005845chr861907 1780 1536 1501 1479 72 --2451 395 31615 1434 463
NM_001005849chr172599 426 --1209 --
NM_001005861chr35784 370 362 346 284 --1156 4987 924 308 251
NM_001005862chr171483 ----1507
NM_001006600chr5172331 2100 1882 1834 1791 1690 1609 1543 961 929 923 772 719 666 626 404 84 11721 42011 1575 790 765 22023 229
NM_001006605chr13808 410 27 146 --1866
NM_001006605chr13808 410 27 146 --1866
NM_001006610chr163904 828 401 2893 663 ----
NM_001006612chrX151 ------
NM_001006613chrX151 ------
NM_001006614chrX151 ------
NM_001006624chr151978 1691 1642 1279 361 21432 509 ----
NM_001006635chr2128 185 ----
NM_001006636chr23810 642 360 1718 11014 --
NM_001006641chr921161 1115 ------
NM_001006642chr921161 1115 ------
NM_001006643chr921161 1115 ------
NM_001006657chr293017 2702 2651 2091 860 546 535 406 164 33240 588 347 22219 790 --
NM_001006665chr12273 239 ------
NM_001006684chrX4599 546 483 89 --1439 --
NM_001006944chr112173 155 ------
NM_001007023chr1465136 5128 4661 4429 3886 3665 21521 33 1212 43114 1866 1792 1555
NM_001007024chr1794321 4182 4019 3929 3865 3589 3270 90 24 24310 4242 22960 213 14266
NM_001007025chr1794321 4182 4019 3929 3865 3589 3270 90 24 24310 4242 22960 213 14266
NM_001007027chr11----141 --
NM_001007075chr431028 913 82 --1195 11038
NM_001007097chr9125050 5038 5032 4781 4732 3968 1908 1605 1361 910 881 271 35024 1475 683 25098 1543 --
NM_001007099chr1----2609 127 2832 593
NM_001007100chr1----2609 127 2832 593
NM_001007102chr661680 1611 1449 402 184 163 11371 ----
NM_001007156chr1561590 1495 1388 620 614 455 1309 21957 1807 --
NM_001007226chr1721400 392 21380 146 ----
NM_001007227chr1721400 392 21380 146 ----
NM_001007228chr1721400 392 21380 146 ----
NM_001007229chr1721400 392 21380 146 ----
NM_001007230chr1721400 392 21380 146 ----
NM_001007237chr152366 526 329 247 235 22265 997 1535 22826 354
NM_001007245chr7181 1458 2440 433 --
NM_001007246chr2151882 755 704 670 464 11488 21301 268 --
NM_001007257chr131342 612 457 1472 --1552
NM_001007267chr21772 2658 178 ----
NM_001007277chr11--11088 1326 --
NM_001007466chr655033 5003 3646 1948 553 --65168 4940 4806 4576 1755 1074 14268
NM_001007467chr22193 ------
NM_001007468chr22------1303
NM_001007544chr1144 2477 368 ----
NM_001007553chr131001 896 136 1192 --11015
NM_001007559chr183721 401 198 1749 --1689
NM_001007565chr33334 116 71 ------
NM_001007595chr15188 --2333 293 --
NM_001007794chr11724 --1561 2739 657
NM_001008225chr72518 89 ------
NM_001008226chr1561756 622 182 170 106 69 1159 11279 21631 116
NM_001008239chr18133841 3397 3388 3135 2989 2960 1414 1198 551 432 318 284 278 53424 3408 3193 2667 1232 43202 2681 572 160 23671 3477
NM_001008388chr42235 60 147 1822 --
NM_001008391chr11158 ----1217
NM_001008392chr362384 2378 1283 784 420 190 43232 1230 484 177 42562 2538 2457 155 33154 940 238
NM_001008393chr4142591 2483 2383 2374 2146 2088 2074 1128 1001 648 376 142 133 50 22185 680 32729 2307 1912 22193 726
NM_001008401chr1921505 1116 21337 1324 21219 21 --
NM_001008405chr72391 83 11502 1289 1517
NM_001008408chr795434 5090 4956 4950 4716 4057 3965 1338 606 25074 4898 75828 5542 5175 4173 2568 2391 669 64549 4455 4419 2285 2023 836
NM_001008491chr281622 1415 1377 679 652 372 188 121 1667 --2703 153
NM_001008492chr281622 1415 1377 679 652 372 188 121 1667 --2703 153
NM_001008495chr872094 1852 1843 1653 1472 829 638 2851 396 22267 256 32128 148 125
NM_001008529chr174883 356 319 35 2414 111 1937 2964 824
NM_001008539chr8135411 5329 5305 5282 5254 4344 3865 3532 3427 1572 1535 1337 33 65268 4798 4671 3979 3471 1121 23493 1063 25400 3454
NM_001008540chr2298 25 --2368 48 --
NM_001008541chr1052233 2027 1554 947 892 170 2278 245 12316
NM_001008541chr1052233 2027 1554 947 892 170 2278 245 12316
NM_001008564chr1362148 2119 1674 884 352 176 11410 1210 12074
NM_001008567chr93147 110 49 2103 92 1136 --
NM_001008660chr1131418 1266 637 31085 102 93 --1498
NM_001008701chr1923127 1119 13078 ----
NM_001008707chr1441433 1204 773 98 1334 1286 11695
NM_001008708chr23527 180 114 --180 2600 549
NM_001008712chr8180 ------
NM_001008723chr102440 385 ------
NM_001008726chr146506 480 358 291 222 55 2367 179 21683 345 11199
NM_001008738chr582880 2685 2628 2520 2118 1976 1970 806 42656 2020 1022 499 3741 401 394 32299 590 210
NM_001008744chr141160 11357 1198 11600
NM_001008783chr62728 67 2909 665 1620 --
NM_001008801chr1941970 1947 1637 1463 12017 42005 1898 467 112 --
NM_001008896chr11235 ------
NM_001008925chr483224 2904 2864 2831 2410 906 569 349 23396 3207 43127 3109 577 535 --
NM_001008938chr11----1334 --
NM_001009185chr52577 187 ----162
NM_001009552chr81466 1613 --153
NM_001009554chr494451 4335 4173 3874 3576 3442 1611 441 296 64659 4126 4063 2877 1485 374 13461 24041 2990
NM_001009554chr494451 4335 4173 3874 3576 3442 1611 441 296 64659 4126 4063 2877 1485 374 13461 24041 2990
NM_001009555chr451665 1519 464 364 325 --189 --
NM_001009567chr102466 64 1217 1695 --
NM_001009571chr721129 52 --2541 61 21249 305
NM_001009880chr2294459 4431 3981 3886 3835 3690 3566 3230 1637 14891 1429 --
NM_001009881chr14631 239 197 157 1452 --2502 423
NM_001009882chr14631 239 197 157 1452 --2502 423
NM_001009894chr1231419 426 184 41570 472 465 42 11598 --
NM_001009899chr3176480 6459 6393 6282 5711 4333 4004 2592 2473 2391 2151 2143 1769 1546 1124 458 219 74621 4239 4197 2193 1220 1050 896 44394 2288 2082 1341 44642 4213 1740 1640
NM_001009909chr1183703 3214 3173 2993 2900 2822 2548 56 23264 3025 33847 3338 2557 1380
NM_001009955chr11198 ----2451 396
NM_001009955chr11198 ----2451 396
NM_001009960chr7112436 2389 2239 2119 1131 1019 998 992 816 808 205 1881 11042 --
NM_001009993chr2104477 4470 4315 3797 3059 1798 1782 1141 837 231 3822 489 194 34341 3106 102 34303 4290 3480
NM_001009994chr6--179 ----
NM_001010000chr1893035 2819 2737 2309 1354 1329 863 393 208 1674 33330 3266 2276 12455
NM_001010844chr6356 47 37 ----1200
NM_001010846chr194372 3719 3472 3080 1657 1120 939 572 320 64494 4262 1778 1374 1082 456 54429 3494 3214 2881 1199 11244
NM_001010853chr6143119 2968 2571 1252 1095 1087 982 684 523 319 249 111 64 54 22799 93 52891 1238 820 292 86 42929 1077 846 374
NM_001010854chr142641 499 ----1776
NM_001010861chr1132490 2141 1954 1934 1710 1079 873 864 661 533 467 117 47 32198 2023 127 1396 21945 282
NM_001010862chrX143334 3255 3029 3011 3002 2784 2537 2250 2213 1265 1193 784 263 62 --21250 1016 --
NM_001010867chr166231 6041 5319 4199 2582 2156 15368 16276 25458 5442
NM_001010888chrX84442 4304 3646 3409 1247 1129 1109 588 1947 23194 1180 --
NM_001010891chr5176473 6287 6263 5489 5257 5080 5067 4195 2676 2230 2187 1446 1067 832 769 440 143 106766 6708 5017 4349 2718 2489 1916 1899 1892 1235 86522 5095 4488 4337 4261 1764 549 191 65390 4845 4677 1438 1202 395
NM_001010895chr981899 1551 804 720 692 491 353 131 51890 669 449 254 34 11859 31867 1539 526
NM_001010908chr102625 281 ------
NM_001010922chr1174131 3676 3488 3252 3197 3091 2802 2722 2707 2627 1583 960 797 661 499 266 143 33627 2980 1160 --33787 3578 3512
NM_001010924chr101382 --1802 11215
NM_001010927chr62417 161 147 ----
NM_001010932chr71385 --1351 --
NM_001010934chr731127 279 140 11189 1755 2954 155
NM_001010942chr1231311 998 199 1100 1479 --
NM_001010971chr11823 2695 330 3904 858 731 --
NM_001010984chr1122407 2353 2279 2061 2033 2026 1922 805 291 229 205 199 22306 2043 ----
NM_001010986chrX92431 1668 1662 891 630 545 416 261 129 1875 12324 21987 938
NM_001010989chr16------2496 104
NM_001010990chr16------2496 104
NM_001011513chr453533 3134 2620 880 72 43127 1417 471 279 12994 21335 508
NM_001011515chr41727 --2791 423 --
NM_001011516chr41727 --2791 423 --
NM_001011537chr382038 1894 1455 843 627 596 310 124 21805 712 32361 2174 1507 32192 211 148
NM_001011666chr7186518 5710 5568 5404 4411 4261 2558 2535 2031 1847 1752 1501 509 431 303 130 73 62 44656 2285 1894 1514 64284 2529 2522 1153 863 630 95493 4984 4339 4311 4132 4088 2619 2314 2072
NM_001011708chr272933 2851 2098 942 787 510 132 3926 566 143 11001 156
NM_001011713chr1431142 1102 1061 1197 11226 41562 1490 1040 482
NM_001011720chr871381 1307 602 472 232 188 29 --31426 1030 1022 1156
NM_001011724chr131251 ------
NM_001011725chr131251 ------
NM_001011885chr1561266 654 561 525 395 132 41713 1506 1398 1282 11695 21816 332
NM_001012333chr11----1327 --
NM_001012334chr11----1327 --
NM_001012393chr1164348 4194 3938 3534 3372 1259 1740 24759 463 --
NM_001012410chr32357 36 2492 464 2512 347 1417
NM_001012420chr1562851 2698 2590 932 439 328 32727 2666 906 2987 360 42823 2519 627 40
NM_001012423chr1562851 2698 2590 932 439 328 32727 2666 906 2987 360 42823 2519 627 40
NM_001012426chr632720 2545 1006 11134 12555 --
NM_001012427chr632720 2545 1006 11134 12555 --
NM_001012515chr1882231 2114 1827 945 884 852 180 164 1643 31460 931 149 42377 2360 1547 421
NM_001012614chr43496 271 254 1770 ----
NM_001012732chr441207 1113 267 92 174 1401 11180
NM_001012751chr1071783 1610 1298 1263 552 78 30 21539 89 2638 247 --
NM_001012755chrX104909 4818 4731 4606 4403 1801 1563 1358 876 421 33846 3585 1631 11135 14188
NM_001012756chr19112897 2645 2511 2458 2368 2136 2087 2008 845 743 602 52838 2819 2680 2553 2054 13034 31298 683 614
NM_001012759chr16----1123 --
NM_001012761chr561825 927 572 388 279 26 3805 560 52 31696 917 885 12410
NM_001012762chr16----1154 --
NM_001012968chrX122664 2602 1940 1815 1712 1122 1078 1020 965 669 512 490 --32616 2025 1866 11115
NM_001012977chrX31416 1372 529 1886 1570 --
NM_001012985chr11198 ------
NM_001013031chr10103463 3181 3146 2658 2171 1380 1257 336 213 139 13209 43345 2991 2479 109 --
NM_001013398chr731486 1115 239 --11414 1131
NM_001013399chr65804 787 775 315 192 --21089 287 --
NM_001013406chr751640 1377 1143 1102 1087 --11415 173
NM_001013438chr32952 634 ----1647
NM_001013439chr31798 ------
NM_001013620chr12228475 8336 8144 7196 7053 6810 5505 5490 5442 5337 5314 5260 3253 3219 3001 2370 2280 1948 1267 1043 928 529 67385 6922 6695 3307 1963 147 98303 7832 7284 5708 5600 3137 2012 490 134 66988 6958 6559 6449 2541 1741
NM_001013629chr1052137 1820 1749 1689 301 ------
NM_001013659chr19104842 4134 3328 2081 1604 1065 582 402 379 218 33401 3335 1990 34658 1774 1384 55239 4897 3418 1821 1214
NM_001013734chr65773 752 688 629 542 ----2578 120
NM_001013746chr752293 583 499 419 167 --12287 21981 1688
NM_001013843chr154366 219 187 26 --1599 2721 121
NM_001014283chr132776 431 1844 41964 1691 265 105 2765 501
NM_001014286chr131343 --185 131
NM_001014431chr145932 908 720 208 82 --1669 --
NM_001014432chr145932 908 720 208 82 --1669 --
NM_001014434chr15861 767 674 648 46 2589 297 --128
NM_001014443chr1----196 --
NM_001014446chr4------133
NM_001014796chr11189 ------
NM_001014796chr11189 ------
NM_001014797chr10127376 6926 6866 5408 2958 2434 2120 2036 1202 710 387 202 77548 5011 3210 3082 2557 588 378 --55718 2451 1581 806 160
NM_001014809chr41898 ----1857
NM_001014811chr11--1113 ----
NM_001014972chr21177 ------
NM_001015045chr432414 1688 1643 31975 1932 748 12031 21894 991
NM_001015048chr1453099 3071 3048 3015 556 22211 294 32971 1992 255 33240 2590 2126
NM_001015049chr1453099 3071 3048 3015 556 22211 294 32971 1992 255 33240 2590 2126
NM_001015508chr81562 --2307 226 --
NM_001015877chrX113092 2616 2340 2320 1093 1027 965 923 644 492 102 1118 1750 12898
NM_001015880chr10111717 1711 1443 1354 1298 662 362 226 205 103 57 1604 1297 11428
NM_001015882chr93691 266 198 ------
NM_001017368chr1742519 2393 900 235 1951 --22545 2475
NM_001017369chr41420 31103 1059 239 2894 717 1980
NM_001017371chr271159 1138 554 527 430 85 37 --41318 1167 1015 415 175
NM_001017395chr3103580 2685 2548 2505 835 728 718 692 221 174 2972 256 21381 666 1924
NM_001017415chr14794 780 173 128 --1242 3818 719 311
NM_001017416chr14794 780 173 128 --1242 3818 719 311
NM_001017420chr821353 1116 21382 373 21403 483 --
NM_001017424chr121413 441 11669 1354 21554 85
NM_001017425chr121413 441 11669 1354 21554 85
NM_001017434chr13622 256 156 1755 3778 590 521 --
NM_001017440chr778147 7377 5704 3108 2513 1549 610 25030 2132 27566 5477 16218
NM_001017523chr121475 1307 --2635 495
NM_001017923chr1491656 1344 653 613 387 292 267 212 192 ----1554
NM_001017926chr861621 1351 1340 1191 711 251 21784 299 11359 21538 1466
NM_001017928chr3----140 --
NM_001017930chrX61535 1468 1103 1092 290 274 21457 1337 1593 1971
NM_001017962chr102712 70 2990 175 4943 767 680 644 3919 904 725
NM_001017969chr92186 145 --1584 128
NM_001017975chr12329 69 --2455 340 2191 77
NM_001017977chr12397 92 ------
NM_001017979chr41630 --1316 1564
NM_001017995chr564588 3476 3365 3250 131 72 13425 14266 14831
NM_001017999chr142085 2055 1626 394 32349 1797 719 --1738
NM_001017999chr142085 2055 1626 394 32349 1797 719 --1738
NM_001018000chr142085 2055 1626 394 32349 1797 719 --1738
NM_001018000chr142085 2055 1626 394 32349 1797 719 --1738
NM_001018001chr142085 2055 1626 394 32349 1797 719 --1738
NM_001018004chr152682 449 --1673 154
NM_001018006chr152682 449 --1673 154
NM_001018007chr152682 449 --1673 154
NM_001018020chr152682 449 --1673 154
NM_001018037chr941373 1083 297 204 11014 1543 --
NM_001018038chr95572 506 154 137 125 154 1168 1595
NM_001018053chr151870 1745 1632 1236 607 --12001 11220
NM_001018054chr131276 901 384 2999 514 1233 1135
NM_001018064chr951879 1367 561 300 70 ----1254
NM_001018065chr9105410 5368 5128 5085 4721 4256 4216 1931 1033 121 35146 3767 548 35352 5169 4287 21798 834
NM_001018066chr9105410 5368 5128 5085 4721 4256 4216 1931 1033 121 35146 3767 548 35352 5169 4287 21798 834
NM_001018067chr1125254 5109 4390 3849 3518 1887 1437 1085 782 542 531 433 74810 4313 1501 1476 762 412 152 55308 4892 1640 1413 370 21403 740
NM_001018068chr1125254 5109 4390 3849 3518 1887 1437 1085 782 542 531 433 74810 4313 1501 1476 762 412 152 55308 4892 1640 1413 370 21403 740
NM_001018069chr1125254 5109 4390 3849 3518 1887 1437 1085 782 542 531 433 74810 4313 1501 1476 762 412 152 55308 4892 1640 1413 370 21403 740
NM_001018072chr121475 1307 --2635 495
NM_001018074chr5133770 3724 3651 2870 2708 2416 1525 1079 749 581 569 523 102 43667 3150 1345 130 --11031
NM_001018075chr5133770 3724 3651 2870 2708 2416 1525 1079 749 581 569 523 102 43667 3150 1345 130 --11031
NM_001018076chr5133770 3724 3651 2870 2708 2416 1525 1079 749 581 569 523 102 43667 3150 1345 130 --11031
NM_001018077chr5133770 3724 3651 2870 2708 2416 1525 1079 749 581 569 523 102 43667 3150 1345 130 --11031
NM_001018080chr1131158 309 239 31322 1141 280 11219 --
NM_001018111chr733986 3904 602 13215 23208 2886 13129
NM_001018676chr8140 --1128 --
NM_001018677chr8140 --1128 --
NM_001020658chr11399 --21290 213 --
NM_001020658chr11399 --21290 213 --
NM_001020818chr1941722 506 171 50 11915 1297 11817
NM_001020819chr1941722 506 171 50 11915 1297 11817
NM_001020820chr1941722 506 171 50 11915 1297 11817
NM_001020821chr1941722 506 171 50 11915 1297 11817
NM_001020825chr551245 1199 1126 345 183 11142 ----
NM_001023567chr1542243 1762 940 441 42391 2114 2048 914 2995 360 22215 40
NM_001024024chr1451061 922 804 227 104 2684 264 2943 767 --
NM_001024070chr1451057 918 800 223 100 2680 260 2939 763 --
NM_001024071chr1451029 890 772 195 72 2652 232 2911 735 --
NM_001024094chr5133770 3724 3651 2870 2708 2416 1525 1079 749 581 569 523 102 43667 3150 1345 130 --11031
NM_001024218chr142234 187 2159 126 1671 --
NM_001024226chr131191 239 165 --1390 1414
NM_001024227chr131191 239 165 --1390 1414
NM_001024228chr131191 239 165 --1390 1414
NM_001024647chr1277485 6722 1102 645 537 453 61 36296 4895 152 12063 56875 6258 1987 1263 1034
NM_001024649chr5102963 2727 2709 2618 2206 2024 1107 1028 705 410 22970 2114 1276 2428 292
NM_001024660chr33634 378 293 31473 1097 132 1454 11122
NM_001024809chr172524 518 --1547 --
NM_001024847chr352436 2408 2252 812 249 --11946 11834
NM_001024855chr351739 1696 1362 512 125 11808 21733 775 1224
NM_001024934chr61517 2699 477 ----
NM_001024935chr61517 2699 477 ----
NM_001024936chr61517 2699 477 ----
NM_001024947chr52312 158 163 11037 1356
NM_001024948chr1103426 3215 3094 2810 2671 2438 2384 886 628 518 43101 3077 1149 746 43455 2683 1131 529 23374 894
NM_001024956chr11115566 5486 4772 4588 3919 3811 2092 1314 1295 839 436 32219 1333 294 42054 1933 65 22 45137 4960 4815 4675
NM_001024959chr3--1260 1251 1325
NM_001024960chr3--1260 1251 1325
NM_001025068chr331854 1420 372 --11171 --
NM_001025069chr331854 1420 372 --11171 --
NM_001025072chr372932 876 674 627 493 361 27 ----12349
NM_001025073chr372932 876 674 627 493 361 27 ----12349
NM_001025076chr10176184 6177 6005 5741 5295 2368 2238 2163 1877 1723 1476 1434 1132 826 523 496 335 24867 1061 54307 2031 1339 1003 43 36088 4389 2121
NM_001025077chr10207542 7535 7363 7099 6653 5053 4826 2834 2792 2490 2184 1881 1854 1693 1380 878 865 669 347 131 36225 5027 2419 55665 2697 2361 287 43 67446 5747 4638 765 713 314
NM_001025079chr3124174 4157 3985 3917 3847 3609 3294 3263 2587 1250 607 166 74188 3563 3556 3324 3152 2667 1444 54070 3462 2795 1568 254 --
NM_001025105chr521109 512 --21030 446 21454 497
NM_001025108chr283230 3214 3042 2546 1626 1411 981 969 --34127 3993 1286 23916 390
NM_001025248chr154405 392 148 138 11276 --2291 47
NM_001025249chr154405 392 148 138 11276 --2291 47
NM_001025252chr873085 2426 2373 1010 983 752 179 33105 2939 428 1409 --
NM_001025253chr873085 2426 2373 1010 983 752 179 33105 2939 428 1409 --
NM_001025266chr3204817 4669 4299 4277 4226 4035 3931 3890 3498 3256 1757 1438 1367 1313 1168 991 941 911 881 185 14810 34753 4104 3513 14798
NM_001025356chr12143031 3017 2989 2947 2805 2727 2671 2112 1829 885 847 797 681 616 12678 22555 376 --
NM_001025366chr641720 1651 1308 277 21880 1448 21714 1251 21849 438
NM_001025366chr641720 1651 1308 277 21880 1448 21714 1251 21849 438
NM_001025367chr641720 1651 1308 277 21880 1448 21714 1251 21849 438
NM_001025367chr641720 1651 1308 277 21880 1448 21714 1251 21849 438
NM_001025368chr641720 1651 1308 277 21880 1448 21714 1251 21849 438
NM_001025368chr641720 1651 1308 277 21880 1448 21714 1251 21849 438
NM_001025369chr641736 1667 1324 293 21896 1464 21730 1267 21865 454
NM_001025369chr641736 1667 1324 293 21896 1464 21730 1267 21865 454
NM_001025370chr641720 1651 1308 277 21880 1448 21714 1251 21849 438
NM_001025370chr641720 1651 1308 277 21880 1448 21714 1251 21849 438
NM_001025389chr1151562 1495 1284 511 25 2274 124 41268 1065 1038 496 31667 1145 525
NM_001025390chr1151562 1495 1284 511 25 2274 124 41268 1065 1038 496 31667 1145 525
NM_001025579chr1711193 ------
NM_001025580chrX93972 3749 3524 3094 997 939 541 430 69 12970 34043 3700 1009 23643 3102
NM_001025595chr451670 1257 647 180 115 11548 11484 2608 564
NM_001025596chr111186 1488 ----
NM_001025603chr111424 21541 311 11032 --
NM_001025616chr431723 1558 417 21230 613 ----
NM_001025777chr251512 1502 1401 1276 47 ----11422
NM_001025780chr981507 1489 1089 606 600 268 156 38 11131 1238 21222 345
NM_001029858chr662473 2303 2272 2259 951 661 12134 1429 22396 971
NM_001029860chr81306 1283 --1330
NM_001029863chr692779 2633 2332 2241 1111 861 839 728 583 33076 2561 193 23215 2090 --
NM_001029875chr541846 936 728 594 42964 1028 235 151 --3319 299 222
NM_001029882chr11571 ----1244
NM_001029882chr11571 ----1244
NM_001029884chr662632 2598 2132 276 267 35 21945 407 11845 --
NM_001029991chr14----1122 --
NM_001029998chr431355 1039 112 ----1539
NM_001030007chr1663237 3097 2922 1383 1066 476 53924 3050 1607 1311 907 23764 1074 11357
NM_001030055chr14194738 4717 4614 4577 4465 4260 4102 3731 3215 3193 2992 2984 2922 1517 1361 999 824 800 208 23652 3051 64478 3840 3759 3683 1716 1163 34684 3395 1687
NM_001030272chr112387 352 --1486 --
NM_001030273chr112387 352 --1486 --
NM_001031623chr641671 1201 385 312 11728 41247 1239 634 61 11285
NM_001031679chr1231234 469 73 --13327 13310
NM_001031684chr241145 1136 404 206 1365 1274 --
NM_001031685chr13900 648 97 ----1934
NM_001031689chr9----129 --
NM_001031692chr71300 ------
NM_001031695chr22114745 4624 3789 3731 3319 1258 1054 1043 962 631 154 23807 3701 32034 1747 1722 35451 4533 253
NM_001031710chr721091 336 --11116 1264
NM_001031711chr541782 1565 637 186 ----11406
NM_001031712chr61268 3309 150 102 ----
NM_001031716chr271116 1094 997 224 150 122 30 21146 799 ----
NM_001031722chr62172 145 ------
NM_001031723chr41374 ------
NM_001031725chr1298 30 190 1109 --
NM_001031732chr482377 1334 1159 1132 800 535 343 286 53707 3677 3651 2357 1433 21259 596 42455 2246 606 513
NM_001031748chr124621 613 235 163 ------
NM_001031801chr221181 ------
NM_001031803chr172270 233 --1310 --
NM_001031804chr16134072 4002 3718 3581 3475 3254 2787 1492 1412 1284 913 732 326 22885 242 43623 3405 1298 518 54425 3358 3201 1588 1371
NM_001031812chr5122250 2158 2131 1951 1820 1696 1581 1527 1474 646 372 337 42077 1787 1703 109 12144 1733
NM_001032221chr92452 164 21717 1698 --2394 202
NM_001032280chr641440 1427 1388 528 ----1336
NM_001032282chr821259 207 1874 --1886
NM_001032283chr124766 396 381 229 --1263 --
NM_001032284chr124766 396 381 229 --1263 --
NM_001032288chr2041611 1586 535 147 21114 1096 11423 --
NM_001032293chr172596 247 ------
NM_001032296chr1372837 2705 2686 2340 2050 452 260 1787 52924 2329 1970 778 254 165
NM_001032380chr1072007 1697 1615 1470 1464 351 293 ------
NM_001032393chrX1640 2783 259 2621 176 --
NM_001032394chr672671 2532 2065 2007 1770 695 133 1705 22642 296 12480
NM_001032395chr652538 2399 1932 1874 562 1572 22509 163 12347
NM_001032410chr211194 ------
NM_001032730chr1146 1627 --2584 490
NM_001033025chr151404 1380 1261 388 204 --31190 1097 75 --
NM_001033030chr31104 1214 140 1113
NM_001033031chr31104 1214 140 1113
NM_001033032chr31104 1214 140 1113
NM_001033045chr2114356 4233 3872 3776 3764 3431 3016 2886 1117 865 60 22922 1105 34181 3497 3461 33964 3041 1542
NM_001033047chr441866 1741 1622 573 --32443 2122 844 1362
NM_001033049chr2142169 1977 1635 452 ----2851 368
NM_001033057chr362108 1921 1855 1689 1590 81 11724 --2459 214
NM_001033059chr651909 1580 1496 1452 609 ------
NM_001033081chr131737 1545 167 21900 1211 154 --
NM_001033082chr131737 1545 167 21900 1211 154 --
NM_001033085chr2--180 --3328 302 246
NM_001033087chr2043076 2981 2965 345 --13060 11327
NM_001033112chr51766 ----1795
NM_001033117chr323540 500 33501 1845 1164 13262 12998
NM_001033503chr54481 410 355 117 ----1382
NM_001033507chr151282 720 573 262 216 ------
NM_001033518chr722904 2209 21021 198 1819 12515
NM_001033519chr722904 2209 21021 198 1819 12515
NM_001033520chr722904 2209 21021 198 1819 12515
NM_001033557chr221257 250 2406 399 ----
NM_001033559chr15126 1369 1352 168
NM_001033561chr17------2682 160
NM_001033564chr641783 1236 698 345 --2745 531 --
NM_001033566chr172736 144 ----1893
NM_001033568chr172736 144 ----1893
NM_001033576chr1722735 2605 22682 2542 12556 --
NM_001033578chr862284 2130 2045 1937 205 107 21873 1665 42354 1961 344 250 2268 226
NM_001033602chr132699 407 --1258 --
NM_001033659chr1711182 11463 133 1377
NM_001033678chr11129 ------
NM_001033723chr841864 1825 580 496 12686 --42779 1948 1757 1736
NM_001033756chr641654 1585 1242 211 21814 1382 21648 1185 21783 372
NM_001033756chr641654 1585 1242 211 21814 1382 21648 1185 21783 372
NM_001033910chr172046 1509 1445 1398 229 163 32 22072 203 21976 1751 2259 240
NM_001033925chr1031831 348 327 1105 22047 180 3655 365 311
NM_001034841chr1685025 4575 4478 3889 1754 1052 1044 362 24235 1579 25270 3980 74994 4187 3444 3422 1965 1952 573
NM_001034845chr481396 1335 1280 1103 1092 910 550 544 1880 --2963 558
NM_001034850chr541566 1361 1025 506 21205 1080 31107 1067 546 1276
NM_001034915chr841284 523 474 347 31014 602 63 ----
NM_001034954chr1062875 2833 2535 281 68 30 22782 1253 22977 2271 --
NM_001034955chr1062875 2833 2535 281 68 30 22782 1253 22977 2271 --
NM_001034956chr1062875 2833 2535 281 68 30 22782 1253 22977 2271 --
NM_001034957chr1062875 2833 2535 281 68 30 22782 1253 22977 2271 --
NM_001035chr111079 11200 11095 --
NM_001035003chr421169 133 1327 11160 1579
NM_001035004chr421169 133 1327 11160 1579
NM_001035260chr1031302 1150 1116 11545 31124 609 333 1281
NM_001035521chr2------1659
NM_001037132chr752255 1516 1503 710 683 22130 1923 2644 223 --
NM_001037133chr752255 1516 1503 710 683 22130 1923 2644 223 --
NM_001037163chr7136 149 --1809
NM_001037164chr761681 1652 1492 1354 1300 694 --21943 516 1187
NM_001037165chr7138932 8872 8451 8347 8338 8095 6902 6720 6673 5850 3366 1503 323 38823 7199 5634 38770 8747 7755 --
NM_001037172chr33962 885 383 1375 21423 368 41192 1147 410 107
NM_001037174chr271911 1903 1407 846 777 358 307 42255 1743 1518 416 12019 --
NM_001037277chr141611 1294 1099 331 41693 1588 1084 80 --11706
NM_001037278chr141611 1294 1099 331 41693 1588 1084 80 --11706
NM_001037290chr112938 804 1998 1878 --
NM_001037317chr1132490 2141 1954 1934 1710 1079 873 864 661 533 467 117 47 32198 2023 127 1396 21945 282
NM_001037332chr522281 1013 22344 2334 11840 12480
NM_001037333chr522281 1013 22344 2334 11840 12480
NM_001037334chr1892253 2092 1879 1592 720 686 388 316 250 42434 2044 918 262 12169 1233
NM_001037339chr141573 1348 705 550 1667 ----
NM_001037340chr141573 1348 705 550 1667 ----
NM_001037341chr141573 1348 705 550 1667 ----
NM_001037341chr141573 1348 705 550 1667 ----
NM_001037535chrX51455 1369 1028 613 604 11563 159 --
NM_001037536chrX51455 1369 1028 613 604 11563 159 --
NM_001037540chrX51455 1369 1028 613 604 11563 159 --
NM_001037553chr2164465 4245 3863 1415 993 104 35050 3990 1460 24042 343 2938 692
NM_001037631chr221015 121 1942 21157 1111 1466
NM_001037637chr51275 --2125 75 --
NM_001037738chr51117 1274 ----
NM_001037872chr24717 479 250 94 2115 104 ----
NM_001037954chr1153472 3043 2994 656 384 13073 11321 23342 3053
NM_001038493chr251592 1426 1415 970 202 ----11004
NM_001038603chr5129 --1306 2405 269
NM_001038633chr11901 ------
NM_001038640chr1521007 289 1981 2873 296 1697
NM_001038702chr562648 2166 1759 1699 862 400 1265 1873 32691 2252 913
NM_001038707chr141682 1551 1440 685 32328 361 32 --2655 353
NM_001038707chr141682 1551 1440 685 32328 361 32 --2655 353
NM_001039029chr12----1470 11969
NM_001039199chr2064746 4725 3436 3349 1095 309 33979 3961 3283 13323 21973 220
NM_001039348chr22954 851 --1413 11078
NM_001039349chr22954 851 --1413 11078
NM_001039350chr71621 11583 ----
NM_001039372chr73630 438 53 ------
NM_001039395chr932328 2233 209 22221 772 1482 --
NM_001039468chr111291 ------
NM_001039469chr111331 ------
NM_001039535chr1881573 664 473 436 429 343 91 68 --184 --
NM_001039538chr293376 3361 3305 2561 2463 2302 2259 1356 293 1280 11160 1481
NM_001039547chr3178088 7833 7793 7193 7022 6846 6423 5057 4887 3136 3026 2789 2490 1670 1133 874 300 57917 3083 602 143 109 65993 4985 4909 2472 1501 713 46641 6599 6590 5953
NM_001039569chr2103382 3372 2397 990 886 673 661 649 572 546 32772 2582 855 22204 305 1831
NM_001039570chr2254668 4601 4509 3371 395 14552 ----
NM_001039571chr2254668 4601 4509 3371 395 14552 ----
NM_001039577chr194507 3675 3435 1770 1205 754 527 221 165 53632 1059 1043 1004 286 1518 --
NM_001039585chr193958 3340 3147 3122 2846 2618 1004 855 598 24007 76 13053 24173 3995
NM_001039590chrX43425 758 601 338 33888 2917 2838 33967 294 274 21539 904
NM_001039591chrX43425 758 601 338 33888 2917 2838 33967 294 274 21539 904
NM_001039618chr11165775 5674 5638 5127 5088 4709 4315 4306 4056 3905 2331 1803 1592 1476 845 220 94863 4595 4570 3775 2159 1420 1138 778 131 65628 5164 4505 3893 3877 1483 11151
NM_001039690chr1672385 1884 1862 1638 1622 787 650 --11728 11875
NM_001039693chr274057 3742 3730 1315 1292 988 979 23696 2823 21646 1624 21114 703
NM_001039711chr1--1381 --1125
NM_001039712chr1--1381 --1125
NM_001039762chr1041963 1902 1543 439 --21914 790 32390 778 390
NM_001039802chr141333 1221 469 403 --21237 484 11290
NM_001039840chrX145617 5573 5560 5179 4811 4105 3997 3867 2302 1985 1920 1788 989 656 75484 2240 1559 1041 466 451 212 24095 1547 --
NM_001039885chr19--11543 --1978
NM_001039937chr1373174 2571 1601 1374 1335 697 613 1599 54029 3990 3708 3143 221 21398 307
NM_001040001chr671648 1522 1504 1452 1430 730 682 --21955 227 --
NM_001040020chr73986 86 44 2433 269 21124 595 21573 1332
NM_001040057chr761503 1355 1160 1000 440 103 11178 ----
NM_001040092chr82106 49 1410 ----
NM_001040100chr31996 1393 ----
NM_001040108chr1422113 2033 --62902 2402 2278 2046 1214 156 1741
NM_001040110chr751707 1570 1340 180 50 1745 21694 1510 2167 131
NM_001040135chr7----1541 --
NM_001040142chr291902 1731 756 638 622 391 368 310 112 21669 552 2676 429 --
NM_001040143chr291902 1731 756 638 622 391 368 310 112 21669 552 2676 429 --
NM_001040144chr1672385 1884 1862 1638 1622 787 650 --11728 11875
NM_001040146chr1672385 1884 1862 1638 1622 787 650 --11728 11875
NM_001040152chr764667 4212 3182 3107 1607 805 13356 --11631
NM_001040153chr133932 387 112 1870 1703 1325
NM_001040157chr492492 2106 1078 860 791 218 164 80 59 32925 2481 2081 42901 1117 1038 955 32312 1149 324
NM_001040158chr52403 178 ------
NM_001040159chr451494 1275 565 407 193 --1392 --
NM_001040181chr361126 1027 939 772 90 35 --184 21151 45
NM_001040182chr361126 1027 939 772 90 35 --184 21151 45
NM_001040183chr361126 1027 939 772 90 35 --184 21151 45
NM_001040199chr361126 1027 939 772 90 35 --184 21151 45
NM_001040200chr361126 1027 939 772 90 35 --184 21151 45
NM_001040202chr472346 2285 1812 1712 936 793 752 42422 2401 2229 460 1108 11938
NM_001040214chr621939 436 22390 2102 12347 11469
NM_001040260chr42455 345 11186 21054 793 --
NM_001040261chr42455 345 11186 21054 793 --
NM_001040272chr911787 --11921 --
NM_001040284chr16225576 5564 5504 5265 5119 4652 4615 4311 4151 4027 3687 3673 2279 2191 1912 1778 1699 1290 1189 641 564 268 55661 5063 4942 4781 1876 15828 54367 2154 1352 1112 466
NM_001040402chr472874 2815 2744 2383 1222 656 514 22097 566 11269 42882 2450 2126 725
NM_001040409chr2--1808 31018 955 82 --
NM_001040424chr2152314 2249 685 557 348 22351 211 22486 737 22134 1967
NM_001040429chr1353588 3018 2318 2262 35 2945 817 23371 2622 --
NM_001040437chr6--193 ----
NM_001040438chr6--193 ----
NM_001040441chr1104387 4158 4102 3582 3435 1476 1416 1089 602 301 25467 1257 13656 34377 4169 689
NM_001040446chr562686 2595 2570 2446 1959 330 22014 1069 --22313 2069
NM_001040450chr1572500 2073 1973 907 609 590 39 12199 12308 --
NM_001040453chr1572500 2073 1973 907 609 590 39 12199 12308 --
NM_001040665chr7114002 3950 3482 3326 3198 3080 1322 1128 404 350 55 44740 4253 3621 359 34861 4098 450 23474 1946
NM_001040666chr7----1563 --
NM_001040708chr84957 944 402 349 --2811 169 2207 132
NM_001040712chr963522 3514 2732 627 508 27 1600 53218 1050 651 567 95 22934 1007
NM_001040875chr872383 2292 1887 1673 955 580 388 22057 475 ----
NM_001040876chr411240 61723 1618 1300 607 419 354 21527 587 2577 347
NM_001042355chr16165421 5349 5239 5232 5084 5068 4883 4849 4674 4518 4166 3632 3454 1859 755 310 34866 3270 1696 35157 746 226 34262 1812 1321
NM_001042399chr123169 90 66 ------
NM_001042403chr125857 256 248 141 87 51022 880 838 202 72 1360 151
NM_001042404chr151910 1848 1415 1286 731 21646 1231 4794 445 313 127 22000 1463
NM_001042406chr61951 11001 1276 --
NM_001042410chr21183 ------
NM_001042412chr16165421 5349 5239 5232 5084 5068 4883 4849 4674 4518 4166 3632 3454 1859 755 310 34866 3270 1696 35157 746 226 34262 1812 1321
NM_001042413chr943737 2881 2710 532 43629 652 625 504 12703 23295 1454
NM_001042424chr462915 2799 849 781 337 304 23280 2278 12215 11299
NM_001042425chr641440 1427 1388 528 ----1336
NM_001042440chr531891 1827 459 1434 51746 1562 1453 792 238 21657 302
NM_001042441chr531891 1827 459 1434 51746 1562 1453 792 238 21657 302
NM_001042442chr531891 1827 459 1434 51746 1562 1453 792 238 21657 302
NM_001042443chr531891 1827 459 1434 51746 1562 1453 792 238 21657 302
NM_001042444chr531891 1827 459 1434 51746 1562 1453 792 238 21657 302
NM_001042445chr531891 1827 459 1434 51746 1562 1453 792 238 21657 302
NM_001042446chr531891 1827 459 1434 51746 1562 1453 792 238 21657 302
NM_001042453chrX51437 1344 1136 260 206 1506 31468 1374 277 2478 412
NM_001042459chr3----161 --
NM_001042473chr10112060 1910 1390 857 742 633 573 555 472 183 86 21767 1584 32154 1528 395 --
NM_001042475chr61317 ------
NM_001042481chr1482644 2455 2084 1997 456 392 350 319 1794 --12404
NM_001042486chr2031039 451 321 131 11200 --
NM_001042492chr1762463 1115 1034 784 692 282 --63493 3031 3007 791 627 508 2321 24
NM_001042493chr671914 1675 593 524 458 334 89 21565 326 21632 1356 1436
NM_001042494chr15103732 3665 3169 3019 2383 965 930 663 501 131 43368 2993 2828 1028 13787 138
NM_001042495chr15103732 3665 3169 3019 2383 965 930 663 501 131 43368 2993 2828 1028 13787 138
NM_001042496chr15103732 3665 3169 3019 2383 965 930 663 501 131 43368 2993 2828 1028 13787 138
NM_001042497chr15103732 3665 3169 3019 2383 965 930 663 501 131 43368 2993 2828 1028 13787 138
NM_001042506chrX1529 1886 1570 11436
NM_001042510chr881780 1763 1595 1474 810 419 243 134 --11459 21643 836
NM_001042511chr881780 1763 1595 1474 810 419 243 134 --11459 21643 836
NM_001042517chr132814 359 1108 2725 374 --
NM_001042533chr3103241 2977 2796 2608 2233 1262 1218 1056 1031 403 33293 2631 392 33132 3060 2399 1700
NM_001042537chrX52302 2245 1834 1735 944 12224 12236 1311
NM_001042543chr481400 1390 1352 1294 1189 1070 435 191 21178 1077 21343 997 1553
NM_001042548chr26609 330 319 240 139 82 --2895 799 --
NM_001042550chr981697 1527 623 569 242 175 53 26 21591 553 2695 501 2715 40
NM_001042552chr131107 547 254 1145 11021 11338
NM_001042555chr12104427 4368 4019 3170 2960 1774 1160 360 347 282 44044 1898 692 339 34393 4063 3857 34534 3276 45
NM_001042599chr287561 7217 6418 6304 4986 2764 2075 770 56897 6609 5808 4929 3077 57857 7544 7034 6820 5567 31779 1190 375
NM_001042601chr3133288 3124 2983 2950 2941 2883 2236 1176 756 670 625 594 91 31233 1003 306 32080 871 616 63268 3259 3205 1043 474 248
NM_001042603chr1285137 5041 4288 3628 2053 1973 1919 1145 21812 1742 95072 4713 4262 3921 3734 3567 1984 1573 1207 44789 3291 1630 1123
NM_001042604chr3204878 4556 4108 3565 3535 3400 3344 3333 3199 3192 3122 3036 1583 1035 915 857 707 523 386 51 64817 4716 4680 2955 1331 98 31217 473 134 53936 3490 1652 1353 1246
NM_001042646chr341757 1242 769 351 31774 1367 1332 ----
NM_001042669chr431723 1558 417 21230 613 ----
NM_001042681chr152231 527 474 65 43 22532 1792 21040 660 1453
NM_001042682chr152231 527 474 65 43 22532 1792 21040 660 1453
NM_001042682chr152231 527 474 65 43 22532 1792 21040 660 1453
NM_001042683chr691834 1428 1300 1140 751 736 727 458 304 31530 1177 78 31570 682 208 --
NM_001042749chrX71985 1866 1756 1471 1395 598 475 41726 1696 527 61 22034 1380 3610 289 222
NM_001042750chrX71985 1866 1756 1471 1395 598 475 41726 1696 527 61 22034 1380 3610 289 222
NM_001042751chrX71985 1866 1756 1471 1395 598 475 41726 1696 527 61 22034 1380 3610 289 222
NM_001042762chr73695 291 53 1254 31095 376 90 11076
NM_001042784chr4190 ------
NM_001043318chr1464053 3858 3692 2789 1662 1167 24173 2831 21588 1574 13952
NM_001043351chr162329 1943 1571 1563 1427 638 ------
NM_001044385chr264041 3755 886 581 205 68 1675 13023 23126 58
NM_001044387chr1944052 3904 2799 1402 --32933 1332 626 1789
NM_001044388chr1944052 3904 2799 1402 --32933 1332 626 1789
NM_001044722chr5122250 2158 2131 1951 1820 1696 1581 1527 1474 646 372 337 42077 1787 1703 109 12144 1733
NM_001044723chr5122250 2158 2131 1951 1820 1696 1581 1527 1474 646 372 337 42077 1787 1703 109 12144 1733
NM_001046chr5122977 2823 2629 2613 2229 1979 1893 1081 1042 870 415 206 22269 1144 42852 2310 1135 669 22553 1030
NM_001049chr1452449 2409 2005 1883 814 --12371 --
NM_001050chr1721090 353 --1938 --
NM_001068chr33256 120 93 ------
NM_001071775chr1341216 1201 565 501 2688 580 31856 1496 220 51838 1527 1349 774 124
NM_001076chr4--173 1196 1393
NM_001076chr4--173 1196 1393
NM_001077628chr12684 456 --1605 --
NM_001078chr12701 514 ------
NM_001080418chr12409 159 ------
NM_001083620chr4112631 2380 2324 2114 1894 1887 1699 1633 560 461 209 51690 965 590 301 252 11619 32566 1963 281
NM_001084chr7145 ------
NM_001096chr171201 ------
NM_001099678chr3136380 6254 5872 5576 4618 4570 4480 4182 1583 1309 839 197 101 36455 4336 4052 36270 2364 953 45075 2403 1523 1075
NM_001100108chr1187546 6024 5340 5238 3350 3242 3044 2857 2493 2328 2277 2222 2007 1716 1602 1501 1309 75 18361 58192 7538 5085 3270 2407 33073 1544 1025
NM_001101662chr1142 ------
NM_001105518chr14899 752 289 101 --1247 1860
NM_001106chr3239590 8733 8613 8295 8087 7872 7599 7418 7402 7347 7216 7079 7036 6806 6222 6126 6006 3792 2699 1533 393 199 133 47839 7463 7020 909 32413 2363 1310 17860
NM_001113490chrX153360 3288 3130 2956 2926 2756 2423 2328 1465 1392 778 343 129 72 45 33685 2912 1068 1117 --
NM_001115chr8183 ------
NM_001116chr1632522 1227 365 --12951 13053
NM_001117chr1862323 2168 2154 1753 426 341 22397 2081 ----
NM_001119chr411399 ------
NM_001121chr1091593 1282 635 603 521 391 346 222 205 31943 1898 1179 41646 1449 1321 1276 31772 1726 512
NM_001122679chr521250 1238 11148 ----
NM_001123chr103327 268 126 --1839 --
NM_001124chr111571 1542 ----
NM_001126chr141002 801 409 314 21016 820 1352 2943 58
NM_001128chr1663237 3097 2922 1383 1066 476 53924 3050 1607 1311 907 23764 1074 11357
NM_001128144chr21135 173 ----
NM_001144chr1651421 1303 1260 1156 222 --11387 --
NM_001146chr852245 1906 1829 1616 1521 --1148 32021 1807 869
NM_001149chr1051286 425 181 143 34 21275 558 --1470
NM_001153chr21721 1233 152 3843 348 265
NM_001159chr22718 711 --1808 --
NM_001160chr12102726 1961 1049 882 796 747 343 284 96 84 62810 2518 2388 2362 1090 455 11040 22120 35
NM_001166chr112180 22 1419 ----
NM_001167chrX166562 6513 6410 5781 2593 2444 2030 2024 1460 1390 900 866 474 332 207 35 66438 5697 2181 1372 1266 519 45656 5521 711 170 75195 4856 4539 2630 2356 1578 556
NM_001173chr14194738 4717 4614 4577 4465 4260 4102 3731 3215 3193 2992 2984 2922 1517 1361 999 824 800 208 23652 3051 64478 3840 3759 3683 1716 1163 34684 3395 1687
NM_001177chr1271735 1521 488 371 267 231 223 21935 850 ----
NM_001178chr112387 352 --1486 --
NM_001186chr2183229 3096 2680 2414 1205 1179 955 546 42972 2812 252 61 12776 32630 2234 471
NM_001187chr211508 1526 --1516
NM_001197chr221108 --184 --
NM_001198chr652343 2219 2206 2066 1782 1939 132 --
NM_001200chr202334 207 ------
NM_001201chr4123822 3810 3725 3559 3429 3233 3180 2975 2521 278 215 51 33672 3060 3018 3659 478 470 22821 1015
NM_001204chr2147726 7399 7242 5385 2503 2082 1726 1606 956 810 772 674 543 444 76226 6101 5232 2978 2569 2534 2514 106671 6176 5661 5294 2456 2333 994 355 301 200 76980 6079 2868 2617 1518 1454 187
NM_001206chr982869 2586 2447 2042 2017 1016 496 488 62474 2327 2006 751 545 384 12657 1167
NM_001207chr51275 --2125 75 --
NM_001219chr792230 1904 1847 1827 1612 1585 1569 370 43 32208 2098 713 1104 --
NM_001222chr1021798 210 31862 1740 283 11790 --
NM_001227chr1051152 224 185 102 65 175 11275 --
NM_001233chr752262 2055 674 396 378 32157 1670 890 --1419
NM_001237chr471028 844 827 749 206 155 78 1189 2942 66 1146
NM_001237chr471028 844 827 749 206 155 78 1189 2942 66 1146
NM_001238chr191169 --1510 1195
NM_001241chr242136 2037 921 718 21528 1489 1137 11757
NM_001241chr242136 2037 921 718 21528 1489 1137 11757
NM_001253chr61248 3308 283 129 ----
NM_001254chr174842 187 131 110 --2934 219 --
NM_001256chr17101152 1129 886 729 660 625 389 363 87 57 1319 32626 2520 1827 --
NM_001257chr1671371 1342 1317 1307 1267 1186 133 11044 ----
NM_001259chr7145815 5645 5014 4965 4720 4682 4550 4506 4227 1417 975 828 769 704 75518 3883 2422 1908 873 511 470 35249 4729 1974 25788 4268
NM_001262chr1168 ----1315
NM_001269chr11950 --21017 913 --
NM_001270chr551103 862 812 746 175 1888 3733 419 314 1240
NM_001278chr104937 427 359 248 11167 --21228 485
NM_001284chr54541 460 177 97 1192 ----
NM_001286chr132838 552 525 --22818 721 --
NM_001288chr62256 187 ------
NM_001289chrX--41683 1319 1287 660 --41525 624 500 486
NM_001290chr45871 857 322 293 207 --2693 410 --
NM_001298chr23356 333 311 11277 2496 343 11028
NM_001304chr17113821 3561 3475 3325 3091 3035 1398 1186 678 646 495 1362 2984 248 33765 3729 529
NM_001310chr1272480 1910 907 848 597 490 81 22930 625 1774 --
NM_001313chr41898 ----1857
NM_001319chr19------11110
NM_001326chr113424 385 95 2471 325 1142 --
NM_001328chr43496 271 254 1770 ----
NM_001329chr10------11642
NM_001331chr1132305 2113 1854 22511 2096 1430 22347 2132
NM_001333chr91282 162 --1249
NM_001338chr2171231 1102 1070 945 871 397 385 11045 --1145
NM_001343chr541358 1337 1102 652 --11324 2581 470
NM_001349chr22466 225 2629 390 --2521 419
NM_001351chr331486 528 279 1151 1484 4686 471 322 265
NM_001356chrX62097 1982 1957 1559 853 335 1557 1139 1882
NM_001358chr4----1119 --
NM_001363chrX5740 717 687 309 187 1643 ----
NM_001364chr11104228 4208 3788 3291 2952 2910 1444 1026 899 125 13024 34406 1475 457 11164
NM_001378chr2----2198 47 1350
NM_001379chr192279 218 1209 169 --
NM_001380chr1041009 790 718 385 11086 2861 854 2957 779
NM_001385chr83395 325 297 1371 --2348 312
NM_001386chr832363 1685 421 21877 1858 32257 794 104 32069 489 413
NM_001389chr21169 --1557 --
NM_001390chr1863374 3327 3202 3115 2780 2565 1410 13401 63661 3012 2300 1405 885 864
NM_001391chr1861228 1095 456 309 276 155 ------
NM_001396chr2182339 2228 2094 2021 1111 248 38 28 31798 964 347 2487 144 22671 2370
NM_001400chr1--11359 31098 1014 887 21383 1291
NM_001401chr961418 1127 1093 1021 392 206 2477 306 11462 21309 400
NM_001402chr632053 198 34 21984 1544 51868 1494 1364 392 229 2378 214
NM_001408chr131540 1054 330 --11044 --
NM_001412chrX122936 2448 2413 1202 907 831 687 618 512 371 210 179 --12383 23635 152
NM_001416chr171447 ------
NM_001417chr1241918 407 235 120 11633 21295 579 21673 132
NM_001418chr112515 175 ----1553
NM_001418chr112515 175 ----1553
NM_001419chr19194709 4621 4413 4340 4241 4230 4172 4115 3910 3750 1576 1302 1227 1166 1025 889 202 139 64 21383 1067 34427 1535 394 14350
NM_001420chr1962503 2423 2117 2108 2081 636 --12472 1651
NM_001422chr112249 194 31329 482 46 1102 --
NM_001427chr751912 1469 1446 382 327 --1288 32104 1823 1478
NM_001429chr2241086 859 797 46 ----2775 343
NM_001430chr21681 ----4714 500 231 193
NM_001432chr4193886 3873 3690 3630 3546 3485 3256 3244 2759 2625 1092 1025 981 878 863 396 222 139 118 21170 946 33658 3446 852 23556 3372
NM_001438chr193287 3251 3112 3086 3080 2857 1037 787 497 22978 545 11193 22246 1018
NM_001439chr151404 1380 1261 388 204 --31190 1097 75 --
NM_001448chrX91711 1657 1345 1295 1160 1124 385 361 116 ----2559 89
NM_001451chr1641066 462 455 383 1933 ----
NM_001452chr62614 574 2650 604 ----
NM_001453chr641565 1475 468 330 1487 2519 196 31462 1306 1239
NM_001454chr17------21012 997
NM_001458chr72647 458 ----1609
NM_001482chr153955 708 362 --2626 318 --
NM_001483chr771099 809 706 409 396 103 66 1308 1921 --
NM_001494chr102581 305 --1297 --
NM_001495chr8----21124 1052 --
NM_001497chr962172 911 868 831 373 92 42151 883 730 562 4547 471 236 200 22246 708
NM_001498chr63898 270 220 1376 --1264
NM_001514chr13403 397 190 ----129
NM_001521chr2------1659
NM_001527chr6124581 3917 3771 3736 3369 3361 3210 3075 1606 1600 897 151 44271 3275 1790 1200 --11314
NM_001530chr143396 273 170 1258 2907 323 --
NM_001533chr19--1231 --1126
NM_001539chr91105 1127 ----
NM_001542chr152366 526 329 247 235 22265 997 1535 22826 354
NM_001543chr52962 940 11130 11075 23600 3549
NM_001546chr631384 432 295 --1936 --
NM_001550chr7181 1458 2440 433 --
NM_001552chr17----11113 --
NM_001553chr43233 85 66 ------
NM_001554chr12598 515 --1135 --
NM_001560chrX52636 2524 2182 832 502 ----12020
NM_001564chr4--122 1104 --
NM_001570chr331489 987 472 11438 1480 --
NM_001584chr1151014 446 415 313 151 4893 363 290 168 ----
NM_001604chr11--1908 11019 2820 359
NM_001609chr10124443 4158 3437 1799 1502 1093 884 725 679 442 283 119 64002 3938 967 816 208 51 --1253
NM_001616chr2113364 3284 3238 3167 2783 2762 2312 2224 899 763 431 42268 999 843 413 1332 43101 2176 957 385
NM_001619chr1121089 50 11061 ----
NM_001620chr112532 329 --1733 --
NM_001621chr792849 2652 2482 2291 2273 694 498 395 147 1316 32580 1040 852 21148 618
NM_001621chr792849 2652 2482 2291 2273 694 498 395 147 1316 32580 1040 852 21148 618
NM_001624chr651376 1151 1138 492 220 41861 1715 627 323 --155
NM_001627chr362062 1849 550 391 331 317 --1960 21893 1646
NM_001634chr651909 1580 1496 1452 609 ------
NM_001635chr7191 ----145
NM_001642chr1121191 1150 21157 176 --2467 272
NM_001650chr1883000 2798 2564 1555 1384 872 381 281 14161 23484 229 54105 2817 1275 900 219
NM_001655chr1151914 1648 742 662 331 --1866 22049 717
NM_001656chr531887 420 65 21258 246 22086 1694 11778
NM_001658chr131191 239 165 --1390 1414
NM_001660chr32665 225 2327 190 1625 --
NM_001661chr173559 514 282 1702 1310 --
NM_001663chr1462349 2066 1853 957 356 321 42567 2268 2209 2091 --1876
NM_001664chr32276 61 --1269 2722 672
NM_001668chr152209 1950 1934 1823 1583 --11675 31691 1391 56
NM_001677chr12878 249 178 ----
NM_001679chr35703 669 620 532 281 ------
NM_001681chr122648 62 1186 ----
NM_001682chr1242899 2781 2169 95 22073 1861 12554 42573 815 769 150
NM_001684chr173636 3129 2966 2702 2551 887 606 24133 797 34051 1544 829 22876 274
NM_001689chr261280 712 656 520 420 279 22009 1956 1428 --
NM_001690chr3112217 1953 1904 1887 1810 1584 795 618 609 602 596 12379 --22109 935
NM_001693chr821233 249 3907 320 164 ----
NM_001695chr893991 3918 2680 1511 1497 1422 198 108 82 1989 21315 872 23045 167
NM_001701chr961616 1570 1497 1475 1466 117 ----1567
NM_001702chr8------1393
NM_001704chr61389 ------
NM_001706chr3--1395 ----
NM_001707chr7------1922
NM_001709chr11102655 2566 2092 1959 1057 1010 896 594 461 431 12882 22896 2298 22906 2590
NM_001718chr641297 1246 836 388 21180 149 --11333
NM_001721chrX165 --1105 --
NM_001726chr1----1154 --
NM_001729chr42321 127 1109 1160 --
NM_001730chr1351335 1257 594 312 189 11396 --21287 504
NM_001730chr1351335 1257 594 312 189 11396 --21287 504
NM_001731chr126941 717 711 295 202 155 1311 ----
NM_001742chr73716 376 160 --2437 383 1447
NM_001745chr561049 903 740 465 365 234 ----11092
NM_001746chr5102963 2727 2709 2618 2206 2024 1107 1028 705 410 22970 2114 1276 2428 292
NM_001748chr12851 280 ----11155
NM_001750chr531891 1827 459 1434 51746 1562 1453 792 238 21657 302
NM_001752chr113601 409 158 ------
NM_001753chr761835 1663 1401 602 237 46 11603 --41647 1448 595 206
NM_001754chr21133686 3531 3428 3266 3250 2880 1617 1031 777 596 550 544 483 11728 83731 3609 1020 870 810 732 490 393 14022
NM_001755chr1642072 1891 534 495 51997 1479 830 665 553 31835 703 244 21915 815
NM_001759chr1295207 5143 4961 4809 3429 3335 1788 1358 1241 14604 44832 4816 1655 1535 21429 891
NM_001762chr71325 131 --2312 177
NM_001769chr121170 ------
NM_001777chr3124174 4157 3985 3917 3847 3609 3294 3263 2587 1250 607 166 74188 3563 3556 3324 3152 2667 1444 54070 3462 2795 1568 254 --
NM_001786chr10152 ------
NM_001791chr141333 1221 469 403 --21237 484 11290
NM_001792chr182913 906 11081 3950 898 889 11052
NM_001794chr20------1278
NM_001795chr1651581 1469 1363 1349 1331 ------
NM_001797chr163676 548 520 2669 579 1645 184
NM_001800chr192567 80 1505 ----
NM_001801chr5----1439 1225
NM_001806chr1982593 2262 1097 1012 867 529 372 365 42054 1119 968 195 2318 282 12939
NM_001812chr41232 1102 ----
NM_001830chrX73974 3370 3285 3220 3009 1570 577 ----24039 441
NM_001839chr15758 307 119 77 41 ----1513
NM_001842chr91578 ------
NM_001843chr12--1200 1220 --
NM_001844chr12------1399
NM_001845chr132913 359 1943 11266 --
NM_001846chr13--2558 532 143 193
NM_001854chr151503 1344 1303 1193 1016 --1233 11033
NM_001855chr93591 108 42 1338 --122
NM_001858chr6164859 4430 4039 3971 3758 3572 3309 3137 1927 1919 1785 1077 517 500 238 59 54374 3146 1816 881 387 44170 3959 3514 1852 24967 4089
NM_001859chr9113969 3282 2883 1583 1531 1086 948 457 300 235 90 1281 23092 361 32828 1567 1056
NM_001875chr24839 825 288 281 21101 1059 --1376
NM_001880chr24311 295 213 114 ------
NM_001882chr5----2509 47 --
NM_001884chr51111 129 ----
NM_001885chr11------129
NM_001889chr12186 108 --1276 --
NM_001892chr521109 512 --21030 446 21454 497
NM_001894chr2231134 1027 201 --11114 --
NM_001895chr2031073 982 904 --2843 195 --
NM_001896chr16177 2459 429 ----
NM_001901chr62904 678 --1691 --
NM_001902chr11108 --1145 1383
NM_001903chr53900 618 311 ------
NM_001904chr311094 2286 27 3877 743 687 --
NM_001918chr1157338 7077 6534 6435 6242 6236 6125 3631 2824 1419 1088 976 796 660 162 38818 2950 1458 48893 6905 649 234 88240 7915 6603 6444 2279 1611 1059 22
NM_001920chr123483 250 24 --1316 --
NM_001921chr441207 1113 267 92 174 1401 11180
NM_001931chr1151314 217 108 95 89 --150 1162
NM_001935chr27916 899 876 845 320 283 160 2937 741 ----
NM_001936chr71621 11583 ----
NM_001938chr171900 1755 1586 1438 740 623 371 31382 489 397 31772 1484 230 11657
NM_001942chr1832075 1881 748 31856 1709 1365 1492 11609
NM_001944chr1882320 2303 2104 1887 1550 806 386 367 32335 324 224 1279 12231
NM_001948chr154405 392 148 138 11276 --2291 47
NM_001949chr64821 813 151 43 12295 33279 2769 533 22268 164
NM_001950chr161723 ------
NM_001951chr81102 --161 2632 596
NM_001954chr62815 780 ------
NM_001955chr61948 ----11037
NM_001957chr421796 1588 --3733 509 425 2755 634
NM_001961chr191322 ------
NM_001963chr41170 --1645 2614 584
NM_001967chr32588 433 ------
NM_001968chr42844 119 ------
NM_001969chr14133948 3813 3316 3264 3248 3064 2967 2487 1188 1040 1021 590 395 12787 23415 2838 13747
NM_001977chr44435 381 333 274 51723 1535 686 651 305 11419 2626 393
NM_001980chr1292016 1809 1538 1394 859 844 778 543 285 1810 12157 11985
NM_001981chr151933 843 774 741 187 32209 2150 2043 1893 41475 660 498 394
NM_001987chr1244342 3381 1547 335 23268 575 24096 1435 24304 1208
NM_001992chr542213 1415 682 135 21646 607 11540 12227
NM_001993chr14950 227 131 59 1336 1234 11034
NM_001994chr11181 ------
NM_001995chr411073 1308 21387 925 21180 502
NM_001998chr3185 1396 --1383
NM_001999chr541524 1084 497 223 61069 967 588 240 129 83 21404 402 1512
NM_002006chr4145833 5395 5146 4694 4269 2335 2231 1584 1365 1114 1008 653 387 126 65696 4640 4350 2293 1798 289 75199 5153 4614 3825 3722 1194 1107 34382 3801 3521
NM_002009chr1562560 1014 921 857 167 96 42773 2063 1021 491 --22304 292
NM_002015chr1373181 2912 2308 1108 1083 449 107 42955 2650 1123 994 12937 1817
NM_002017chr1151286 1023 341 322 105 --31333 968 150 11038
NM_002024chrX52028 1840 555 143 49 41833 1618 1504 222 1351 12195
NM_002025chrX139320 9183 8885 7414 5768 2981 2747 1884 1486 669 629 295 118 48081 3194 1990 594 28943 2964 79051 8358 6004 5996 2216 1293 974
NM_002027chr8140 --1128 --
NM_002031chr63697 689 333 --1261 --
NM_002037chr62447 351 ----1327
NM_002040chr21103160 3117 3049 2571 2424 2227 1174 657 166 129 32896 2546 992 --42123 2044 857 38
NM_002044chr154558 412 303 239 2278 189 21579 1462 21383 386
NM_002048chr941267 1193 987 214 31373 1153 1042 --31301 1284 1022
NM_002056chr22806 105 1735 --1839
NM_002061chr15629 609 560 354 274 2742 149 1386 11540
NM_002063chrX31170 791 30 31272 1092 1063 1335 --
NM_002069chr741448 566 328 320 1425 3616 461 150 21905 179
NM_002072chr94951 891 809 238 2973 269 1905 --
NM_002073chr2211080 1261 --1616
NM_002074chr111108 31684 277 266 1592 1495
NM_002076chr1292907 2378 2238 1210 1055 1038 789 557 275 2905 701 23119 296 23028 2988
NM_002077chr932055 747 500 2737 474 2693 86 22095 817
NM_002090chr44513 439 194 145 ----1454
NM_002092chr4135011 4972 4326 4112 3486 3448 3442 3323 1798 703 449 336 63 33884 3686 520 --31210 894 560
NM_002094chr161317 ------
NM_002106chr41281 ----1263
NM_002107chr12392 357 --2465 204 1341
NM_002111chr433366 2735 595 --13850 --
NM_002114chr6131 ------
NM_002126chr1763089 1627 1244 1047 649 229 21546 817 24156 440 11132
NM_002128chr13102377 2240 2216 2061 2034 1587 678 459 267 30 42394 2330 1601 76 32048 2006 504 42543 2348 1771 119
NM_002129chr42400 324 1162 --1349
NM_002130chr521079 121 196 1372 21289 299
NM_002134chr16------1100
NM_002136chr121251 ------
NM_002137chr772356 1993 1478 967 803 708 538 42198 2158 830 545 42076 370 269 261 12326
NM_002138chr43789 658 573 --2336 214 --
NM_002139chrX2153 145 ----1114
NM_002140chr93946 100 23 ----1480
NM_002145chr171303 ----1270
NM_002146chr1741165 968 423 173 1344 --11441
NM_002156chr21307 ------
NM_002158chr2143791 3456 3358 3261 2902 1539 1339 1225 1048 692 486 475 254 151 43480 3145 2369 284 11525 53554 3439 3386 2730 144
NM_002160chr92480 433 ----1602
NM_002163chr162492 476 --11146 --
NM_002165chr20--1274 ----
NM_002166chr24687 581 511 71 1231 --1131
NM_002167chr12468 421 ----1505
NM_002182chr3132719 2697 2123 2011 1995 1000 917 910 574 425 414 320 292 22489 1944 22377 663 22470 313
NM_002190chr62315 235 --2248 121 1350
NM_002193chr251602 1517 1454 1403 1394 --11436 --
NM_002199chr48890 876 847 791 784 361 355 37 --21036 938 --
NM_002202chr51147 1255 --21033 283
NM_002203chr593714 3634 3350 3017 1451 458 360 129 96 23854 333 --180
NM_002207chr31313 ------
NM_002210chr2183132 3107 2907 2853 2504 2427 2351 2332 2213 1236 1115 955 874 573 566 250 213 30 21268 384 2670 512 1938
NM_002211chr1081124 1110 1094 1088 899 862 815 379 1457 1945 1139
NM_002214chr7175457 5052 4641 4448 4439 4318 4200 4092 3998 3534 2033 1672 1564 1474 1338 1095 676 105737 5500 5241 4492 3669 1617 1142 786 552 71 11768 55394 5278 1020 986 570
NM_002223chr1253686 2938 978 748 402 22636 354 12729 21437 1197
NM_002227chr11954 ----3906 501 76
NM_002229chr192459 424 ------
NM_002232chr11234 1364 11111 11242
NM_002234chr123765 720 695 ----2651 201
NM_002235chr1231730 1712 52 --21409 101 11457
NM_002239chr241186 1173 1095 802 11080 --1813
NM_002240chr211118 ------
NM_002242chr211665 31582 1386 738 21595 538 --
NM_002245chr1175 ------
NM_002247chr1061703 676 624 445 161 114 1929 --11542
NM_002264chr374847 3678 3479 3449 1579 1461 318 64366 3063 1764 1571 784 407 23497 1077 --
NM_002267chr1342316 1727 1705 987 32166 2098 495 12025 22362 942
NM_002268chr321501 1401 11408 --11470
NM_002269chr6----1352 1339
NM_002270chr5135539 5162 4097 3470 1966 1912 1683 1115 1054 764 593 479 208 85565 5523 4856 3734 3707 3575 3547 1435 74708 3861 2248 2158 1819 1033 464 45489 5012 4775 852
NM_002271chr1332155 1580 826 12372 42107 1647 888 717 22336 745
NM_002285chr283230 3214 3042 2546 1626 1411 981 969 --34127 3993 1286 23916 390
NM_002291chr7--155 1106 --
NM_002293chr172752 2744 2384 942 879 868 792 --22436 2065 12456
NM_002296chr171769 1551 1360 1086 283 238 160 11140 31721 1242 705 1375
NM_002310chr5226625 6019 6011 5877 4819 4652 4497 4427 4352 4177 4147 4023 2183 1640 1484 1425 1316 1131 728 691 160 81 46374 5746 5206 484 36160 1162 542 86562 6133 5984 5666 4163 1562 1103 815
NM_002312chr138720 684 403 298 268 226 156 149 5849 661 335 204 100 11060 --
NM_002313chr1074809 4362 4059 3971 3825 3180 1134 33244 1633 1069 54277 3380 1221 1020 600 23467 497
NM_002314chr7----1922 --
NM_002335chr11--150 ----
NM_002336chr12154868 4268 3725 3594 3223 3171 1727 1671 1595 1410 1391 1218 974 952 840 24850 1713 33952 1780 792 54660 4164 3918 3563 190
NM_002345chr123637 482 242 1102 --1142
NM_002349chr281677 1530 1502 1351 521 473 308 131 1105 51166 515 385 378 320 1334
NM_002350chr821252 1012 1184 1791 --
NM_002351chrX51619 1353 556 345 294 1378 21574 1493 --
NM_002354chr21376 1402 ----
NM_002355chr1241433 1058 478 268 11391 11087 1336
NM_002356chr692519 2366 2276 1833 831 645 570 281 127 42137 923 909 113 52381 2291 2181 801 143 22447 515
NM_002358chr42648 102 1611 ----
NM_002360chr732511 2305 2106 ------
NM_002372chr53569 544 51 ----1214
NM_002374chr293376 3361 3305 2561 2463 2302 2259 1356 293 1280 11160 1481
NM_002376chr141506 ------
NM_002381chr22856 672 --1785 1316
NM_002382chr142143 137 --2499 205 2250 131
NM_002384chr181993 1975 --1987
NM_002391chr11----1327 --
NM_002395chr661417 1059 935 594 490 284 11156 --161
NM_002396chr183683 475 443 ------
NM_002397chr552053 1628 1432 245 36 2806 149 32164 1805 1619 --
NM_002398chr251440 1093 972 581 403 --21129 269 1594
NM_002399chr1541058 946 440 372 ------
NM_002402chr721112 869 1462 1327 21158 1092
NM_002403chr11413 ------
NM_002408chr143808 339 296 1208 ----
NM_002416chr42165 49 1846 --11306
NM_002425chr11----136 --
NM_002430chr2262093 1806 619 443 425 337 22452 2185 --22537 214
NM_002431chr14------1307
NM_002438chr102466 64 1217 1695 --
NM_002440chr13345 102 30 ------
NM_002442chr1221517 424 11771 31670 1524 1476 2494 479
NM_002444chrX21644 1245 ----21967 1624
NM_002445chr881565 1486 1161 1140 1107 618 556 213 1339 11256 11128
NM_002448chr41783 ------
NM_002449chr551074 464 295 254 196 1328 --2977 417
NM_002451chr983835 3035 2906 1283 1204 838 617 244 11179 32932 1272 1248 1945
NM_002467chr84430 382 178 111 ----1406
NM_002469chr121420 1444 ----
NM_002473chr2231285 1002 92 ----11163
NM_002480chr12----31296 264 213 --
NM_002481chr1158004 7831 7495 7085 5915 5308 3128 2840 2678 2470 2407 1674 617 385 219 36373 5450 2781 36693 5006 1783 25368 1259
NM_002486chr982309 2263 2058 1602 610 488 158 88 2740 44 1534 2433 110
NM_002499chr1572467 2235 1813 1536 663 652 557 1978 32499 1584 565 32449 2173 2139
NM_002500chr23916 522 475 1498 1465 1350
NM_002501chr1932803 2628 2572 12824 53807 2771 2588 1613 1578 --
NM_002505chr6----1132 --
NM_002508chr141855 1703 1469 1257 --11900 11915
NM_002514chr811096 11130 1772 --
NM_002515chr1421802 30 31875 1396 490 31810 732 196 --
NM_002516chr191322 ------
NM_002518chr241196 491 387 220 ----1473
NM_002519chr115574 420 345 323 194 11157 11391 --
NM_002520chr53312 209 81 ------
NM_002522chr1773956 3923 3897 3000 2930 1015 601 23518 272 ----
NM_002523chr72922 782 21055 906 ----
NM_002525chr1142 ------
NM_002526chr661623 1502 1467 639 366 256 21486 280 41681 1441 1209 1163 11668
NM_002527chr12182 ------
NM_002536chrX----1216 --
NM_002544chr172257 119 ------
NM_002545chr1164348 4194 3938 3534 3372 1259 1740 24759 463 --
NM_002546chr82817 619 --1557 --
NM_002553chr7--1458 --1501
NM_002569chr1521482 72 11549 152 --
NM_002570chr1521042 170 1897 1936 --
NM_002577chr363895 3463 2663 2491 2485 627 33797 3371 1437 33973 1297 637 12796
NM_002581chr975543 5376 5091 4863 4110 3618 969 25508 4253 15456 34807 4159 3996
NM_002583chr121515 3533 175 36 ----
NM_002586chr61252 21624 568 --11193
NM_002594chr2032328 972 178 22382 351 1119 21714 1679
NM_002595chr12121960 1859 1720 1459 1435 1388 1201 709 207 162 138 42 21466 520 21772 551 1449
NM_002600chr141573 1348 705 550 1667 ----
NM_002605chr1511054 21179 474 11235 --
NM_002606chr211208 1195 --1183
NM_002608chr22------11593
NM_002610chr2103070 2735 2719 2497 2395 2267 2185 2163 679 547 42880 2859 2471 2341 22378 321 3882 574 227
NM_002612chr772131 2115 1819 1794 1685 744 695 --21718 224 --
NM_002613chr16135080 5074 4726 4454 4252 3959 3343 2166 1912 1636 1606 539 137 --14747 --
NM_002618chr21443 1351 --151
NM_002623chr202521 22 1679 --3782 173 105
NM_002624chr12177 ------
NM_002628chr351009 897 878 500 267 ------
NM_002636chr6------2475 464
NM_002641chrX51815 1518 282 192 94 21913 28 21780 352 51686 1667 1445 1349 1314
NM_002643chr2------1137
NM_002645chr1173081 2728 2633 2543 2310 556 112 22455 226 12471 12483
NM_002648chr631300 859 410 --1817 --
NM_002649chr7--41577 1403 1158 1095 31463 1396 1069 11530
NM_002651chr11682 --1689 --
NM_002655chr8195252 4964 4851 4563 4513 3879 3810 3797 3690 3668 3322 2032 1652 1308 1127 1089 445 238 64 65157 3998 3783 3244 322 158 33390 2011 748 43580 3446 3272 1521
NM_002656chr621069 44 31022 995 57 2888 780 11047
NM_002657chr2033909 3003 1420 1984 43808 3327 3289 3096 12639
NM_002667chr621155 362 1316 --11010
NM_002669chr4----141 --
NM_002670chr361507 1191 621 603 535 301 --11489 21402 557
NM_002677chr883001 2913 2800 2524 2156 864 110 31 21022 498 2638 323 1800
NM_002687chr147949 840 523 503 452 306 157 --251 23 21316 269
NM_002690chr8255 44 ----190
NM_002699chr151427 1305 1227 561 552 --11019 --
NM_002706chr21540 --144 1139
NM_002707chr22310 276 ------
NM_002709chr2113628 3333 3018 2921 2885 2858 2755 2622 1171 965 635 53500 2786 2251 599 145 43566 2343 1301 733 43356 2544 457 272
NM_002710chr125868 739 450 404 241 --3316 212 62 11071
NM_002713chr151038 860 753 303 219 ------
NM_002715chr521017 472 ----31188 1155 419
NM_002716chr1183337 2287 945 587 379 222 183 38 23701 3306 22250 67 11120
NM_002718chr351915 1852 870 741 53 2263 40 21831 141 31728 698 89
NM_002719chr1472355 2327 1785 1598 789 340 107 4847 769 727 700 2928 415 --
NM_002720chr161259 ------
NM_002721chr94400 84 58 44 2516 140 --1133
NM_002726chr62176 161 ------
NM_002727chr10------3203 161 105
NM_002729chr102349 213 1593 2828 327 --
NM_002731chr1112901 2890 2732 2656 2050 1950 1942 1224 865 560 231 1899 13147 32752 2331 934
NM_002734chr1772274 2102 1784 1749 853 702 483 11941 31993 1684 359 --
NM_002736chr791743 1612 1578 783 738 564 463 435 120 41673 1385 556 479 --22090 815
NM_002737chr17145737 5479 5439 4854 4670 4428 1620 1582 1372 1215 797 688 195 82 14896 25675 5369 46234 4987 4358 1472
NM_002740chr382816 2744 2546 2401 2037 1935 908 439 21955 1745 52498 2443 974 888 529 22432 242
NM_002741chr19------153
NM_002745chr2284279 4264 3798 3602 3524 1554 1522 1316 --169 33829 3328 3134
NM_002747chr1821263 609 11709 --21908 157
NM_002748chr1581088 1075 965 855 181 128 83 58 11169 --3983 429 137
NM_002755chr154855 846 307 180 --1160 1716
NM_002756chr172981 695 --2641 394 1892
NM_002758chr173389 158 145 --1500 --
NM_002767chr174419 193 153 122 ------
NM_002786chr111247 1280 ----
NM_002787chr72216 196 ----3659 640 126
NM_002788chr14--130 ----
NM_002809chr17------1356
NM_002811chr16----125 --
NM_002813chr1241216 1127 996 362 11086 1307 1184
NM_002816chr171278 2112 105 ----
NM_002819chr1921249 1208 ----2141 115
NM_002821chr62831 798 ------
NM_002822chr121339 11647 21127 560 41292 273 148 38
NM_002823chr21275 ----1240
NM_002825chr7----1611 3555 483 163
NM_002827chr2021831 1804 --31614 1413 1196 21247 453
NM_002828chr182350 170 1719 ----
NM_002835chr73675 580 225 1488 ----
NM_002837chr1264516 4369 3570 3219 2961 1703 33352 3261 2805 14008 24579 57
NM_002838chr141095 1042 920 356 1204 --1417
NM_002839chr963522 3514 2732 627 508 27 1600 53218 1050 651 567 95 22934 1007
NM_002840chr121659 1535 --41628 654 459 330 --
NM_002841chr34478 437 155 108 ----1670
NM_002843chr1173206 992 894 408 388 100 83 --13409 43440 1349 1306 325
NM_002844chr6101433 1166 877 554 517 449 189 165 147 97 21043 398 11259 --
NM_002845chr18----1127 --
NM_002849chr1221098 810 --11054 --
NM_002850chr192813 780 1449 --1493
NM_002851chr75776 735 690 545 272 ------
NM_002858chr131322 1038 243 11027 --1102
NM_002868chr1252293 2035 1703 761 547 --32346 400 155 --
NM_002869chr1162149 2131 2093 1527 806 431 1869 62208 2104 1417 570 286 268 --
NM_002871chr151856 713 665 328 96 1774 --11567
NM_002874chr952412 2285 2058 382 302 3944 787 621 1630 32343 2195 595
NM_002882chr222100 86 ----149
NM_002886chr3155194 4907 4695 4160 3724 3706 3402 1852 1454 1445 966 919 831 654 78 53917 3268 1598 981 475 65166 4792 3943 3370 1411 1325 54956 3290 1650 1473 1317
NM_002887chr5132 ------
NM_002892chr1451189 651 614 466 166 11740 11562 21425 1388
NM_002895chr202609 209 2622 221 1706 1145
NM_002897chr22271 28 1730 1545 1120
NM_002901chr112394 379 --1752 --
NM_002902chr154423 126 105 98 1515 ----
NM_002906chr111363 2817 342 22171 618 22223 910
NM_002912chr61185 4935 833 334 220 177 2913 616
NM_002924chr11530 --1241 --
NM_002938chr4--11754 11519 --
NM_002940chr411240 61723 1618 1300 607 419 354 21527 587 2577 347
NM_002941chr371593 1166 657 483 275 168 123 1150 11061 --
NM_002942chr361193 406 348 320 210 182 ----21428 909
NM_002948chr331293 1279 399 31112 817 490 21242 423 1107
NM_002953chr12273 239 ------
NM_002955chr631457 760 378 --31872 1808 727 31416 528 287
NM_002956chr1251092 1043 1034 483 235 --2229 107 --
NM_002957chr913335 --13214 13755
NM_002958chr35784 370 362 346 284 --1156 4987 924 308 251
NM_002959chr193726 3546 2927 1530 1403 1348 1228 242 193 21787 227 53812 1026 969 718 295 12827
NM_002971chr351138 1088 921 316 309 31042 820 811 ----
NM_002973chr123512 436 123 1592 --1103
NM_002977chr282378 2197 2181 1170 933 657 509 95 1904 43277 2626 2251 265 33242 3013 2314
NM_002979chr1----2609 127 2832 593
NM_002982chr171136 --1293 --
NM_002994chr4101925 1831 1755 1467 1435 1301 685 527 495 486 41855 1522 716 335 11644 --
NM_002995chr13825 762 125 2339 133 ----
NM_002998chr841817 813 767 423 11748 31889 896 562 1866
NM_003011chr921160 233 1648 21478 124 21182 38
NM_003012chr821984 138 22614 998 23076 236 22659 957
NM_003016chr1762027 1346 692 336 256 247 2589 428 --1611
NM_003017chr641102 1001 968 892 31381 1153 145 1109 21178 327
NM_003022chrX3950 882 465 21063 807 ----
NM_003026chr941174 509 188 32 ----2290 217
NM_003030chr321363 1351 31951 1880 506 1450 1602
NM_003031chr163904 828 401 2893 663 ----
NM_003032chr322261 984 42726 866 429 415 12365 --
NM_003034chr12168159 7603 7331 5805 5502 5166 5154 2918 2647 2440 2134 1735 1677 1641 1081 792 55917 5347 3252 2300 1684 --45631 5409 607 455
NM_003035chr14952 614 112 24 --1962 1738
NM_003036chr121196 1027 ----1351
NM_003042chr361962 1419 859 792 488 291 32190 2112 343 21374 231 --
NM_003043chr374285 4239 3917 760 496 384 321 34266 4066 1048 34335 4055 2608 24037 2779
NM_003046chr8135411 5329 5305 5282 5254 4344 3865 3532 3427 1572 1535 1337 33 65268 4798 4671 3979 3471 1121 23493 1063 25400 3454
NM_003048chr262728 2106 2020 730 331 318 22539 1729 2670 305 22795 2211
NM_003051chr161258 806 666 254 247 241 11742 31566 1530 1381 1327
NM_003058chr6------2501 406
NM_003060chr541316 464 338 116 --11076 21337 959
NM_003068chr841016 897 772 720 1711 --2993 855
NM_003071chr331397 808 542 42064 1871 763 509 1173 11786
NM_003073chr22------1303
NM_003074chr332030 401 82 1425 12067 --
NM_003079chr1751003 775 720 100 63 --2176 39 11041
NM_003081chr202349 246 21075 784 --1769
NM_003082chr143424 356 128 1933 2493 25 --
NM_003085chr5----1418 --
NM_003087chr10------1243
NM_003088chr7----1767 --
NM_003092chr20179 ------
NM_003094chr15903 770 192 168 50 1940 ----
NM_003095chr125379 355 283 256 25 2333 314 ----
NM_003099chr1566394 5048 4426 1721 189 45 55314 2447 642 629 382 46530 2025 1899 1430 --
NM_003101chr151666 1065 1049 596 355 11339 41636 1380 662 318 21649 1528
NM_003105chr111107 174 ----
NM_003106chr331069 929 889 1967 --1357
NM_003107chr672197 2110 1989 1655 1648 1641 490 32504 2007 1686 12419 32450 1894 541
NM_003108chr2226893 5978 5864 5821 5445 5415 5148 5110 5053 4997 4963 4955 4849 4478 2849 2584 1568 1559 1376 1267 1069 1000 56646 6023 5849 4918 1125 97203 6812 6327 5726 4674 2139 692 583 551 36353 948 242
NM_003110chr1721098 994 1967 ----
NM_003111chr271159 1138 554 527 430 85 37 --41318 1167 1015 415 175
NM_003112chr7153096 3076 2855 2350 2323 2242 2157 2042 1126 1037 1020 785 688 285 113 23171 168 22479 2342 12073
NM_003113chr22259 27 173 1809 1116
NM_003114chr86620 332 272 248 197 176 1632 ----
NM_003128chr272717 2699 2443 2400 2078 1896 435 31102 655 443 2231 128 12857
NM_003130chr751213 989 917 256 110 ----21184 980
NM_003131chr632082 778 713 --11570 1760
NM_003137chr682199 2079 1966 1941 1821 1712 535 430 --3703 664 128 1553
NM_003140chrY150 ------
NM_003142chr2--368 42 31 ----
NM_003144chr621940 529 21970 413 21551 690 42109 2097 866 206
NM_003150chr1722097 1469 1168 31458 458 125 2515 359
NM_003155chr882759 1979 1067 948 921 718 619 531 2703 416 22683 500 199
NM_003157chr33655 118 43 2936 841 1303 1706
NM_003161chr1793351 3196 2895 2858 2698 2583 917 516 214 33049 1170 156 33363 2940 2720 11397
NM_003162chr2--1842 1801 --
NM_003178chr331471 670 38 ----2781 320
NM_003182chr71177 1531 --1465
NM_003182chr71177 1531 --1465
NM_003183chr22151 44 1782 --1235
NM_003184chr831043 1026 978 --11145 --
NM_003185chr2061173 1008 448 227 217 27 1200 11305 --
NM_003188chr61846 1781 3714 697 52 --
NM_003189chr152980 2798 2635 2487 646 22545 1313 141 --
NM_003194chr62389 361 ----2423 52
NM_003198chr11298 1239 ----
NM_003199chr18105664 5656 4579 4238 3825 3663 1982 1952 1738 1721 25678 70 11329 22013 748
NM_003201chr104945 689 295 127 2982 812 2727 656 1996
NM_003204chr1731193 1177 104 11169 21753 1562 --
NM_003205chr1532099 2010 663 2816 537 12363 11949
NM_003211chr1271310 1299 1286 474 289 235 41 21725 303 1336 --
NM_003217chr1232005 790 704 21858 1734 21919 1881 --
NM_003220chr641440 1427 1388 528 ----1336
NM_003221chr694094 3003 1664 1651 1564 1453 1269 627 446 53495 3215 436 139 35 33823 1095 429 11293
NM_003222chr2061257 1057 966 953 921 846 1318 1169 --
NM_003223chr163744 675 92 --1324 --
NM_003234chr372421 1807 1751 841 532 247 156 --22060 926 --
NM_003242chr352436 2408 2252 812 249 --11946 11834
NM_003244chr18188 ------
NM_003246chr1552054 2006 1953 1855 1746 11371 ----
NM_003247chr641673 1590 1293 291 ----21996 454
NM_003253chr2141894 1886 1848 501 ----11263
NM_003255chr1752197 1936 1639 866 440 --22645 1882 21973 593
NM_003257chr1581290 1232 1074 1015 978 937 268 88 --31176 1143 569 21438 446
NM_003259chr191154 ------
NM_003262chr3185199 4585 3838 2083 2063 1927 1888 1865 1845 1778 1538 1183 945 835 762 490 452 324 44627 3231 1806 1000 14264 14721
NM_003264chr4------1501
NM_003269chr621260 363 2473 454 1966 11161
NM_003272chr13627 110 74 --1592 1230
NM_003274chr2183014 2663 2515 2181 1887 1137 865 389 22608 873 12126 22741 1059
NM_003275chr921185 426 --11122 --
NM_003286chr2081145 1127 1021 409 375 336 251 111 --1845 --
NM_003288chr201460 ----1586
NM_003291chr134824 634 315 79 128 1207 --
NM_003295chr13----1160 --
NM_003298chr3165962 5897 5799 5634 5486 4872 4404 3864 2276 2025 1937 1904 1634 963 240 199 66108 5853 5127 4847 1348 1237 25455 4431 46071 5104 3884 1583
NM_003300chr14----1501 --
NM_003304chr381509 1425 1398 1376 1083 524 289 262 1411 41384 1252 1003 644 21115 184
NM_003305chr42141 95 ------
NM_003309chr651800 1755 1514 1305 770 --21926 1900 --
NM_003314chr5--192 ----
NM_003317chr142724 659 --1107 1213
NM_003319chr22798 310 1887 137 --
NM_003336chrX3839 305 283 --1365 2780 700
NM_003337chr581664 1069 529 377 175 160 94 78 ----21460 350
NM_003338chr1091661 1431 1423 1349 1299 551 428 329 118 41752 1404 1235 129 31498 1226 238 21882 584
NM_003339chr54997 534 483 280 11373 1386 --
NM_003340chr42432 77 --1113 1256
NM_003341chr32436 21 1201 ----
NM_003342chr1793171 2994 2416 2173 1232 760 411 342 232 12197 32006 803 647 --
NM_003344chr791686 1621 1217 624 613 170 163 112 93 ------
NM_003347chr2271875 1840 1498 1492 1432 611 272 2557 226 2483 149 12253
NM_003349chr2041611 1586 535 147 21114 1096 11423 --
NM_003352chr23834 793 42 1718 1974 3998 225 50
NM_003359chr461140 998 957 513 503 277 --41011 880 436 414 --
NM_003362chr12----5902 850 790 756 90 --
NM_003367chr192477 111 --1125 --
NM_003368chr14794 780 173 128 --1242 3818 719 311
NM_003369chr1142664 2506 821 295 32525 2098 226 --12723
NM_003370chr193802 685 649 ----1767
NM_003372chrX5783 252 218 108 93 2724 49 1702 --
NM_003374chr54744 584 256 75 130 ----
NM_003375chr102312 138 ------
NM_003376chr641720 1651 1308 277 21880 1448 21714 1251 21849 438
NM_003376chr641720 1651 1308 277 21880 1448 21714 1251 21849 438
NM_003379chr61916 1719 1415 --
NM_003380chr10--166 --1231
NM_003384chr142352 150 ------
NM_003385chr23807 320 146 3866 822 197 ----
NM_003387chr262652 2497 2451 1902 637 559 32711 2386 579 21978 735 11963
NM_003390chr11----1448 2867 817
NM_003392chr3114279 3648 3522 3515 3188 2992 2879 1589 1222 94 81 34270 4235 3896 34181 3999 869 13914
NM_003400chr22604 126 --1762 1238
NM_003403chr143808 573 340 1106 ----
NM_003404chr2021870 1855 12004 11258 21427 265
NM_003406chr871981 1518 1333 792 242 212 151 11852 21411 1400 --
NM_003409chr1861311 1041 425 319 271 262 21456 1230 21158 150 --
NM_003410chrX72842 2762 2425 2287 2115 2062 236 62826 2483 2186 1108 278 60 --72770 2627 2543 2375 2326 1085 149
NM_003411chrY51854 1804 1630 1494 659 11263 21825 1561 159
NM_003412chr32359 304 42995 2210 1076 179 13081 32418 1006 126
NM_003413chrX41789 301 220 89 2446 418 1320 41569 1399 282 51
NM_003418chr3--1845 --1792
NM_003427chr6----1654 --
NM_003430chr1971664 1429 1423 1378 1217 1151 233 --21114 503 21625 1177
NM_003431chr11454 ------
NM_003439chr733209 2998 804 21261 1194 22597 835 22708 731
NM_003442chr112701 123 1854 2329 152 2905 716
NM_003452chr941005 981 924 881 ------
NM_003453chr133307 260 222 ------
NM_003457chr172596 247 ------
NM_003463chr693126 2567 2290 2052 906 787 570 382 210 43075 2807 2401 2352 12821 1858
NM_003467chr2298 25 --2368 48 --
NM_003468chr284269 3719 3507 3308 2996 2819 1120 214 34352 1356 730 52934 912 870 264 244 11002
NM_003469chr2----1342 --
NM_003470chr1651848 1420 1392 665 201 --1567 --
NM_003471chr342234 880 233 207 22167 1552 1444 --
NM_003472chr671506 949 344 306 197 143 137 41494 1273 1247 175 21407 290 1590
NM_003473chr103434 170 75 21062 837 --1956
NM_003474chr1062387 2317 2160 1946 635 249 --22036 97 --
NM_003477chr112759 566 --1247 --
NM_003478chr11133354 3259 2868 2786 2746 2523 2193 2065 1108 997 966 586 325 63020 2965 2719 1161 355 262 23333 2086 42481 1178 700 427
NM_003482chr1222306 513 12800 32366 2300 841 42773 2634 2520 1985
NM_003483chr1272610 2531 2055 2042 1810 588 276 12033 42091 1938 581 298 --
NM_003488chr171953 ------
NM_003489chr2183347 3028 2834 2218 1263 1086 1064 721 53166 3136 2439 2115 981 63424 3205 3148 2132 825 557 32758 397 35
NM_003495chr6144 ------
NM_003496chr74806 666 307 259 ------
NM_003503chr17971 439 317 260 182 112 76 31291 1270 855 ----
NM_003505chr731302 636 389 11684 41859 1309 758 348 --
NM_003506chr861079 1057 896 457 393 307 11286 41115 910 832 231 --
NM_003507chr241983 1884 1773 1330 11545 --32062 1841 1695
NM_003517chr1137 ------
NM_003522chr6139 ------
NM_003528chr151728 1452 1376 1331 1128 11360 1183 --
NM_003548chr1146 ------
NM_003557chr171638 1561 1533 1426 1406 1100 389 ----11075
NM_003559chr1763287 3064 1076 1039 818 303 11171 --13863
NM_003563chr1721400 392 21380 146 ----
NM_003566chr12163020 2998 2793 2619 2279 2133 1360 1230 1224 1130 953 866 852 802 645 623 42703 1041 792 583 53461 2760 2502 305 49 32861 1153 761
NM_003567chr11316 ------
NM_003569chr64656 547 536 129 188 175 --
NM_003574chr18185672 5605 5362 4180 4160 4114 4050 3638 2250 2144 2075 1325 777 608 511 338 294 45 55113 4217 4167 970 378 55390 4066 981 921 731 54438 1866 1849 1360 1333
NM_003576chr1372837 2705 2686 2340 2050 452 260 1787 52924 2329 1970 778 254 165
NM_003580chr81185 2133 67 1518 154
NM_003582chr12220 42 ------
NM_003583chr12173939 3815 3655 3494 3397 3250 3081 3064 2695 2423 1440 812 347 198 165 137 88 33285 2928 2533 13555 13463
NM_003590chr2144013 3979 2987 2939 2888 2843 2796 1234 1203 1129 1075 1057 795 29 43824 3606 496 67 ----
NM_003591chr10--1332 1321 --
NM_003592chr71476 1114 1416 --
NM_003597chr272201 2021 1933 839 377 365 314 1583 11798 2230 36
NM_003601chr41190 ----1163
NM_003603chr462043 1455 1431 1394 838 682 21993 1841 12123 12072
NM_003607chr174229 4072 4034 3209 948 655 444 23840 2999 14241 --
NM_003615chr353820 3312 1320 1264 364 93284 3203 2849 1218 1162 1045 840 792 616 53618 873 584 533 206 53547 1302 609 296 120
NM_003618chr271274 1215 974 467 400 379 157 21290 513 11335 --
NM_003620chr171960 2757 397 184 51028 852 416 358 56
NM_003622chr1292602 2550 2420 2156 1996 1855 975 665 489 --1820 22200 1639
NM_003626chr1171348 1243 1072 1023 1006 298 206 --2411 149 11134
NM_003629chr153373 2588 587 377 52 22990 2129 --22312 364
NM_003630chr65697 538 532 176 164 1718 2606 118 146
NM_003633chr522305 961 12407 --22081 862
NM_003642chr2--180 --3328 302 246
NM_003645chr15------1255
NM_003654chr111562 --166 --
NM_003655chr171311 ------
NM_003658chr11----1853 --
NM_003659chr21828 1882 21056 43 41165 1108 995 372
NM_003663chr383290 3166 2673 2384 815 746 482 312 41275 1114 759 597 33274 2624 1013 11226
NM_003668chr12----127 --
NM_003670chr341419 1181 1160 929 11451 ----
NM_003671chr973402 3392 2806 2499 1350 912 378 33356 3059 2511 23482 2982 13432
NM_003672chr16549 535 506 241 112 87 41948 453 230 38 1275 11371
NM_003675chr104421 200 146 136 ------
NM_003677chr1251613 1593 1523 609 326 21668 73 21904 751 32007 1683 839
NM_003684chr131141 845 816 --1702 --
NM_003688chrX1297 --1204 --
NM_003692chr94991 729 384 106 1802 --3712 189 61
NM_003701chr1321004 141 --1714 2216 55
NM_003702chr81781 ----1724
NM_003704chr4----1637 --
NM_003711chr51248 ------
NM_003713chr141399 1122 427 56 1497 --31768 1561 120
NM_003714chr552744 728 695 555 50 23116 881 1868 --
NM_003718chr74552 439 116 32 ------
NM_003722chr382556 2488 2372 1948 1919 1844 1802 1678 11685 32644 445 119 21961 800
NM_003740chr651893 1885 1801 1356 1262 ----11340
NM_003743chr23904 307 280 --1260 1590
NM_003744chr1431263 1227 933 1901 --1869
NM_003749chr1362267 1796 1533 808 329 249 11563 22064 1676 1309
NM_003750chr10--4762 669 662 35 ----
NM_003758chr1521315 1029 21351 459 ----
NM_003758chr1521315 1029 21351 459 ----
NM_003759chr494092 4051 4042 4036 3964 2829 2736 1009 626 44099 3731 3440 657 43393 889 767 218 42642 877 358 161
NM_003760chr13693 330 257 1703 --2272 53
NM_003762chr151458 1338 1184 327 193 11238 ----
NM_003763chr2073083 2447 2074 1981 1129 359 282 2967 674 1428 23148 3033
NM_003764chr63755 596 271 --1663 1614
NM_003766chr172509 40 2148 69 1225 --
NM_003769chr12294 33 1337 1107 1122
NM_003772chr1161123 929 920 420 384 246 21030 400 --11311
NM_003774chr12143242 3212 3190 3167 2995 2865 2522 2508 2441 2422 2397 2390 1305 455 53252 2555 2165 1222 1002 43152 605 489 387 32409 2378 255
NM_003777chr73559 395 96 --1402 --
NM_003783chr141060 425 384 329 1809 41092 958 438 134 21225 158
NM_003786chr17----1362 --
NM_003787chr1891634 1456 1387 1253 1152 533 492 430 105 1475 1280 11218
NM_003794chr331055 684 174 21066 987 1732 --
NM_003796chr19--2435 388 ----
NM_003797chr111194 ------
NM_003799chr18104252 3690 2827 1529 1214 1029 612 268 228 99 11149 --11090
NM_003800chr672252 1982 1646 1509 571 457 389 1427 12040 31519 799 130
NM_003809chr171488 ----1472
NM_003816chr851521 1394 1150 1115 1093 --165 31229 1048 77
NM_003818chr2051104 985 938 314 138 1969 --1258
NM_003819chr11228 ------
NM_003821chr83255 205 71 2481 237 2587 158 --
NM_003822chr193132 3094 2486 2471 2465 2448 1129 1082 329 42629 2607 672 619 11208 --
NM_003825chr1521027 984 11490 11575 --
NM_003829chr95910 842 251 198 81 ------
NM_003831chr1871856 1806 1591 1314 1305 294 162 21531 1339 31832 1519 676 21721 308
NM_003845chr12------193
NM_003850chr132563 89 ------
NM_003858chr14----2647 37 --
NM_003860chr111350 ------
NM_003861chr1452676 2310 2088 1132 319 --42588 2038 1980 660 1581
NM_003862chr5177 ------
NM_003864chr4--1187 ----
NM_003870chr1531798 1493 1389 1298 1143 21612 631
NM_003872chr232207 692 643 --13041 --
NM_003873chr1072375 1917 1825 1796 1561 805 594 11605 1972 32246 2066 525
NM_003884chr3101739 1707 1654 1248 1227 701 509 215 195 70 61869 1857 1571 1294 631 454 --31484 524 25
NM_003885chr1762663 2487 2316 2217 1927 598 12233 145 --
NM_003887chr262305 1684 1507 258 173 153 32347 753 134 11929 21571 796
NM_003899chr1362614 2308 2114 1856 670 342 1603 12022 12154
NM_003901chr1062627 1046 802 258 150 51 32672 827 706 21977 183 --
NM_003902chr12217 93 2781 321 1732 --
NM_003906chr21150 ------
NM_003909chr873027 2626 2551 2288 1890 680 86 32192 2181 1909 22998 1028 42442 1053 632 442
NM_003913chr664089 3405 3029 764 565 352 53579 2966 1060 499 213 73983 2998 1679 1392 937 469 326 53431 2799 1309 1080 784
NM_003914chr13------1183
NM_003916chrX51273 1012 598 265 27 31512 364 242 1572 31066 552 156
NM_003921chr191788 1575 1265 639 280 268 207 145 62 2109 47 41437 1157 231 25 41728 1559 1376 253
NM_003922chr153404 286 171 ------
NM_003924chr421409 1254 11261 ----
NM_003927chr183411 333 149 --1126 1848
NM_003930chr741890 1704 393 255 32141 1943 425 22569 370 --
NM_003931chr61517 2699 477 ----
NM_003932chr2241420 1231 774 288 21427 1326 --31727 474 243
NM_003934chr981263 1178 1097 824 478 383 337 73 2909 418 31242 920 877 41063 512 440 409
NM_003938chr191187 ------
NM_003939chr1044035 3828 3738 3093 33794 1101 268 24146 3507 22726 2591
NM_003940chr3----146 --
NM_003941chr792371 1940 1838 1731 1677 1628 917 732 702 22053 1892 3418 139 32 22111 384
NM_003942chr112173 155 ------
NM_003946chr161565 ------
NM_003947chr3193 1876 --21360 1013
NM_003948chr4132595 2432 2400 2284 2238 1884 1715 1646 1079 462 332 289 57 22183 2067 11952 --
NM_003953chr162880 2378 2267 2164 415 386 22719 515 ----
NM_003966chr5147707 7218 7028 6578 6329 5652 2791 2756 1996 1556 978 525 202 25 57012 7000 6838 2618 914 36530 2965 237 37048 5766 5097
NM_003968chr32112 80 --2445 135 --
NM_003972chr103447 389 89 2487 374 1288 --
NM_003980chr651188 1056 580 526 382 1346 31306 256 112 1466
NM_003981chr15------31056 1037 898
NM_003987chr1022022 1469 ------
NM_003988chr1022099 1546 ------
NM_003989chr1021958 1405 ------
NM_003990chr1021958 1405 ------
NM_003993chr1172 ------
NM_003994chr12104350 3323 3275 3250 3112 1393 1365 1323 249 132 53788 2910 2723 1404 1275 13958 24323 4123
NM_003998chr43668 617 162 2457 428 ----
NM_004006chrX62541 2512 2378 2287 318 121 1921 --52578 2178 1750 971 764
NM_004007chrX62541 2512 2378 2287 318 121 1921 --52578 2178 1750 971 764
NM_004009chrX62541 2512 2378 2287 318 121 1921 --52578 2178 1750 971 764
NM_004010chrX62541 2512 2378 2287 318 121 1921 --52578 2178 1750 971 764
NM_004011chrX62541 2512 2378 2287 318 121 1921 --52578 2178 1750 971 764
NM_004012chrX62541 2512 2378 2287 318 121 1921 --52578 2178 1750 971 764
NM_004013chrX62541 2512 2378 2287 318 121 1921 --52578 2178 1750 971 764
NM_004014chrX62541 2512 2378 2287 318 121 1921 --52578 2178 1750 971 764
NM_004015chrX62541 2512 2378 2287 318 121 1921 --52578 2178 1750 971 764
NM_004016chrX62455 2426 2292 2201 232 35 1835 --52492 2092 1664 885 678
NM_004017chrX62541 2512 2378 2287 318 121 1921 --52578 2178 1750 971 764
NM_004018chrX62455 2426 2292 2201 232 35 1835 --52492 2092 1664 885 678
NM_004019chrX1112 ------
NM_004020chrX62541 2512 2378 2287 318 121 1921 --52578 2178 1750 971 764
NM_004021chrX62455 2426 2292 2201 232 35 1835 --52492 2092 1664 885 678
NM_004022chrX62455 2426 2292 2201 232 35 1835 --52492 2092 1664 885 678
NM_004023chrX62455 2426 2292 2201 232 35 1835 --52492 2092 1664 885 678
NM_004028chr1883000 2798 2564 1555 1384 872 381 281 14161 23484 229 54105 2817 1275 900 219
NM_004035chr17164914 4813 4481 4268 4222 4018 3818 3812 3378 3368 2029 1151 1030 337 179 118 34524 4275 2055 54850 4610 1202 961 369 11167
NM_004040chr241349 1264 982 853 ----21273 969
NM_004050chr1422684 2463 --12259 32602 2399 2381
NM_004060chr551208 944 849 475 428 --21174 866 --
NM_004061chr5------2607 46
NM_004063chr8--1351 1311 1100
NM_004067chr771143 1050 1006 565 459 430 75 --21475 595 21230 1028
NM_004071chr22105 67 --197 161
NM_004075chr121534 1514 3407 155 147 --
NM_004079chr172961 2435 1821 1150 904 688 52 11124 32022 1957 597 32076 2062 466
NM_004080chr751021 560 489 266 183 123 ----
NM_004081chrY41611 1601 381 238 11221 1582 3569 422 360
NM_004085chrX1630 --1197 --
NM_004087chr331464 1302 375 11716 3657 522 83 31760 1607 586
NM_004093chr1373153 2898 2862 2480 2405 2115 2014 13174 22821 1116 13265
NM_004094chr14102914 1050 941 843 837 809 503 463 441 112 32030 1865 791 22388 212 22522 784
NM_004096chr1031827 1391 310 --42145 1430 1369 732 --
NM_004100chr652284 1646 100 55 31 --3880 756 616 1231
NM_004101chr561794 1453 1412 1379 604 300 42096 1754 458 342 1727 31782 1596 436
NM_004105chr22954 851 --1413 11078
NM_004109chr1182231 2213 1925 1786 257 176 123 45 42185 2092 2075 1667 --2161 63
NM_004111chr114462 197 161 150 1697 ----
NM_004117chr642061 1717 1535 1529 32083 1735 1519 1502 32182 1488 463
NM_004124chr14103447 3228 3028 2734 2673 2282 2222 1326 1309 644 52904 1051 947 778 651 33214 581 541 1877
NM_004126chr71115 --2189 80 --
NM_004128chr131152 2483 416 1165 1139
NM_004133chr872644 2603 2432 2318 566 139 90 21707 56 11821 1426
NM_004136chr1593191 2963 2509 2346 2276 2193 1067 470 317 1176 63288 1234 986 969 520 169 11189
NM_004145chr191356 ------
NM_004156chr81466 1613 --153
NM_004157chr32783 254 --2775 27 --
NM_004161chr251507 1335 654 163 110 1210 21501 1293 --
NM_004162chr32504 143 1869 1165 --
NM_004163chr182409 136 152 ----
NM_004170chr951839 1152 558 437 389 11655 1498 1357
NM_004171chr11219644 9542 9294 7859 7643 7563 7085 6080 3434 3187 3121 2783 2118 1951 1684 1452 1336 1056 1043 533 281 31713 614 596 48395 7178 1431 942 68217 7621 7340 6886 2709 27
NM_004172chr561931 1848 1725 1562 1307 314 1356 21913 26 1209
NM_004180chr24608 533 419 408 --154 2584 165
NM_004186chr3151 ------
NM_004187chrX2519 84 1526 21417 953 --
NM_004203chr16128 ------
NM_004205chr11----1565 2543 61
NM_004208chrX174 --1154 --
NM_004215chr85465 401 167 109 86 ------
NM_004225chr841211 1027 571 463 11150 --11442
NM_004227chr73597 550 499 --11138 32941 2850 1913
NM_004229chrX112020 1874 1844 1827 1777 1652 1645 1631 581 435 323 --1370 1100
NM_004232chr18183840 3800 3613 3525 3510 3478 3340 3312 3237 2850 2820 1360 1285 933 691 584 325 207 21044 1011 43489 3116 3002 499 43385 2679 1268 412
NM_004235chr92639 54 1875 ----
NM_004241chr10124 2650 208 --1719
NM_004242chr64371 288 94 65 154 ----
NM_004244chr123428 378 99 ------
NM_004261chr151002 989 840 686 197 ------
NM_004264chr1261257 1246 997 488 162 128 1427 2219 139 11153
NM_004268chr1121036 461 ----31161 291 111
NM_004272chr572017 1912 1873 1569 1456 1362 521 31297 1236 737 21654 784 32040 1403 383
NM_004274chr1442205 1253 759 696 12046 42908 2266 706 454 1734
NM_004279chr751867 850 429 307 236 --21523 337 --
NM_004280chr61186 3458 297 44 ----
NM_004281chr104392 185 95 55 1505 ----
NM_004282chr64219 206 184 63 ----1704
NM_004285chr196392 6245 4140 4134 2266 1779 1525 515 265 --1790 46446 6405 6384 1592
NM_004290chr531288 871 844 11363 --31024 928 184
NM_004291chr51102 --1425 --
NM_004293chr993755 2811 2389 1344 1250 1210 729 422 102 23137 2934 33636 3010 1395 23269 3165
NM_004301chr32350 317 ----1138
NM_004311chr1093044 2985 2969 2347 1057 1045 724 641 477 22007 286 --12238
NM_004316chr1241107 802 413 83 --1460 21192 447
NM_004319chr173019 2969 2861 2692 2401 2269 658 12933 33037 90 80 1833
NM_004326chr111252 11126 1209 1224
NM_004327chr2272442 2083 2047 1774 562 304 219 2957 411 ----
NM_004329chr103892 258 48 2973 222 1247 --
NM_004330chr1541101 808 362 92 --1385 2952 189
NM_004331chr872004 957 883 876 827 627 115 31765 577 397 --12128
NM_004337chr861634 1543 1443 685 491 263 2674 374 151 21436 138
NM_004338chr18196748 6615 6153 5926 5370 5364 5088 4977 4969 4498 4474 4311 2382 1954 1604 1573 1263 904 592 76983 6704 5975 2064 1558 576 478 27046 6845 46953 5736 5325 1373
NM_004342chr752319 1620 741 619 445 ----1388
NM_004346chr461546 1446 1396 496 346 28 11496 11167 --
NM_004349chr831129 498 157 2994 318 11058 --
NM_004354chr45828 695 647 602 585 2336 197 --1311
NM_004356chr111127 ------
NM_004360chr1652011 1848 1725 1709 271 1354 41644 782 477 332 3633 412 207
NM_004362chr42722 675 --121 --
NM_004365chr51296 1233 1272 --
NM_004367chr641717 1671 1161 455 11127 --21740 1209
NM_004369chr21696 2703 32 1737 --
NM_004370chr642137 1662 341 169 1253 12071 --
NM_004379chr251379 1318 1222 580 394 21463 1431 1677 31110 627 328
NM_004380chr1652337 863 359 79 38 21951 692 22194 324 1919
NM_004384chr5122250 2158 2131 1951 1820 1696 1581 1527 1474 646 372 337 42077 1787 1703 109 12144 1733
NM_004385chr5--1155 ----
NM_004386chr1952302 2292 1897 606 169 --22314 1916 --
NM_004389chr21570 --2736 60 --
NM_004392chr1382546 2463 1773 994 936 783 241 94 12079 11708 31986 697 489
NM_004393chr382351 2330 1611 1471 619 493 212 206 --11581 --
NM_004397chr1154172 3536 3514 572 331 22672 559 63360 3347 2890 2834 423 145 23728 251
NM_004404chr281622 1415 1377 679 652 372 188 121 1667 --2703 153
NM_004411chr73691 669 267 ------
NM_004412chr10145476 5337 5180 4756 4361 4296 4182 2154 2100 1044 886 383 361 110 45904 5679 4204 397 25082 3677 76049 4969 4385 4095 2063 1064 270
NM_004415chr64833 755 711 172 1192 1181 --
NM_004426chr1221968 335 --11983 1218
NM_004429chrX41451 393 252 123 --1372 11467
NM_004430chr8102787 2781 2519 2512 2322 2242 2100 1722 816 587 22408 877 11859 32659 1823 723
NM_004432chr971913 694 665 493 315 227 154 31694 768 278 --1184
NM_004434chr1441433 1204 773 98 1334 1286 11695
NM_004436chr1--1564 ----
NM_004438chr253180 2769 2723 2017 81 22776 31 22469 451 --
NM_004440chr661928 1872 1838 1463 785 485 11809 --41267 697 418 303
NM_004442chr121127 290 ----1255
NM_004447chr1251050 906 230 175 61 --198 --
NM_004448chr171483 ----1507
NM_004449chr2181408 1280 1174 1052 957 423 306 277 ----11325
NM_004451chr111697 1737 ----
NM_004457chr241595 624 565 409 1285 1137 2347 301
NM_004458chrX52669 2643 2524 2139 67 41839 959 849 486 32650 2621 1024 32532 1791 258
NM_004459chr17101853 1599 1518 1429 1349 459 422 154 125 83 162 12001 21802 1564
NM_004462chr81664 ------
NM_004463chrX1213 1182 2623 151 --
NM_004464chr4194208 4079 3448 3345 3329 3289 3245 3085 2771 2762 2746 1370 1119 897 597 588 477 462 355 23305 642 24253 3231 63868 3625 3535 1537 922 433
NM_004469chrX1401 --137 --
NM_004480chr141821 1726 --1561
NM_004481chr122473 964 22086 411 12356 32567 2395 83
NM_004482chr26935 779 722 619 597 129 3800 712 609 1675 --
NM_004491chr1923157 2853 ----24276 4166
NM_004492chr15277 23 1259 1207 --
NM_004496chr1461317 1256 1056 858 459 125 1510 11337 --
NM_004498chr151336 ----160
NM_004499chr51365 ------
NM_004500chr1461323 778 690 559 286 237 22041 408 ----
NM_004501chr1113699 3121 3069 2944 2874 1633 1277 939 772 288 124 74072 4010 3462 3230 2824 2777 1192 33132 946 173 53604 3192 963 564 86
NM_004503chr121615 ----1855
NM_004504chr271869 966 737 649 434 389 92 52180 1171 938 708 542 1727 4984 716 490 300
NM_004505chr173653 558 495 21673 1491 21765 1284 1531
NM_004506chr61288 2670 62 ----
NM_004516chr19111215 1183 788 510 423 386 370 323 175 144 37 --21278 415 11153
NM_004520chr52570 94 1716 1748 --
NM_004521chr10--2293 122 1372 --
NM_004523chr1031485 1247 572 191 --132
NM_004524chr172242 205 --1282 --
NM_004525chr281130 1103 1029 1017 462 175 153 56 21264 1169 ----
NM_004526chr31635 --1642 --
NM_004529chr961463 1303 1258 1164 188 84 11114 1996 11370
NM_004535chr2051369 1344 1300 1181 613 ----11387
NM_004537chr1281467 1166 1068 1043 448 344 187 171 1369 31326 1268 251 --
NM_004559chr1--1396 2319 304 1271
NM_004571chr2193402 2975 2933 2753 2656 2121 1056 610 574 22903 1048 12146 1220
NM_004575chr491599 1514 1508 1483 1435 566 554 362 356 2637 502 ----
NM_004576chr5--1439 1379 160
NM_004580chr1531362 1250 630 11703 --11570
NM_004582chr12124 44 ------
NM_004583chr172214 207 --1227 --
NM_004586chrX65200 4982 4442 3992 1108 324 34954 4884 4478 54946 4877 4385 4333 3390 35089 2115 713
NM_004593chr32239 63 ----2877 690
NM_004595chrX1381 --2134 121 --
NM_004598chr573093 3025 2854 2773 2752 2567 2215 2732 341 32734 1302 1231 12483
NM_004599chr222508 440 --2680 101 1689
NM_004600chr13969 958 580 ----2984 371
NM_004602chr2031431 1022 930 1980 21438 585 --
NM_004607chr5------1209
NM_004612chr9134105 3719 3518 3354 3348 1560 1523 1342 933 518 293 251 56 44365 1832 959 490 33727 3387 1116 24216 273
NM_004615chrX2802 724 144 --1885
NM_004619chr172046 1509 1445 1398 229 163 32 22072 203 21976 1751 2259 240
NM_004622chr272474 1786 1717 1566 491 290 273 32309 1669 690 1120 11599
NM_004630chr112975 483 --1740 --
NM_004631chr131276 901 384 2999 514 1233 1135
NM_004635chr32123 96 --1750 --
NM_004642chr122195 36 --1232 1527
NM_004643chr141808 --1840 1121
NM_004645chr17--1732 --2852 80
NM_004650chrX91922 1697 1613 1359 1331 1241 700 350 74 11314 21910 131 11213
NM_004654chrY21226 463 1864 1277 --
NM_004657chr23485 209 198 --21317 1209 21343 1218
NM_004660chrY42085 2022 1886 1505 1558 1855 --
NM_004661chr571284 1084 1057 923 824 101 41 --11254 --
NM_004666chr651079 1019 422 218 24 1936 ----
NM_004670chr10111717 1711 1443 1354 1298 662 362 226 205 103 57 1604 1297 11428
NM_004673chr121562 291 51464 1224 303 219 56 1546 3611 387 117
NM_004681chrY1678 1139 --1593
NM_004685chr1352987 2437 1111 842 173 12463 1369 2950 782
NM_004686chr851718 1685 1190 526 495 11736 21318 155 21822 164
NM_004689chr141344 1333 ----
NM_004694chr173709 650 181 2348 120 --1207
NM_004696chr12539 304 --2815 652 1859
NM_004703chr1742486 2213 1952 82 --142 1851
NM_004708chr19--198 ----
NM_004709chrX31696 79 33 11210 1259 1704
NM_004715chr18----1168 --
NM_004719chr12--32864 2378 2172 22460 124 32682 1937 519
NM_004725chr101107 --31146 1110 177 1162
NM_004726chrX115429 5244 4007 3726 3588 2005 1935 1769 1102 1003 991 44335 4124 3489 2313 21368 244 23894 3659
NM_004727chr1521747 1684 --11892 11386
NM_004730chr551945 1939 1441 412 266 21590 1369 1327 --
NM_004731chr1231686 1656 398 41534 619 276 152 1551 31497 164 72
NM_004733chr32549 49 2595 100 ----
NM_004734chr1363222 3003 2727 2559 465 107 --1512 1362
NM_004736chr1102248 2031 1814 1763 1555 802 796 561 252 197 --2829 542 21845 419
NM_004737chr2231197 1083 112 --1346 --
NM_004738chr2021016 746 2343 299 1984 22302 2214
NM_004739chr111632 --1607 --
NM_004742chr31305 ----1558
NM_004744chr463907 3749 3610 2735 1427 935 43424 1531 1169 994 21336 851 21286 1025
NM_004745chr8126970 6863 6836 6604 6593 5859 5579 4323 2366 1992 821 353 26363 5281 47043 6107 5681 897 25738 1758
NM_004747chr1051351 1225 1029 652 496 --11023 11333
NM_004748chr15154102 3798 3775 3720 2942 2782 2574 1442 1315 1273 609 541 196 45 26 33240 3037 203 21644 853 1888
NM_004755chr141211 21100 80 1489 1247
NM_004756chr1921410 1361 --11490 11520
NM_004760chr752352 2283 977 699 537 32481 1882 168 32054 1712 224 21907 527
NM_004762chr17----31947 461 153 --
NM_004764chr123610 534 206 1472 280 57 1589
NM_004765chr16149 ------
NM_004768chr12874 198 3932 910 803 21072 66 --
NM_004772chr551388 1363 1251 616 358 --1175 11096
NM_004774chr1762520 2059 806 622 601 355 32673 2578 369 1549 23024 2032
NM_004775chr1892308 2122 1950 1788 1602 1517 444 277 65 21621 766 22181 612 32044 1915 899
NM_004776chr2023200 300 13248 12249 3646 604 513
NM_004779chr52400 164 21224 367 41344 1317 1027 462 1294
NM_004781chr121279 613 1354 2247 156 1645
NM_004781chr121279 613 1354 2247 156 1645
NM_004788chr1152708 1940 800 632 126 11727 42419 2378 2366 654 21919 585
NM_004789chr9--175 ----
NM_004791chr132573 29 2767 732 ----
NM_004792chr22199 42 ------
NM_004795chr1321809 1688 11450 11738 11550
NM_004797chr383715 3688 3658 2688 1303 1065 931 321 11207 ----
NM_004801chr221059 85 ----2982 141
NM_004805chr251006 992 549 493 341 1957 1326 2917 476
NM_004808chr1062983 2087 1181 456 247 196 23314 277 32716 1310 399 --
NM_004815chr1134448 4075 3058 1852 1784 1484 1182 1093 861 794 720 627 610 13106 64879 3798 1912 1888 1821 506 54838 3738 558 266 230
NM_004817chr91542 ------
NM_004820chr8----173 --
NM_004821chr52810 674 --1200 --
NM_004824chr651431 1246 1061 943 921 2281 166 11484 --
NM_004830chr63842 785 343 2795 67 --3804 719 672
NM_004831chr19--1710 ----
NM_004834chr2103222 3197 3186 3093 2741 2419 1328 1182 1044 198 --1978 --
NM_004836chr25848 759 642 338 129 1235 1742 2991 57
NM_004837chr141611 1294 1099 331 41693 1588 1084 80 --11706
NM_004840chrX42418 1906 1711 489 32435 619 46 12388 1924
NM_004841chr11308 11140 1769 --
NM_004842chr651786 1487 1480 1313 1228 21574 595 31457 1123 672 1606
NM_004846chr21129 ------
NM_004850chr251448 1430 1332 1287 534 11174 --21296 515
NM_004855chr15--1194 ----
NM_004857chr14124011 3922 3426 3397 3266 3110 1836 1697 1656 609 427 73 13735 1333 24564 414
NM_004859chr1772904 2621 2312 1187 1165 936 99 1360 --1572
NM_004863chr1475069 4563 3633 1973 1208 552 538 33521 1362 1093 33365 1965 1147 44398 3373 2059 753
NM_004865chr6--145 ----
NM_004866chr5124767 3747 3344 3280 3211 1393 1256 1245 611 556 471 75 53737 3676 3623 713 456 2941 183 44708 3866 1437 822
NM_004869chr1871370 1259 1170 534 407 349 302 11547 31219 1095 544 --
NM_004871chr1794321 4182 4019 3929 3865 3589 3270 90 24 24310 4242 22960 213 14266
NM_004872chr1--166 ----
NM_004873chr1453099 3071 3048 3015 556 22211 294 32971 1992 255 33240 2590 2126
NM_004879chr11--1966 1204 --
NM_004883chr51199 ------
NM_004884chr1521248 1219 ----21393 1368
NM_004887chr53268 185 168 ----1304
NM_004888chr931019 202 84 --1217 2391 304
NM_004891chr21224 ------
NM_004893chr52403 178 ------
NM_004896chr1031217 1065 1031 11460 31039 524 248 1196
NM_004897chr104902 782 643 199 1674 121 --
NM_004898chr452600 1131 1103 1068 21 12758 32297 1941 1079 --
NM_004902chr202346 58 3865 595 228 3731 323 45 --
NM_004904chr7186518 5710 5568 5404 4411 4261 2558 2535 2031 1847 1752 1501 509 431 303 130 73 62 44656 2285 1894 1514 64284 2529 2522 1153 863 630 95493 4984 4339 4311 4132 4088 2619 2314 2072
NM_004905chr13911 877 109 --3592 362 161 --
NM_004906chr65694 608 472 271 21 ------
NM_004912chr751640 1377 1143 1102 1087 --11415 173
NM_004915chr214824 818 568 551 1263 1247 1747
NM_004926chr1431569 1334 659 21395 1293 ----
NM_004932chr541661 594 200 193 11786 11303 --
NM_004937chr1712543 ------
NM_004938chr941244 1194 419 308 21072 1054 1356 --
NM_004943chr19------1794
NM_004946chr53490 434 333 1381 2393 314 --
NM_004947chr331939 221 213 --12334 1731
NM_004949chr1861818 1479 1465 690 673 399 62111 1625 1516 1379 855 256 21796 1457 41972 1860 411 284
NM_004953chr31306 ------
NM_004954chr111291 ------
NM_004956chr744254 2790 1019 269 1769 24516 3672 21678 109
NM_004965chr217711 657 633 303 97 68 45 --3173 153 119 --
NM_004966chr103998 746 678 ------
NM_004969chr103580 558 550 2222 213 --2420 198
NM_004972chr921081 376 21192 828 --3966 776 238
NM_004973chr621259 416 21142 235 1346 --
NM_004985chr12164425 4268 4221 3817 3740 3725 2864 1628 1615 1342 923 810 789 427 302 293 74443 3326 3226 2835 1459 1229 150 64238 3794 3254 1704 1195 24 43964 3404 1292 1216
NM_004987chr22273 59 --1138 1308
NM_004992chrX87498 7449 7091 7041 5478 5407 2754 191 28325 1129 46272 6213 1990 1955 11833
NM_004992chrX87498 7449 7091 7041 5478 5407 2754 191 28325 1129 46272 6213 1990 1955 11833
NM_004995chr1411530 ------
NM_004999chr694393 3099 2883 1627 1394 1253 698 549 407 23214 1053 43525 1717 929 354 33814 2809 1688
NM_005006chr22847 669 2800 231 21030 695 --
NM_005010chr752255 1516 1503 710 683 22130 1923 2644 223 --
NM_005011chr751707 1570 1340 180 50 1745 21694 1510 2167 131
NM_005013chr11--1100 ----
NM_005014chr92770 254 ----1267
NM_005016chr121151 197 ----
NM_005023chr531114 1025 148 11488 21517 521 4491 293 223 92
NM_005026chr121888 1252 --11760 --
NM_005028chr1022355 833 22290 272 ----
NM_005032chrX2418 305 3798 764 330 1929 --
NM_005036chr22187970 7784 7573 7285 6575 6472 5436 5323 5148 3191 3008 2316 1776 1654 1444 1275 267 167 68352 8187 7148 1252 868 576 67001 6641 5394 1170 554 426 48371 7271 6098 1899
NM_005037chr31174 ------
NM_005045chr71365 162 1749 --
NM_005054chr251763 1525 1304 1283 1186 1184 11238 11216
NM_005056chr1275381 5285 4532 3872 2217 2163 1389 32056 1986 232 95316 4957 4506 4165 3978 3811 2228 1817 1451 45033 3535 1874 1367
NM_005057chr131777 1181 413 21245 471 --11800
NM_005063chr1063768 3558 3503 1340 773 53 2872 137 33131 1547 849 --
NM_005065chr14115257 5164 5042 5023 4212 2139 2015 1127 602 470 313 95278 4292 4270 4191 4011 3845 3543 579 497 44392 4120 4098 353 12070
NM_005066chr16773 303 224 202 97 70 164 --2781 581
NM_005067chr3164 --1995 --
NM_005078chr1541865 1564 1551 1318 21479 659 --21875 585
NM_005079chr873085 2426 2373 1010 983 752 179 33105 2939 428 1409 --
NM_005086chr1261687 1338 1190 192 138 130 21525 75 21243 184 --
NM_005087chr31798 ------
NM_005088chrX3892 752 645 --1726 --
NM_005095chr151698 1472 1438 527 99 31445 1430 772 42194 2093 1503 301 2505 221
NM_005096chrX11125 ------
NM_005099chr121093 948 11135 --11225
NM_005102chr26609 330 319 240 139 82 --2895 799 --
NM_005110chr5--1327 1704 --
NM_005112chr43851 700 642 --1632 --
NM_005113chr143472 379 122 --1130 --
NM_005114chr42647 491 175 2460 453 --
NM_005116chr2064380 4374 3927 3164 1649 1372 14508 --34579 4451 4290
NM_005119chr13910 898 455 21070 419 11012 1508
NM_005121chr17153410 3381 3351 3312 3262 2738 2325 1530 1366 1349 1047 572 532 393 116 33645 3503 2856 53696 3300 3031 1168 487 73801 3154 2895 2874 1331 1190 461
NM_005124chr62931 30 ----2850 184
NM_005126chr321910 675 1861 12014 --
NM_005128chr21----1696 --
NM_005131chr182100 21 ------
NM_005135chr15103732 3665 3169 3019 2383 965 930 663 501 131 43368 2993 2828 1028 13787 138
NM_005151chr1892253 2092 1879 1592 720 686 388 316 250 42434 2044 918 262 12169 1233
NM_005153chr161537 ------
NM_005154chr152676 229 258 34 1539 1640
NM_005155chr62669 125 ----1536
NM_005156chr9175385 4699 4472 4087 4020 3972 3805 3476 3455 2005 1556 1219 1192 1046 890 856 204 104587 4166 3915 1934 1732 1107 823 772 373 136 55028 4971 3788 1599 649 33744 1648 934
NM_005159chr1552115 2039 798 474 55 22185 552 ----
NM_005160chr22126761 6236 5878 5645 5449 4855 2615 1364 1273 944 474 280 56307 5091 2608 1234 305 85693 5384 5281 4838 4723 2422 2414 1429 26488 1731
NM_005163chr145932 908 720 208 82 --1669 --
NM_005164chr1241976 822 616 536 52675 2083 1989 684 656 41862 1703 665 315 1594
NM_005168chr22698 395 --1211 21686 387
NM_005171chr1241133 1037 385 98 11087 21074 527 2859 332
NM_005180chr1061602 1150 502 420 376 217 41175 1060 427 32 --21273 1101
NM_005181chr8----1718 1306
NM_005186chr111579 1595 ----
NM_005188chr11138202 8163 7152 6810 6301 5894 3336 3146 2579 1327 642 591 206 58073 7921 6845 5067 3268 47953 7109 5408 1624 68344 6096 5989 5162 2946 484
NM_005190chr65804 787 775 315 192 --21089 287 --
NM_005194chr202573 148 ------
NM_005197chr14105515 5163 4659 4535 4448 1334 1312 724 154 106 12339 65721 5564 3968 1422 1075 907 35147 5015 202
NM_005201chr32958 951 ----139
NM_005203chr10157 1401 ----
NM_005204chr105919 793 774 361 354 1307 ----
NM_005207chr2243355 1493 914 748 43679 3580 3329 1126 23346 2663 23754 3557
NM_005214chr22978 84 1905 21120 1074 1429
NM_005219chr511179 --11668 --
NM_005220chr1711466 1427 11226 1326
NM_005227chr11508 ------
NM_005229chrX------1841
NM_005230chr125615 428 251 233 219 1159 ----
NM_005233chr3102622 2595 2220 2024 1657 1596 660 616 556 395 22386 437 12257 51938 1858 811 574 225
NM_005235chr287561 7217 6418 6304 4986 2764 2075 770 56897 6609 5808 4929 3077 57857 7544 7034 6820 5567 31779 1190 375
NM_005238chr1183526 3457 667 620 418 336 115 94 23560 2179 43239 3222 1043 218 63435 3378 3325 2739 609 311
NM_005239chr21102004 1392 1384 1331 1265 814 771 349 219 160 11279 ----
NM_005241chr31433 --2987 949 --
NM_005242chr521507 533 31457 1284 1171 ----
NM_005243chr221291 166 --2336 49
NM_005252chr141684 --1644 --
NM_005254chr1591400 1229 996 915 524 508 347 225 151 157 ----
NM_005256chr111797 1978 1162 --
NM_005257chr1831379 1195 903 11129 --1313
NM_005259chr251496 1288 1182 1017 997 11128 ----
NM_005261chr841015 920 823 653 --2956 797 1753
NM_005264chr104914 365 161 149 1243 ----
NM_005271chr101840 --21172 458 --
NM_005273chr72323 317 ----1301
NM_005277chr481730 1510 1224 614 480 392 383 357 2763 491 2735 312 1652
NM_005278chrX2485 415 ------
NM_005279chr24749 281 179 37 2863 717 --3783 739 212
NM_005281chr12712 625 --1721 --
NM_005284chr61363 ------
NM_005295chr7197 146 1272 --
NM_005296chrX21033 147 ----2786 376
NM_005302chr7--1308 163 --
NM_005316chr1121155 1051 1295 3863 824 747 1376
NM_005318chr22178 11274 11173 11226
NM_005324chr173802 437 233 21930 1432 --1554
NM_005327chr41206 ------
NM_005328chr82779 766 2715 534 --3617 599 514
NM_005329chr1652348 2305 2196 861 111 2877 647 22328 779 --
NM_005333chrX3970 431 346 21245 318 11072 1477
NM_005339chr4154225 3984 3866 3428 2907 1723 1529 1335 1019 964 906 719 498 105 68 73715 3206 3122 2625 1449 767 93 62966 777 468 414 227 43 54328 4290 4271 1329 517
NM_005342chrX42784 1863 606 332 12427 32841 2619 655 62706 1885 854 687 672 241
NM_005358chr1341725 1614 1507 247 --1757 51497 530 371 357 106
NM_005359chr18175911 5901 5480 5380 5127 4946 4561 4264 4098 4092 1856 1796 1520 1272 1141 643 240 42296 1737 381 313 46526 4279 1514 1339 22027 861
NM_005369chrX2441 176 ----1199
NM_005375chr63850 257 165 1305 1776 3420 273 194
NM_005378chr21580 ----2332 58
NM_005381chr2156 ------
NM_005385chr352381 2224 2108 293 194 11951 52576 2541 697 528 124 1244
NM_005387chr115702 679 654 466 159 ----1223
NM_005388chr931625 1291 1055 31473 1146 329 21350 403 31174 1084 140
NM_005392chr931480 1463 1217 11880 11743 11662
NM_005397chr733986 3904 602 13215 23208 2886 13129
NM_005398chr1041323 1245 233 27 --1460 11165
NM_005399chr1103828 3470 3276 1023 973 749 708 474 360 196 44335 3001 2688 1217 34248 3728 995 21333 1109
NM_005400chr272988 2830 2592 2194 1972 1884 203 186 12011 32874 1981 1067
NM_005402chr761802 1508 649 267 29 23 1373 2730 444 1283
NM_005406chr1831523 502 173 --21297 455 21636 266
NM_005410chr53557 189 63 3641 513 149 ----
NM_005414chr3------2309 216
NM_005415chr25795 769 304 108 46 ----1545
NM_005424chr1----1115 --
NM_005426chr13900 648 97 ----1934
NM_005430chr121973 ------
NM_005433chr1872617 2519 2355 1992 1738 515 460 32433 1896 855 52225 1968 1784 767 109 62723 2585 2451 2051 868 452
NM_005436chr10104034 4026 3613 3457 1592 1259 1206 709 570 364 32910 917 892 33693 1391 1189 14149
NM_005437chr1031353 241 227 --31376 1271 1154 --
NM_005443chr42522 194 ------
NM_005445chr101299 1238 ----
NM_005450chr171229 ------
NM_005455chr1101662 1527 1519 1496 1412 1372 1317 1226 531 285 1128 --21882 163
NM_005458chr912471 --32447 2225 1947 --
NM_005461chr2051868 1818 1506 1238 697 11773 11657 --
NM_005465chr141914 1906 1477 1429 --1403 1628
NM_005475chr1233216 2950 230 1290 32966 2264 2009 23256 2113
NM_005476chr941382 1303 210 59 --182 1301
NM_005477chr1522179 203 12563 --2336 162
NM_005477chr1522179 203 12563 --2336 162
NM_005479chr1021488 1388 ------
NM_005487chr2272033 2024 1723 1655 420 183 110 1104 12148 22060 1431
NM_005493chr63759 598 208 --1788 192
NM_005494chr71250 ------
NM_005497chr17125944 2026 1733 1497 1489 1336 1120 1085 1078 561 327 280 35847 5666 1785 54999 2250 2220 473 204 35072 4206 1970
NM_005499chr192667 413 1200 --1471
NM_005502chr9103022 2804 2453 2414 2320 1264 1157 1149 1060 245 42400 2272 2043 778 11042 --
NM_005504chr12116251 5915 5016 4693 4087 2403 1971 1915 1687 1608 1450 55928 4928 4717 4668 475 56281 6058 5772 5639 2273 46270 6117 4256 461
NM_005506chr452440 2154 1058 1037 801 22456 1886 52912 2757 2735 2288 680 --
NM_005509chr571812 1259 1169 434 284 111 105 31886 1521 1475 --1739
NM_005513chr351283 538 522 426 98 --11481 --
NM_005517chr12342 64 ----1116
NM_005519chr10--1545 --1519
NM_005520chr5--1775 1614 --
NM_005521chr101275 --1282 --
NM_005523chr721569 162 31120 1060 998 11384 --
NM_005524chr32282 264 1316 1130 --
NM_005526chr81287 ------
NM_005530chr1521369 116 11436 51401 1221 368 134 103 --
NM_005537chr134429 344 338 267 2897 885 1383 1103
NM_005539chr1041297 1004 877 565 182 1323 1242
NM_005542chr731942 1481 1246 21340 1302 188 21524 453
NM_005544chr22772 635 ------
NM_005561chr132830 824 ----1801
NM_005562chr141684 683 504 34 ----21482 1141
NM_005570chr1871175 1119 988 786 481 430 175 1958 1106 2998 738
NM_005573chr53750 718 91 1607 4691 614 299 115 1505
NM_005575chr5------1635
NM_005576chr152235 228 ------
NM_005578chr3165079 4986 4814 4452 4415 4340 4110 3665 3376 1940 1910 1678 1492 1006 286 203 21476 896 55162 4535 1815 1672 333 21439 156
NM_005581chr191324 ------
NM_005585chr151321 ------
NM_005587chr153978 935 763 1778 ----
NM_005591chr118973 946 544 501 451 281 212 84 32357 779 767 1169 22819 2269
NM_005593chr122610 510 2530 414 ----
NM_005595chr12957 948 ----2637 150
NM_005596chr9156096 6083 5746 5556 5157 4348 4148 1961 1662 1605 1425 1361 1286 472 410 56311 6031 1590 1418 706 85540 5214 4831 4665 4049 3949 2086 2043 44087 4014 2337 157
NM_005599chr141162 965 361 312 11379 --21146 1089
NM_005602chr34944 891 258 150 11183 11097 31304 1137 407
NM_005603chr1861815 1735 1625 805 485 50 31942 1499 189 1742 21299 1259
NM_005604chr651767 1713 1556 906 692 32467 1774 1724 32338 2303 111 --
NM_005607chr83797 351 278 ------
NM_005610chr13819 709 289 1779 2673 593 --
NM_005611chr1631029 874 179 1823 ----
NM_005613chr142208 1801 1706 1366 ------
NM_005614chr71198 --1235 11010
NM_005618chr63603 491 244 138 --1635
NM_005627chr64900 697 684 205 124 ----
NM_005629chrX----1171 --
NM_005632chr16----1983 --
NM_005637chr183721 401 198 1749 --1689
NM_005638chrX61661 1541 1481 1459 544 409 11770 21623 296 21751 131
NM_005639chr1261800 1267 1255 1242 217 141 31439 506 382 1363 11369
NM_005644chr11119 --191 --
NM_005646chr11224 --1257 146
NM_005647chrX83267 3202 3132 2861 2529 1024 954 888 53469 2834 1094 1050 1042 13151 1181
NM_005650chr2231385 1106 360 21214 418 --11199
NM_005655chr821259 207 1874 --1886
NM_005656chr2131482 593 111 184 --21525 490
NM_005657chr15154 166 ----
NM_005662chr81109 ------
NM_005665chr1144882 4792 4756 4693 3990 1186 958 946 836 672 561 491 278 169 14681 44411 3454 1983 510 --
NM_005667chr22352 328 1438 155 --
NM_005668chr5174568 4494 4374 4268 3440 3302 3248 3237 3229 3066 3045 2804 1772 1765 834 634 511 13881 41831 1654 1447 1246 3963 645 627
NM_005685chr71113 ----1145
NM_005707chr1541331 1198 812 226 1175 ----
NM_005715chr612577 --22775 2736 32696 2018 639
NM_005717chr12300 119 --1348 --
NM_005718chr3--1260 1251 1325
NM_005721chr251033 946 717 392 144 21084 95 1802 --
NM_005722chr262432 2307 1765 1608 958 613 52217 2191 1940 1897 1743 22209 528 22265 781
NM_005724chr152700 218 1645 1595 --
NM_005725chr162446 1810 772 742 535 280 22394 2237 42430 753 441 78 --
NM_005733chr52255 188 ------
NM_005738chr761681 1652 1492 1354 1300 694 --21943 516 1187
NM_005739chr1562305 2057 1920 1798 604 363 --11742 11848
NM_005746chr7102552 2504 2406 2195 1002 812 796 654 444 215 52438 1895 1709 1064 890 22666 1907 32532 1105 1015
NM_005748chr1283337 2900 1259 1139 1019 1000 889 349 2980 477 32114 461 24 33110 2859 311
NM_005749chr171266 2473 199 186 --
NM_005752chr1651094 990 881 856 87 11112 ----
NM_005754chr541236 1039 384 311 1241 --11144
NM_005756chrX31493 210 187 41168 1036 309 241 --11157
NM_005759chr2124519 4416 4109 3975 3610 3560 3080 1140 857 704 506 242 11744 44755 4747 1867 1755 24553 3849
NM_005761chr12----1130 --
NM_005762chr191130 ------
NM_005765chrX2824 728 --1566 --
NM_005767chr131320 2247 119 ----
NM_005776chr141707 2697 206 3781 627 276 1141
NM_005779chr563673 3645 3150 2987 2783 425 12346 23198 1255 --
NM_005786chr1851002 995 947 231 129 --11299 --
NM_005789chr1761377 753 607 548 404 123 --12088 --
NM_005795chr2132991 2948 2754 2737 2555 2356 2301 2152 2037 890 882 727 472 52507 2369 1181 1100 453 --42720 2453 1058 991
NM_005797chr1141771 1307 528 522 21492 1479 11276 21383 58
NM_005801chr172765 128 1190 ----
NM_005802chr92746 208 2679 126 1327 2650 262
NM_005806chr211466 21346 828 --1972
NM_005807chr12606 288 ----1125
NM_005808chr362384 2378 1283 784 420 190 43232 1230 484 177 42562 2538 2457 155 33154 940 238
NM_005813chr281982 1051 926 832 592 504 227 215 21753 1037 42630 2394 360 262 1549
NM_005819chr142823 1264 933 487 12667 23471 2465 23488 1227
NM_005822chr642295 2069 878 240 21649 860 21985 1879 21964 1953
NM_005826chr15625 451 419 410 164 ----1515
NM_005828chr1794982 4886 4730 4658 1912 1769 510 473 224 --31534 725 639 14253
NM_005832chr361318 565 506 497 426 119 31206 1005 364 --11483
NM_005835chr64473 463 196 37 --178 128
NM_005836chr8480 68 48 42 ----1199
NM_005839chr13381 288 232 ----2927 257
NM_005840chrX127268 7059 6838 5953 5193 4743 2929 2330 2264 1317 1168 763 34677 1719 1083 66968 6052 6004 5773 4807 2342 37569 6663 5014
NM_005841chr411028 --11003 1392
NM_005842chr133666 483 162 --153 --
NM_005843chr261967 1927 1757 1729 1695 1367 1441 --41858 1492 1451 24
NM_005850chr11167 ------
NM_005853chr164576 548 415 189 1480 ----
NM_005857chr15982 578 159 89 69 2474 148 1558 51116 1060 210 175 79
NM_005859chr551561 1529 1511 1004 514 21240 1026 1189 --
NM_005862chr36992 887 813 677 431 416 1293 3941 378 114 1301
NM_005863chr103525 419 286 --2250 148 2216 202
NM_005868chr782218 2032 2023 1927 1567 707 678 509 1393 32303 1674 186 1963
NM_005870chr131217 1954 1576 --
NM_005871chr1051045 857 848 435 52 ----11103
NM_005872chr12200 61 --1401 --
NM_005880chr1651272 1247 592 317 296 31364 333 132 ----
NM_005885chr521190 459 --21481 101 11600
NM_005895chr12124129 4072 4024 3275 3199 3182 3083 3035 2580 1015 724 468 23076 214 --13169
NM_005896chr24827 215 206 158 ------
NM_005898chr1133093 225 193 11150 23021 629 32588 2320 977
NM_005899chr1761604 1499 1432 1318 431 351 --2410 93 --
NM_005900chr43961 789 779 1464 --11087
NM_005901chr18198632 8590 8422 8416 8297 7993 7624 7297 6939 6676 6249 5967 3244 2459 1734 1515 1503 1329 362 37519 1292 232 107549 6004 5371 5312 2752 1787 1364 683 479 401 57167 6607 6558 1226 1022
NM_005902chr1564461 4011 3578 3172 3091 1226 24526 988 34069 3972 3408 24034 3198
NM_005903chr5125195 4842 4547 4396 4121 3981 3936 3816 3735 872 302 46 54935 4310 1286 262 198 44686 4109 1660 1075 54998 4892 4578 4569 677
NM_005907chr61316 21617 1253 21564 233 1119
NM_005909chr584059 3731 3586 3552 3428 3235 680 601 1317 53379 1471 1409 1374 990 33858 3182 1315
NM_005920chr153836 2469 1457 632 108 --33794 3397 183 --
NM_005922chr6136 --2367 97 --
NM_005923chr64518 277 263 61 1220 2488 196 --
NM_005924chr72746 330 ----11144
NM_005927chr531113 1043 1007 --1415 2931 67
NM_005933chr1111866 1946 1678 22537 1114
NM_005935chr485158 4812 4758 4696 4260 3676 3361 1460 54860 3744 3602 1951 941 44532 4201 3938 429 53499 1937 1444 1067 311
NM_005938chrX1565 1577 ----
NM_005941chr852606 1688 1325 1047 793 21408 1349 --31164 1131 331
NM_005955chr174866 4749 4577 3965 2018 1795 167 25252 1340 1891 --
NM_005962chr1052233 2027 1554 947 892 170 2278 245 12316
NM_005962chr1052233 2027 1554 947 892 170 2278 245 12316
NM_005964chr1731451 185 122 ----1298
NM_005966chr262185 2125 1710 1672 1586 604 21959 710 21910 1818 --
NM_005973chr1------1315
NM_005977chr133418 251 32 2882 666 1329 1144
NM_005982chr14------1157
NM_005985chr20------1721
NM_005986chr1342055 831 642 115 --22607 245 --
NM_005989chr72613 210 21528 529 ----
NM_005996chr1251576 1041 626 592 176 --31316 1167 584 --
NM_005999chr15444 404 346 311 177 21235 131 1988 --
NM_006007chr993823 3182 1323 1209 1064 833 655 42 36 34431 3099 1718 31520 993 933 31337 917 394
NM_006010chr31229 --186 --
NM_006011chr1543242 3172 3023 1200 21592 1554 --34225 1031 860
NM_006012chr19--1173 ----
NM_006015chr13822 293 287 --1399 --
NM_006016chr692171 2093 2057 1787 1692 1435 891 364 73 2872 236 --12119
NM_006024chr73776 230 192 1647 --1637
NM_006033chr1852155 1637 1548 1467 531 21974 207 3855 833 607 22353 2247
NM_006035chr1411228 11329 11237 --
NM_006036chr262108 1955 1732 1644 405 101 1543 11870 2583 118
NM_006037chr2124777 4574 3887 1710 1677 1659 1502 1436 1202 1191 1081 684 2977 48 64356 4222 3871 3648 1875 1695 1491
NM_006039chr17------21088 1067
NM_006041chr17----1102 --
NM_006047chr2063266 3142 3088 2765 2177 853 33538 2230 476 21194 531 42949 2481 2470 999
NM_006048chr1----3857 467 351 --
NM_006054chr1111333 1208 31535 1314 125 --
NM_006060chr7104224 4052 3970 3545 3386 3245 3196 1029 196 190 23117 1121 11689 13350
NM_006063chr2------176
NM_006067chr1661025 892 804 416 301 113 --2336 167 2361 66
NM_006070chr33334 116 71 ------
NM_006078chr22--1194 ----
NM_006079chr64844 774 687 280 2159 103 ----
NM_006080chr731132 1104 956 22536 748 11029 1975
NM_006085chr181337 1315 1309 1195 872 831 386 215 11016 --21144 1099
NM_006086chr161234 ------
NM_006089chrX61801 1715 1262 654 76 56 11909 --2678 285
NM_006090chr11724 --1561 2739 657
NM_006094chr841760 773 742 250 21528 910 --1155
NM_006095chr4104375 4165 4087 4049 3765 3658 3576 918 518 301 84488 4474 3321 3236 2824 1530 1268 904 53938 3858 3469 455 209 21391 278
NM_006100chr32591 61 --1558 1230
NM_006106chr1193427 3355 2814 2748 2715 987 884 342 231 33283 3261 2101 22218 1261 32847 2763 1017
NM_006107chr172410 160 ------
NM_006108chr1172113 2045 1629 1569 1488 919 691 31924 1681 872 2462 170 --
NM_006116chr22----11613 --
NM_006135chr12422 165 ----11232
NM_006136chr731241 1216 241 1911 2940 381 21344 1307
NM_006139chr252621 2422 2267 2224 2133 --22307 2235 22529 2159
NM_006141chr1672050 1958 1941 1928 887 397 267 22519 1922 1983 32268 1702 869
NM_006147chr13460 59 33 185 ----
NM_006148chr1772828 2682 2294 2074 710 436 213 --1720 195
NM_006152chr12130 --2213 37 --
NM_006153chr33632 430 138 ----1558
NM_006154chr1562764 1100 1006 998 58 29 42936 1111 178 116 32698 1142 167 32928 2844 366
NM_006155chr281622 1415 1377 679 652 372 188 121 1667 --2703 153
NM_006157chr11----1106 --
NM_006158chr821453 544 ----21150 529
NM_006160chr171551 1414 --31076 642 469
NM_006164chr23440 400 366 ------
NM_006166chr1272648 2604 2433 1850 1673 392 318 52340 1980 775 210 191 3898 728 697 21810 568
NM_006167chr861790 814 689 610 600 185 31987 956 621 ----
NM_006180chr951879 1367 561 300 70 ----1254
NM_006182chr11189 ------
NM_006183chr121539 ------
NM_006186chr261278 1132 1082 966 433 282 ------
NM_006187chr1272961 2832 2630 2560 1146 926 893 1525 --12952
NM_006191chr121389 ----1971
NM_006195chr931087 955 404 21058 1025 1149 --
NM_006196chr2--188 ----
NM_006197chr821881 1687 31994 788 287 ----
NM_006202chr192270 256 ------
NM_006203chr5155236 4934 4664 4555 4420 3656 3646 3556 1598 1541 1239 1230 1098 1007 348 44637 4361 4127 828 95610 5528 4496 3963 3825 3757 1486 226 35 --
NM_006204chr10--1232 ----
NM_006206chr452487 2087 1834 985 556 22920 455 22724 895 22536 487
NM_006209chr82106 49 1410 ----
NM_006212chr1175076 4971 4890 4638 3915 3898 3582 3509 3442 3436 3387 2083 1268 1167 834 750 141 44625 3596 1505 927 21394 841 --
NM_006218chr3------1293
NM_006223chrX1488 ----2539 102
NM_006226chr241156 469 382 59 1196 21390 1279 --
NM_006232chr3------1224
NM_006237chr1341970 1436 512 302 11579 ----
NM_006241chr382005 1841 941 803 463 296 191 69 1864 22237 706 41857 748 547 397
NM_006242chr2052142 1859 1606 1527 847 21970 736 ----
NM_006244chr111494 ------
NM_006246chr1411106 2374 251 1986 --
NM_006251chr562797 2741 2730 2678 2200 670 42390 1105 929 805 32968 2668 2536 22292 1194
NM_006252chr1257299 6757 6751 6473 6465 5736 5526 4825 4806 4739 4675 3038 2911 2799 2284 2152 1789 1389 1208 1164 684 655 649 433 62 106878 5060 4651 4630 2753 1635 1444 1343 1171 497 77274 7184 6815 4665 3000 1672 261 36710 2249 621
NM_006256chr1112756 2695 2468 2369 2144 1970 984 747 619 320 117 21792 49 12024 42656 543 472 295
NM_006257chr10--1970 ----
NM_006258chr1021172 1166 21450 612 --11438
NM_006264chr42215 175 1128 --1145
NM_006265chr891451 1297 1146 1139 534 522 329 323 250 11270 --11508
NM_006267chr251596 633 433 333 323 31847 1422 642 31585 1564 151 --
NM_006268chr1121215 898 --1823 --
NM_006275chr2062370 1622 751 710 444 312 31884 1683 103 --21958 372
NM_006278chr111374 ------
NM_006281chr821132 1064 --3439 80 24 1781
NM_006281chr821132 1064 --3439 80 24 1781
NM_006282chr20104694 4405 4366 4234 3360 3211 589 235 176 156 64754 3668 3253 442 355 249 24669 4346 11694
NM_006283chr8114897 4164 3561 3530 1887 1722 1428 1019 978 410 403 74642 3742 1646 1567 1411 497 305 23467 1149 23942 1213
NM_006287chr272667 2504 2480 1718 978 809 92 21636 394 1782 --
NM_006290chr611792 21779 685 11824 --
NM_006291chr1432049 2005 1462 ------
NM_006296chr21131 --135 --
NM_006298chr652642 2597 1114 800 545 22470 1249 21004 612 --
NM_006300chr1951622 543 457 336 37 12065 12246 --
NM_006305chr152202 49 ------
NM_006306chrX85908 4810 4804 3965 1806 1576 849 500 13741 43831 1990 1940 1535 11418
NM_006310chr173915 367 335 31305 1136 939 --11190
NM_006311chr172284 65 ----1262
NM_006313chr1251548 1207 263 198 141 11582 11622 --
NM_006315chr463846 2803 2781 2767 2750 1541 31602 797 334 --34550 1482 485
NM_006320chr451152 755 439 433 47 ----2337 257
NM_006322chr131604 --1288 1633
NM_006329chr142760 512 ----1625
NM_006330chr84452 302 197 176 21507 1205 ----
NM_006334chr91100 ------
NM_006335chr12759 395 ----184
NM_006338chr1148 ------
NM_006339chr19------1535
NM_006345chr42946 233 11319 31279 378 120 1460
NM_006350chr5----188 --
NM_006352chr131833 1450 764 2776 257 31932 1569 374 32069 1806 508
NM_006353chr6----31232 244 103 165
NM_006359chrX52302 2245 1834 1735 944 12224 12236 1311
NM_006363chr204577 412 175 98 ------
NM_006364chr1451156 940 865 514 348 1361 ----
NM_006366chr661080 1040 993 849 463 394 ----11182
NM_006369chr11440 --1422 --
NM_006371chr384606 4262 4247 3690 617 534 435 386 24414 1279 --25299 692
NM_006372chr61123 --2443 189 --
NM_006375chrX51787 1762 1714 1525 1406 2750 539 21433 77 21387 332
NM_006378chr941404 1035 527 482 ------
NM_006379chr73710 540 162 22010 1708 31495 937 573 11675
NM_006380chr17104080 3271 2885 1613 1520 1363 1130 903 380 360 33119 1114 976 24138 391 1278
NM_006386chr2242323 892 297 46 31917 1516 517 52422 1663 1644 527 119 --
NM_006393chr1093051 2972 2913 2900 2840 1307 963 389 78 22797 1415 21272 352 23179 59
NM_006401chr93432 375 335 --2476 411 --
NM_006403chr671848 1400 1372 1359 524 202 122 21443 559 11722 21834 1776
NM_006407chr331305 1129 465 21314 478 ----
NM_006415chr921115 291 --31296 974 221 21159 181
NM_006416chr6128 ----1709
NM_006420chr2092993 2652 2625 2545 2339 2263 2154 910 410 43489 3100 2226 2172 --23186 583
NM_006424chr411958 ----21775 439
NM_006425chr551330 434 251 100 59 ----11093
NM_006434chr1062875 2833 2535 281 68 30 22782 1253 22977 2271 --
NM_006447chr211194 ------
NM_006449chr2112136 1865 1759 1619 813 669 651 534 525 138 123 ----1634
NM_006451chr53893 762 386 --1327 --
NM_006452chr441544 1101 299 24 191 1180 --
NM_006454chr433105 2725 2267 ----32128 1105 954
NM_006457chr453533 3134 2620 880 72 43127 1417 471 279 12994 21335 508
NM_006460chr175226 214 184 96 41 21248 719 31231 647 287 --
NM_006461chr17136 ------
NM_006464chr242891 1480 1431 1372 13084 1683 24581 805
NM_006466chr203764 401 148 ----2703 364
NM_006469chr14541 531 476 212 1647 21580 396 --
NM_006474chr151978 1691 1642 1279 361 21432 509 ----
NM_006475chr134565 522 460 247 --1582 --
NM_006482chr12173939 3815 3655 3494 3397 3250 3081 3064 2695 2423 1440 812 347 198 165 137 88 33285 2928 2533 13555 13463
NM_006489chr1421802 30 31875 1396 490 31810 732 196 --
NM_006494chr19------1163
NM_006496chr14779 447 165 126 2479 259 41701 514 362 252 2598 341
NM_006502chr6140 11070 2225 113 --
NM_006504chr1062978 2709 2630 1028 312 248 42619 611 533 160 127 42654 2642 1092 173
NM_006516chr151278 1086 263 242 182 ------
NM_006520chrX31672 1632 1408 --3585 503 438 1449
NM_006521chrX21422 1177 ------
NM_006526chr2022101 1497 21765 594 21894 790 31458 540 288
NM_006527chr42731 553 2645 198 1152 --
NM_006529chr481391 1381 1343 1285 1180 1061 426 182 31629 1169 1068 11334 31616 674 544
NM_006532chr1921883 1778 ----12011
NM_006534chr20143284 3084 2571 2546 2515 2470 2435 1266 1218 1045 762 167 136 24 1347 22334 754 41275 1235 887 837
NM_006536chr12759 138 --11026 2991 30
NM_006537chr151237 ------
NM_006538chr253064 2893 1663 482 393 21548 1513 42627 572 358 242 34169 562 502
NM_006539chr161105 ------
NM_006540chr881525 1438 1279 1185 1173 490 392 193 --21546 1519 1467
NM_006544chr14255758 5736 5680 5477 5318 4879 4356 4056 3875 3737 2147 2087 2044 2030 1797 1695 1335 974 815 718 699 352 343 284 227 65765 5265 5103 4228 4076 1150 45978 3805 2272 442 76054 4129 3849 3835 2110 1851 240
NM_006546chr1796235 6057 5773 5578 4309 1845 918 490 366 52537 2213 1788 344 252 42565 1804 1217 395 56417 5736 4843 4460 907
NM_006547chr761709 1589 712 554 482 109 --1320 21889 659
NM_006548chr331608 1388 1321 --31397 1281 516 1545
NM_006549chr1242143 1901 582 290 21059 155 --2575 281
NM_006554chr2128 185 ----
NM_006557chr961662 1170 438 394 150 114 11541 21462 44 11571
NM_006558chr8--2464 331 --191
NM_006559chr13837 401 55 1192 3978 234 157 --
NM_006560chr111186 1488 ----
NM_006561chr10176184 6177 6005 5741 5295 2368 2238 2163 1877 1723 1476 1434 1132 826 523 496 335 24867 1061 54307 2031 1339 1003 43 36088 4389 2121
NM_006565chr1641120 1064 1027 62 1414 1376 --
NM_006572chr17113468 2944 2335 1225 1192 1101 885 540 134 105 24 32351 2226 1184 12797 32602 126 70
NM_006575chr1451202 583 553 333 312 --1382 1273
NM_006577chr251262 981 454 302 193 31142 1092 476 --31231 1019 250
NM_006582chr1163 ------
NM_006587chr441203 1054 496 476 21685 1340 21695 57 --
NM_006595chr1181286 607 500 487 452 445 335 277 1327 --2814 582
NM_006599chr16218182 8002 7931 7853 7397 7136 6654 5883 5493 5042 3135 3104 3047 2492 1836 1368 1107 999 848 830 581 --87996 6910 6551 5795 5454 1541 819 640 24995 1140
NM_006601chr125922 898 885 769 197 11027 --2845 150
NM_006603chrX71985 1866 1756 1471 1395 598 475 41726 1696 527 61 22034 1380 3610 289 222
NM_006609chr2101981 576 514 418 292 234 180 140 134 80 31905 882 750 32932 1067 228 32962 2170 1172
NM_006614chr3102945 2808 2732 2586 2327 1178 1093 707 645 546 21372 1269 11467 --
NM_006618chr111275 11099 1466 11397
NM_006620chr6134289 4117 3761 3664 3658 3555 3268 3036 2953 1092 777 387 107 --21888 818 --
NM_006621chr151634 294 123 98 83 11414 51995 1563 638 385 61 --
NM_006622chr52552 501 2568 236 1178 --
NM_006624chr1051704 1461 293 274 231 51377 720 696 265 221 1434 1569
NM_006625chr111144 ------
NM_006625chr111144 ------
NM_006625chr111144 ------
NM_006626chr992138 1693 863 840 807 572 484 471 107 42635 1052 783 522 52229 1804 663 464 270 12498
NM_006628chr15114396 3118 3071 2997 1318 1090 1035 905 331 303 72 1296 34039 3141 1413 22862 1075
NM_006633chr52510 21 1279 --3766 118 76
NM_006636chr2--1808 31018 955 82 --
NM_006642chr1------1304
NM_006646chr1383077 3014 2779 2309 2042 1972 539 49 42529 2498 1953 1016 21934 952 1456
NM_006648chr91121 ------
NM_006654chr12104427 4368 4019 3170 2960 1774 1160 360 347 282 44044 1898 692 339 34393 4063 3857 34534 3276 45
NM_006660chr151291 --1279 1252
NM_006667chrX11128 1337 1125 2914 165
NM_006675chr1243404 591 511 488 --12196 13417
NM_006680chr11--1113 ----
NM_006682chr762484 1931 1924 1059 263 126 22741 172 --22835 1940
NM_006690chr20--12331 --22361 2036
NM_006691chr1121022 789 11141 ----
NM_006693chr71846 1664 1873 --
NM_006699chr172461 2353 2122 699 636 462 291 ----12436
NM_006700chr122750 565 ------
NM_006703chr62380 190 --1367 --
NM_006706chr54862 808 755 66 2240 232 ----
NM_006713chr54312 249 58 46 --1143 --
NM_006716chr741216 1125 90 57 1357 21320 80 150
NM_006717chr9103357 3266 3048 3034 2728 2149 2064 860 826 295 43216 2621 1080 205 23260 530 12879
NM_006718chr621069 44 31022 995 57 2888 780 11047
NM_006720chr1074809 4362 4059 3971 3825 3180 1134 33244 1633 1069 54277 3380 1221 1020 600 23467 497
NM_006721chr103327 268 126 --1839 --
NM_006722chr371218 1016 890 825 340 311 152 1993 53056 2896 1997 85 46 32763 2236 898
NM_006724chr6136 --2367 97 --
NM_006726chr41230 21243 215 --1120
NM_006727chr51557 1359 1129 1539
NM_006729chrX125159 4832 4609 3842 3690 2095 1422 1407 1358 990 812 467 43445 1924 1310 344 55147 5004 3951 1882 1777 11260
NM_006731chr9114870 4515 4201 3592 3586 2276 2146 2054 926 832 459 25690 801 14231 43804 975 957 333
NM_006732chr1911940 12161 11424 --
NM_006734chr641119 427 283 270 1224 1521 --
NM_006735chr72302 88 --1100 --
NM_006738chr1543954 3145 1440 1166 24528 1767 23285 1647 13017
NM_006743chrX4864 285 271 260 1371 1760 2196 141
NM_006745chr41420 31103 1059 239 2894 717 1980
NM_006746chrX51455 1369 1028 613 604 11563 159 --
NM_006750chr16137826 6890 6465 6316 5448 5402 2930 2727 2123 1906 1506 839 329 87951 5639 5242 2350 2285 2165 803 730 37858 7744 2633 16588
NM_006751chr25947 801 780 411 405 3253 189 55 ----
NM_006754chr751168 1162 999 847 140 --2987 515 1242
NM_006756chr851494 1315 607 535 234 11509 --31358 285 104
NM_006759chr22270 44 2243 220 --1122
NM_006761chr172844 612 ----2181 160
NM_006763chr132092 1892 1859 --2160 126 2595 92
NM_006764chr32459 326 --3410 108 52 --
NM_006765chr8----154 --
NM_006766chr882693 2386 2354 2240 1048 990 901 146 52313 647 611 357 214 11736 51682 1061 743 708 407
NM_006773chr2101562 1532 1370 461 450 334 305 261 244 204 3589 268 25 21554 582 11452
NM_006775chr6113064 3018 2688 2611 2557 2235 2057 1116 577 331 292 --32840 2577 1124 2806 685
NM_006777chrX52936 2443 2402 1078 148 --3826 770 397 22928 979
NM_006783chr132598 254 --1648 --
NM_006788chr1831459 334 283 1815 --31568 1387 306
NM_006790chr51105 ----1313
NM_006791chr152565 431 1133 155 --
NM_006802chr11269 2192 87 11190 --
NM_006803chr8148 1271 1362 1634
NM_006805chr561758 1631 496 309 285 258 --3623 579 510 --
NM_006806chr212128 81 ----1158
NM_006811chr204824 816 299 71 1960 ----
NM_006813chr65856 784 651 297 58 2641 612 ----
NM_006815chr126545 462 282 205 159 87 ------
NM_006818chr12742 83 --1773 --
NM_006819chr111293 ------
NM_006823chr841308 1294 898 449 --11175 --
NM_006826chr241059 474 460 45 11305 1394 11210
NM_006827chr1493312 2912 2901 2876 1323 1198 1022 785 116 42799 981 593 535 1195 --
NM_006831chr112407 330 ----1296
NM_006832chr141851 31082 412 323 --1762
NM_006836chr122581 118 ----1599
NM_006838chr1241599 1279 329 93 31839 1660 201 1391 --
NM_006851chr1262444 2203 1088 912 874 291 22214 93 3928 303 61 22671 1993
NM_006852chr1782908 2493 2014 1067 877 603 429 128 --32418 2407 2399 32212 903 574
NM_006854chr7102060 1914 1487 1344 623 355 328 223 199 55 1335 ----
NM_006861chr122830 683 --21476 348 12113
NM_006868chr1863077 2964 2102 1052 611 468 1826 ----
NM_006873chr293345 3217 3039 2317 1197 1039 882 452 375 33433 1259 1163 23274 1380 1795
NM_006874chr41976 11153 2788 107 --
NM_006877chr61356 ----1317
NM_006884chr321363 1351 31951 1880 506 1450 1602
NM_006885chr16104024 2837 1601 1317 1073 497 443 434 210 191 33775 809 427 23577 676 53753 3398 2777 1265 1156
NM_006887chr22220 214 --1616 1545
NM_006888chr1493425 3165 3088 2893 2337 2289 1400 1171 1143 --23200 683 1730
NM_006892chr2071391 1289 1256 1200 1124 1103 974 --31182 1093 497 11269
NM_006892chr2071391 1289 1256 1200 1124 1103 974 --31182 1093 497 11269
NM_006893chr11121 ------
NM_006894chr1--2341 316 ----
NM_006901chr151511 --1398 --
NM_006908chr751452 968 294 181 22 --11195 41421 1179 1158 260
NM_006910chr161146 --1300 --
NM_006914chr921369 414 --1254 --
NM_006915chrX71886 463 303 266 227 197 95 32302 183 115 2692 128 2783 567
NM_006916chr271236 1153 477 300 250 231 190 ----1486
NM_006918chr11115566 5486 4772 4588 3919 3811 2092 1314 1295 839 436 32219 1333 294 42054 1933 65 22 45137 4960 4815 4675
NM_006920chr2102080 1933 1648 1521 1322 1314 747 388 111 65 ----21611 626
NM_006922chr282005 1894 1800 1700 684 362 213 109 --21748 339 12561
NM_006924chr17124218 4139 3187 3093 2886 1584 1128 976 714 331 188 127 13298 33944 907 78 53999 3972 3264 820 636
NM_006930chr571475 1407 1283 612 525 167 73 21290 109 21746 1274 --
NM_006931chr1221586 786 12160 31648 600 514 1182
NM_006937chr172599 426 --1209 --
NM_006938chr184833 247 214 198 --3934 923 78 --
NM_006939chr1471205 1012 960 456 443 141 95 --31177 363 57 31213 949 417
NM_006940chr1211894 1123 1630 2423 312
NM_006947chr441631 1266 409 125 21793 546 1487 21364 32
NM_006948chr2152466 1904 582 363 157 32268 2124 253 11558 --
NM_006951chr102792 286 ----2525 42
NM_006952chr311127 --1279 --
NM_006959chr193332 127 93 180 1375 1417
NM_006963chr1051166 1083 206 76 37 ------
NM_006965chr1831212 972 223 4440 428 206 166 1320 1306
NM_006981chr9102708 2581 2537 2506 2500 2395 1963 1050 528 506 32202 430 341 1792 21117 619
NM_006982chr12250 29 ------
NM_006990chr12743 111 ------
NM_006993chr101272 --1263 --
NM_006996chr1101897 1864 1741 1320 1300 623 587 561 473 25 41276 1251 598 262 21649 109 174
NM_006999chr522053 520 11885 12083 21403 577
NM_007005chr951573 1420 1227 1192 1082 1559 1141 --
NM_007006chr16143541 3495 3279 3175 2894 2824 2590 2228 2207 1309 398 291 264 258 22582 974 22810 1171 32780 2502 735
NM_007007chr12194271 4197 3866 3775 3758 3674 3659 3359 3200 3110 1802 1320 955 811 700 531 346 189 83 64522 4165 3957 3918 3461 1629 104405 3444 3403 3148 1811 1741 1392 1372 1273 979 11709
NM_007010chr1751920 623 617 453 399 3718 333 238 11463 11567
NM_007011chr15136536 6504 5178 4777 4759 4242 2549 2501 2416 2078 694 282 247 --34737 1341 1201 32764 1229 514
NM_007013chr81915 ----1800
NM_007017chr55848 791 657 610 88 2858 270 --2636 303
NM_007019chr201185 1130 138 --
NM_007023chr24981 870 422 409 ----1697
NM_007026chr172143 118 --1608 1201
NM_007027chr32442 416 --2190 141 142
NM_007033chr121641 627 1464 2682 574 1116
NM_007034chr151039 791 327 237 169 --21030 385 21048 677
NM_007035chr1210849 706 698 687 648 626 611 555 307 202 ------
NM_007038chr21125906 4902 3864 2342 2318 2110 2076 1669 1624 1446 565 379 11790 64853 2209 1775 1686 1236 1098 15707
NM_007039chr1482308 2012 1862 1582 883 849 628 392 32301 2256 367 --21934 522
NM_007040chr1941019 1008 983 704 ------
NM_007043chr1241914 1863 1308 357 1743 1505 11928
NM_007045chr6----1212 1142
NM_007050chr2088036 8007 7383 6823 6002 3180 2057 930 23010 1850 35633 2393 1711 27870 2881
NM_007052chrX1586 ----3429 214 197
NM_007054chr573617 3468 3343 2821 2762 963 529 53727 2435 983 937 708 23595 609 53745 3534 2545 1148 805
NM_007064chr33634 378 293 31473 1097 132 1454 11122
NM_007068chr22--41013 646 154 83 129 1966
NM_007073chr6134258 4036 4021 3717 3701 3299 2827 2640 744 403 298 283 177 84082 3396 3204 2706 2594 1317 193 43 1879 12749
NM_007078chr1053060 2487 2012 586 447 --22926 389 22070 823
NM_007080chr43324 98 46 ------
NM_007084chr1321449 1256 21438 1045 --21430 1342
NM_007099chr23742 222 131 1802 --2791 233
NM_007106chr1362094 1039 693 225 202 195 11738 32058 2025 1729 1941
NM_007107chr332175 2010 99 32404 2087 1940 12169 31575 1561 581
NM_007111chr132919 767 --163 --
NM_007114chr393287 3113 2817 2788 2628 2606 2351 896 452 53343 3214 1115 1053 524 2984 842 52671 2519 1016 230 132
NM_007118chr5------1283
NM_007123chr131081 151 74 ----31281 911 289
NM_007124chr672032 1775 1428 806 770 400 187 --1350 --
NM_007125chrY51223 987 455 329 281 31172 973 423 --31286 1048 525
NM_007129chr1341029 1010 996 115 1390 2950 172 1153
NM_007137chrX155447 5310 4945 4409 4352 4244 4233 3806 3791 3712 3585 2065 1144 571 542 21837 174 24116 1912 --
NM_007145chr1931131 1043 278 --1518 11250
NM_007146chr1772771 1934 1866 1811 1027 468 406 1420 21963 1110 21090 717
NM_007147chr1921173 920 --1896 31234 401 53
NM_007157chrX2261 157 22919 2541 4758 720 482 354 11174
NM_007158chr131001 896 136 1192 --11015
NM_007159chr341430 495 476 292 21670 100 2706 569 21652 242
NM_007166chr1131418 1266 637 31085 102 93 --1498
NM_007172chr2223215 519 --53185 2345 1054 248 194 32640 2531 2145
NM_007173chr1152066 388 323 146 45 --21573 451 11855
NM_007174chr1272337 2127 1744 1728 1565 498 33 --31985 456 439 --
NM_007175chr8143565 3514 3411 3307 3248 2888 2590 2584 2329 1278 981 838 804 516 12616 32829 557 52 22841 1059
NM_007187chr132861 753 1915 11040 1787
NM_007190chr103426 404 29 --11163 1362
NM_007191chr124461 205 162 24 ----2469 449
NM_007195chr18153553 3507 3419 2928 2897 2876 2870 2796 2771 2643 2431 2304 1477 1341 402 33666 2853 496 23099 2340 12391
NM_007198chr831661 1428 372 ----11161
NM_007200chr1543954 3145 1440 1166 24528 1767 23285 1647 13017
NM_007203chr9144011 3754 3609 3128 3050 3042 2955 2902 2806 1429 906 826 620 78 --1576 --
NM_007207chr13691 670 290 --2240 149 --
NM_007212chr1112167 2158 2123 1835 1526 1492 674 371 323 240 36 21446 560 12302 --
NM_007214chr661183 967 521 453 403 118 1126 1853 --
NM_007217chr31321 169 ----
NM_007218chr82642 250 1757 1279 1747
NM_007222chr861621 1351 1340 1191 711 251 21784 299 11359 21538 1466
NM_007231chrX82329 2058 1794 1741 543 203 170 46 11836 2385 290 1326
NM_007235chr121518 ----1335
NM_007236chr1552423 1900 1650 586 412 11692 12359 --
NM_007238chr202836 348 24154 149 21564 1277 21415 400
NM_007245chr161917 1963 ----
NM_007246chr42353 294 --1816 31059 829 743
NM_007249chr13219056 8924 8481 6465 6346 5782 3638 3315 3217 3190 2776 2469 2442 2161 1872 1759 1709 1207 995 422 44 57178 6124 3679 3012 379 29236 3653 58893 3460 1977 1824 899
NM_007250chrX1577 --1452 1405
NM_007275chr31457 --11092 --
NM_007282chr33970 768 106 ------
NM_007286chr51636 ------
NM_007287chr373194 3101 750 687 580 495 444 2591 531 13240 12266
NM_007288chr373194 3101 750 687 580 495 444 2591 531 13240 12266
NM_007289chr373194 3101 750 687 580 495 444 2591 531 13240 12266
NM_007292chr17164914 4813 4481 4268 4222 4018 3818 3812 3378 3368 2029 1151 1030 337 179 118 34524 4275 2055 54850 4610 1202 961 369 11167
NM_007315chr231463 1175 439 11366 11353 --
NM_007331chr4132771 2722 2526 2502 2376 1986 1771 797 790 758 515 245 194 ----22346 266
NM_007345chr1862325 1874 1773 1762 1656 117 42256 1862 1748 82 11607 --
NM_007347chr15113022 2404 2396 2160 2111 2071 2063 1170 781 693 589 42994 2910 2081 667 ----
NM_007349chr72396 389 1439 1169 --
NM_007350chr1284555 4378 4095 3978 3605 1656 570 296 74590 3957 3648 3402 1320 1269 753 44465 4073 3321 163 34239 3308 336
NM_007353chr752770 2546 2516 2263 1092 12849 22692 2510 12369
NM_007358chr171860 1518 1299 1271 578 568 228 21328 194 --32047 222 94
NM_007359chr1751397 457 431 413 29 21705 23 --1400
NM_007361chr144672 495 265 239 1640 --1194
NM_007362chr35402 353 337 178 92 11005 1396 21470 1394
NM_007372chr173334 175 43 1717 1747 --
NM_007373chr1051348 1225 1206 329 57 ----1167
NM_007375chr162388 2378 1795 1013 693 385 --31710 887 480 22758 1032
NM_012069chrX52446 1765 1002 257 22 --12719 2827 184
NM_012074chr1411032 --184 --
NM_012081chr553443 2857 2671 324 242 13396 1442 12944
NM_012082chr83647 396 244 1333 1604 1698
NM_012089chr15431 267 254 188 175 --11388 1206
NM_012090chr141304 1109 1053 525 ------
NM_012092chr271929 1901 1611 1215 601 458 171 1344 11427 21403 623
NM_012093chr1--1863 11241 11260
NM_012096chr393540 3316 3254 3094 1287 868 478 310 304 43274 2622 970 138 53779 3739 3413 1481 698 12455
NM_012097chr271911 1903 1407 846 777 358 307 42255 1743 1518 416 12019 --
NM_012102chr152231 527 474 65 43 22532 1792 21040 660 1453
NM_012104chr1163401 3121 3115 2615 1486 804 2815 535 23342 346 13101
NM_012104chr1163401 3121 3115 2615 1486 804 2815 535 23342 346 13101
NM_012108chr42429 62 170 ----
NM_012115chr63550 382 25 172 --1232
NM_012120chr652477 2392 962 516 298 22694 780 1209 31919 321 238
NM_012124chr112704 337 1786 145 2584 138
NM_012129chr7112540 2048 1869 1860 1580 791 588 447 205 157 35 --32516 1794 654 32216 1754 193
NM_012141chr1373174 2571 1601 1374 1335 697 613 1599 54029 3990 3708 3143 221 21398 307
NM_012155chr19----1219 --
NM_012158chr13--31449 1437 1264 21466 226 11370
NM_012160chr64519 366 88 78 1120 ----
NM_012161chr451108 739 146 128 80 2325 254 ----
NM_012164chr9267431 7394 7107 7008 6816 6575 6553 6208 5772 5746 5506 5223 5201 4723 2941 2689 2517 2510 2382 2374 2194 1796 1443 1222 382 304 37456 6683 2424 57199 6913 6274 4860 286 11465
NM_012175chr11--2946 281 ----
NM_012176chr51246 ----1265
NM_012177chr65570 533 234 174 60 1165 ----
NM_012180chr43631 603 30 1638 --1691
NM_012183chr1--1495 1383 1626
NM_012188chr521084 939 --11096 --
NM_012193chr1195343 5195 4101 2086 1436 1145 984 763 711 64790 4236 1536 1469 691 411 33547 1901 394 21825 1154
NM_012197chr951619 1476 1371 1231 654 1525 1370 --
NM_012199chr1134444 3997 3903 3337 2881 2832 1703 1505 1464 1263 1220 546 457 --21190 582 23961 958
NM_012207chr1071002 374 239 209 85 59 29 1731 1996 --
NM_012210chr951515 1069 155 147 60 1427 11350 --
NM_012214chr2165721 5455 5189 5076 4931 4742 4541 4425 4135 2530 2358 1944 1913 1863 198 74 75300 4484 1959 1240 1154 1029 718 54908 1877 895 638 539 46281 6192 5386 1980
NM_012215chr1071917 1752 1681 1540 1208 408 38 --11228 --
NM_012218chr193547 467 391 1434 ----
NM_012219chr363218 3144 2869 1262 1243 1083 --1555 1440
NM_012223chr231135 168 150 31112 872 335 ----
NM_012224chr431224 844 128 --21185 781 --
NM_012229chr1011453 31398 1318 291 ----
NM_012233chr221082 926 11157 ----
NM_012234chr3113284 2996 2897 2665 1441 997 900 421 269 189 111 23590 3150 23262 3134 1722
NM_012238chr1041739 1634 1606 1182 51757 1597 1578 625 271 1159 4547 507 348 212
NM_012243chr12651 370 1804 --1129
NM_012245chr142420 129 ----1188
NM_012247chr101205 1413 2934 403 4906 815 300 36
NM_012249chr273372 3183 3168 2989 2296 1333 407 23441 3072 53103 3022 2481 2211 855 22835 615
NM_012250chr1151200 991 908 883 280 --41245 408 351 265 --
NM_012252chr7195181 5098 4883 4742 4665 4643 4429 4027 3925 3886 3814 3451 3422 2153 1757 1201 1072 868 377 35010 3494 298 15258 54479 4161 3661 3564 105
NM_012255chr202333 121 1483 189 --
NM_012257chr721054 52 4789 337 207 135 2752 22 --
NM_012259chr651218 975 927 521 346 11360 --11057
NM_012262chr1135280 4506 4110 3929 3554 3289 1927 1850 1504 1066 899 567 196 43307 1595 1294 926 45019 4922 3479 1453 31986 576 29
NM_012266chr921104 933 11165 ----
NM_012272chr12------1454
NM_012281chr761811 1756 1595 961 269 146 11892 32096 876 289 11689
NM_012284chr121319 ------
NM_012286chrX2418 69 2635 144 2473 58 --
NM_012287chr3114403 4345 4133 3943 3582 3281 3050 2749 1410 892 75 84371 3184 2949 1640 1207 1076 915 809 43970 989 707 588 --
NM_012290chr231279 1247 112 --11209 11158
NM_012294chr793699 3593 3231 1256 1220 903 391 335 264 13427 23469 242 24065 3524
NM_012296chr1163725 3718 2475 576 511 222 13643 --13823
NM_012297chr462336 2100 1998 714 419 59 22048 247 ----
NM_012300chr542557 1784 945 610 52272 1798 1621 1008 42 1990 --
NM_012301chr772144 1422 795 666 649 460 74 1731 21381 52 --
NM_012302chr14862 252 163 106 ----21054 981
NM_012304chr51504 12462 12525 2560 61
NM_012307chr18----4857 828 400 257 --
NM_012308chr1152332 2221 2183 2060 432 12429 ----
NM_012309chr1174671 4331 3324 3016 1728 1210 944 13999 31618 1379 929 23236 1859
NM_012310chrX2488 103 ----2528 76
NM_012311chr102657 485 2531 37 ----
NM_012316chr1125264 4400 3723 1941 1621 1199 1169 586 513 342 336 135 25133 2041 ----
NM_012325chr201358 --11621 1132
NM_012327chr1861592 1492 998 986 562 47 --21266 1113 --
NM_012329chr1761391 1357 1270 1188 437 282 --21602 365 3650 506 475
NM_012330chr1061697 1491 1247 1217 1164 349 1572 1529 11765
NM_012331chr81552 ------
NM_012334chr594407 3442 1652 1269 1253 1247 1090 698 575 22975 235 23530 3283 13291
NM_012342chr10--1202 --1508
NM_012343chr531084 1037 304 2334 186 ----
NM_012347chr641204 1033 212 184 1166 22944 2443 22534 566
NM_012382chr5104442 4105 3119 2878 1744 1361 1190 882 585 432 43031 975 280 50 33358 2765 702 64066 3876 1378 761 746 308
NM_012383chr91315 ------
NM_012388chr1543167 406 359 319 32577 242 221 42188 2181 788 328 32223 2051 974
NM_012395chr753416 2477 1066 606 342 31025 882 366 --23185 2594
NM_012397chr1851656 1615 1328 1239 678 189 31775 1723 1198 --
NM_012399chr2291890 1807 1331 1295 755 705 532 506 382 2775 737 11278 --
NM_012405chr1103789 3304 3017 3006 2991 2822 2645 2478 583 411 33165 1073 518 32654 1441 94 13862
NM_012406chr122215 81 ----11336
NM_012414chr12822 330 1149 ----
NM_012417chr171548 --160 --
NM_012419chr63480 405 151 --1448 --
NM_012420chr1092149 1900 1590 797 441 410 288 79 70 1609 2726 200 11560
NM_012425chr1052644 1993 474 463 109 --11846 32547 1781 288
NM_012428chr152758 316 1177 1683 11027
NM_012430chr32549 523 2776 769 1754 1135
NM_012432chr11356 ----3346 300 30
NM_012433chr2--180 1242 --
NM_012434chr62277 41 21580 1408 41334 1310 124 101 11626
NM_012446chr52411 129 --1490 --
NM_012448chr1752350 564 361 304 67 ----22367 1607
NM_012454chr62417 161 147 ----
NM_012463chr1231479 1284 213 --21563 1378 1430
NM_012464chr482775 2734 2347 1898 1866 1092 615 420 --12428 52894 2145 1842 967 65
NM_012465chr1063367 2848 2646 2607 2380 2166 --158 43319 3257 2945 1312
NM_012471chrX3632 607 166 --21499 202 2641 592
NM_012475chr1----196 --
NM_012479chr752509 2052 831 796 374 --22624 2355 32467 2339 2157
NM_012482chr11684 2628 285 1183 --
NM_012484chr53175 142 105 --3611 550 520 1635
NM_013229chr12102726 1961 1049 882 796 747 343 284 96 84 62810 2518 2388 2362 1090 455 11040 22120 35
NM_013230chrY61773 1593 1413 1173 1147 702 11221 --11504
NM_013231chr1483978 3786 3774 3407 2760 1137 865 45 34420 1280 236 --21356 229
NM_013232chr5--1347 --1397
NM_013233chr2--1529 1292 1176
NM_013235chr53906 158 145 1870 ----
NM_013238chr1361647 1295 450 405 218 170 31285 442 182 2247 90 --
NM_013254chr123727 665 198 1573 ----
NM_013255chr7238727 8710 7905 7334 7243 6854 6515 5920 5818 5488 5463 3032 2722 2107 1971 1351 988 846 329 276 263 144 128 58570 8518 5901 5864 3154 88881 8204 3326 2034 1606 792 509 345 47420 7233 7219 3531
NM_013257chr862284 2130 2045 1937 205 107 21873 1665 42354 1961 344 250 2268 226
NM_013261chr493115 3029 3023 2823 2566 2535 2432 1458 1106 12763 43429 2674 1199 643 23743 3217
NM_013262chr641352 494 414 257 1573 1460 21107 1023
NM_013264chr113223 144 77 ------
NM_013269chr12144453 4374 4140 3463 3382 3239 3224 3044 1668 1565 1437 917 393 86 163 34463 4446 3983 33233 3213 1535
NM_013272chr15------2395 57
NM_013281chr2041080 344 240 157 41555 1420 1351 481 --143
NM_013282chr193995 152 146 11174 2941 78 41243 1215 978 283
NM_013283chr53803 203 110 --1649 4876 823 63 33
NM_013286chr343018 2326 493 264 155 --43810 326 190 166
NM_013293chr72492 223 1183 160 1728
NM_013296chr13366 346 110 --1338 --
NM_013302chr16104602 4174 1859 1328 1263 1005 610 465 355 205 24367 151 43843 1780 1247 105 24315 938
NM_013304chr161235 ------
NM_013309chr1582623 2601 2476 1931 1786 563 451 399 4862 749 660 309 1354 --
NM_013316chr7--21065 722 1251 1672
NM_013322chr791734 1655 1508 1476 535 365 157 83 27 31461 627 286 11095 1126
NM_013330chr12221 97 ------
NM_013336chr362014 1654 1222 287 176 97 1548 1562 --
NM_013341chr272933 2851 2098 942 787 510 132 3926 566 143 11001 156
NM_013346chrX155 ------
NM_013352chr63872 312 109 --1883 1296
NM_013354chr861488 912 900 492 171 24 --1486 21453 1410
NM_013355chr9----1275 --
NM_013357chr83736 672 184 --1587 --
NM_013372chr15103087 2899 2526 2503 2365 2152 1219 446 186 77 --1499 12950
NM_013373chr2211005 ------
NM_013374chr353108 3089 2916 2354 837 42763 2279 2010 463 32745 2069 586 33010 2959 2801
NM_013377chr122496 89 1431 ----
NM_013380chr191593 --2860 617 167
NM_013381chr1272348 2035 1593 774 169 142 135 31762 1620 651 --1884
NM_013386chr181572 1470 1314 1196 1176 1156 387 196 --21254 240 21418 1267
NM_013396chr2171466 1030 545 201 114 108 41 --3614 98 49 1627
NM_013411chr162397 1096 1067 1001 933 64 1731 22835 852 41824 328 229 202
NM_013412chr241240 1225 1172 1059 136 --1815
NM_013423chrX31239 1220 838 1408 11279 --
NM_013427chrX31239 1220 838 1408 11279 --
NM_013433chr1922059 1627 11615 11824 11802
NM_013436chr22745 627 3758 699 230 1150 --
NM_013437chr891415 1384 1291 1191 993 369 348 319 117 11316 11155 --
NM_013438chr931421 1253 134 2586 54 --2310 242
NM_013444chrX31088 974 145 2109 56 --1445
NM_013446chr72483 129 1217 ----
NM_013448chr142633 135 1615 1745 --
NM_013449chr1252543 2460 2249 1856 1827 --12562 --
NM_013450chr241228 946 405 386 1506 --1158
NM_013937chr641028 921 778 171 21176 909 1159 1879
NM_013943chr1103142 3017 2807 2727 2477 2392 2150 909 849 614 43089 836 189 159 11296 13215
NM_013975chr171553 1437 ----
NM_013981chr51199 ------
NM_013982chr51199 ------
NM_013983chr51199 ------
NM_013986chr221291 166 --2336 49
NM_013989chr1465136 5128 4661 4429 3886 3665 21521 33 1212 43114 1866 1792 1555
NM_013993chr62815 780 ------
NM_013994chr62815 780 ------
NM_013995chrX51885 1610 892 766 213 32006 718 267 42085 2046 929 567 2692 648
NM_013996chr71177 1531 --1465
NM_013996chr71177 1531 --1465
NM_013997chr71177 1531 --1465
NM_013997chr71177 1531 --1465
NM_013998chr71177 1531 --1465
NM_013998chr71177 1531 --1465
NM_014003chr16----1322 --
NM_014011chr242267 2161 1902 317 42497 2474 2369 1957 42128 1019 758 256 32607 686 623
NM_014016chr311647 21181 334 199 2684 460
NM_014021chr1103245 2744 2533 2392 2345 1103 755 739 585 200 31374 466 159 43209 997 986 401 1787
NM_014023chr1062858 2733 1983 1174 633 186 12079 ----
NM_014028chr692489 2272 1232 1199 734 624 321 227 104 63370 3199 3116 2653 2558 2398 31192 865 196 3847 566 135
NM_014033chr1262265 2121 1956 1892 745 308 42314 1637 1482 350 11766 --
NM_014034chr631185 1145 431 11441 1182 11262
NM_014035chr521413 1281 21301 175 1564 11404
NM_014038chr71299 ----3427 410 170
NM_014039chr1141351 1021 402 380 --11299 2939 225
NM_014043chr341595 1491 1355 207 1515 11132 21557 475
NM_014048chr16145206 4953 4928 4887 4684 4202 4134 4026 3731 1957 1948 1233 764 69 --21275 861 25086 1394
NM_014055chr12--1358 1347 --
NM_014057chr931570 273 130 --11299 --
NM_014071chr201107 ----179
NM_014079chr31953 --162 --
NM_014089chr1362148 2119 1674 884 352 176 11410 1210 12074
NM_014106chr15102974 2892 2648 1898 887 794 745 354 235 76 --12234 2320 49
NM_014110chr151038 860 753 303 219 ------
NM_014112chr8145451 5439 5361 3901 3603 3551 2021 1905 1860 1786 1743 1179 816 630 34594 3786 758 65103 3813 3540 1852 1845 44 45013 2102 1155 233
NM_014117chr1672660 2517 2105 1961 987 731 532 12423 --22451 194
NM_014141chr7115371 3546 3302 2148 1884 1689 1489 1294 1276 980 87 42050 1875 1123 758 64324 558 388 355 184 154 45114 4143 2083 1393
NM_014154chr321075 116 --1548 21353 1258
NM_014155chr11247206 7130 6898 6859 6744 6313 6259 5799 5663 5319 5082 5049 5000 4759 4711 2665 2426 2251 2089 1652 1611 1420 1369 409 22492 1468 76342 5305 4993 2978 2063 1546 619 87415 7393 6505 6023 5730 1260 760 355
NM_014170chr3--2335 94 --1368
NM_014171chr25773 554 544 213 95 ------
NM_014178chr143407 174 62 1559 130 --
NM_014181chr262859 1096 881 716 617 524 22611 976 --1952
NM_014182chr12------1764
NM_014184chr11144 ------
NM_014189chr411399 ------
NM_014190chr411751 ------
NM_014211chr531725 396 234 --21582 1413 21672 545
NM_014212chr12267 60 --2732 629 --
NM_014213chr21138 ------
NM_014216chr1411302 --2127 120 --
NM_014217chr121413 441 11669 1354 21554 85
NM_014223chr1------2699 300
NM_014225chr191384 ------
NM_014233chr1771975 1918 1474 1438 1406 730 591 21902 719 1616 --
NM_014236chr1--1227 ----
NM_014240chr382627 2593 2528 1130 1065 954 895 344 13629 13439 --
NM_014241chr10163 ----2309 115
NM_014243chr462096 1786 1506 1336 796 511 --11325 21610 415
NM_014246chr2232313 2255 1876 21463 436 31921 1805 1688 --
NM_014250chr2272033 2024 1723 1655 420 183 110 1104 12148 22060 1431
NM_014253chrX82506 2476 2454 2250 744 206 199 157 12135 1544 147
NM_014255chr12185 ------
NM_014264chr41120 2635 225 175 2599 571
NM_014267chr112661 608 1116 1728 1102
NM_014268chr1821306 338 --21265 1242 --
NM_014271chrX2680 331 ----3817 350 262
NM_014280chr12684 112 ------
NM_014283chr121271 346 --21122 597 21251 139
NM_014290chr93165 79 41 ------
NM_014294chr861481 1269 1157 349 332 256 1581 1391 2143 86
NM_014296chr32580 515 1539 11623 11276
NM_014305chr133692 650 555 --1534 2680 493
NM_014309chr22114735 4614 3779 3721 3309 1248 1044 1033 952 621 144 23797 3691 32024 1737 1712 35441 4523 243
NM_014313chr131533 425 55 31652 1631 1203 11293 1434
NM_014315chr141117 ------
NM_014319chr1251775 365 347 138 101 21741 1568 --21283 77
NM_014322chr13999 992 187 11116 --1297
NM_014323chr225731 695 669 658 104 1905 2322 115 --
NM_014325chr1282063 1954 1740 1610 1503 394 244 219 1289 32174 412 363 1273
NM_014329chr161283 ------
NM_014331chr4197657 6743 6695 6496 6182 6092 6072 5996 5143 2753 2725 2596 2338 2286 1728 1006 871 126 60 57824 2991 2957 2012 775 57458 5112 4894 2917 234 47338 5417 4824 990
NM_014332chrX--1378 ----
NM_014333chr11102772 2542 2168 1891 1879 1785 477 461 229 98 --32822 2683 2476 12582
NM_014335chr1521056 205 2952 943 ----
NM_014350chr551028 998 814 768 387 1741 1305 1411
NM_014360chr141587 ----2301 265
NM_014363chr1331283 1180 122 133 3924 442 349 --
NM_014372chr162036 1831 1825 1459 481 200 1831 --21929 544
NM_014376chr522281 1013 22344 2334 11840 12480
NM_014381chr1422113 2033 --62902 2402 2278 2046 1214 156 1741
NM_014382chr361650 1211 671 494 392 351 2678 333 31795 644 99 21343 359
NM_014388chr1105920 5280 2140 2091 2083 1655 1566 779 446 427 1769 ----
NM_014391chr102575 192 ------
NM_014393chr8142242 2117 1818 1775 1674 1635 1616 1520 851 402 379 281 115 79 22032 1850 2859 241 21743 1625
NM_014395chr421316 253 31377 731 270 21989 499 31836 695 583
NM_014399chr73734 280 140 1835 1272 1779
NM_014405chr17----12372 12393
NM_014415chr331507 1479 562 1589 1535 41151 1105 675 512
NM_014423chr5125282 4988 4656 3797 3643 2222 1995 1901 1810 547 415 312 64443 3739 3499 2151 1543 214 35572 1875 321 45504 4569 3922 1142
NM_014426chr203725 548 144 ------
NM_014429chr31637 260 25 1649 --
NM_014431chr1051694 1454 1428 166 152 ------
NM_014435chr42606 541 --1646 265 49
NM_014445chr35937 805 411 289 43 22024 556 21742 1527 --
NM_014447chr451669 1256 647 180 115 11547 11483 2608 564
NM_014452chr64940 465 407 312 --2282 58 3486 416 204
NM_014454chr62942 270 ----21081 674
NM_014456chr1031300 762 681 4692 540 474 25 41827 1309 228 92 31414 485 158
NM_014458chr11209 2547 503 21142 915 11418
NM_014461chr3--1174 ----
NM_014469chr114258 147 116 108 --1311 --
NM_014487chr41155 ------
NM_014488chr111595 ----1278
NM_014491chr73312 221 87 ----1251
NM_014494chr1641697 1550 1468 747 --1477 --
NM_014495chr12201 115 2220 122 --2517 441
NM_014497chr21177 ------
NM_014498chr3----1265 1122
NM_014500chrX----1267 --
NM_014503chr12------1474
NM_014504chr762036 1830 1730 1582 1331 506 1317 --21590 117
NM_014505chr121385 ------
NM_014506chr931579 1480 1255 51548 1244 1187 1155 400 ----
NM_014515chr123800 110 39 ----1696
NM_014517chr341343 740 531 319 21705 788 21942 1326 --
NM_014520chr172438 85 ----173
NM_014521chr231832 360 308 --1260 21456 382
NM_014547chr155821 714 214 134 113 ----2632 331
NM_014547chr155821 714 214 134 113 ----2632 331
NM_014548chr154517 304 283 145 11559 21569 323 --
NM_014552chr231476 1385 611 11535 11509 --
NM_014570chr221261 --1141 21013 847
NM_014572chr1341213 727 507 294 1103 21513 1115 21452 1311
NM_014573chr1711153 --1189 --
NM_014574chr1461276 601 589 445 264 153 1489 11444 --
NM_014575chr34496 200 171 164 1357 1154 --
NM_014577chr225924 861 775 637 91 --1868 1277
NM_014583chr3--1468 ----
NM_014584chr1441335 1202 143 90 1233 1512 1160
NM_014585chr271288 946 940 504 422 339 105 21076 1063 --1433
NM_014587chr1631589 619 601 ------
NM_014602chr3126 ------
NM_014606chr471572 1392 1096 1076 436 388 93 41316 1234 246 120 --21433 320
NM_014607chr272090 786 534 450 408 352 272 21903 492 1485 32150 1973 1794
NM_014612chr951316 457 373 178 171 21157 604 11211 2503 313
NM_014613chr552943 2043 1104 759 361 12759 --1140
NM_014614chr211347 189 11509 11093
NM_014615chr1683317 2620 2321 1080 827 649 607 376 22947 1269 2866 282 21017 244
NM_014616chr383331 2753 2256 1392 445 360 344 313 ----43482 3005 2233 2166
NM_014620chr123505 240 221 --1301 1270
NM_014629chr821366 872 21373 508 --1425
NM_014630chr1553608 1329 1322 1301 241 13231 13560 12955
NM_014633chr111434 --2106 46 --
NM_014634chr2232600 1341 1006 1390 23588 3293 22956 839
NM_014635chr261741 1497 1267 1246 1149 22 31420 162 148 --11179
NM_014636chr984187 4092 4049 3755 3238 2981 1313 402 11283 13706 --
NM_014637chr841215 1019 573 528 31485 553 326 1333 21224 1048
NM_014647chr1652011 1915 1424 596 273 21635 1458 12210 21623 649
NM_014649chr191171 ----3187 157 88
NM_014655chr172353 2034 1932 1584 675 450 435 ------
NM_014660chr751006 811 775 730 717 21051 69 ----
NM_014663chr11782 ------
NM_014666chr541281 477 435 38 ------
NM_014667chr321567 823 12484 2627 385 --
NM_014670chr2111391 1274 1219 1189 1163 1080 522 345 192 138 76 --31318 1139 590 11634
NM_014671chr761412 1375 1291 1039 274 162 11265 21331 567 1153
NM_014674chr3134019 4006 3782 3750 3209 3003 1615 1575 1392 785 757 418 386 23725 28 21317 770 43702 2937 2456 1607
NM_014675chr12465 455 ----1515
NM_014676chr11399 --21290 213 --
NM_014677chr821395 333 11044 ----
NM_014678chr22--1107 2775 90 --
NM_014679chr112527 291 1207 --3970 407 313
NM_014682chr8122290 1962 1542 794 522 454 443 373 345 337 304 184 31799 1729 776 22239 1764 --
NM_014683chr17102021 2015 1810 1552 1454 1386 1328 843 778 729 --21912 105 21510 311
NM_014685chr16------2496 104
NM_014686chr1952166 1828 529 489 339 12557 --1972
NM_014689chr22415 392 1563 ----
NM_014697chr11967 ------
NM_014700chr1611346 --11373 --
NM_014701chr15103424 3183 3040 2798 2539 2420 2250 898 726 166 3964 621 268 ----
NM_014702chr6123412 3350 2979 2822 2225 2215 2166 1371 1045 647 472 113 12358 53453 2425 610 194 140 32340 662 180
NM_014705chr792164 2085 1602 1473 1377 1366 357 286 270 22035 303 1772 21998 553
NM_014707chr742266 2022 878 492 52179 2153 1926 584 447 --22313 1632
NM_014709chr24573 406 145 27 ------
NM_014711chr1652071 2028 2001 1474 163 32132 1523 1420 31901 1705 1463 21672 711
NM_014712chr161612 ------
NM_014713chr21201 ------
NM_014720chr1051733 1643 1484 1351 358 31783 533 253 2616 157 --
NM_014721chr6207418 7388 7313 7288 6839 6159 6001 5970 4930 2903 2270 2204 2026 1993 1971 1194 1053 890 731 694 27349 1633 47373 7263 6949 6189 97194 6631 6491 6169 6063 2062 1071 765 669
NM_014727chr191262 ------
NM_014729chr861760 1696 1521 910 624 544 11977 21589 186 2557 379
NM_014730chr12105295 4372 3787 3406 1353 1292 1282 1192 348 247 11437 35023 4755 1684 13917
NM_014730chr12105295 4372 3787 3406 1353 1292 1282 1192 348 247 11437 35023 4755 1684 13917
NM_014733chr561915 1841 918 709 340 252 32296 1643 470 11849 --
NM_014735chrX72128 2042 1943 1468 1360 554 171 1488 --11352
NM_014737chr2064204 3885 3159 1666 1099 674 23513 699 24057 1642 --
NM_014739chr6163865 3752 3424 3227 3183 2988 2963 2836 1372 1146 645 429 248 155 138 54 61395 1218 1020 841 758 240 34039 3576 682 13970
NM_014742chr2051663 1318 1111 660 330 --11750 11728
NM_014743chr4133026 2978 2417 2369 2165 1255 953 651 597 444 300 210 146 23149 275 11274 22794 2206
NM_014746chr2134263 4094 3946 3614 3438 1569 1150 848 571 485 454 378 95 24330 1401 --64384 3419 1482 1042 639 558
NM_014749chr143778 598 346 2128 45 --2218 169
NM_014751chr881732 456 286 237 231 193 185 63 21837 308 --11899
NM_014752chr1191932 1578 1429 774 560 429 379 337 233 21917 351 41870 1690 1653 516 21678 1392
NM_014754chr8--1956 ----
NM_014755chr2133729 3477 3354 3297 3241 2782 1669 1591 1123 1073 1064 477 188 21619 1403 53537 3314 2655 1086 1033 43926 3655 3587 3345
NM_014756chr11----1334 --
NM_014757chr562269 2174 1946 466 47 23 12191 --2481 458
NM_014764chr1211264 ------
NM_014765chr182116 1985 1694 994 936 861 385 54 3625 564 46 1919 12032
NM_014766chr783740 3078 2978 1474 955 390 258 26 ----12583
NM_014772chr1833108 2750 1305 --12332 12506
NM_014774chr183267 2958 2585 2408 2026 2012 781 127 52516 2311 892 313 238 --1165
NM_014775chr22193 ------
NM_014779chr331084 992 966 ------
NM_014781chr82230 94 2912 871 2929 148 11231
NM_014782chrX1272 ------
NM_014783chr1541681 1113 410 165 41815 1661 1287 239 1196 21654 213
NM_014787chr132335 2069 419 12106 2870 488 --
NM_014790chr52366 141 2420 120 ----
NM_014791chr92289 125 183 1217 1258
NM_014795chr221290 402 1368 1428 --
NM_014802chr123286 210 168 ----31156 240 77
NM_014803chr1082967 2710 2608 2392 2378 1976 861 323 32028 1173 120 12807 31829 924 246
NM_014810chr1103414 3364 3028 2840 2563 2448 1449 1173 1139 1014 33035 1095 633 32487 1386 1004 22546 119
NM_014812chr151910 1848 1415 1286 731 21646 1231 4794 445 313 127 22000 1463
NM_014819chr552338 2266 2259 1952 1669 22021 591 32323 2249 186 --
NM_014820chr341853 1636 1570 653 1822 1314 51775 630 402 244 34
NM_014822chr43484 98 54 ----1237
NM_014824chr1151719 1564 1484 289 70 51856 1821 1666 1410 99 31657 1622 1574 11890
NM_014826chr174229 4072 4034 3209 948 655 444 23840 2999 14241 --
NM_014827chr12590 377 21704 1138 11064 41594 656 501 175
NM_014828chr1432058 817 203 1406 32546 1651 1619 1704
NM_014829chr592299 1950 1847 1564 931 826 568 523 22 42319 1503 910 253 12351 51981 1754 877 122 97
NM_014830chr1253917 3295 2888 1300 219 --12762 --
NM_014832chr1341789 751 521 297 ----22024 1636
NM_014835chr2032182 2175 1961 3590 437 405 1558 --
NM_014836chr1072007 1697 1615 1470 1464 351 293 ------
NM_014838chr2282894 2335 2095 1757 962 884 353 257 21091 1047 52646 2306 2121 1800 496 1281
NM_014839chr121591 756 22004 933 52277 2095 1990 794 231 12383
NM_014841chr621077 913 1204 ----
NM_014844chr1411494 14218 ----
NM_014848chr1531826 1782 845 --12614 12417
NM_014850chr323540 500 33501 1845 1164 13262 12998
NM_014862chr1544087 3240 1506 305 24199 877 1402 14131
NM_014864chr1134413 4155 3211 1627 1488 1352 1344 1155 714 586 426 270 33 23050 619 13080 --
NM_014867chr863319 3177 1354 1028 757 596 33790 3470 966 --11494
NM_014868chr122810 244 1164 2620 88 --
NM_014871chr12------1611
NM_014872chr962082 758 658 539 533 319 2444 110 --11453
NM_014873chr1134556 4425 4327 3834 3823 3715 3600 3370 1553 1377 1217 374 205 34411 219 155 34373 4345 3433 24884 1802
NM_014874chr111806 ------
NM_014877chr17187592 7291 6681 6628 6213 6129 6080 5736 5500 5183 5043 2983 2941 1970 1610 793 105 35 41391 1280 1209 832 87805 7269 6763 5087 4933 3042 3008 733 72508 2241 1515 767 480 239 164
NM_014883chr432414 1688 1643 31975 1932 748 12031 21894 991
NM_014888chr73986 86 44 2433 269 21124 595 21573 1332
NM_014890chr3----161 --
NM_014892chr64636 407 252 208 2484 140 1178 --
NM_014893chrY42306 1923 1595 400 11542 4918 776 431 374 --
NM_014897chr172752 691 12182 23036 2197 33005 2405 716
NM_014899chr5133140 3110 2766 2721 2266 2067 2012 1997 1181 1016 993 817 33 32985 2615 172 42649 1047 725 640 23183 2320
NM_014900chr23885 263 140 ------
NM_014902chr2031039 451 321 131 11200 --
NM_014903chr1251748 758 670 635 214 139 --1689
NM_014904chr1074033 3147 2708 1267 1134 685 541 32871 1223 1097 33915 2918 593 32759 2672 784
NM_014905chr221798 757 1520 ----
NM_014906chr17104124 3986 3464 3426 2666 1357 924 776 736 534 11540 1660 43731 3434 1651 126
NM_014909chr1422541 492 --22742 223 12731
NM_014912chr1083326 3169 2702 1385 1325 1311 267 136 --12150 52809 2689 2478 983 117
NM_014913chr1821483 574 11358 1605 --
NM_014918chr1551493 1313 422 190 117 1435 21194 31 1259
NM_014920chr683429 2953 2657 2504 2384 1480 1417 513 23577 673 1550 63761 3063 318 247 171 158
NM_014921chr1923127 1119 13078 ----
NM_014923chr1351998 742 703 485 269 2733 362 31987 255 21 12044
NM_014924chr1463223 2717 2198 909 749 720 22876 2081 42440 709 427 137 12811
NM_014926chr361022 952 457 390 368 274 ------
NM_014932chr351516 1282 742 607 406 11302 1697 --
NM_014934chr13154022 3220 2669 2640 2511 2503 2496 1284 1047 1005 983 892 817 389 320 1445 12575 43939 3706 955 336
NM_014936chr6102727 2701 2674 2094 1978 1114 654 585 510 469 32271 1142 669 12492 12867
NM_014937chr1041315 437 404 72 1127 ----
NM_014943chr831270 494 428 11076 1328 --
NM_014945chr531340 247 161 ----1355
NM_014946chr2103108 2777 2463 2236 1054 875 618 477 445 108 22348 1244 21008 959 1404
NM_014947chr1102987 2784 2439 2279 1958 1137 826 543 475 439 22152 421 11225 --
NM_014949chr12856 662 --3711 241 43 1143
NM_014950chr1451759 1150 1126 634 552 1664 21746 1181 --
NM_014951chr1062619 2515 2477 2139 739 171 1250 --22312 1673
NM_014953chr1394215 3855 3398 2781 2647 624 138 114 103 1754 13314 33741 3645 43
NM_014961chr451564 1558 1405 877 178 51841 1548 1386 484 142 --12128
NM_014962chr2091890 1781 1111 727 235 215 186 150 142 42641 2455 2360 1160 12855 31984 1051 394
NM_014964chr1741949 792 692 678 31795 810 526 11506 --
NM_014970chr13217 125 119 ------
NM_014974chr1031375 443 425 1383 21187 285 --
NM_014977chr143529 520 514 ------
NM_014978chr1061775 1460 1336 560 94 41 --1167 --
NM_014982chr14114970 4756 4391 4079 3880 3727 3687 1488 1344 1127 567 21799 1022 44352 3948 422 215 65049 4292 3372 2101 1355 1261
NM_014988chr432012 1998 1030 --22101 523 --
NM_014989chr642017 1956 1791 1676 22037 1460 2764 468 --
NM_014990chr1421348 1140 1318 1951 --
NM_014991chr473132 2957 2906 2800 1220 325 312 22286 822 22920 864 22132 569
NM_014992chr142718 23 ----1778
NM_014996chr32982 358 --123 21085 108
NM_014999chr1241692 1033 565 410 1125 11597 --
NM_015000chr12112930 2901 2615 2167 2130 1215 1076 898 831 783 540 11103 42281 2087 807 197 42885 2008 1919 916
NM_015001chr1----2742 328 --
NM_015008chr3103580 2685 2548 2505 835 728 718 692 221 174 2972 256 21381 666 1924
NM_015009chr32743 165 ------
NM_015015chr1921779 1381 2536 247 ----
NM_015017chr111030 1199 1134 11108
NM_015020chr1673805 3499 2460 2369 902 332 286 11452 23856 1558 1936
NM_015024chr841406 1325 1149 410 --11084 --
NM_015025chr252315 2279 1658 1059 448 1766 1331 12657
NM_015026chr12194559 4532 4493 4451 4369 4246 4196 4078 3874 3121 3114 1623 1459 1308 1248 894 622 101 85 63881 3509 3308 916 696 553 33082 1903 802 21274 335
NM_015027chr1632020 1550 1316 1710 11759 31867 1405 691
NM_015032chr13112767 2653 2373 2360 2120 1813 815 746 722 653 391 31992 902 753 42790 862 480 277 21790 1050
NM_015035chr2096469 6131 5769 5200 4068 2432 2280 1067 316 11231 35215 1861 857 11470
NM_015037chr101269 ------
NM_015040chr273419 3265 3164 2516 2094 783 329 33225 2304 2205 1238 2697 624
NM_015042chr1573481 3187 2812 1190 1045 933 826 14190 44366 4303 3567 2971 14333
NM_015045chr1072259 2147 1541 657 621 521 299 42055 1681 1627 830 31997 628 132 21893 1407
NM_015046chr962708 2328 2065 1834 648 252 1340 2784 749 12598
NM_015049chr293073 2854 2238 2041 1237 807 763 707 264 22425 271 52880 2342 1190 1159 1019 32033 869 695
NM_015051chr942491 850 777 97 21275 186 42968 1206 546 132 33296 2128 1322
NM_015052chr73557 436 117 --11105 11058
NM_015055chr1152337 1856 1812 478 422 22839 2527 12940 --
NM_015056chr21102555 2467 2366 2129 1911 1843 1785 527 442 84 1461 22167 1805 22207 2086
NM_015057chr134704 617 167 103 ------
NM_015059chr1573990 3515 3045 996 577 522 342 23719 1529 ----
NM_015061chr92665 652 ----2868 725
NM_015068chr753519 3064 1229 966 459 --11013 1483
NM_015069chr162496 207 1609 2504 429 --
NM_015071chr5106478 5724 5457 5383 4828 4552 4279 2101 981 960 56399 6262 5987 2405 2305 11946 32254 2238 1021
NM_015073chr1942076 2034 1573 631 --11917 1613
NM_015074chr1114874 4599 4276 3514 3457 753 691 669 526 485 192 34620 3830 3803 23082 78 23030 248
NM_015076chr6134531 4283 4200 3563 3477 2912 1008 928 765 685 374 363 189 52954 1493 1058 508 459 44178 3050 1504 1363 54481 4116 3970 1555 1116
NM_015082chr562543 1857 1824 1693 500 83 22047 1700 ----
NM_015087chr13122685 2658 2505 2407 2266 2242 2103 859 460 402 322 182 --12287 1103
NM_015091chr142249 124 1635 ----
NM_015092chr16124477 4428 4070 4014 3768 3209 3184 2971 2929 1503 1324 1180 13040 53486 3368 3321 3075 1153 33417 1462 1059
NM_015093chr631805 1768 693 11564 1682 11707
NM_015094chr2253339 1825 1537 908 801 24662 1169 --1638
NM_015097chr321697 423 21853 1733 2738 254 1335
NM_015100chr122038 554 --31929 1912 112 1272
NM_015101chr13746 569 507 --22149 102 32452 2287 554
NM_015107chrX62434 2400 2338 2296 2233 124 --22072 1830 11969
NM_015110chr982537 2380 2068 980 953 836 772 224 41007 744 434 124 12209 2853 729
NM_015115chr472874 2815 2744 2383 1222 656 514 22097 566 11269 42882 2450 2126 725
NM_015120chr21274 ------
NM_015122chr191204 ------
NM_015124chr2242504 2331 2256 65 --12454 --
NM_015129chrX71752 1688 506 396 219 62 43 11486 11797 --
NM_015130chr471318 1295 1170 1146 1135 875 52 21040 91 1510 31343 446 391
NM_015132chr73704 672 666 41355 1306 1262 202 ----
NM_015134chr171649 ------
NM_015135chr7------1188
NM_015137chr851648 1040 965 731 642 51954 1759 928 368 292 31944 1697 239 42063 1726 319 101
NM_015138chr1592868 2652 2567 2547 2283 1856 963 755 626 22156 1885 21058 285 21864 639
NM_015139chr1--1154 142 --
NM_015141chr392699 2411 2398 2368 2184 756 599 404 127 62267 1932 1898 1698 774 469 2547 530 --
NM_015143chr441400 504 425 35 --188 1390
NM_015144chr1673989 3978 3934 3767 3245 2766 1601 34026 2958 1431 63040 2774 2684 693 488 101 33851 2931 1461
NM_015149chr141861 1466 507 389 12097 21538 1438 12030
NM_015151chr211229 21023 900 --1365
NM_015153chr63703 681 107 ----1226
NM_015155chr1042946 2828 2561 299 32084 1132 165 52751 2576 2311 1253 386 --
NM_015156chr1433857 3704 2872 33816 3734 1001 23018 2482 12572
NM_015158chr94774 570 542 342 ------
NM_015163chr1472017 1778 1224 751 493 303 35 --1404 --
NM_015169chr81376 1464 ----
NM_015170chr852023 2017 1663 837 217 22085 1847 42282 1792 1611 829 21918 1888
NM_015172chr141403 1277 537 515 11215 21159 1038 11301
NM_015176chr161557 1361 1350 583 339 194 31777 1404 328 31631 1146 437 1407
NM_015178chr832669 855 138 ------
NM_015180chr141799 --1618 2665 574
NM_015184chr3--1108 ----
NM_015185chrX2358 300 2285 28 22302 469 --
NM_015186chr92483 330 3458 319 113 1356 --
NM_015187chr44983 348 328 224 --1689 1147
NM_015191chr113991 92 58 173 1529 --
NM_015192chr2082849 2665 2305 2246 2067 914 339 294 22890 2679 23046 932 --
NM_015196chr4----1130 --
NM_015199chr362761 2494 2051 1867 701 658 53007 1104 562 195 159 43025 2412 596 464 --
NM_015200chr4122478 2394 2259 1913 1034 935 881 792 646 361 256 205 31665 828 368 --42515 2504 908 478
NM_015203chr1178 ------
NM_015206chr1593802 3158 2838 2819 2579 1206 808 543 219 22897 60 --33698 1524 453
NM_015208chr1873511 2669 2630 1104 1086 999 494 43294 1129 700 180 33549 2799 512 43412 3366 2499 1520
NM_015209chr142085 2055 1626 394 32349 1797 719 --1738
NM_015213chr112644 187 --2730 713 1675
NM_015215chr1112779 2741 2727 2472 1944 870 731 587 221 173 66 12020 32524 2117 634 12259
NM_015216chr54575 373 52 27 21358 432 --21542 98
NM_015225chr962611 1066 769 649 537 160 22920 2441 12276 --
NM_015226chr1623248 3201 --1615 33168 719 482
NM_015227chr2142968 2328 353 135 23313 2429 23493 837 --
NM_015229chr1721147 763 ----11155
NM_015230chr451741 1671 1351 1337 429 21639 276 137 31767 1536 531
NM_015231chr115945 870 388 254 44 --2920 626 1273
NM_015233chr132699 407 --1258 --
NM_015236chr451257 946 321 220 162 --21424 151 21319 368
NM_015239chr9155 ------
NM_015245chr642246 739 310 294 --21108 275 --
NM_015246chr1622031 141 ----11325
NM_015247chr16165421 5349 5239 5232 5084 5068 4883 4849 4674 4518 4166 3632 3454 1859 755 310 34866 3270 1696 35157 746 226 34262 1812 1321
NM_015250chr931695 1667 328 21841 631 2703 168 --
NM_015256chr52577 187 ----162
NM_015264chr2294459 4431 3981 3886 3835 3690 3566 3230 1637 14891 1429 --
NM_015265chr262481 2154 2001 955 150 130 1795 32645 2318 652 21950 506
NM_015267chr1251918 1794 1774 1437 341 12178 ----
NM_015268chr32232 139 1718 ----
NM_015269chr14631 239 197 157 1452 --2502 423
NM_015271chr464016 3921 3419 3103 2628 92 34270 3560 1047 13034 --
NM_015272chr162857 335 1365 32020 342 306 22054 663
NM_015275chr1242013 869 466 307 1205 11943 1132
NM_015277chr1841837 1703 1284 501 --11553 1372
NM_015278chr6123312 3148 2728 2545 2439 2347 2136 1153 1135 905 611 244 23351 2573 1796 13268
NM_015282chr241922 1008 559 427 --11084 1308
NM_015288chr523597 2879 13561 1135 11441
NM_015291chr1113546 3511 3438 3401 3144 3059 2880 2737 2355 1192 283 22543 2385 22215 41 12347
NM_015296chr1351134 1025 958 377 353 --31180 871 269 1315
NM_015299chr1433907 2502 776 ------
NM_015310chr8208338 8277 8119 7697 7679 6898 6564 6537 6346 5867 5445 5077 3227 3151 2867 1832 1183 1023 902 174 25437 3238 46500 6103 5825 349 --
NM_015313chr11144545 4373 3972 3754 3059 1918 1813 1759 1615 894 877 404 384 378 24654 3702 54311 4261 4174 3622 857 12983
NM_015314chr7102367 2252 2192 800 699 688 641 567 490 144 92322 2100 2039 1904 1721 1022 681 518 164 ----
NM_015315chr531388 269 223 1303 13468 1910
NM_015317chr292697 2603 2557 2466 1911 640 366 312 161 1519 1153 32199 342 107
NM_015321chr1953330 1700 1519 998 969 --23532 1029 --
NM_015322chr15155 ------
NM_015323chr651723 1634 1565 1437 485 41164 1150 273 166 --2493 441
NM_015326chr173003 2426 1922 1892 1118 955 117 1828 22121 245 --
NM_015328chr753062 2261 629 603 484 --33142 2618 29 22844 1983
NM_015335chr1272664 2260 2192 980 882 610 403 32609 2110 833 52267 2041 1895 1706 650 32391 1881 458
NM_015336chr12102545 2378 2029 2014 1966 1764 1698 442 356 226 1920 2833 236 11929
NM_015342chr51129 ------
NM_015344chr821657 748 22198 407 1331 --
NM_015347chr1242764 2743 2502 2348 22190 739 1297 --
NM_015349chr642726 2407 1115 474 --22317 749 2431 308
NM_015352chr2063801 3388 3295 1462 1092 338 ------
NM_015355chr1761974 1807 1715 476 410 378 11258 61699 1449 1251 791 755 84 1258
NM_015356chr8176 ------
NM_015358chr2151219 1173 1093 426 275 21300 985 --1453
NM_015359chr832833 2384 1859 22694 1173 --22877 1887
NM_015360chr5--129 1185 --
NM_015365chrX93972 3749 3524 3094 997 939 541 430 69 12970 34043 3700 1009 23643 3102
NM_015367chr2281557 1534 1200 1136 1104 1098 533 230 31620 1566 1524 1526 --
NM_015375chr164904 4857 3786 3045 1432 1397 14734 34571 3675 3340 34173 1442 1315
NM_015378chr172953 2155 1983 701 662 492 272 21899 1167 1983 2469 219
NM_015382chr144616 579 552 154 ------
NM_015385chr1062875 2833 2535 281 68 30 22782 1253 22977 2271 --
NM_015387chr251909 1593 1583 1384 1342 2484 140 21791 158 21676 207
NM_015393chr463668 3185 3156 2582 2435 102 11189 31523 561 489 1380
NM_015394chr1242054 1770 1628 707 2719 255 3584 434 243 --
NM_015397chr961731 1722 1567 1357 668 347 11799 31772 1485 598 21910 1312
NM_015409chr1262783 2658 2255 2151 1839 584 22734 2270 --12520
NM_015412chr372932 876 674 627 493 361 27 ----12349
NM_015419chrX2421 144 2764 87 11104 --
NM_015423chr1151629 1511 1381 1355 361 2330 238 1435 31284 399 110
NM_015429chr33770 260 190 ----1355
NM_015431chr12524 80 1625 42758 2402 654 243 21295 372
NM_015435chr841255 301 212 168 --11008 --
NM_015436chr493043 2723 2683 2650 2229 1276 725 388 168 23215 3026 42946 2928 396 354 --
NM_015439chr6124 1512 1494 --
NM_015446chr151144 1136 645 406 112 21644 372 21557 1341 11513
NM_015455chr573664 3414 3373 1656 1279 747 627 34146 4132 2757 21294 902 61383 1016 865 849 664 549
NM_015457chr1131099 323 219 21119 878 --2304 110
NM_015458chr8135100 5055 4872 4266 3871 3711 1714 1258 899 671 567 248 35 54693 4462 3235 1115 411 35237 4437 947 34294 1417 866
NM_015460chr342019 2001 1662 771 ----1336
NM_015462chr171253 ----1229
NM_015464chr75980 954 924 251 143 1313 1720 2880 269
NM_015472chr31130 1354 ----
NM_015472chr31130 1354 ----
NM_015474chr201146 --2465 215 1257
NM_015475chr241016 761 381 166 ----1236
NM_015477chr1561040 936 865 816 775 670 ------
NM_015483chr72847 125 --1917 --
NM_015485chr12330 282 195 --1350
NM_015497chr1541090 764 408 216 --11156 1318
NM_015503chr16--1696 ----
NM_015508chr31518 1174 11598 2154 130
NM_015520chr372806 2619 2553 2387 2288 1920 779 12422 --21928 912
NM_015523chr11--1244 ----
NM_015530chr22798 394 2701 219 1928 --
NM_015534chr131047 928 437 1257 --11072
NM_015535chr283831 2656 1261 1196 1187 1044 136 127 54199 2883 2836 1392 712 43975 3966 3248 371 --
NM_015548chr65941 818 370 147 82 ------
NM_015550chr7123539 3179 3050 2925 2433 2311 2221 1150 1088 1012 589 226 21192 483 23489 2879 31238 984 617
NM_015553chr6104978 4902 4886 4194 4186 4049 4020 3856 1302 893 21326 1267 24815 3953 --
NM_015554chr1552691 2443 2017 939 519 42303 1097 376 85 21085 1032 42958 2360 592 487
NM_015555chr641671 1201 385 312 11728 41247 1239 634 61 11285
NM_015556chr14--1216 ----
NM_015559chr182934 749 --1876 --
NM_015564chr551119 729 489 177 79 1791 73496 3392 3196 3161 2906 2672 152 1161
NM_015565chr2151793 1731 536 495 437 32026 1966 107 22182 642 22275 1504
NM_015567chr1341057 938 422 225 1974 --11316
NM_015568chr2064353 3729 3711 3110 1692 294 1862 24329 1721 24146 3096
NM_015569chr1134717 4591 4389 4292 3000 1909 1903 1891 1680 1546 1258 1027 497 54759 4432 4397 3652 3191 44737 4383 1203 1017 44804 3330 1814 530
NM_015570chr721832 1299 --11636 1509
NM_015571chr6112680 2605 2522 2259 2230 2196 1853 968 910 870 662 12104 21688 825 11645
NM_015575chr273534 3498 3334 3038 1473 817 786 --1773 13449
NM_015576chr322743 1999 11811 --32609 1052 714
NM_015577chr511787 --21539 667 --
NM_015578chr1971867 1452 1338 1294 596 327 250 31975 699 200 41363 811 775 578 1683
NM_015601chr1051018 861 274 106 60 1979 --1968
NM_015602chr181825 1692 1463 1427 713 678 325 223 11595 1346 21390 108
NM_015609chr132007 1928 1110 22998 2985 1561 22347 2202
NM_015610chr722904 2209 21021 198 1819 12515
NM_015626chr1741057 901 300 124 2374 154 11238 2212 89
NM_015630chr251067 1056 803 442 343 1285 11148 --
NM_015633chr1221173 27 11087 3981 923 790