TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3659
miRNA Sequence: UGAGUGUUGUCUACGAGGGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000037chr852302 1007 607 134 76 21738 634 ----
NM_000038chr561739 1406 826 670 314 192 21784 1608 21990 1352 --
NM_000052chrX73368 3161 3055 2612 894 464 415 ------
NM_000059chr131800 --1287 --
NM_000068chr1911105 21569 1270 147 --
NM_000081chr171824 1796 1180 732 693 564 32 --21323 428 --
NM_000084chrX55029 2426 1756 1374 1364 25262 1083 11829 15890
NM_000089chr71307 --2550 231 --
NM_000090chr21288 --1271 --
NM_000091chr252910 2646 2140 853 637 --11079 --
NM_000092chr273407 2966 1277 1032 693 466 224 34045 1548 1021 ----
NM_000104chr223011 2996 ----1329
NM_000108chr721245 62 11871 1157 --
NM_000109chrX42559 2551 890 705 11059 ----
NM_000110chr11428 ------
NM_000114chr2011169 ----11266
NM_000115chr13112602 2587 942 856 723 614 555 546 251 230 70 22168 757 --2296 146
NM_000125chr664205 4061 3358 3345 384 95 --11157 --
NM_000127chr81258 ------
NM_000134chr451615 1540 1401 461 122 ------
NM_000138chr1562615 2285 2000 628 507 130 ------
NM_000142chr4----11338 --
NM_000151chr1731891 1185 741 --1283 --
NM_000161chr1431733 1562 81 ----11609
NM_000163chr532223 1881 516 ------
NM_000165chr631614 1543 412 --1483 --
NM_000167chrX21501 86 1351 1358 --
NM_000168chr762730 2487 1335 1192 1054 423 2844 233 12929 1791
NM_000176chr543354 3080 1167 651 --12934 --
NM_000177chr91229 ------
NM_000179chr2161 ------
NM_000189chr262402 2172 2093 1532 399 328 ----12314
NM_000208chr1944516 4186 3653 2984 --23435 1208 --
NM_000214chr2041784 1251 1176 72 ------
NM_000216chrX93454 3144 3065 2807 1546 1481 1184 382 75 ----11209
NM_000217chr1285143 4159 3687 2091 1476 999 784 330 23586 1253 --12151
NM_000222chr441408 1337 666 141 --1245 --
NM_000245chr7102062 2051 2039 1896 1575 1561 1486 819 462 34 --3504 436 232 --
NM_000252chrX41453 1379 334 291 ------
NM_000259chr15166119 6091 5986 5423 5271 5198 2226 1897 1838 1511 1310 1284 1076 783 334 152 --14454 1214
NM_000264chr963087 3021 2936 2481 2399 1030 ------
NM_000266chrX1173 1799 ----
NM_000267chr1763373 3341 2184 696 635 325 --22458 642 --
NM_000276chrX91833 1677 884 733 605 455 374 268 179 ------
NM_000277chr124840 601 571 245 1185 1692 --
NM_000286chr172768 85 ----1883
NM_000297chr442051 2044 1291 582 ------
NM_000314chr1093113 2921 2421 1272 1199 859 620 479 175 1989 ----
NM_000318chr862957 2712 2675 2605 1116 900 12930 ----
NM_000325chr42618 274 ------
NM_000330chrX12307 1378 11989 --
NM_000332chr6187188 7018 6900 6481 6313 5550 5442 5034 4724 4482 2784 2635 2263 1588 1251 1140 1130 601 --12743 25109 1477
NM_000333chr361122 1093 1023 428 206 38 11005 171 --
NM_000337chr5106229 6217 6008 5943 5665 5053 2015 1161 366 59 44320 1780 1424 459 35905 1936 329 12515
NM_000345chr43758 737 725 ------
NM_000346chr171648 ----11770
NM_000352chr11131 ------
NM_000353chr1631213 1090 412 1169 ----
NM_000358chr51103 ------
NM_000362chr22123529 3255 3117 2980 2614 2486 2458 1145 856 126 117 59 12742 ----
NM_000380chr92513 131 ------
NM_000393chr262096 2079 1724 1405 1356 807 ------
NM_000397chrX82443 2320 909 589 385 372 211 199 21893 711 --2674 558
NM_000401chr1121140 1040 --169 --
NM_000408chr253052 2522 2117 288 118 13470 1129 --
NM_000411chr2133143 2378 2240 41257 1123 845 480 ----
NM_000414chr51117 --144 --
NM_000428chr1432082 1845 858 --12240 --
NM_000430chr17103551 2939 2744 2489 2357 1451 925 741 732 47 ------
NM_000439chr531701 835 297 --1638 1929
NM_000441chr762117 1888 1667 1583 492 124 ----188
NM_000454chr21287 80 ------
NM_000461chr394397 4194 4058 3346 2816 1362 1028 341 36 33881 1288 1255 2812 511 24154 1784
NM_000462chr1511737 --11856 --
NM_000474chr71471 --1574 --
NM_000478chr13732 617 282 ------
NM_000486chr1223055 1034 11053 12723 13251
NM_000489chrX93424 3334 3131 2967 2146 1341 919 602 441 ----12934
NM_000508chr41225 1617 127 --
NM_000522chr751142 928 502 342 41 11192 ----
NM_000530chr151128 1077 867 828 454 ------
NM_000531chrX1287 ------
NM_000544chr6_cox_hap133103 3017 133 1303 ----
NM_000555chrX146343 6027 5919 5907 2059 1867 1729 1418 1342 1232 884 875 657 372 ----12622
NM_000575chr22162 139 ------
NM_000584chr421226 944 --176 --
NM_000590chr51121 ------
NM_000596chr74573 545 124 60 ------
NM_000609chr1062962 2532 2343 1125 778 132 ------
NM_000610chr11103049 3021 2756 2723 2472 2312 2171 907 868 733 170 --12714
NM_000612chr1183839 3786 3713 3417 3349 2882 496 304 11459 --1859
NM_000615chr1183017 2973 2786 1860 682 418 377 280 1228 --12702
NM_000618chr12106333 5888 4218 4081 2475 2282 1780 831 163 111 16299 21564 156 11729
NM_000618chr12106333 5888 4218 4081 2475 2282 1780 831 163 111 16299 21564 156 11729
NM_000620chr1231478 637 52 11945 --11931
NM_000627chr2133 ------
NM_000633chr1885096 4671 4174 3887 1694 1486 892 839 --34053 3374 3215 --
NM_000693chr1531535 657 103 1286 --11447
NM_000719chr1266641 6206 5264 4900 4787 722 26166 5361 36291 5021 4913 --
NM_000722chr71107 ------
NM_000724chr101728 1709 ----
NM_000726chr22553 221 21153 532 21345 973 --
NM_000761chr1521488 1351 ------
NM_000780chr831249 155 26 ------
NM_000793chr1454267 1787 1564 928 260 ------
NM_000794chr54659 391 205 160 ------
NM_000806chr551841 1708 1542 770 529 11701 --1313
NM_000809chr4159263 9008 8369 7384 7262 6227 6158 3461 3454 3438 3168 2997 2418 514 484 --23407 2620 --
NM_000811chr52797 321 1692 ----
NM_000813chr574769 3867 3749 2125 1304 418 359 14293 24857 4352 --
NM_000814chr1573879 3811 3706 1640 987 453 39 --11152 --
NM_000818chr101407 --1397 --
NM_000824chr43795 299 102 ------
NM_000826chr482485 1754 1666 924 842 791 540 485 --11697 --
NM_000827chr552536 2349 653 311 239 ------
NM_000828chrX1580 --2655 183 1638
NM_000829chr1132000 921 572 1552 12079 --
NM_000831chr166244 6139 5179 4949 3877 1758 13995 ----
NM_000859chr521716 511 --41459 1289 1084 600 11257
NM_000864chr11987 ------
NM_000865chr61233 ------
NM_000868chrX31732 459 452 12333 ----
NM_000870chr521042 552 11176 2419 230 --
NM_000875chr15146951 5731 5547 5436 4989 4287 2787 2615 2216 1808 1184 702 577 279 ----1263
NM_000878chr223724 466 156 197 11374 --
NM_000880chr83848 299 229 ------
NM_000883chr72695 661 ------
NM_000883chr72695 661 ------
NM_000891chr1763283 1378 1270 1081 619 180 2877 757 ----
NM_000898chrX4824 675 565 27 ------
NM_000899chr1284423 4227 3614 3471 3386 1461 1133 753 ----14033
NM_000901chr452478 2115 1948 585 106 12008 11918 --
NM_000908chr52712 600 1536 ----
NM_000910chr431599 1473 175 ----1624
NM_000917chr102833 668 --1100 --
NM_000919chr53600 487 127 ------
NM_000921chr123556 85 72 ------
NM_000922chr112276 130 ------
NM_000935chr321106 137 ------
NM_000944chr442420 2034 452 429 ----1690
NM_000945chr231910 1355 197 --129 --
NM_000950chrX82968 2518 2407 907 695 128 63 41 13151 12871 --
NM_000957chr11534 2562 517 ----
NM_000961chr2053997 1493 1280 992 643 12469 33092 2778 2730 1720
NM_000965chr331152 158 72 1401 2847 27 1268
NM_000989chr8184 ------
NM_000999chr17140 ------
NM_001001323chr1272662 2059 953 932 826 409 118 ------
NM_001001330chr103944 817 494 ------
NM_001001331chr3102753 2604 2531 2464 1667 1092 895 852 343 126 1596 11832 --
NM_001001389chr11103049 3021 2756 2723 2472 2312 2171 907 868 733 170 --12714
NM_001001390chr11103049 3021 2756 2723 2472 2312 2171 907 868 733 170 --12714
NM_001001391chr11103049 3021 2756 2723 2472 2312 2171 907 868 733 170 --12714
NM_001001392chr11103095 3067 2802 2769 2518 2358 2217 953 914 779 1116 --12760
NM_001001395chr1282211 1979 1013 691 536 527 42 36 ------
NM_001001396chr194472 4118 3628 3510 3217 1763 1682 1510 599 --12906 --
NM_001001419chr553361 1541 1330 961 530 21814 898 11292 11599
NM_001001420chr553361 1541 1330 961 530 21814 898 11292 11599
NM_001001436chr162651 148 1665 ----
NM_001001481chr882695 1023 968 931 883 658 481 55 --12398 --
NM_001001483chr11--1435 ----
NM_001001484chr1042186 2082 1795 687 --12261 153
NM_001001556chr1561408 1161 518 492 307 299 ----11212
NM_001001664chr283615 3245 2759 2608 1250 1065 441 247 ----22751 2522
NM_001001665chr2123408 2808 2597 2401 1196 918 608 516 482 462 382 146 --12190 --
NM_001001787chr11529 ------
NM_001001890chr2143623 3233 1664 1037 ------
NM_001001928chr22117942 7636 7228 7152 6499 1973 835 624 420 310 52 25166 2706 25313 1606 12950
NM_001001933chr14615 575 227 165 ------
NM_001001936chr1031152 1043 440 --11099 --
NM_001001971chr1061164 1088 896 499 319 105 ------
NM_001001974chr1062379 2333 2205 1951 1517 411 1888 ----
NM_001001992chr211100 ------
NM_001001995chrX41856 1166 720 327 1309 2230 113 --
NM_001002026chr332497 2373 2083 11537 --21957 481
NM_001002033chr171111 1241 1317 --
NM_001002233chr842041 851 331 193 --11440 --
NM_001002243chr21223 ------
NM_001002255chr63269 97 32 ------
NM_001002258chr251876 1842 1739 1369 451 ----1408
NM_001002295chr102304 276 1861 ----
NM_001002800chr33442 348 91 ------
NM_001002838chrX61766 1260 399 317 265 200 --11747 --
NM_001002843chr1521156 126 --11265 --
NM_001002860chr1484673 4344 3916 1853 1647 1592 1414 750 11751 13646 --
NM_001002909chr1762098 2057 1971 1600 403 365 ------
NM_001002926chr772660 2170 1953 985 959 267 117 ------
NM_001003407chr1065094 5079 3695 3159 1651 1459 25113 4629 1181 15071
NM_001003408chr1065094 5079 3695 3159 1651 1459 25113 4629 1181 15071
NM_001003652chr18178556 8481 8218 8081 7694 6701 6337 5619 5553 3334 2929 2903 2162 1647 1638 1495 117 48193 7809 3321 2432 26887 202 --
NM_001003674chr18106977 6718 6343 5763 5318 5056 1721 1688 1647 739 25715 2019 36854 5305 4470 --
NM_001003675chr18106977 6718 6343 5763 5318 5056 1721 1688 1647 739 25715 2019 36854 5305 4470 --
NM_001003679chr11306 ------
NM_001003688chr42828 106 --1223 --
NM_001003712chr1283829 3717 3038 2928 1006 748 704 357 ----1523
NM_001003760chr673339 1267 1046 665 362 283 97 33458 2562 1187 13590 11160
NM_001003786chr174243 169 115 79 ------
NM_001003787chr174243 169 115 79 ------
NM_001003788chr174243 169 115 79 ------
NM_001003792chr33819 309 279 ------
NM_001003793chr33819 309 279 ------
NM_001003800chr941146 419 265 157 12644 ----
NM_001003810chr41580 ------
NM_001003845chr22549 453 ------
NM_001003940chr1553734 3257 1385 220 76 1160 12537 --
NM_001003942chr1553734 3257 1385 220 76 1160 12537 --
NM_001003943chr1553738 3261 1389 224 80 1164 12541 --
NM_001003945chr931491 590 402 11221 1661 11893
NM_001003954chr82273 56 ------
NM_001004065chr953878 3859 3590 2842 2763 11584 ----
NM_001004106chr5----1793 --
NM_001004313chr1731521 1447 59 1499 1404 --
NM_001004317chr664438 4418 3338 3103 2837 1088 --34330 4057 2790 23624 1329
NM_001004342chr176111 6005 5000 4651 4373 3712 1471 142 1258 15646
NM_001004346chr42407 262 ------
NM_001004354chr921075 1028 ------
NM_001004360chr221378 801 1130 1421 --
NM_001004419chr1284548 4352 3437 3395 2810 1143 927 808 ------
NM_001004441chr541524 1136 569 387 ------
NM_001004720chr241010 749 179 21 1378 1805 --
NM_001004722chr251179 918 348 190 101 --2974 24 --
NM_001005242chr1231526 1325 1183 ------
NM_001005271chr171714 ------
NM_001005273chr171714 ------
NM_001005375chrY41673 1320 400 242 11167 11616 --
NM_001005386chr232476 2282 839 ------
NM_001005404chr1784235 3936 3911 3616 3579 3207 1427 85 --156 --
NM_001005417chr11476 ------
NM_001005463chr1092509 2128 1981 1766 941 778 757 403 380 11040 ----
NM_001005473chr5106287 6228 5994 5967 5531 5032 4245 4214 434 170 --35637 4581 74 11850
NM_001005474chr331330 316 256 --11320 134
NM_001005505chr351136 633 608 585 75 ------
NM_001005739chr24879 732 690 232 ------
NM_001005746chr22553 221 21153 532 21345 973 --
NM_001005747chr22553 221 21153 532 21345 973 --
NM_001005751chr102173 102 ------
NM_001005781chr23465 395 219 ----1531
NM_001005782chr23914 844 668 ----1980
NM_001005845chr871677 1659 1541 1380 1289 600 436 ------
NM_001005849chr17158 ------
NM_001006115chr322046 1039 11964 ----
NM_001006600chr542091 2056 1715 1651 ------
NM_001006610chr162836 171 ------
NM_001006623chr242204 2029 829 715 --21587 854 11636
NM_001006938chrX1639 2737 616 ----
NM_001006945chr13564 544 525 ----1538
NM_001007023chr1454267 1787 1564 928 260 ------
NM_001007075chr421114 236 ------
NM_001007094chr1084122 3016 2747 1560 1178 373 238 158 --23479 3117 --
NM_001007097chr983856 3390 3175 1887 1568 1464 505 494 ------
NM_001007098chr1--149 ----
NM_001007102chr651191 511 386 345 117 11637 ----
NM_001007156chr15----11966 --
NM_001007214chr151545 1378 1181 293 45 --1188 --
NM_001007245chr72606 147 ------
NM_001007246chr2121818 139 --11629 --
NM_001007255chr1138 ------
NM_001007257chr131355 1295 70 1424 --21486 140
NM_001007267chr22952 145 ------
NM_001007271chr102752 301 ------
NM_001007277chr111872 --1416 --
NM_001007471chr92339 226 --1578 --
NM_001007553chr151252 1179 939 373 106 ----1419
NM_001007559chr185741 397 353 228 60 --1194 --
NM_001007563chr9124 ------
NM_001008220chr533673 362 300 12976 1796 --
NM_001008225chr71769 ------
NM_001008239chr1853376 3172 1256 636 423 13695 ----
NM_001008392chr373133 2853 2362 2202 2180 100 34 --1727 --
NM_001008408chr7126077 5546 5187 5028 4801 4450 1570 1147 884 676 352 219 11254 23974 2028 --
NM_001008491chr262073 1905 1397 760 309 217 --3362 62 38 22019 385
NM_001008492chr262073 1905 1397 760 309 217 --3362 62 38 22019 385
NM_001008495chr842027 1920 1599 801 12277 ----
NM_001008539chr8134598 4243 3953 3787 3487 3327 3271 1931 1700 1428 1332 1289 439 --34443 3846 1749 --
NM_001008660chr1151534 1192 1044 575 529 ------
NM_001008707chr1431673 1296 339 11643 ----
NM_001008711chr831157 430 67 ------
NM_001008738chr562909 2759 2138 894 768 709 ------
NM_001008777chr171508 ------
NM_001008895chr1331067 484 34 ------
NM_001008925chr4103327 2890 2827 2250 1317 1226 1060 889 507 139 1462 12642 --
NM_001009552chr81487 --1624 --
NM_001009554chr4114373 4058 3942 3921 3207 3201 1841 1431 1322 748 482 ------
NM_001009554chr4114373 4058 3942 3921 3207 3201 1841 1431 1322 748 482 ------
NM_001009555chr421781 1366 --11242 --
NM_001009567chr101674 ------
NM_001009881chr1--197 --1580
NM_001009882chr1--197 --1580
NM_001009899chr386476 5605 5006 4561 4513 4308 4275 265 ------
NM_001009909chr1143728 1414 738 80 22745 992 --13039
NM_001009923chr202943 574 ------
NM_001009960chr742402 2370 1921 1015 ----1467
NM_001009993chr224557 3484 1117 ----
NM_001010853chr673014 2838 2763 2695 2108 2086 2058 ------
NM_001010861chr15794 616 599 506 213 --11823 1293
NM_001010867chr1106206 6068 5827 4986 4611 4398 2402 1932 995 326 15295 11847 --
NM_001010888chrX104370 4132 4000 3855 3793 3638 3163 1232 1170 46 13922 --13333
NM_001010891chr596703 5997 5831 2307 1962 896 858 656 345 25473 1721 14672 1641
NM_001010895chr931574 1381 560 11927 1373 --
NM_001010908chr102166 40 --1229 --
NM_001010934chr72221 136 ------
NM_001010938chr31202 ------
NM_001010942chr122273 165 ------
NM_001010980chr163117 2526 2251 2242 348 70 21315 934 22217 229 1432
NM_001010984chr162611 1838 1699 901 719 27 11952 ----
NM_001010986chrX5697 567 445 344 209 ----22233 2077
NM_001010989chr161235 ------
NM_001010990chr161235 ------
NM_001011513chr483823 3474 2921 1382 1172 771 558 441 14129 ----
NM_001011537chr332243 1959 1724 --1796 --
NM_001011551chrX2439 196 ------
NM_001011553chr73775 669 277 ------
NM_001011657chrX--1125 ----
NM_001011666chr7136400 6225 5891 5577 4952 4815 4315 2599 2289 932 777 330 219 --55564 5546 4293 4093 1280 26604 2400
NM_001011708chr282395 1923 1005 995 901 647 408 154 1398 12164 --
NM_001011713chr1421619 388 ------
NM_001011885chr1521647 1261 --11622 142
NM_001012338chr152143 29 ------
NM_001012393chr11114668 4459 4261 4220 3442 1665 1649 1296 1177 675 543 --21254 942 --
NM_001012398chr1641049 860 420 331 1797 ----
NM_001012420chr1562877 2738 2722 2395 609 501 ------
NM_001012421chr91290 1626 ----
NM_001012423chr1562877 2738 2722 2395 609 501 ------
NM_001012478chr191630 ------
NM_001012614chr41278 ------
NM_001012751chr1031787 442 354 ----11346
NM_001012755chrX135112 5037 4719 4500 4192 3992 1507 1020 995 959 748 689 340 14472 35064 4884 4408 --
NM_001012759chr161117 ------
NM_001012762chr161148 ------
NM_001012968chrX72815 2684 2597 2311 743 689 557 --1823 --
NM_001012969chr151306 ------
NM_001012977chrX51344 1299 1289 1129 945 ------
NM_001012989chrX4573 541 498 94 ------
NM_001013031chr1043242 984 914 542 --42970 2201 225 169 190
NM_001013399chr611084 ------
NM_001013415chr441400 1059 632 45 ------
NM_001013437chr181185 ------
NM_001013438chr33818 716 389 ----1123
NM_001013439chr33664 562 235 ------
NM_001013642chr1--1921 ----
NM_001013691chr191720 ------
NM_001013699chr123547 175 47 1571 ----
NM_001013717chr541461 1112 481 468 1254 ----
NM_001013843chr153893 644 272 ------
NM_001014380chr1374069 3663 1816 1042 1033 617 146 ----24743 430
NM_001014431chr141773 ----1917
NM_001014432chr141773 ----1917
NM_001014434chr13756 709 698 ------
NM_001014796chr11176 ------
NM_001014796chr11176 ------
NM_001014797chr1087785 7520 6378 5551 5515 2725 2173 2031 26040 1603 13140 25891 30
NM_001014812chr15----1306 1325
NM_001014831chr191814 --1665 --
NM_001014832chr191814 --1665 --
NM_001014834chr191814 --1665 --
NM_001014835chr191814 --1665 --
NM_001014839chr131019 854 817 11092 ----
NM_001014841chr131019 854 817 11092 ----
NM_001015045chr431556 792 295 ----1329
NM_001015508chr82300 98 ------
NM_001015877chrX62395 2374 2004 1907 723 240 2448 359 23000 840 --
NM_001015881chrX----11189 --
NM_001015882chr92900 732 ------
NM_001015887chr321789 1607 31631 1436 1382 193 --
NM_001017369chr43447 124 66 ------
NM_001017395chr373647 3562 3538 3411 3320 683 457 12984 12831 1794
NM_001017405chr42188 79 --1140 --
NM_001017415chr1150 --1276 --
NM_001017416chr1150 --1276 --
NM_001017420chr841411 1349 1139 557 21084 110 1246 --
NM_001017440chr797097 6548 5809 5604 5278 5041 4983 1273 194 1894 ----
NM_001017923chr1471686 1582 1331 1302 1106 1029 321 ------
NM_001017926chr841583 360 288 211 1113 11544 --
NM_001017962chr102833 668 --1100 --
NM_001017977chr13348 140 22 ------
NM_001017979chr41203 --1113 1668
NM_001017999chr132255 2048 455 11467 11885 --
NM_001017999chr132255 2048 455 11467 11885 --
NM_001018000chr132255 2048 455 11467 11885 --
NM_001018000chr132255 2048 455 11467 11885 --
NM_001018001chr132255 2048 455 11467 11885 --
NM_001018004chr153697 224 26 ------
NM_001018006chr153697 224 26 ------
NM_001018007chr153697 224 26 ------
NM_001018009chr331019 60 37 --1245 --
NM_001018020chr153697 224 26 ------
NM_001018054chr151272 1042 931 228 54 --1471 --
NM_001018067chr174206 3704 1812 1505 1141 514 272 --14558 --
NM_001018068chr174206 3704 1812 1505 1141 514 272 --14558 --
NM_001018069chr174206 3704 1812 1505 1141 514 272 --14558 --
NM_001018074chr543354 3080 1167 651 --12934 --
NM_001018075chr543354 3080 1167 651 --12934 --
NM_001018076chr543354 3080 1167 651 --12934 --
NM_001018077chr543354 3080 1167 651 --12934 --
NM_001018111chr763594 2595 886 865 813 174 1618 ----
NM_001020658chr131573 1511 533 ------
NM_001020658chr131573 1511 533 ------
NM_001023560chr661079 889 850 801 274 58 ------
NM_001023567chr1572429 2269 2125 2109 1767 798 717 1536 ----
NM_001023587chr311174 ------
NM_001024024chr141787 ----1663
NM_001024094chr543354 3080 1167 651 --12934 --
NM_001024218chr141808 ------
NM_001024226chr131159 1013 820 --2803 443 --
NM_001024227chr131159 1013 820 --2803 443 --
NM_001024228chr131159 1013 820 --2803 443 --
NM_001024401chr1622379 349 --12832 --
NM_001024463chr1521167 1024 ----1120
NM_001024601chr1133 ------
NM_001024647chr12156913 6367 6279 5380 5168 4705 2971 2527 2385 2121 1361 1199 1190 1044 502 27028 6996 26307 5330 11714
NM_001024649chr572902 2674 1097 874 222 175 139 22124 95 --1450
NM_001024680chr241589 1241 478 296 --21518 668 --
NM_001024688chr822028 1727 22162 355 ----
NM_001024808chr1252581 2297 719 366 170 ----1200
NM_001024847chr382428 2402 2301 2134 1011 607 266 223 --22356 2282 12502
NM_001024855chr331933 347 234 --21351 1210 --
NM_001024934chr6--1439 1626 --
NM_001024935chr6--1439 1626 --
NM_001024936chr6--1439 1626 --
NM_001024947chr52816 427 ----1923
NM_001024948chr132204 1033 170 165 ----
NM_001024956chr11205889 5703 5560 5387 5197 4964 4920 4877 4764 4754 4497 4228 3757 3675 2272 2248 1274 861 723 416 34034 1240 1019 25040 4052 15109
NM_001025068chr341516 718 294 263 --21797 679 --
NM_001025069chr341516 718 294 263 --21797 679 --
NM_001025076chr10116041 5810 5770 5530 4732 4573 4393 4316 4177 3949 254 14664 11906 25425 2500
NM_001025077chr10157399 7168 7128 6888 6090 5931 5751 5674 5535 5307 1612 751 528 420 375 16022 --16783
NM_001025079chr393981 3600 3203 1375 861 849 628 372 59 --12539 11096
NM_001025100chr1862928 2803 1394 1216 376 297 12621 ----
NM_001025105chr531504 1253 1238 11400 1492 --
NM_001025108chr294006 3923 3860 1651 1585 786 353 114 64 2698 330 --23474 1614
NM_001025252chr862984 2726 2284 1203 930 816 1262 1771 1243
NM_001025253chr862984 2726 2284 1203 930 816 1262 1771 1243
NM_001025266chr394520 3664 3126 3088 3052 1510 898 416 179 1779 44900 4683 3156 452 1633
NM_001025356chr1252759 2585 2274 676 24 --32801 697 612 12599
NM_001025366chr621515 181 ----11474
NM_001025366chr621515 181 ----11474
NM_001025367chr621515 181 ----11474
NM_001025367chr621515 181 ----11474
NM_001025368chr621515 181 ----11474
NM_001025368chr621515 181 ----11474
NM_001025369chr621531 197 ----11490
NM_001025369chr621531 197 ----11490
NM_001025370chr621515 181 ----11474
NM_001025370chr621515 181 ----11474
NM_001025579chr1731171 1035 276 ------
NM_001025580chrX54286 2925 2868 822 774 ------
NM_001025616chr421937 503 ------
NM_001029858chr673268 3010 2755 2712 2220 1181 649 12326 ----
NM_001029860chr81278 ------
NM_001029863chr683210 2935 2577 2355 2215 784 741 428 ------
NM_001029875chr562890 2724 2692 1051 912 164 22795 535 11857 12214
NM_001029884chr622705 923 --11722 --
NM_001029998chr431119 909 546 1969 11301 --
NM_001030001chr141186 ------
NM_001030006chr1741806 394 187 145 ------
NM_001030007chr1683956 3063 2962 2520 1145 1125 671 228 12674 43515 3399 2948 291 1361
NM_001030055chr14124195 3478 3173 1599 1260 1232 1055 954 870 540 436 363 1109 ----
NM_001031679chr12113163 3042 2783 2286 2211 1323 1098 944 920 708 619 13231 23496 3281 --
NM_001031684chr211318 1336 31056 954 269 --
NM_001031690chr763132 2924 1106 977 178 105 11021 ----
NM_001031695chr2275442 5410 3866 3622 3521 1342 148 ------
NM_001031700chr482543 2360 1987 490 399 345 305 161 11637 12340 --
NM_001031716chr22741 200 ----2784 56
NM_001031732chr4123711 3681 3629 3206 2474 2368 2256 2250 1306 1015 900 220 --13427 --
NM_001031746chr10--11401 ----
NM_001031804chr1643301 3250 2866 1271 13558 13756 --
NM_001031812chr592286 2271 1848 1729 1492 940 808 294 158 11715 1554 --
NM_001032280chr631698 1223 524 ------
NM_001032282chr831193 412 374 ----11069
NM_001032283chr1261018 865 782 370 72 61 ------
NM_001032284chr1261018 865 782 370 72 61 ------
NM_001032293chr171111 ------
NM_001032296chr1372832 2815 2275 2119 2055 1118 1026 12164 1675 --
NM_001032363chr152249 2099 2038 1403 62 11446 ----
NM_001032363chr152249 2099 2038 1403 62 11446 ----
NM_001032393chrX4657 608 545 286 ----1296
NM_001032394chr642856 2715 2280 854 22052 431 ----
NM_001032395chr642723 2582 2147 721 21919 298 ----
NM_001032410chr211100 ------
NM_001032730chr12702 226 --2239 122 --
NM_001033044chr131822 1624 1489 --11244 --
NM_001033045chr273948 3303 3091 1225 950 697 595 1319 14042 --
NM_001033047chr432671 1645 939 ------
NM_001033049chr2132192 2111 1962 --22019 1527 --
NM_001033056chr131822 1624 1489 --11244 --
NM_001033057chr352066 1993 1930 1818 131 ------
NM_001033059chr631632 703 613 12093 1292 11375
NM_001033085chr23332 306 222 ------
NM_001033112chr51185 1104 ----
NM_001033117chr373817 1954 1796 1676 1353 1284 328 --24328 995 --
NM_001033506chr112430 85 ------
NM_001033518chr752864 2084 1754 161 40 12501 ----
NM_001033519chr752864 2084 1754 161 40 12501 ----
NM_001033520chr752864 2084 1754 161 40 12501 ----
NM_001033551chr1773514 3348 2763 1311 1123 1014 763 2903 480 14099 --
NM_001033557chr231002 388 57 11107 ----
NM_001033561chr174928 292 220 95 ------
NM_001033566chr17251 38 ------
NM_001033568chr17251 38 ------
NM_001033723chr842703 1900 1817 448 1399 1539 --
NM_001033756chr621449 115 ----11408
NM_001033756chr621449 115 ----11408
NM_001033925chr1041871 1672 433 57 ----21967 871
NM_001034837chr52822 122 ------
NM_001034838chr52822 122 ------
NM_001034841chr1694922 4752 3719 3489 2151 1229 930 677 409 12039 --25247 3695
NM_001034845chr42982 88 ----11260
NM_001034850chr52527 171 --11465 --
NM_001034915chr861547 1522 1329 1144 1100 1057 1118 ----
NM_001035chr161267 824 423 415 262 82 2354 220 ----
NM_001035003chr43583 233 101 ------
NM_001035004chr43583 233 101 ------
NM_001035254chr952538 622 423 140 128 ------
NM_001035258chr17140 ------
NM_001035260chr1021128 301 ----1359
NM_001035511chr111906 --11514 1642
NM_001035512chr112013 146 11621 1749
NM_001035513chr112013 146 11621 1749
NM_001037126chr7140 ------
NM_001037131chr2----21270 424 --
NM_001037132chr731877 801 54 11552 ----
NM_001037133chr731877 801 54 11552 ----
NM_001037174chr242159 1979 1703 1653 ----11609
NM_001037281chr161107 ------
NM_001037317chr15794 616 599 506 213 --11823 1293
NM_001037332chr542555 909 839 636 12095 ----
NM_001037333chr542555 909 839 636 12095 ----
NM_001037334chr1872310 1769 1687 1613 858 828 445 12385 ----
NM_001037339chr141761 1436 608 418 --21634 29 --
NM_001037340chr141761 1436 608 418 --21634 29 --
NM_001037341chr141761 1436 608 418 --21634 29 --
NM_001037341chr141761 1436 608 418 --21634 29 --
NM_001037872chr21605 ------
NM_001037954chr1153266 2911 2694 2219 1126 ------
NM_001038640chr151680 ------
NM_001038702chr562520 2471 2061 784 498 269 1848 --22291 1775
NM_001038707chr132005 1530 795 ------
NM_001038707chr132005 1530 795 ------
NM_001039091chrX21399 1386 11280 ----
NM_001039111chr31162 ------
NM_001039199chr20114875 4782 4465 3991 3955 3711 1705 1503 1292 596 224 --23498 1915 --
NM_001039348chr2164 1116 1881 --
NM_001039349chr2164 1116 1881 --
NM_001039372chr7249 26 ----1601
NM_001039395chr942114 1872 1852 203 12167 2300 84 --
NM_001039459chr731043 760 123 --11153 --
NM_001039465chr14--1402 ----
NM_001039538chr293511 3265 2316 1478 1472 1400 531 327 208 --43144 2328 2289 1427 --
NM_001039547chr3187830 7711 7621 7409 7202 7190 6748 6352 5512 2355 2322 2090 2049 1747 729 666 608 488 --15072 --
NM_001039569chr272923 2822 1301 1165 692 405 29 1502 1850 --
NM_001039570chr2283917 3727 1598 1386 1278 1006 793 345 11122 21728 1648 --
NM_001039571chr2283917 3727 1598 1386 1278 1006 793 345 11122 21728 1648 --
NM_001039574chr12810 245 ------
NM_001039585chr194194 4037 4011 3919 3880 3818 3367 2857 1360 --2684 38 --
NM_001039590chrX73831 3751 1593 1262 650 572 355 --13614 1879
NM_001039591chrX73831 3751 1593 1262 650 572 355 --13614 1879
NM_001039618chr11105972 5445 4962 4431 4150 3608 2238 1973 1965 841 --12206 24100 317
NM_001039693chr294144 4101 3919 3421 3271 3042 2829 2502 377 --21404 33 1193
NM_001039711chr13775 743 357 --1325 --
NM_001039712chr13775 743 357 --1325 --
NM_001039762chr1072277 1755 1694 941 823 765 62 --11674 --
NM_001039802chr12539 137 ----11108
NM_001039840chrX95143 4446 4308 2081 1625 1257 1191 617 201 1336 24074 1662 --
NM_001039937chr13174147 3851 3819 3444 3384 3232 2840 2826 1619 1596 1502 1379 1315 737 493 216 116 11028 ----
NM_001039938chr1351525 1178 1086 492 345 1307 195 --
NM_001040001chr671685 1655 1404 1306 811 479 213 --121 12078
NM_001040020chr731495 1226 1009 11467 11592 --
NM_001040057chr71282 ------
NM_001040092chr81331 1430 ----
NM_001040101chr411159 ------
NM_001040102chr1052608 2285 851 619 501 --21085 132 --
NM_001040103chr1052608 2285 851 619 501 --21085 132 --
NM_001040135chr73779 657 323 ------
NM_001040142chr282482 2063 1861 1679 1663 1551 332 235 ------
NM_001040143chr282482 2063 1861 1679 1663 1551 332 235 ------
NM_001040152chr761523 1344 570 429 214 67 --1402 --
NM_001040153chr132805 272 1230 1198 --
NM_001040157chr492778 2752 2664 2199 2091 662 541 273 94 12384 2950 368 --
NM_001040172chr521042 552 11176 2419 230 --
NM_001040173chr521042 552 11176 2419 230 --
NM_001040179chr62952 876 --1912 1654
NM_001040181chr331047 995 53 2160 142 ----
NM_001040182chr331047 995 53 2160 142 ----
NM_001040183chr331047 995 53 2160 142 ----
NM_001040199chr331047 995 53 2160 142 ----
NM_001040200chr331047 995 53 2160 142 ----
NM_001040214chr662408 1904 946 870 424 149 11975 --11730
NM_001040284chr16175756 5700 5500 5410 5116 4881 4611 3992 3731 3612 1958 1655 1356 1285 832 573 559 22084 1686 13881 --
NM_001040402chr463149 2492 2208 2101 2008 449 13105 22609 755 --
NM_001040409chr21309 1363 132 --
NM_001040429chr1343321 913 549 526 --22618 594 --
NM_001040441chr1135495 5254 5040 4699 4487 3452 3317 1877 1666 1551 1023 812 344 --11959 --
NM_001040446chr582226 2077 2053 1733 951 902 725 109 ------
NM_001040450chr1562505 1066 676 670 245 180 2300 234 ----
NM_001040453chr1562505 1066 676 670 245 180 2300 234 ----
NM_001040619chr11440 ------
NM_001040665chr7124964 4691 4362 3675 3666 3142 1745 1654 1222 974 741 292 24796 3888 ----
NM_001040666chr72666 64 1498 ----
NM_001040708chr82353 111 --1268 --
NM_001040712chr963281 2490 2246 2198 774 453 --11233 --
NM_001040876chr431860 1774 101 ----11942
NM_001042355chr1634347 580 197 23611 3392 25272 4301 15104
NM_001042388chr182897 191 ------
NM_001042404chr171886 1845 1823 1439 1266 718 353 ------
NM_001042406chr63357 336 325 ----155
NM_001042412chr1634347 580 197 23611 3392 25272 4301 15104
NM_001042424chr493275 3103 2329 2273 2231 789 714 567 260 --11106 --
NM_001042425chr631698 1223 524 ------
NM_001042430chr143512 203 111 ------
NM_001042440chr541709 1587 1311 350 --31481 1357 439 --
NM_001042441chr541709 1587 1311 350 --31481 1357 439 --
NM_001042442chr541709 1587 1311 350 --31481 1357 439 --
NM_001042443chr541709 1587 1311 350 --31481 1357 439 --
NM_001042444chr541709 1587 1311 350 --31481 1357 439 --
NM_001042445chr541709 1587 1311 350 --31481 1357 439 --
NM_001042446chr541709 1587 1311 350 --31481 1357 439 --
NM_001042453chrX41739 655 210 116 ------
NM_001042459chr32317 309 ------
NM_001042473chr1032044 1834 179 ------
NM_001042479chrX2674 52 11671 --12168
NM_001042480chrX2674 52 11671 --12168
NM_001042481chr1452092 1865 1800 1771 519 --22306 880 --
NM_001042492chr1763373 3341 2184 696 635 325 --22458 642 --
NM_001042494chr1593191 1391 1071 1013 977 798 626 496 399 --12448 --
NM_001042495chr1593191 1391 1071 1013 977 798 626 496 399 --12448 --
NM_001042496chr1593191 1391 1071 1013 977 798 626 496 399 --12448 --
NM_001042497chr1593191 1391 1071 1013 977 798 626 496 399 --12448 --
NM_001042506chrX41310 1300 1139 945 ------
NM_001042510chr832025 1810 862 ----1128
NM_001042511chr832025 1810 862 ----1128
NM_001042517chr132654 378 --166 --
NM_001042533chr393251 3029 2720 2643 2164 1321 1257 670 493 12458 --1623
NM_001042537chrX21871 202 1326 11566 --
NM_001042555chr1273486 1499 1219 1207 742 183 84 --23960 1087 --
NM_001042599chr2127438 7411 7184 5832 5675 5613 5186 907 884 489 167 109 11069 36528 5377 637 36915 2005 1468
NM_001042601chr362406 2063 844 771 630 326 12503 33210 3112 2467 12648
NM_001042603chr1275280 5230 5060 1998 1988 1004 172 --11363 --
NM_001042604chr334504 1556 298 ------
NM_001042646chr341937 1906 329 87 1706 11376 --
NM_001042669chr421937 503 ------
NM_001042681chr132503 1012 373 --11045 --
NM_001042682chr132503 1012 373 --11045 --
NM_001042682chr132503 1012 373 --11045 --
NM_001042749chrX11821 ------
NM_001042750chrX11821 ------
NM_001042751chrX11821 ------
NM_001043318chr1433912 3024 757 13581 --11180
NM_001044305chr641464 1450 454 43 11039 ----
NM_001044385chr293578 2853 2536 2511 1386 1147 304 180 118 12829 ----
NM_001044722chr592286 2271 1848 1729 1492 940 808 294 158 11715 1554 --
NM_001044723chr592286 2271 1848 1729 1492 940 808 294 158 11715 1554 --
NM_001046chr562937 2817 2498 2436 2337 452 32288 1089 1074 --1798
NM_001048183chr162487 1415 949 759 135 82 1581 21200 197 --
NM_001068chr32308 22 ------
NM_001071775chr1331644 1635 560 --11676 --
NM_001079874chr131985 773 364 --21814 547 --
NM_001083620chr472483 1665 923 841 790 539 484 --11696 --
NM_001092chr1731679 356 278 1694 21753 105 --
NM_001095chr1241680 1382 338 102 --11265 --
NM_001099678chr3146013 5692 5534 4981 4704 4471 3898 1679 843 770 598 407 137 28 2895 865 --25647 2019
NM_001106chr3119546 9532 8172 7159 7068 2628 1296 1003 950 889 695 12838 37712 7120 5896 --
NM_001112808chr12371 90 ------
NM_001113490chrX52677 2520 2362 2336 259 1674 12258 1470
NM_001123chr103735 252 39 1553 ----
NM_001126chr14981 771 414 98 --127 --
NM_001128chr1683956 3063 2962 2520 1145 1125 671 228 12674 43515 3399 2948 291 1361
NM_001143chrY----138 --
NM_001148chr4112197 2141 2081 1880 1849 1673 1409 720 513 394 87 1207 ----
NM_001149chr104876 502 452 385 ------
NM_001153chr21836 --3905 696 39 --
NM_001156chr10----1504 --
NM_001159chr21219 --1751 --
NM_001167chrX126777 6257 5504 5032 4928 4264 2568 2375 2157 1833 671 598 --22644 1586 --
NM_001172chr148736 656 622 165 123 114 97 74 ------
NM_001173chr14124195 3478 3173 1599 1260 1232 1055 954 870 540 436 363 1109 ----
NM_001177chr1242271 1970 357 298 32478 2035 877 ----
NM_001186chr2163086 2662 2418 2144 1259 95 12868 ----
NM_001191chr2021418 177 ------
NM_001197chr221139 1157 ----
NM_001201chr473786 3648 3305 3185 3066 1179 1146 --23166 2712 --
NM_001204chr2137045 6585 6058 5820 5735 5563 5071 4857 2327 1527 1391 1202 711 1982 27373 592 25330 2594
NM_001206chr972994 2725 2561 2294 2123 395 100 --21967 205 11999
NM_001218chr15132677 2606 2551 2306 2151 872 782 638 606 414 207 74 58 22232 1742 1329 --
NM_001219chr772306 1841 1547 508 332 229 209 21687 540 --1481
NM_001233chr772088 2050 1723 1520 412 333 42 ------
NM_001237chr4--1405 ----
NM_001237chr4--1405 ----
NM_001238chr191523 ------
NM_001241chr271851 917 768 431 361 305 55 ----1620
NM_001241chr271851 917 768 431 361 305 55 ----1620
NM_001256chr1742652 2463 1090 867 --22169 1149 1778
NM_001259chr7105963 5649 5504 5147 4914 4297 4222 2097 2028 1994 11826 12512 14987
NM_001261chr941096 1051 490 411 ------
NM_001262chr1----1353 --
NM_001263chr4152 ----1160
NM_001269chr131005 954 106 ------
NM_001270chr521078 279 --3979 935 728 1435
NM_001271chr1572921 2844 2018 797 673 581 141 --22821 1090 --
NM_001280chr192639 233 ------
NM_001282chr1741806 394 187 145 ------
NM_001283chr7----1159 --
NM_001284chr51442 ------
NM_001289chrX2368 95 ----1638
NM_001304chr1773614 2961 1244 980 827 386 68 --12649 --
NM_001310chr1222275 901 --12000 31052 208 189
NM_001315chr622030 1464 ------
NM_001328chr41278 ------
NM_001329chr1021017 36 ------
NM_001331chr1152460 2325 2030 1981 546 --12302 22522 1990
NM_001332chr51980 11224 ----
NM_001346chr362620 370 284 226 176 114 31008 83 60 ----
NM_001349chr2--187 ----
NM_001351chr331536 369 298 1103 11589 --
NM_001356chrX62435 2124 2090 1890 1806 716 32277 1586 709 12115 --
NM_001358chr42350 167 ------
NM_001364chr11104789 4572 4557 3629 3601 3432 2999 953 851 420 24664 4155 34598 4527 373 --
NM_001378chr21410 ------
NM_001380chr1021030 111 --1296 --
NM_001385chr82413 66 ------
NM_001386chr83506 493 56 --11985 1277
NM_001390chr18103667 3495 3452 3153 2838 2580 2330 766 462 24 22228 1241 1912 --
NM_001396chr2132055 1823 504 --12087 --
NM_001400chr111363 ------
NM_001412chrX93192 2867 2330 1486 1314 1280 938 665 23 23461 677 --1886
NM_001416chr171159 ------
NM_001417chr122775 440 --151 --
NM_001418chr111751 ------
NM_001418chr111751 ------
NM_001419chr1954847 4272 904 448 144 14811 --11003
NM_001429chr222969 440 ------
NM_001430chr252009 1962 1871 1504 1481 ------
NM_001431chr621226 1128 --1898 130
NM_001432chr483640 2472 1278 904 828 778 530 109 12879 ----
NM_001438chr163326 3153 2416 1281 944 925 ------
NM_001440chr832265 683 420 1320 ----
NM_001444chr81130 ------
NM_001449chrX11263 --11220 --
NM_001451chr1621324 424 ------
NM_001452chr62498 469 1630 ----
NM_001453chr621774 1436 ----11704
NM_001457chr331478 559 505 --1945 --
NM_001460chr183578 3538 3243 2306 1392 1301 273 71 22209 280 11096 --
NM_001482chr151644 ------
NM_001490chr983637 3481 3397 3266 2552 2312 591 528 22608 1363 --1750
NM_001494chr102259 204 --1135 --
NM_001495chr811128 ------
NM_001497chr922261 306 ------
NM_001498chr631255 423 329 ------
NM_001543chr574369 3652 3255 3244 3194 1622 920 --1120 --
NM_001546chr621334 48 --21232 207 --
NM_001550chr72606 147 ------
NM_001584chr113871 199 73 ------
NM_001587chrX91833 1677 884 733 605 455 374 268 179 ------
NM_001609chr1074279 4216 4125 3372 2969 1497 1102 13044 ----
NM_001615chr2161 ------
NM_001616chr273175 2619 1397 1071 972 631 350 ------
NM_001621chr762901 2412 2217 2008 882 369 --22474 575 --
NM_001621chr762901 2412 2217 2008 882 369 --22474 575 --
NM_001634chr631632 703 613 12093 1292 11375
NM_001642chr1121347 1050 1934 ----
NM_001649chrX31644 938 67 12440 ----
NM_001650chr18104148 4087 4017 3739 3442 3417 3160 2953 2868 960 1452 ----
NM_001655chr1131494 836 183 1786 12159 11828
NM_001658chr131159 1013 820 --2803 443 --
NM_001660chr3------1631
NM_001663chr1462757 2019 1861 1764 1065 824 ------
NM_001668chr142139 893 433 176 21600 829 1922 --
NM_001677chr121167 357 1109 ----
NM_001681chr122484 196 ------
NM_001682chr1262376 1773 667 646 540 123 ------
NM_001683chr3102753 2604 2531 2464 1667 1092 895 852 343 126 1596 11832 --
NM_001684chr194189 3835 3345 3227 2934 1480 1399 1227 316 --12623 --
NM_001689chr251876 1842 1739 1369 451 ----1408
NM_001690chr351967 1026 927 590 248 --1177 --
NM_001693chr84886 811 69 39 ------
NM_001695chr8114215 3652 3364 3357 3213 2729 1519 752 493 364 156 32744 1637 1622 13469 13488
NM_001699chr1921316 47 21378 704 1256 --
NM_001701chr941424 1344 409 361 --11126 --
NM_001704chr62447 385 152 ----
NM_001706chr31207 --169 --
NM_001709chr1151072 977 853 752 225 11770 1395 --
NM_001713chr531103 840 153 ------
NM_001718chr621157 30 ------
NM_001730chr1311109 1649 ----
NM_001730chr1311109 1649 ----
NM_001742chr72644 329 ------
NM_001743chr21484 ------
NM_001746chr572902 2674 1097 874 222 175 139 22124 95 --1450
NM_001748chr16907 364 293 276 107 76 ------
NM_001750chr541709 1587 1311 350 --31481 1357 439 --
NM_001754chr2143623 3233 1664 1037 ------
NM_001759chr1254585 1962 1784 1168 972 --21182 1031 --
NM_001777chr393981 3600 3203 1375 861 849 628 372 59 --12539 11096
NM_001788chr73775 669 277 ------
NM_001791chr12539 137 ----11108
NM_001792chr1841021 228 205 189 ----1881
NM_001795chr1621315 533 ------
NM_001797chr163754 283 171 1739 1244 --
NM_001799chr5174 --1223 --
NM_001800chr19----170 --
NM_001806chr1932680 656 140 12778 ----
NM_001812chr42332 270 ------
NM_001826chr1173 ------
NM_001830chrX53828 1470 1067 867 33 1780 13985 --
NM_001839chr13248 142 97 ------
NM_001845chr1331214 1087 947 ------
NM_001859chr993809 3594 3495 1432 1306 1230 757 543 489 12655 22443 987 --
NM_001873chr44627 601 97 90 ------
NM_001875chr271110 881 751 401 381 366 232 --1420 --
NM_001880chr2--135 ----
NM_001881chr10--1512 ----
NM_001890chr41368 ------
NM_001892chr531504 1253 1238 11400 1492 --
NM_001895chr2031195 921 397 --194 --
NM_001904chr36768 719 290 274 168 49 ----1261
NM_001918chr1178678 8323 8043 7240 6113 3067 2817 2703 2601 2289 2192 1868 1647 1602 1309 541 328 26740 2697 38434 5936 1893 --
NM_001920chr12--1526 ----
NM_001931chr1141273 1191 1142 1002 ------
NM_001938chr111897 1563 ----
NM_001945chr511228 ----1299
NM_001946chr122980 160 ------
NM_001949chr632744 2733 2282 11188 ----
NM_001951chr84547 512 136 48 ----1655
NM_001955chr62271 65 --1148 --
NM_001956chr1122 ------
NM_001957chr431775 663 236 ------
NM_001963chr41603 ------
NM_001968chr43795 641 598 --1849 --
NM_001969chr1463741 3079 2605 1561 681 115 ----13537
NM_001987chr1284043 4019 3328 3166 3075 2844 479 132 --24092 2869 --
NM_001995chr431353 219 169 ------
NM_001999chr521517 1101 --1346 --
NM_002006chr495557 5540 5194 4644 3786 2284 1164 934 872 --11563 1766
NM_002009chr1572212 1816 1098 1079 760 728 173 ------
NM_002013chr142220 197 ------
NM_002015chr13103361 3192 2492 2455 1071 956 778 717 428 415 22918 24 ----
NM_002017chr1131111 483 142 136 ----
NM_002024chrX71623 1521 654 619 337 235 213 ------
NM_002025chrX189179 8365 7760 6574 5990 5760 3387 3134 2012 1879 1702 1503 1491 1348 931 846 330 167 57925 6382 5971 2771 1419 17962 38906 1951 1935
NM_002028chr1421335 932 ------
NM_002035chr18103873 3686 3619 3526 3380 3160 2985 1477 1405 189 189 11375 --
NM_002039chr46936 764 301 260 239 78 ------
NM_002040chr2162381 2056 1228 1210 1041 145 13076 ----
NM_002044chr1561408 1161 518 492 307 299 ----11212
NM_002045chr31164 ------
NM_002051chr102304 276 1861 ----
NM_002052chr811463 --1550 --
NM_002054chr2------1436
NM_002061chr171945 1470 1374 1260 436 248 153 --11735 --
NM_002063chrX11055 ----1285
NM_002065chr131822 1624 1489 --11244 --
NM_002069chr73655 550 488 11269 11425 --
NM_002074chr121490 344 --11538 --
NM_002077chr952133 310 126 59 39 1680 ----
NM_002078chr32596 104 ------
NM_002082chr5----1756 --
NM_002087chr171302 ------
NM_002106chr41312 --142 --
NM_002107chr1124 ------
NM_002114chr61482 ----142
NM_002126chr1773698 3527 2569 1477 1314 512 95 11053 22777 2716 --
NM_002128chr1341918 1696 769 427 ----11644
NM_002129chr42156 91 ------
NM_002130chr561659 1545 1407 682 604 438 --1465 11480
NM_002136chr12------1143
NM_002137chr742239 2222 2060 206 11781 12019 --
NM_002138chr41580 ------
NM_002140chr92366 249 --2904 128 --
NM_002146chr1741051 940 557 268 ------
NM_002157chr2----1168 --
NM_002158chr273738 3149 3115 940 857 758 124 --2654 25 --
NM_002160chr92568 467 ------
NM_002167chr11482 --1510 --
NM_002181chr24508 492 307 101 ------
NM_002192chr71615 1493 ----
NM_002194chr2--1173 ----
NM_002199chr42384 130 --1757 --
NM_002202chr521099 173 ------
NM_002203chr593062 3012 2550 1590 1554 1490 1119 349 279 13618 ----
NM_002210chr272387 2277 2268 933 884 630 475 --13373 23014 2620
NM_002211chr1041169 1085 738 28 ------
NM_002214chr7145614 5353 5005 4923 4831 4807 2214 2068 810 777 304 294 235 126 11918 23948 455 11529
NM_002222chr31446 ----1120
NM_002228chr131055 939 293 --1321 --
NM_002232chr12238 131 ------
NM_002234chr122738 214 ------
NM_002239chr241045 939 797 341 ------
NM_002247chr1042152 1795 684 311 ----11438
NM_002249chr11524 ----189
NM_002252chr2--1130 ----
NM_002254chr241974 1503 438 389 11983 12239 --
NM_002264chr365023 3352 3067 1984 832 111 25014 4929 1676 14317
NM_002266chr17------1235
NM_002267chr1362215 2193 2181 1912 378 344 133 ----
NM_002268chr341916 1739 331 35 ------
NM_002270chr5105293 5186 4372 4265 3849 3621 3611 1951 1718 780 15280 13794 13554
NM_002271chr1382385 1832 1794 1680 1667 652 229 46 ------
NM_002285chr294006 3923 3860 1651 1585 786 353 114 64 2698 330 --23474 1614
NM_002293chr152495 2136 1997 600 244 1758 12734 --
NM_002294chrX----177 --
NM_002296chr151794 1712 714 542 385 --21495 29 --
NM_002310chr5166403 6222 6027 5858 5784 5532 5377 5337 5117 4891 4766 4389 2314 787 660 70 16234 25413 5246 24529 4289
NM_002313chr1065094 5079 3695 3159 1651 1459 25113 4629 1181 15071
NM_002334chr1131931 1787 632 21763 720 ----
NM_002336chr12114930 4196 4106 3903 3400 1686 1631 1169 518 467 144 ------
NM_002345chr121129 ------
NM_002349chr231303 478 109 ------
NM_002350chr82999 941 ------
NM_002354chr21397 ----1272
NM_002355chr1231290 401 363 ------
NM_002356chr662821 2030 1907 1091 559 456 --12575 12258
NM_002373chr153966 897 276 --1932 --
NM_002374chr293511 3265 2316 1478 1472 1400 531 327 208 --43144 2328 2289 1427 --
NM_002376chr144540 408 384 53 ------
NM_002382chr1411215 ------
NM_002387chr5114995 4871 3874 3838 3186 1494 1290 991 973 869 860 14577 25166 3975 1286
NM_002395chr641182 449 339 295 197 ----
NM_002397chr542026 851 355 205 1541 1227 --
NM_002398chr21178 1311 ----
NM_002399chr1531387 1169 115 2406 314 ----
NM_002408chr143624 583 315 ----1698
NM_002430chr2222328 303 --12134 --
NM_002438chr101674 ------
NM_002440chr1182 ------
NM_002442chr1221109 693 11560 ----
NM_002460chr692728 2610 2480 1178 1138 1096 1035 682 550 11232 --12460
NM_002469chr12196 1143 1410 --
NM_002480chr1231389 418 367 --1566 --
NM_002485chr822028 1727 22162 355 ----
NM_002486chr972241 1897 1685 1001 807 310 179 ----12422
NM_002487chr151551 ----1774
NM_002499chr1542493 2401 744 97 11624 11969 --
NM_002500chr2----1111 11292
NM_002505chr661547 1154 1105 537 299 94 ------
NM_002507chr1741979 1628 202 35 ------
NM_002508chr121547 310 11597 147 --
NM_002514chr831090 842 404 1322 ----
NM_002515chr1461959 1814 737 531 419 352 ------
NM_002519chr1141363 613 562 277 ------
NM_002526chr641628 1310 1069 568 ------
NM_002530chr152143 29 ------
NM_002538chr53474 246 220 --1192 --
NM_002542chr31246 ------
NM_002545chr11114668 4459 4261 4220 3442 1665 1649 1296 1177 675 543 --21254 942 --
NM_002547chrX83809 3000 2723 1654 1116 531 491 246 24288 1306 11130 --
NM_002556chr1121759 623 ------
NM_002568chr8192 ------
NM_002572chr111317 1269 ----
NM_002577chr363784 3595 3061 3015 354 24 11161 13628 13449
NM_002581chr995180 4392 4316 3943 3714 1933 1862 522 452 13966 11955 15514
NM_002583chr122597 152 ------
NM_002586chr631446 1396 349 ------
NM_002588chr521743 106 ------
NM_002592chr201236 ------
NM_002594chr2072496 2418 2300 2094 1892 1524 475 11964 ----
NM_002595chr121559 1772 21867 525 11300
NM_002600chr141761 1436 608 418 --21634 29 --
NM_002605chr1531145 450 372 --1919 --
NM_002607chr7177 --2221 158 --
NM_002610chr283143 2913 2674 2627 2256 2245 354 329 1195 ----
NM_002612chr781903 1882 1831 1815 1516 567 131 21 ----22039 723
NM_002613chr1675341 5063 4606 4389 3270 1810 1232 13447 12077 --
NM_002618chr23345 96 34 ------
NM_002627chr102208 77 ----159
NM_002641chrX4480 286 221 32 1373 --11328
NM_002645chr1183038 2535 2267 1978 1095 917 548 89 32963 2569 1104 11235 12899
NM_002646chr111840 ------
NM_002647chr181328 --1267 --
NM_002648chr641263 481 231 129 ------
NM_002655chr823631 1590 14236 24416 4353 25163 1708
NM_002657chr2043746 655 276 142 12736 ----
NM_002662chr361955 1533 1430 1369 640 634 ----1534
NM_002687chr1461166 1136 456 413 281 154 ------
NM_002697chr12228 204 ------
NM_002699chr111211 ------
NM_002703chr421714 180 ------
NM_002707chr22362 303 --1375 --
NM_002709chr271404 1017 723 704 451 428 195 22456 490 22737 2246 --
NM_002710chr124970 927 825 445 ------
NM_002711chr72580 52 ------
NM_002713chr11967 --1196 --
NM_002715chr53833 413 310 21310 519 --1104
NM_002716chr1153318 1329 835 717 241 ------
NM_002718chr362529 2166 2160 1719 479 258 --2692 251 --
NM_002719chr1441678 1486 822 390 196 --12035
NM_002731chr14978 962 155 45 133 12344 12932
NM_002736chr731910 1595 1585 ------
NM_002737chr1786658 5953 5683 4535 1611 896 574 188 15305 15044 --
NM_002740chr362764 2240 1840 903 298 185 ----12576
NM_002742chr143130 67 30 --1678 --
NM_002745chr22113727 3721 3376 3217 2897 2782 1791 1201 1134 1006 589 22940 1667 1761 13550
NM_002747chr1831924 1439 415 --21518 1470 --
NM_002748chr1521202 285 --1271 --
NM_002765chrX21399 1386 11280 ----
NM_002821chr63803 744 615 ------
NM_002822chr1271618 1580 702 266 258 125 27 ----11190
NM_002825chr71645 ------
NM_002828chr181300 1226 1981 --
NM_002829chr911317 ------
NM_002833chr1521394 623 --11387 --
NM_002837chr1284427 3736 3581 3356 1015 797 429 248 14604 14512 --
NM_002839chr963281 2490 2246 2198 774 453 --11233 --
NM_002840chr11510 --11496 11529
NM_002843chr1143432 2354 783 651 --11079 --
NM_002844chr641076 899 213 80 ------
NM_002849chr1231102 1025 370 ------
NM_002851chr72760 495 ------
NM_002852chr31154 146 199 --
NM_002855chr1143400 2425 861 758 12863 11050 --
NM_002858chr11165 ----21315 548
NM_002863chr14150 ----163
NM_002867chr11682 3631 189 115 ----
NM_002868chr123579 532 159 --1351 --
NM_002869chr1141815 1494 575 272 ------
NM_002874chr981999 1602 837 559 420 362 96 26 --11979 --
NM_002886chr3114677 4654 4497 4455 4246 3922 1984 1633 1572 708 204 --24591 3413 --
NM_002890chr53396 110 100 ------
NM_002892chr1421524 482 --1417 184
NM_002893chrX2331 137 --1347 --
NM_002902chr15194 --1250 --
NM_002906chr1181692 1558 579 407 359 286 160 103 ------
NM_002912chr64707 603 320 224 ------
NM_002923chr12646 626 ------
NM_002924chr13501 141 49 ------
NM_002940chr431860 1774 101 ----11942
NM_002941chr31583 ------
NM_002942chr331322 1051 915 ------
NM_002959chr184055 3808 3762 1456 1188 532 187 57 ------
NM_002968chr1691134 1058 1051 750 439 293 258 140 128 ------
NM_002998chr841882 1713 587 148 --21898 1849 --
NM_003001chr112013 146 11621 1749
NM_003010chr1741708 1584 666 147 ------
NM_003012chr863051 3032 2648 2108 1231 174 1508 12677 --
NM_003013chr46822 800 700 587 574 93 ------
NM_003016chr1732021 519 148 ------
NM_003022chrX1170 --1522 1140
NM_003031chr162836 171 ------
NM_003034chr12107684 7551 7439 7366 6658 5297 5023 2347 1657 202 --26308 3123 --
NM_003036chr12287 280 --1273 --
NM_003037chr1158 --1557 --
NM_003043chr364325 4118 3377 2954 2629 50 1343 ----
NM_003046chr8134598 4243 3953 3787 3487 3327 3271 1931 1700 1428 1332 1289 439 --34443 3846 1749 --
NM_003048chr252533 1096 1048 900 113 --12342 --
NM_003051chr121539 1524 11423 ----
NM_003059chr51319 ----1299
NM_003068chr81716 --1678 --
NM_003069chrX156 ------
NM_003070chr91607 ------
NM_003071chr311637 31795 667 378 ----
NM_003074chr342071 1907 1475 168 --11592 1197
NM_003079chr172666 31 ------
NM_003081chr202365 159 1806 ----
NM_003091chr201286 ------
NM_003095chr121373 ------
NM_003100chr52404 165 ------
NM_003101chr121478 1123 21510 189 --1380
NM_003107chr652174 2016 1977 1874 1680 ------
NM_003108chr2147257 6990 6764 6534 5730 5083 5035 4590 4483 2558 2143 915 736 246 15870 1997 --
NM_003112chr753241 2934 2373 988 457 --12406 --
NM_003115chr11417 ------
NM_003128chr222731 2504 --1175 --
NM_003131chr6----12285 --
NM_003133chr11367 ------
NM_003136chr141117 ----1266
NM_003144chr631676 1652 301 12076 ----
NM_003150chr174842 627 551 439 --11934 --
NM_003155chr832091 2024 1917 11985 1173 1312
NM_003157chr31699 ------
NM_003161chr1773367 3269 2989 2297 2223 1313 395 --23005 124 --
NM_003162chr221101 127 ----1720
NM_003178chr331797 1476 529 ------
NM_003182chr71526 ------
NM_003182chr71526 ------
NM_003185chr2021158 195 --11096 --
NM_003189chr153325 3211 2932 2696 2590 11163 12871 --
NM_003194chr61479 ------
NM_003199chr1875321 5081 4871 4597 4336 2145 1796 13762 24990 85 --
NM_003201chr102700 159 --1866 --
NM_003203chr222148 1779 146 ----
NM_003206chr6----1138 --
NM_003214chr62457 157 ------
NM_003220chr631698 1223 524 ------
NM_003221chr663897 3836 3192 3092 350 277 --21220 1210 13129
NM_003222chr202908 325 1351 ----
NM_003234chr311582 ------
NM_003242chr382428 2402 2301 2134 1011 607 266 223 --22356 2282 12502
NM_003246chr1552020 1827 1456 1402 460 ------
NM_003250chr17--1349 ----
NM_003253chr2161330 1239 1214 1187 693 301 --11772 --
NM_003257chr1511354 ------
NM_003262chr3114995 4977 4321 3932 3698 3336 3329 2072 1663 753 376 31756 1012 130 2910 560 1797
NM_003269chr641227 1206 1155 1101 ------
NM_003270chrX4986 338 304 98 ------
NM_003275chr921300 374 --1407 --
NM_003281chr1114364 4006 3993 3925 3695 3660 3460 1599 961 719 325 21143 594 11839 --
NM_003292chr172231 2150 1979 819 545 311 79 1103 ----
NM_003298chr386219 5569 5525 1844 1674 722 430 419 --15134 --
NM_003299chr12----1177 --
NM_003300chr141194 ------
NM_003304chr321543 387 ------
NM_003305chr4170 ------
NM_003319chr22335 22 130 1617 --
NM_003326chr141716 1028 968 876 1939 ----
NM_003337chr541581 1365 1308 365 --1526 --
NM_003338chr1041230 342 78 60 --1639 11824
NM_003339chr571587 1348 1280 1195 559 201 182 ------
NM_003340chr411207 ------
NM_003342chr1792638 1236 1170 737 622 614 556 122 77 12629 ----
NM_003344chr71211 ------
NM_003345chr16164 ------
NM_003348chr1251166 571 539 294 94 ------
NM_003352chr23914 844 668 ----1980
NM_003366chr16----1169 --
NM_003368chr1150 --1276 --
NM_003369chr1132519 1764 1041 1874 ----
NM_003373chr1091787 1776 1235 349 319 308 230 180 164 11563 ----
NM_003374chr5------2827 694
NM_003375chr101331 ------
NM_003376chr621515 181 ----11474
NM_003376chr621515 181 ----11474
NM_003379chr62912 710 --1142 --
NM_003380chr101224 ------
NM_003387chr222458 1098 1700 --22503 318
NM_003390chr1141119 1021 966 31 ------
NM_003392chr374078 3867 3657 2774 1132 969 807 --13708 24014 3773
NM_003403chr142722 337 ------
NM_003404chr2061787 1569 778 530 276 234 11507 ----
NM_003406chr841416 595 431 186 1647 --1501
NM_003409chr183485 107 21 1334 ----
NM_003410chrX52916 2637 2601 1073 89 1770 12572 12454
NM_003412chr373160 3090 2391 2108 954 670 66 --12851 --
NM_003413chrX21493 469 --1306 --
NM_003421chr1084122 3016 2747 1560 1178 373 238 158 --23479 3117 --
NM_003423chr1992645 2553 1795 880 797 647 453 355 67 11690 ----
NM_003430chr1931230 665 564 1132 11110 --
NM_003435chr19161 ------
NM_003439chr7123576 3518 3222 2953 2587 2488 2275 1210 783 754 745 310 2940 121 13031 13455
NM_003445chr19199 ------
NM_003453chr13178 1209 ----
NM_003454chr161186 --1288 --
NM_003455chr111677 1509 11648 --
NM_003457chr171111 ------
NM_003458chr363477 3117 916 656 643 532 23271 1469 ----
NM_003463chr663123 2993 724 461 421 370 1521 ----
NM_003466chr282465 2096 1978 1917 1734 763 433 131 ------
NM_003468chr283412 3256 3125 1709 1507 1441 1219 968 ----24087 1052
NM_003469chr2294 58 ------
NM_003470chr1621801 681 ------
NM_003473chr103819 399 221 ------
NM_003474chr1082415 2157 1860 1821 1742 800 770 669 ------
NM_003477chr112629 553 ------
NM_003478chr11113106 2944 2507 2137 2043 1196 1171 1104 561 500 198 32388 2050 868 1456 --
NM_003482chr1222795 2447 12458 ----
NM_003483chr1272485 2304 2037 753 450 406 62 1566 2832 772 --
NM_003487chr171262 ------
NM_003489chr2173252 3221 2361 2096 972 774 176 --31259 743 224 --
NM_003498chr1632612 487 103 22750 2463 ----
NM_003503chr15505 159 137 116 54 ------
NM_003506chr841003 914 483 88 ------
NM_003557chr121557 1020 --1462 --
NM_003558chr92680 191 ------
NM_003559chr1743177 2778 1470 1017 ----13382
NM_003564chr12191 77 ------
NM_003566chr12113489 3335 3235 3174 2600 2212 990 838 108 96 39 --1485 --
NM_003569chr63588 567 181 ------
NM_003574chr1864850 4508 4094 3909 2229 1102 11069 15217 --
NM_003576chr1372832 2815 2275 2119 2055 1118 1026 12164 1675 --
NM_003581chr241010 749 179 21 1378 1805 --
NM_003583chr1293792 3107 2767 2377 1292 1018 612 514 128 23611 336 13343 --
NM_003589chr1331067 484 34 ------
NM_003590chr253176 3110 2737 2503 391 12910 ----
NM_003601chr4----1202 --
NM_003603chr4----11607 --
NM_003607chr174339 3929 3774 2751 2650 852 265 23283 3048 2937 796 --
NM_003615chr373876 3577 3488 3243 1199 1086 463 13404 ----
NM_003618chr261180 903 832 455 58 44 --1935 --
NM_003620chr173845 363 345 ------
NM_003622chr1241758 1663 188 22 ----165
NM_003633chr522236 1751 ------
NM_003637chr131059 574 267 ----11375
NM_003642chr23332 306 222 ------
NM_003645chr152260 27 ------
NM_003648chr242229 1878 1784 759 --1233 --
NM_003651chr121522 ------
NM_003659chr221178 825 21208 223 ----
NM_003663chr353322 3201 2815 1302 719 ------
NM_003670chr311456 ------
NM_003671chr93932 606 511 33331 2964 2213 ----
NM_003672chr131684 1228 133 11448 ----
NM_003679chr183081 3062 3047 2842 2801 2207 1266 1154 1219 12603 --
NM_003701chr1331043 430 48 ------
NM_003713chr151645 1434 1088 389 280 ------
NM_003716chr31239 1371 ----
NM_003732chr5------1308
NM_003735chr521743 106 ------
NM_003736chr521743 106 ------
NM_003743chr221753 1505 11741 ----
NM_003750chr101987 153 ----
NM_003759chr444148 3865 3092 2946 12903 ----
NM_003760chr13828 608 210 --1698 --
NM_003762chr12924 298 --1561 --
NM_003764chr65794 745 668 658 259 ----2688 585
NM_003766chr17----1494 --
NM_003768chr131297 297 157 ------
NM_003769chr12170 ------
NM_003774chr1263203 1300 825 653 290 124 --12770 --
NM_003780chr11476 ------
NM_003783chr12804 169 ----11031
NM_003787chr181115 --1652 --
NM_003795chr62445 424 ----1122
NM_003796chr192215 179 --1225 --
NM_003797chr111156 ------
NM_003800chr632394 164 53 --1454 --
NM_003816chr871291 1273 1155 994 498 214 50 ------
NM_003822chr142420 955 166 110 ----12121
NM_003825chr1521387 95 --21508 1005 --
NM_003829chr91858 ----1130
NM_003831chr1821523 1199 --1323 --
NM_003850chr134578 556 130 58 --1500 --
NM_003866chr42733 523 ------
NM_003872chr233063 2747 2096 12104 1449 --
NM_003873chr1062567 2542 2477 2409 2039 580 12004 12050 --
NM_003877chr122911 374 ------
NM_003884chr341651 1240 352 124 ----1531
NM_003887chr262341 1979 1772 1576 485 198 ------
NM_003895chr2142178 2036 1556 859 11400 11348 --
NM_003899chr1332328 2011 575 22383 80 11742 --
NM_003901chr1062350 1982 1820 986 442 305 12516 12436 --
NM_003902chr12744 242 ------
NM_003913chr663410 3116 3034 3018 2891 1715 11183 ----
NM_003916chrX31259 1208 934 ----11193
NM_003921chr141792 1586 1464 636 --1543 --
NM_003922chr151114 ------
NM_003927chr186969 863 442 313 300 133 --11018 --
NM_003930chr742314 951 704 110 ------
NM_003931chr6--1439 1626 --
NM_003932chr2211510 --1237 11744
NM_003934chr941289 1124 842 123 ------
NM_003939chr1083951 3834 3249 3207 3140 2622 1282 866 --1773 --
NM_003941chr7132276 1887 1825 1598 897 678 617 410 404 343 283 50 43 ------
NM_003947chr321137 428 3994 901 398 ----
NM_003948chr442568 2279 1639 380 1567 22673 1752 1991
NM_003956chr10153 ------
NM_003958chr673911 3838 3282 2872 2403 1353 440 --13723 --
NM_003972chr1021344 537 ------
NM_003980chr641353 552 396 222 ------
NM_003983chr1663136 1741 1507 1177 784 746 23332 2741 ----
NM_003994chr1284423 4227 3614 3471 3386 1461 1133 753 ----14033
NM_003998chr43628 530 221 ------
NM_004006chrX42559 2551 890 705 11059 ----
NM_004007chrX42559 2551 890 705 11059 ----
NM_004009chrX42559 2551 890 705 11059 ----
NM_004010chrX42559 2551 890 705 11059 ----
NM_004011chrX42559 2551 890 705 11059 ----
NM_004012chrX42559 2551 890 705 11059 ----
NM_004013chrX42559 2551 890 705 11059 ----
NM_004014chrX42559 2551 890 705 11059 ----
NM_004015chrX42559 2551 890 705 11059 ----
NM_004016chrX42473 2465 804 619 1973 ----
NM_004017chrX42559 2551 890 705 11059 ----
NM_004018chrX42473 2465 804 619 1973 ----
NM_004020chrX42559 2551 890 705 11059 ----
NM_004021chrX42473 2465 804 619 1973 ----
NM_004022chrX42473 2465 804 619 1973 ----
NM_004023chrX42473 2465 804 619 1973 ----
NM_004024chr11349 ------
NM_004028chr18104148 4087 4017 3739 3442 3417 3160 2953 2868 960 1452 ----
NM_004034chr10----1504 --
NM_004035chr17105153 4898 4730 4688 3745 3728 3665 3270 1740 193 24881 4623 1868 --
NM_004036chr21643 196 ----
NM_004040chr231045 932 895 1887 ----
NM_004050chr1432586 2022 653 --1550 --
NM_004061chr53514 432 129 --1556 --
NM_004067chr721528 70 ------
NM_004071chr21101 ------
NM_004073chr1--1252 ----
NM_004075chr123432 54 21 ------
NM_004079chr162703 2414 1090 639 584 43 --1874 12765
NM_004081chrY41673 1320 400 242 11167 11616 --
NM_004087chr352053 1752 1639 674 338 --1581 --
NM_004089chrX----11189 --
NM_004093chr1353233 908 829 201 125 --12068 1578
NM_004094chr1452924 2828 2428 1968 467 --1199 1921
NM_004100chr6--1444 2358 215 11809
NM_004103chr8----1825 --
NM_004105chr2164 1116 1881 --
NM_004112chr1751376 1188 482 473 34 1267 1336 --
NM_004113chr361649 1391 807 732 532 492 3401 234 141 ----
NM_004117chr642048 1618 1502 370 ----11424
NM_004124chr14163597 3422 3125 3070 2788 2718 2643 2227 1250 1075 869 790 766 365 250 68 --21082 732 --
NM_004132chr1021186 389 1400 1454 --
NM_004136chr1532524 2029 804 2858 104 --22119 1097
NM_004156chr81487 --1624 --
NM_004161chr231181 515 150 --11389 --
NM_004162chr32494 231 --1395 --
NM_004171chr11169568 9245 8972 8788 8689 8200 8029 7828 7665 7459 3844 3295 2247 1071 1020 362 29339 2664 16496 18610
NM_004172chr561854 1763 1482 771 753 351 11999 ----
NM_004180chr2267 58 --1572 --
NM_004187chrX1970 ------
NM_004200chr1142612 2567 858 259 ------
NM_004215chr83539 497 62 ------
NM_004225chr81961 21057 87 --1367
NM_004229chrX62074 1898 902 727 703 395 1548 ----
NM_004232chr1873718 3689 3482 2836 1036 989 927 --23519 592 --
NM_004235chr93827 590 104 1854 ----
NM_004236chr15----1421 --
NM_004241chr104724 588 547 217 ------
NM_004267chr31141 ------
NM_004272chr531934 1551 637 1281 ----
NM_004274chr14113171 2827 2682 2095 1237 1123 876 685 661 536 505 ----12581
NM_004277chr62540 139 11402 1688 --
NM_004279chr762154 1660 663 581 328 104 ------
NM_004281chr102369 138 ------
NM_004293chr973786 3418 2777 2493 1360 1229 920 1994 11086 23189 1411
NM_004294chr131582 ------
NM_004301chr3--164 ----
NM_004306chr82273 56 ------
NM_004311chr1062996 2231 2109 1929 1252 59 ------
NM_004327chr2282490 2127 1669 825 771 537 501 419 ------
NM_004330chr1531072 982 260 ------
NM_004331chr862687 2633 2278 1984 1031 981 --11778 --
NM_004337chr872027 1928 1900 884 756 536 212 --31967 1556 255 --
NM_004338chr18106977 6718 6343 5763 5318 5056 1721 1688 1647 739 25715 2019 36854 5305 4470 --
NM_004339chr2161699 1391 1330 285 265 47 --21533 1467 --
NM_004342chr721927 496 --22211 463 --
NM_004349chr8----11094 --
NM_004364chr19----1957 --
NM_004365chr52281 21 ------
NM_004369chr22224 125 --1273 --
NM_004370chr642096 1978 1583 245 ------
NM_004379chr281758 1544 1231 702 603 481 93 77 ------
NM_004380chr1642545 1963 986 385 22302 1936 --1944
NM_004384chr592286 2271 1848 1729 1492 940 808 294 158 11715 1554 --
NM_004385chr51150 ------
NM_004389chr22200 161 --1239 --
NM_004392chr1331653 630 56 22427 525 1445 11927
NM_004393chr32632 383 12301 ----
NM_004397chr1194143 3471 3025 2805 1322 1308 1140 861 225 --13428 --
NM_004404chr262073 1905 1397 760 309 217 --3362 62 38 22019 385
NM_004407chr451006 673 656 187 148 ------
NM_004414chr2141312 1216 1017 974 138 ----
NM_004423chr372517 2502 2004 1943 1734 1691 763 1356 12567 --
NM_004427chr131018 246 68 --1271 --
NM_004430chr842594 2369 2095 1921 ------
NM_004432chr982276 2114 2046 876 829 728 584 569 ------
NM_004434chr1431673 1296 339 11643 ----
NM_004436chr11552 ------
NM_004438chr293111 2386 2062 1303 960 785 445 325 287 12899 12955 11043
NM_004440chr631955 583 504 ------
NM_004441chr341253 1203 458 402 ------
NM_004443chr31292 ------
NM_004449chr2121124 558 ----1990
NM_004450chr141111 ----1307
NM_004454chr332234 917 496 11518 21624 721 --
NM_004457chr22159 57 ------
NM_004458chrX41916 899 839 429 12661 12242 11964
NM_004459chr171777 ------
NM_004463chrX296 38 1586 ----
NM_004464chr473340 3004 1697 1296 991 856 209 11406 11137 11043
NM_004480chr143698 299 124 ------
NM_004482chr27971 834 706 647 634 614 150 3337 329 303 ----
NM_004491chr1942663 1447 1024 685 --2664 425 --
NM_004496chr142529 330 --1455 --
NM_004500chr1441868 1700 812 194 ------
NM_004501chr1123938 3809 3703 3566 3379 2856 1497 1466 1323 1181 858 480 12663 33599 1540 91 --
NM_004502chr174564 223 212 170 ------
NM_004504chr223078 1161 2788 267 13017 --
NM_004505chr1722000 1593 11813 ----
NM_004514chr1732310 170 116 12773 2148 74 --
NM_004516chr19------11138
NM_004520chr51533 --1154 --
NM_004525chr241312 474 238 38 ----183
NM_004535chr2031710 1177 565 --11753 --
NM_004540chr213910 598 30 --2246 146 --
NM_004543chr2121 ------
NM_004566chr1042312 2027 945 336 --1787 --
NM_004571chr2183383 2541 2494 981 880 791 244 49 12335 ----
NM_004575chr421246 398 ------
NM_004576chr5141 --1148 --
NM_004580chr1531823 1418 447 1616 ----
NM_004586chrX105299 4237 1986 1729 1127 1050 648 447 423 393 14137 ----
NM_004593chr33830 763 747 ------
NM_004598chr562893 2645 2496 2440 2380 2350 12261 ----
NM_004600chr121232 262 --1415 --
NM_004602chr2031352 997 54 ------
NM_004612chr974878 4298 1323 975 610 412 208 --23447 1450 23673 501
NM_004615chrX3949 153 108 ------
NM_004621chr1131278 954 833 1907 ----
NM_004622chr262286 2241 2091 1816 1640 103 --1155 --
NM_004631chr151272 1042 931 228 54 --1471 --
NM_004637chr331306 1280 1015 ------
NM_004654chrY41254 1218 1084 546 ------
NM_004655chr1721047 84 ------
NM_004656chr321236 149 1975 ----
NM_004660chrY42049 1821 1736 652 11528 22181 2040 --
NM_004663chr1531590 1263 407 ------
NM_004666chr631295 1152 207 ------
NM_004671chr18--1228 ----
NM_004681chrY5691 682 516 197 169 ------
NM_004687chr1731875 708 511 --11998 --
NM_004694chr173629 306 144 --1234 --
NM_004703chr1742321 835 718 214 ------
NM_004705chr112602 247 --1656 --
NM_004709chrX11732 ----191
NM_004718chr21103 ------
NM_004719chr1282859 2512 2073 1755 1016 804 597 589 --22660 2273 --
NM_004721chr31271 --1303 --
NM_004723chr13360 94 42 ------
NM_004726chrX105688 5601 5311 4525 4279 4061 2132 913 204 185 11986 24961 4215 --
NM_004729chrX61555 743 536 404 198 66 1882 1662 --
NM_004730chr541635 353 179 107 12069 11446 --
NM_004731chr1281850 1768 1761 1421 1247 748 470 267 ------
NM_004733chr3121 ------
NM_004740chr17--1119 ----
NM_004742chr341361 1236 1161 298 --1453 --
NM_004744chr473652 3116 2566 1544 1261 638 106 --13067 --
NM_004745chr8126916 6173 6018 5954 5307 4720 4426 2630 2153 1546 622 240 22609 703 --15624
NM_004747chr1051298 1241 1229 240 197 ----11041
NM_004748chr1583696 3627 3497 3277 3022 1463 622 149 13713 ----
NM_004755chr1451196 1137 973 866 166 ------
NM_004757chr43530 464 168 ------
NM_004758chr1721035 328 ------
NM_004760chr752032 1922 751 588 346 22188 726 1840 1500
NM_004763chr211140 ------
NM_004774chr1783138 3074 2810 2509 2313 727 426 247 21937 523 ----
NM_004775chr1852223 2104 2075 1851 917 ------
NM_004776chr2062478 2294 1299 1232 226 106 --13256 23035 1264
NM_004779chr531303 536 230 ------
NM_004781chr141101 498 402 165 ------
NM_004781chr141101 498 402 165 ------
NM_004788chr1152461 2309 2137 806 372 1960 12690 --
NM_004791chr132762 192 ------
NM_004796chr14--1275 ----
NM_004798chr2073572 3300 2996 2974 2387 2273 835 1181 1677 --
NM_004801chr22274 23 21192 577 --11174
NM_004815chr174848 4093 3571 3475 1876 1107 158 44894 4250 3594 3335 13017 14698
NM_004817chr93761 527 241 ------
NM_004821chr53823 317 165 --1581 --
NM_004822chr1723597 1008 ----13515
NM_004824chr641142 1050 555 267 ------
NM_004834chr262963 2609 2423 2282 843 474 13236 ----
NM_004839chr151251 --1448 --
NM_004840chrX42082 2063 1624 393 --12305 --
NM_004844chr331019 60 37 --1245 --
NM_004850chr241754 1542 1329 497 21114 127 ----
NM_004857chr14104354 3530 3497 3484 3470 3199 880 667 501 309 --11635 --
NM_004859chr17103074 2856 2534 2293 2016 1143 493 448 313 180 --22495 2354 --
NM_004863chr14115084 4904 4206 3620 1762 1548 855 758 666 256 84 35221 4032 3459 14691 --
NM_004866chr5114973 4564 4346 4130 4076 3741 3374 1947 1828 850 328 21821 258 ----
NM_004867chrX2445 64 183 ----
NM_004874chr81110 --152 --
NM_004879chr111750 --1294 --
NM_004884chr1571741 1360 655 618 533 391 286 11352 ----
NM_004887chr53847 773 163 ------
NM_004896chr1021043 216 ----1274
NM_004897chr102623 134 --1319 --
NM_004898chr432173 2034 596 12428 11084 --
NM_004904chr7136400 6225 5891 5577 4952 4815 4315 2599 2289 932 777 330 219 --55564 5546 4293 4093 1280 26604 2400
NM_004926chr1431875 1643 1374 2665 540 ----
NM_004929chr821511 985 --21147 392 21362 485
NM_004932chr541158 323 165 33 --1499 --
NM_004936chr942732 596 402 266 1207 12411 12345
NM_004938chr911184 ------
NM_004939chr21138 ------
NM_004947chr342318 2206 2119 989 21831 113 ----
NM_004948chr1851437 1045 1028 361 50 ----11061
NM_004949chr1861917 1713 860 591 368 183 ------
NM_004956chr773932 3587 3122 3071 2849 1441 208 --1971 --
NM_004958chr11785 --1751 1853
NM_004965chr211114 --1280 --
NM_004966chr102822 224 ------
NM_004967chr43429 381 334 ------
NM_004969chr102479 397 ------
NM_004972chr92450 242 --1892 --
NM_004973chr621266 1146 ------
NM_004975chr202358 313 ------
NM_004978chr111473 135 ----
NM_004985chr1284405 4189 3874 3695 3116 1361 1346 437 23950 1670 11373 --
NM_004992chrX138402 7833 7765 7727 7613 7234 6947 5765 5145 3313 2287 1336 389 28232 2685 ----
NM_004992chrX138402 7833 7765 7727 7613 7234 6947 5765 5145 3313 2287 1336 389 28232 2685 ----
NM_004996chr1631745 677 484 1605 11413 --
NM_004999chr6104075 3959 3863 3649 3521 3394 1364 404 348 188 34324 3778 1426 33420 3095 565 12739
NM_005010chr731877 801 54 11552 ----
NM_005016chr121128 ------
NM_005020chr71546 1491 ----
NM_005023chr531439 1364 354 11214 --1388
NM_005026chr122017 1683 --21831 743 --
NM_005028chr1062217 2184 648 626 614 33 --12295 --
NM_005032chrX1245 ------
NM_005036chr22117942 7636 7228 7152 6499 1973 835 624 420 310 52 25166 2706 25313 1606 12950
NM_005045chr72966 914 --1362 --
NM_005054chr251675 1356 1300 522 54 ------
NM_005056chr1275524 5474 5304 2242 2232 1248 416 --11607 --
NM_005063chr1013458 ----12407
NM_005065chr14104428 3751 3264 2135 2063 1898 1206 1035 632 388 1279 23511 60 14157
NM_005076chr15984 762 642 240 89 13977 ----
NM_005077chr91460 ------
NM_005079chr862984 2726 2284 1203 930 816 1262 1771 1243
NM_005087chr33664 562 235 ------
NM_005095chr121829 1823 ----1495
NM_005097chr103135 113 89 ------
NM_005103chr111305 ------
NM_005105chr142222 1999 640 538 ------
NM_005110chr52633 312 ------
NM_005112chr41408 --2987 287 --
NM_005116chr2064089 3723 3359 1460 1138 104 ------
NM_005119chr11482 ------
NM_005121chr1783751 3727 3309 3103 3087 3076 2776 233 13222 13473 --
NM_005134chr182897 191 ------
NM_005135chr1593191 1391 1071 1013 977 798 626 496 399 --12448 --
NM_005141chr4143 ------
NM_005149chr141412 877 445 214 ----11066
NM_005151chr1872310 1769 1687 1613 858 828 445 12385 ----
NM_005156chr985020 4544 4236 1696 1516 1011 617 349 1789 13844 12094
NM_005160chr2286228 5847 5436 5060 4586 2136 1703 225 16661 15622 1819
NM_005163chr141773 ----1917
NM_005168chr251480 1231 1162 653 308 1136 --11459
NM_005180chr1031446 360 164 ------
NM_005184chr1931184 991 62 --176 1642
NM_005188chr1197206 6987 6644 6629 1026 919 846 829 812 15176 21405 543 --
NM_005190chr611084 ------
NM_005191chr331459 1354 1156 ------
NM_005194chr20----1569 --
NM_005197chr14115741 5708 5648 5558 5534 4653 4631 4609 4597 4513 374 45636 2446 1213 237 36152 5726 4696 --
NM_005201chr32456 31 --1134 --
NM_005204chr103944 880 613 1645 ----
NM_005207chr2253247 2712 2679 2604 243 ------
NM_005220chr1731153 241 212 ------
NM_005222chr73991 904 669 --1358 --
NM_005224chr19--2484 261 1236 --
NM_005229chrX11205 1507 ----
NM_005231chr1131403 223 161 ------
NM_005233chr342585 1927 1867 1673 22046 120 ----
NM_005235chr2127438 7411 7184 5832 5675 5613 5186 907 884 489 167 109 11069 36528 5377 637 36915 2005 1468
NM_005238chr1143229 3194 3109 988 --32981 1152 740 --
NM_005241chr311029 --2954 370 --
NM_005243chr221103 ------
NM_005244chr202518 197 --1472 --
NM_005254chr1531165 897 503 ------
NM_005256chr113667 320 150 1365 1380 --
NM_005257chr18----31023 1004 972 --
NM_005259chr221304 1292 --1440 21197 623
NM_005261chr82924 82 ------
NM_005264chr103729 616 131 --1811 --
NM_005277chr471944 1786 1638 1281 628 282 160 ------
NM_005284chr63354 338 331 ------
NM_005295chr7--133 ----
NM_005316chr11----1370 --
NM_005324chr1771983 1885 1737 737 548 178 47 1572 1811 11997
NM_005333chrX31232 936 119 183 1366 --
NM_005338chr793689 3476 3017 2875 2767 1608 1041 508 145 ------
NM_005339chr42832 210 12821 24248 762 --
NM_005342chrX42417 255 235 32 ------
NM_005347chr961546 1393 1336 1130 419 36 --1472 --
NM_005349chr41563 1523 ----
NM_005358chr1341656 1610 375 24 11733 ----
NM_005359chr18115654 5611 5174 4478 4158 2523 1453 1001 980 866 237 --11663 15522
NM_005369chrX3586 255 68 ------
NM_005375chr621123 1102 --138 --
NM_005376chr141037 257 205 160 --1439 --
NM_005384chr91232 ------
NM_005385chr342696 2659 1665 118 --11982 --
NM_005387chr11197 ------
NM_005392chr921692 1268 ------
NM_005397chr763594 2595 886 865 813 174 1618 ----
NM_005398chr1041073 1039 246 148 ------
NM_005399chr1113917 3910 3883 3380 1726 1477 1421 1150 1104 682 573 ----14025
NM_005400chr262406 2212 2121 1071 991 696 21955 74 12626 --
NM_005402chr741720 1646 1181 98 ------
NM_005410chr53763 614 22 ------
NM_005417chr2032001 1847 257 --11632 --
NM_005433chr1852826 2578 2409 2146 1918 11113 11902 --
NM_005436chr1074031 3276 1447 1171 943 459 186 --12829 --
NM_005437chr1021175 577 --31452 983 342 --
NM_005458chr972368 2184 1754 1538 989 745 75 1142 ----
NM_005461chr2051416 1368 734 567 527 ------
NM_005465chr131592 709 183 11571 ----
NM_005475chr1262943 2480 571 417 353 113 12256 ----
NM_005476chr931100 987 431 ------
NM_005479chr1021440 1109 --11614 --
NM_005493chr6--126 --1530
NM_005494chr7168 ------
NM_005496chr33442 348 91 ------
NM_005497chr1795831 5713 5372 5159 4257 1767 1543 992 84 14007 35502 3958 1008 11030
NM_005499chr191409 ------
NM_005502chr983083 2926 2859 2385 2316 1260 585 307 12468 ----
NM_005504chr12106570 2229 1619 1455 1441 893 753 572 343 237 --25460 2007 --
NM_005509chr531550 1250 390 --11740 1370
NM_005517chr121281 56 --1144 --
NM_005519chr103540 401 356 ------
NM_005520chr52650 540 ----1296
NM_005522chr71521 11126 ----
NM_005527chr61154 --1260 --
NM_005530chr1531312 1054 449 21235 295 ----
NM_005534chr211490 ------
NM_005539chr1061255 1198 434 137 77 38 ------
NM_005542chr741917 1864 563 522 11899 11220 --
NM_005561chr133865 224 83 ------
NM_005563chr11263 ------
NM_005570chr1861073 1025 951 897 354 127 ------
NM_005578chr3104411 4132 3841 3471 1212 876 867 827 774 62 14263 11315 --
NM_005584chr131729 --3660 316 274 --
NM_005587chr152884 684 1769 ----
NM_005593chr123480 379 189 ------
NM_005595chr14683 300 212 155 ------
NM_005596chr975769 5414 4757 1562 1282 1079 255 14716 55242 2432 2091 1437 582 1865
NM_005599chr141125 1119 454 49 1344 ----
NM_005602chr331282 1240 1064 ------
NM_005604chr642474 741 324 176 11832 11709 --
NM_005613chr131469 823 572 --22230 2128 --
NM_005627chr62851 173 ------
NM_005637chr185741 397 353 228 60 --1194 --
NM_005638chrX51590 1529 1295 566 285 --1541 --
NM_005639chr1241684 1541 1459 1402 ----11510
NM_005647chrX23383 449 22351 247 1524 12182
NM_005655chr831193 412 374 ----11069
NM_005665chr1114892 4593 4114 4005 3956 3086 1646 1253 1218 1176 1073 14825 23976 3560 13779
NM_005668chr554559 3859 3360 1462 1140 1280 ----
NM_005669chr572075 1929 1570 847 601 184 109 ------
NM_005686chr131558 412 272 1149 ----
NM_005693chr11----196 --
NM_005708chr132455 72 ------
NM_005711chr52841 412 11017 --1388
NM_005715chr692841 2626 2493 2265 1946 1853 1012 839 587 --1119 12293
NM_005717chr13996 454 356 1278 ----
NM_005721chr23933 806 348 --1776 --
NM_005722chr232476 2282 839 ------
NM_005725chr141862 1525 1504 82 ------
NM_005731chr2----150 --
NM_005737chr252466 2386 2361 2288 1166 ------
NM_005746chr782658 2238 2046 1100 1089 902 862 470 12636 ----
NM_005748chr12102950 2707 2580 2452 1364 771 744 695 197 182 196 --1651
NM_005749chr173654 542 207 1108 ----
NM_005752chr1611149 ------
NM_005759chr2104210 3128 1848 1805 958 567 542 481 336 121 24153 496 44165 3094 1112 667 --
NM_005760chr2195 ------
NM_005765chrX4724 621 301 245 ------
NM_005766chr1331010 893 250 21026 449 ----
NM_005776chr14--1191 ----
NM_005779chr562305 1394 1193 1091 517 372 12497 11385 --
NM_005781chr31202 ------
NM_005783chr21470 1574 2598 416 1102
NM_005786chr18131 ------
NM_005795chr212444 12421 2935 218 --
NM_005797chr1171787 1748 1373 642 440 394 292 ------
NM_005802chr92734 712 --1605 --
NM_005807chr15755 578 479 67 57 --1587 --
NM_005808chr373133 2853 2362 2202 2180 100 34 --1727 --
NM_005813chr242617 2347 2189 508 --11906 --
NM_005822chr642288 2227 1812 961 --1465 --
NM_005826chr12670 58 1154 ----
NM_005828chr1744890 3201 919 411 ----13472
NM_005832chr3143 --11218 --
NM_005835chr63203 124 32 ------
NM_005836chr8138 ------
NM_005839chr15649 608 275 189 95 ------
NM_005840chrX96448 5733 5323 5257 2714 2501 2444 2271 284 27274 2376 27119 6268 15947
NM_005841chr411131 ------
NM_005843chr241905 1865 520 479 1284 ----
NM_005848chr15----162 126
NM_005852chr171714 ------
NM_005853chr161475 ------
NM_005857chr141496 1489 1343 180 ------
NM_005859chr541424 1102 462 284 ------
NM_005862chr33420 354 322 --188 --
NM_005868chr762214 2018 1012 462 177 98 --182 --
NM_005871chr103821 368 258 ------
NM_005876chr22610 64 ------
NM_005882chr42188 79 --1140 --
NM_005884chr191814 --1665 --
NM_005891chr61191 ----1159
NM_005896chr23796 612 572 178 ----
NM_005898chr1163190 2533 1238 1155 577 498 1244 1934 1776
NM_005900chr42828 106 --1223 --
NM_005901chr18178556 8481 8218 8081 7694 6701 6337 5619 5553 3334 2929 2903 2162 1647 1638 1495 117 48193 7809 3321 2432 26887 202 --
NM_005902chr1544416 3992 2834 1133 --1490 --
NM_005903chr553361 1541 1330 961 530 21814 898 11292 11599
NM_005904chr1841517 1087 1069 44 1492 ----
NM_005907chr621257 547 ------
NM_005909chr574085 4077 4041 3115 2655 2629 257 13011 1647 23472 3151
NM_005920chr153693 1072 574 448 290 23244 2652 ----
NM_005923chr61235 ------
NM_005924chr71975 --1383 --
NM_005927chr531179 270 79 ----11312
NM_005930chr143926 584 84 ------
NM_005933chr1182327 2290 1144 918 807 611 387 59 1151 32396 2192 861 --
NM_005935chr484179 4079 3771 3727 1421 908 294 177 23444 1490 ----
NM_005941chr823198 991 33569 266 174 ----
NM_005955chr165532 4312 3829 3716 3584 2171 ------
NM_005966chr272333 2138 1896 1834 828 657 234 --155 1534
NM_005973chr1------1345
NM_005977chr1341041 733 279 24 ------
NM_005981chr121931 ------
NM_005985chr201750 ------
NM_005996chr1241150 1104 1091 267 ------
NM_006007chr93592 119 61 ----23451 3144
NM_006009chr12158 ------
NM_006011chr1584283 4141 3711 3383 3169 3137 1154 453 13515 ----
NM_006015chr1--1491 ----
NM_006016chr641972 884 555 64 11907 ----
NM_006022chr131925 ----1162
NM_006030chr351136 633 608 585 75 ------
NM_006035chr1421283 909 ------
NM_006037chr2114609 4284 3954 3921 3478 3173 2991 1886 1394 1054 273 --13519 --
NM_006041chr172416 142 --1176 --
NM_006047chr20123542 3487 3474 3133 2867 2640 2196 2174 1230 1207 654 181 1699 23274 1287 --
NM_006054chr112520 357 ----187
NM_006060chr763527 2795 2705 1699 1611 591 13477 23810 923 --
NM_006062chr22927 192 1341 11227 1783
NM_006067chr163817 391 330 ------
NM_006076chr742341 2213 589 478 --12730 --
NM_006079chr65823 807 718 709 674 1218 168 --
NM_006080chr722620 992 11863 --12065
NM_006089chrX41883 1211 508 52 ------
NM_006094chr822268 1774 --1926 1902
NM_006095chr484492 4130 3480 1601 1436 1398 791 167 1138 --13157
NM_006096chr81324 ------
NM_006099chr13243 201 39 --1572 --
NM_006106chr1163317 3110 2903 952 661 488 --13146 1353
NM_006108chr115949 932 413 164 30 ----1384
NM_006113chr131985 773 364 --21814 547 --
NM_006135chr141195 993 400 141 1484 ----
NM_006136chr72916 402 ------
NM_006139chr262608 2519 2287 859 506 235 ------
NM_006141chr1652299 1979 996 582 526 ------
NM_006145chr193895 720 403 1950 ----
NM_006148chr1772926 2771 2581 2532 413 358 34 ------
NM_006153chr3--1568 ----
NM_006154chr1592904 2145 2089 1116 919 892 830 466 326 12408 ----
NM_006155chr262073 1905 1397 760 309 217 --3362 62 38 22019 385
NM_006158chr81558 1149 11347 --
NM_006164chr21374 ------
NM_006166chr1272488 2464 2278 2067 1938 1771 539 ------
NM_006182chr11176 ------
NM_006186chr221068 815 --1907 --
NM_006190chr221076 807 --1351 --
NM_006194chr142879 426 1157 ----
NM_006195chr951132 1122 1078 238 210 ----1932
NM_006197chr852234 1464 773 109 64 21749 42 ----
NM_006202chr192648 266 11440 ----
NM_006203chr585495 5222 4379 4170 3954 3671 3409 977 --15393 25019 1401
NM_006206chr462683 2672 2519 1935 1830 663 ------
NM_006209chr81331 1430 ----
NM_006223chrX1426 ------
NM_006224chr1742457 1860 588 581 ----12170
NM_006237chr1351955 1875 1692 1636 873 32215 2028 384 11853 --
NM_006241chr331873 1677 262 --1468 --
NM_006246chr1441132 883 131 22 ------
NM_006251chr553029 2058 1188 914 907 ------
NM_006252chr1126965 6415 6160 6104 5317 4894 3031 2809 2330 1080 554 94 16689 35987 5808 2851 11407
NM_006256chr192803 2205 2091 1898 1891 1878 270 207 160 --12465 12513
NM_006258chr1011305 --1323 --
NM_006265chr831162 985 456 11355 1438 --
NM_006275chr2062530 2226 809 746 630 397 --138 --
NM_006277chr21596 ------
NM_006282chr2084548 4446 4351 4008 3607 3387 932 85 ------
NM_006283chr8103867 3523 3298 1937 1726 1416 1235 924 754 509 24931 4451 --13405
NM_006287chr242257 1772 786 23 ------
NM_006290chr641970 1681 1391 1261 ------
NM_006298chr683047 2955 2593 2198 2186 1308 1201 986 2962 514 1620 --
NM_006300chr1971617 962 882 858 281 202 103 1628 ----
NM_006302chr21208 132 ----
NM_006304chr7151 ------
NM_006306chrX65779 4434 2012 1947 1828 1389 ----13709
NM_006310chr1731286 963 155 --1306 --
NM_006313chr1271268 1203 1194 671 482 371 31 11160 ----
NM_006315chr454526 3147 547 161 74 44168 2922 969 151 1195 --
NM_006322chr13----1676 --
NM_006352chr141942 793 605 308 ------
NM_006353chr64989 916 129 54 1280 ----
NM_006358chr223466 421 235 --11056 --
NM_006359chrX21871 202 1326 11566 --
NM_006360chr11160 ------
NM_006364chr144869 477 464 423 126 ----
NM_006366chr631342 240 141 1338 ----
NM_006367chr11935 ----1980
NM_006371chr394969 4507 4465 4386 4197 4001 3973 1148 586 13652 1706 --
NM_006372chr61155 ------
NM_006373chr1711081 ------
NM_006379chr752188 1996 1437 737 181 ------
NM_006380chr1784162 3952 3756 3344 1618 642 425 106 --12820 --
NM_006386chr2262486 2342 1803 621 222 54 ------
NM_006401chr92379 154 ------
NM_006410chr111477 1421 ----
NM_006416chr6------1317
NM_006419chr42787 195 1768 --1603
NM_006420chr2093439 2970 2763 2559 2471 2392 1122 829 355 --11206 12139
NM_006421chr8--1491 1155 --
NM_006425chr541635 1269 1255 45 ------
NM_006439chr42570 190 ------
NM_006447chr211100 ------
NM_006451chr53846 697 149 ------
NM_006457chr483823 3474 2921 1382 1172 771 558 441 14129 ----
NM_006459chr1041859 353 295 101 --11493 --
NM_006460chr1731819 606 61 ------
NM_006467chr571533 675 655 414 198 189 48 ------
NM_006469chr121643 65 11171 1424 --
NM_006472chr161224 1197 1170 1064 954 800 165 ----
NM_006482chr1293792 3107 2767 2377 1292 1018 612 514 128 23611 336 13343 --
NM_006489chr1461959 1814 737 531 419 352 ------
NM_006497chr171820 ------
NM_006504chr1042470 1189 1171 1023 --12647 1903
NM_006516chr181636 1592 1500 1201 1138 1076 584 353 21627 1092 ----
NM_006517chrX41939 733 620 88 12095 ----
NM_006526chr202446 160 ------
NM_006527chr43640 575 160 --1597 --
NM_006529chr441705 1624 580 508 ------
NM_006534chr2083280 2213 1300 1075 782 601 373 48 1802 12426 --
NM_006537chr154591 460 65 45 ------
NM_006538chr254143 4000 3622 1659 524 ------
NM_006544chr14166101 6043 5966 5803 5592 5369 4515 2423 2159 1991 1970 1793 875 659 584 114 --15425 --
NM_006546chr1796102 5681 4591 4141 2655 1562 1079 936 205 1777 26607 4569 --
NM_006557chr941760 1725 557 81 ----11251
NM_006561chr10116041 5810 5770 5530 4732 4573 4393 4316 4177 3949 254 14664 11906 25425 2500
NM_006565chr16----11096 --
NM_006572chr1763507 3188 2592 1362 433 358 22289 1319 22219 789 --
NM_006574chr3158 ------
NM_006575chr14143 ------
NM_006577chr221011 414 ------
NM_006584chr17149 ------
NM_006595chr1131782 565 491 --11610 --
NM_006597chr113185 169 46 ------
NM_006599chr16128292 8248 8239 8124 7386 7298 6346 6135 2851 2499 2466 1320 27260 609 23185 542 26059 5302
NM_006601chr122856 231 ------
NM_006602chr202766 592 ------
NM_006603chrX11821 ------
NM_006609chr242569 2153 1081 269 --12873 --
NM_006614chr362709 2690 2263 966 183 23 13234 1490 --
NM_006618chr131490 1427 194 ------
NM_006621chr131905 651 43 11804 ----
NM_006624chr1032139 354 270 --1120 11675
NM_006626chr942334 1678 599 409 --22672 2433 --
NM_006628chr1584503 4315 4185 3953 3911 3214 2851 1485 44057 1774 1102 960 24523 1138 --
NM_006629chr1862275 1860 1000 599 257 180 1920 1103 --
NM_006633chr51706 --1543 --
NM_006636chr21309 1363 132 --
NM_006642chr1--152 ----
NM_006644chr13----1648 --
NM_006646chr1353073 2759 2265 978 174 1769 ----
NM_006650chr533673 362 300 12976 1796 --
NM_006653chr62345 59 ------
NM_006654chr1273486 1499 1219 1207 742 183 84 --23960 1087 --
NM_006675chr1243155 2651 1083 332 ------
NM_006682chr792436 2331 2251 1793 867 573 433 360 62 --1211 --
NM_006698chr201110 ------
NM_006699chr122715 1880 ----22547 683
NM_006704chr132183 85 ------
NM_006706chr51767 1203 1153 --
NM_006708chr641318 1258 907 425 ------
NM_006713chr51134 ------
NM_006717chr933394 2973 2460 --13030 1630
NM_006720chr1065094 5079 3695 3159 1651 1459 25113 4629 1181 15071
NM_006721chr103735 252 39 1553 ----
NM_006726chr42453 322 11126 ----
NM_006729chrX124941 4318 4288 3797 3747 2129 1995 1768 1435 775 656 154 23639 78 24809 3589 24503 322
NM_006731chr9124722 3870 3714 2139 1948 1875 1387 1251 983 964 933 916 ----14793
NM_006734chr631318 477 359 ----11401
NM_006745chr43447 124 66 ------
NM_006749chr841257 1058 1051 941 ------
NM_006750chr16117968 6894 6169 6107 5981 5579 5036 3106 2613 1704 1384 16383 27996 199 13224
NM_006756chr831287 1183 478 ------
NM_006763chr11501 --11679 --
NM_006766chr831743 779 218 ----1763
NM_006769chr11191 ----1516
NM_006775chr632978 676 279 22271 2127 22278 1902 12821
NM_006777chrX82859 2793 2726 2312 1860 1836 401 370 ------
NM_006788chr1821696 95 ------
NM_006790chr53392 362 165 ------
NM_006802chr11460 ----21170 970
NM_006805chr51545 ------
NM_006807chr1731008 492 317 ------
NM_006808chr9151 ------
NM_006811chr2031001 705 231 ------
NM_006815chr121253 1107 21325 1247 --
NM_006818chr11847 1991 ----
NM_006826chr231163 513 405 ----1260
NM_006832chr141213 ------
NM_006838chr122732 113 ------
NM_006852chr1742671 2411 2220 1005 --1859 --
NM_006854chr762004 1379 1265 619 564 490 ------
NM_006873chr252862 1338 1035 808 756 11403 12473 --
NM_006874chr441042 306 102 56 --1313 --
NM_006885chr1694210 3770 3423 3211 3172 3037 2725 521 188 --1725 --
NM_006888chr1463530 2834 1371 801 694 233 --13327 --
NM_006892chr2021263 569 ----1376
NM_006892chr2021263 569 ----1376
NM_006896chr741135 402 304 151 ------
NM_006908chr761241 1224 536 428 363 222 1114 ----
NM_006914chr931088 234 101 ------
NM_006915chrX42056 984 546 72 12185 ----
NM_006918chr11205889 5703 5560 5387 5197 4964 4920 4877 4764 4754 4497 4228 3757 3675 2272 2248 1274 861 723 416 34034 1240 1019 25040 4052 15109
NM_006920chr242044 1429 1290 234 --1330 --
NM_006922chr242391 287 228 192 ----21631 119
NM_006924chr17124162 3293 3259 2960 1764 1717 1369 971 850 595 234 158 --1586 --
NM_006925chr14--1402 ----
NM_006930chr551479 742 721 713 116 21926 1382 --1149
NM_006937chr17158 ------
NM_006939chr1431008 989 27 ------
NM_006940chr1221803 277 --11393 --
NM_006948chr2151599 849 330 314 120 1548 1219 --
NM_006950chrX1270 ------
NM_006951chr101673 --1599 --
NM_006955chr1053096 2510 2412 652 225 --22355 1298 --
NM_006956chr782214 1744 1591 897 700 653 351 195 ------
NM_006965chr1831038 799 376 ----132
NM_006981chr952375 2318 2159 1139 288 --11207 --
NM_006982chr12----147 --
NM_007005chr921132 44 2613 109 ----
NM_007006chr1673142 2653 2517 2359 990 409 237 ----11299
NM_007007chr12124290 4085 3980 3922 3843 3731 3664 3425 1745 1157 904 527 --34144 4134 1088 1885
NM_007010chr1751877 1526 1342 106 75 11886 --1359
NM_007011chr15126784 6699 6624 6558 6501 6243 5907 5865 5627 5415 4563 23 22440 1863 15328 22032 1208
NM_007017chr53697 666 296 ------
NM_007023chr23756 727 204 ------
NM_007026chr171210 ------
NM_007027chr3129 ------
NM_007030chr5105194 4931 4620 3423 3155 1850 1108 1029 849 75 25034 4461 24657 183 --
NM_007035chr124710 535 304 285 ------
NM_007036chr53688 252 63 --1189 --
NM_007038chr21126086 5512 4787 4075 3944 2139 1540 1295 1118 397 251 48 55456 5035 2198 994 812 25284 2150 14474
NM_007039chr1451826 1687 854 623 91 ------
NM_007045chr62172 126 ------
NM_007049chr62974 942 ------
NM_007051chr11115 ------
NM_007054chr5133842 3751 3110 2975 1437 1413 1200 941 770 713 516 501 181 --1958 --
NM_007073chr683933 3558 3255 3170 1554 1160 628 67 --23983 1177 14171
NM_007076chr12----1105 --
NM_007106chr1392734 2699 2529 1124 689 576 428 177 137 1460 --22346 642
NM_007107chr312161 12239 11540 --
NM_007114chr383117 2694 2483 1231 775 564 386 56 12438 22468 2343 --
NM_007115chr22357 86 ------
NM_007118chr53869 801 201 1814 ----
NM_007124chr641867 1312 405 153 ------
NM_007125chrY31460 1181 259 --1361 --
NM_007137chrX45558 3604 2200 1392 14205 15579 14125
NM_007139chr731208 1143 370 1815 11115 --
NM_007145chr1921344 1337 ------
NM_007146chr1782882 2859 2737 2379 1807 1799 363 234 ------
NM_007150chrX31817 827 507 11833 11709 --
NM_007158chr151252 1179 939 373 106 ----1419
NM_007159chr341505 1150 1100 316 155 ----
NM_007166chr1151534 1192 1044 575 529 ------
NM_007172chr2253252 2495 1322 183 93 13080 12045 --
NM_007175chr873492 2621 2315 1218 609 496 264 ----11101
NM_007189chr751531 1506 159 112 94 ------
NM_007191chr122675 102 194 ----
NM_007195chr1873300 2603 1134 798 587 198 86 ------
NM_007203chr953878 3859 3590 2842 2763 11584 ----
NM_007204chr11500 ------
NM_007207chr12789 355 --1140 --
NM_007214chr621339 1285 ------
NM_007217chr3----1277 --
NM_007218chr81971 1769 ----
NM_007222chr841583 360 288 211 1113 11544 --
NM_007236chr1542482 1796 686 653 ------
NM_007246chr43851 715 82 --2838 674 --
NM_007249chr13189423 8998 7341 6995 6947 6920 6503 6494 6434 3723 3472 3401 2591 1982 1837 1133 632 149 69092 6395 6089 5914 5854 548 28787 1771 16148
NM_007259chr12396 343 ------
NM_007269chr1----1616 --
NM_007270chr71419 11520 11107 --
NM_007271chr641167 393 331 69 ------
NM_007276chr741105 767 236 173 ------
NM_007279chr191630 ------
NM_007282chr31886 ----1751
NM_007285chr16----1402 --
NM_007292chr17105153 4898 4730 4688 3745 3728 3665 3270 1740 193 24881 4623 1868 --
NM_007308chr43737 725 477 ------
NM_007320chr191232 ------
NM_007325chrX1580 --2655 183 1638
NM_007331chr432441 721 189 22669 647 12314 --
NM_007332chr821607 1344 21354 1268 --11580
NM_007345chr183358 352 64 1710 12166 --
NM_007347chr1522059 1135 --11189 --
NM_007350chr1284444 3879 3567 3411 1821 978 508 461 24544 2846 13633 1658
NM_007361chr141131 ------
NM_007362chr321442 302 --2474 31 --
NM_007373chr1021352 260 11602 11437 --
NM_007375chr1102600 2459 2301 2142 2104 2065 730 615 573 368 --1485 12497
NM_012069chrX22415 2322 --1927 1862
NM_012072chr2094028 3254 1653 1455 1359 846 824 504 24 --11694 14061
NM_012074chr1441099 1074 431 423 ------
NM_012081chr563479 3259 2995 2922 595 508 1352 --1836
NM_012090chr121163 955 ------
NM_012095chr10103525 3030 2753 2330 2178 1229 1219 778 571 530 11282 ----
NM_012096chr363278 1369 1291 1230 694 396 32421 2409 366 ----
NM_012097chr242159 1979 1703 1653 ----11609
NM_012102chr132503 1012 373 --11045 --
NM_012104chr1152725 2353 1325 920 513 12527 2235 218 22392 1118
NM_012104chr1152725 2353 1325 920 513 12527 2235 218 22392 1118
NM_012110chr42213 87 ------
NM_012117chr12--146 ----
NM_012120chr683031 2543 2470 2038 1164 754 260 50 --22789 232 11049
NM_012124chr113330 127 49 ------
NM_012137chr112732 ----1281
NM_012141chr13174147 3851 3819 3444 3384 3232 2840 2826 1619 1596 1502 1379 1315 737 493 216 116 11028 ----
NM_012153chr1152171 1693 715 449 153 1647 ----
NM_012154chr81316 159 ----
NM_012156chr2073233 2431 1144 1006 634 606 92 13422 1503 --
NM_012157chr3--2950 320 ----
NM_012158chr1331784 1196 710 ----1557
NM_012164chr987495 7486 7390 7304 6984 6518 6423 6102 14679 47271 6918 5217 1305 --
NM_012175chr115810 780 657 145 25 ------
NM_012176chr51230 ------
NM_012180chr41280 1717 ----
NM_012193chr11114581 4278 3680 3601 2101 1760 1746 565 463 454 415 11075 ----
NM_012199chr153451 1498 1337 702 276 ----13712
NM_012214chr295609 5536 1817 1504 1292 575 297 213 90 1959 56088 5726 5627 5467 4326 1465
NM_012224chr441174 1119 854 268 ------
NM_012234chr3103619 3469 3229 3055 2919 2819 2774 568 534 193 ----1912
NM_012238chr105634 511 440 342 194 --1606 --
NM_012242chr101566 ------
NM_012243chr12968 298 ----1867
NM_012244chr141238 1170 ----
NM_012247chr1021013 245 1275 --1776
NM_012249chr2123434 3277 3205 3158 3128 3003 2889 2873 2341 740 663 216 --23528 3218 --
NM_012250chr112436 194 ------
NM_012255chr201415 ------
NM_012257chr721013 202 --1853 --
NM_012259chr641321 1030 441 241 ------
NM_012262chr195250 4812 4531 1881 1862 1371 1231 679 325 --24409 1846 --
NM_012281chr752444 1819 832 398 362 ------
NM_012286chrX1241 --147 1231
NM_012287chr3113927 3910 3409 3267 2920 2834 1687 1618 1155 1069 997 13153 13299 --
NM_012290chr25673 456 334 313 206 21400 54 ----
NM_012294chr784102 3848 3805 3656 3588 3373 1009 36 1125 11017 1857
NM_012297chr462445 2340 2275 2039 802 503 1464 ----
NM_012300chr562277 2209 1674 1616 837 757 --22575 2553 --
NM_012301chr732214 866 534 --11724 --
NM_012304chr582467 1849 983 673 643 543 525 501 --12199 --
NM_012308chr1132024 467 105 --1615 --
NM_012309chr1194576 4084 3472 3240 1820 1518 1497 366 139 --14401 --
NM_012325chr2031241 1124 585 --168 --
NM_012328chr721015 960 ----1170
NM_012329chr1731649 599 74 --1581 --
NM_012333chr141162 387 260 128 ------
NM_012334chr564400 4203 3190 2979 1869 318 13903 21095 622 --
NM_012338chr73939 775 421 --1947 --
NM_012343chr53798 404 366 ----11162
NM_012347chr632970 2495 823 --23032 892 --
NM_012382chr594338 3933 2851 1601 1432 1161 828 567 559 21249 480 11558 --
NM_012383chr92444 404 ------
NM_012412chr73719 604 142 ------
NM_012414chr12615 190 ----1270
NM_012416chr9----1451 --
NM_012417chr171457 --1405 --
NM_012419chr6----1506 --
NM_012428chr1531038 875 379 1766 ----
NM_012429chr2231389 493 485 --2894 359 11361
NM_012433chr22312 84 ------
NM_012443chr103670 287 148 123 1158 --
NM_012448chr1731922 656 122 ----1102
NM_012463chr1221463 1349 ----1460
NM_012465chr1062952 2350 2185 968 837 715 --11133 --
NM_012467chr161107 ------
NM_012470chr7------1364
NM_012471chrX41979 1371 596 150 ------
NM_012481chr172583 152 191 1324 --
NM_012482chr12490 62 2656 218 ----
NM_013230chrY61514 1389 1323 1168 526 506 1312 11686 --
NM_013231chr1454350 3298 1726 859 55 23753 836 23233 128 --
NM_013233chr241129 1106 449 426 1340 1189 --
NM_013235chr53865 729 642 1852 ----
NM_013236chr2221161 487 ------
NM_013237chr51368 1359 ----
NM_013254chr123568 202 52 ------
NM_013255chr7117144 6184 5974 5526 3330 2667 2294 1463 625 381 363 38230 3543 3281 12541 --
NM_013261chr493608 2979 2842 2808 2770 2464 1061 851 112 ----13306
NM_013262chr621205 236 ------
NM_013267chr122339 78 ------
NM_013269chr1274475 4279 3364 3322 1070 854 735 ------
NM_013281chr2071373 1331 1183 1127 1084 1040 88 ------
NM_013283chr53886 625 582 1720 ----
NM_013286chr363821 3616 3359 2368 1496 904 1487 ----
NM_013293chr72178 136 ------
NM_013302chr1653384 3238 1576 1176 765 1446 --11417
NM_013309chr1572587 1920 1051 712 638 348 219 ------
NM_013322chr771704 1421 1353 1088 503 216 80 ------
NM_013330chr11186 ------
NM_013341chr282395 1923 1005 995 901 647 408 154 1398 12164 --
NM_013354chr851419 1364 1301 1187 340 ------
NM_013357chr83594 285 277 ------
NM_013372chr1573176 3126 2976 2581 2286 2131 882 12116 1224 --
NM_013374chr383118 3065 2342 2271 886 286 209 83 ----1920
NM_013381chr1272233 1911 1796 1733 823 579 267 ------
NM_013396chr2151582 1073 983 482 367 1595 ----
NM_013402chr1142168 1701 659 352 --22090 1009 198
NM_013411chr142611 817 138 30 22628 2332 --12231
NM_013423chrX1106 187 --1158
NM_013427chrX1106 187 --1158
NM_013433chr1921521 711 21511 401 ----
NM_013434chr221489 764 --11474 11260
NM_013434chr221489 764 --11474 11260
NM_013436chr26818 802 663 522 512 504 1196 ----
NM_013437chr831110 928 913 1461 ----
NM_013438chr961822 1600 1349 1167 375 314 --1581 --
NM_013444chrX3896 885 449 --1340 --
NM_013445chr21142 ------
NM_013448chr142766 60 ----1148
NM_013450chr221043 853 ----1316
NM_013943chr162976 2080 893 761 248 169 --11259 --
NM_013951chr282465 2096 1978 1917 1734 763 433 131 ------
NM_013952chr282542 2173 2055 1994 1811 840 510 208 ------
NM_013953chr282542 2173 2055 1994 1811 840 510 208 ------
NM_013958chr81119 ------
NM_013959chr81119 ------
NM_013961chr81119 ------
NM_013962chr81119 ------
NM_013986chr221103 ------
NM_013989chr1454267 1787 1564 928 260 ------
NM_013992chr282542 2173 2055 1994 1811 840 510 208 ------
NM_013995chrX52528 2306 1035 887 66 32263 979 300 22463 2041 --
NM_013996chr71526 ------
NM_013996chr71526 ------
NM_013997chr71526 ------
NM_013997chr71526 ------
NM_013998chr71526 ------
NM_013998chr71526 ------
NM_014000chr1091787 1776 1235 349 319 308 230 180 164 11563 ----
NM_014007chr951192 1172 1146 1124 1027 1952 ----
NM_014016chr321338 1198 ------
NM_014021chr182763 2613 2447 1065 721 712 304 266 23153 1352 12117 --
NM_014023chr1092944 2890 2064 2002 1105 988 967 909 730 ------
NM_014028chr652849 2180 2111 1267 366 --11159 --
NM_014034chr631452 1027 281 1988 ----
NM_014043chr321511 1338 --1565 --
NM_014044chr22160 144 ------
NM_014048chr16125017 4492 4191 3932 3856 3587 3229 2098 1050 719 690 165 --14322 14837
NM_014055chr121412 ------
NM_014057chr921385 1226 --11110 --
NM_014106chr1532992 2697 528 1364 11890 --
NM_014109chr841170 1137 904 340 ------
NM_014110chr11967 --1196 --
NM_014112chr8115331 4896 4374 3427 2013 1977 1935 1815 1265 1183 95 14580 --1701
NM_014117chr1631770 741 606 ------
NM_014141chr7114512 3581 3380 1956 1923 1750 1705 1473 1349 1110 83 --1425 --
NM_014145chr202943 574 ------
NM_014154chr351252 558 532 276 242 ------
NM_014155chr1186973 4671 4640 2380 1236 1135 779 137 --15071 --
NM_014157chr1642899 1486 231 216 33968 3331 403 ----
NM_014166chr1351082 980 966 108 35 ------
NM_014170chr3186 ------
NM_014181chr211784 2544 324 12854 --
NM_014208chr41295 ------
NM_014211chr531301 451 246 ------
NM_014231chr1241610 172 158 80 144 --1659
NM_014232chr1711502 ------
NM_014232chr1711502 ------
NM_014240chr394203 3945 3919 3780 3707 1589 645 318 168 22687 400 ----
NM_014243chr461604 1552 803 598 482 376 ------
NM_014253chrX32480 1844 1611 ------
NM_014264chr42561 486 ------
NM_014267chr111160 ------
NM_014268chr1851212 1080 996 580 24 ------
NM_014271chrX1711 --1546 1686
NM_014279chr93994 353 86 ------
NM_014283chr121226 466 --11563 1584
NM_014284chr131019 854 817 11092 ----
NM_014292chr2221666 56 ------
NM_014294chr841030 916 420 268 ------
NM_014299chr1912138 --1494 --
NM_014309chr2275432 5400 3856 3612 3511 1332 138 ------
NM_014313chr131622 420 135 ------
NM_014317chr10169 ------
NM_014319chr1221803 254 ------
NM_014322chr121096 962 ------
NM_014325chr1251753 513 302 152 116 --12256 1566
NM_014329chr161319 ------
NM_014331chr4157844 7471 7373 6582 6383 5924 4755 3051 2945 2887 2018 1724 1379 1338 561 14995 16234 22707 533
NM_014333chr112646 182 ------
NM_014344chr11----1222 --
NM_014345chr6----1824 --
NM_014352chr1121388 1002 ------
NM_014372chr11456 11596 ----
NM_014376chr542555 909 839 636 12095 ----
NM_014379chr82955 327 11022 ----
NM_014382chr321427 125 11758 ----
NM_014388chr1155742 5295 5257 4915 4856 4817 4660 3677 1208 875 775 764 577 422 363 25352 327 1792 --
NM_014392chr411159 ------
NM_014393chr821768 1511 1363 31901 783 486 --
NM_014399chr73667 368 97 ------
NM_014405chr1712387 ------
NM_014408chr13615 501 37 1191 ----
NM_014415chr341584 594 143 59 ------
NM_014421chr461907 1894 1578 844 671 531 --1419 --
NM_014423chr595677 4192 4073 3637 3520 3463 714 92 42 34608 1816 886 ----
NM_014426chr203529 242 148 ------
NM_014429chr32708 642 ----1468
NM_014432chr64617 586 377 335 ------
NM_014437chr15826 810 294 266 104 ------
NM_014445chr352313 2279 932 854 455 ------
NM_014447chr411632 ------
NM_014452chr611221 ----1471
NM_014458chr13391 338 84 ------
NM_014472chr101717 ------
NM_014491chr72728 702 ------
NM_014494chr1651777 1655 211 156 55 ------
NM_014495chr13604 208 36 ------
NM_014504chr731871 616 182 161 ----
NM_014507chr2211243 ------
NM_014515chr122840 399 ----167
NM_014522chrX2691 456 ------
NM_014547chr152309 187 ------
NM_014547chr152309 187 ------
NM_014572chr134407 367 267 166 11634 1456 11558
NM_014575chr31463 --1514 --
NM_014584chr1471100 1076 1012 541 208 187 100 ------
NM_014586chr2124238 1843 2612 325 23766 81 --
NM_014588chr204784 707 580 90 ------
NM_014592chr52822 122 ------
NM_014602chr3145 ------
NM_014603chr172661 523 --1441 --
NM_014606chr441169 474 290 124 ------
NM_014607chr221434 496 11344 ----
NM_014612chr911051 ------
NM_014613chr573100 2687 2599 2539 2515 2415 338 --12749 --
NM_014614chr231333 1187 212 ------
NM_014615chr1643110 2960 2937 312 --12978 --
NM_014616chr353395 3367 3231 2856 493 ------
NM_014623chr6133 ------
NM_014629chr851226 917 307 275 206 ------
NM_014630chr1534007 3394 1015 1862 23267 2455 --
NM_014635chr231324 1263 484 ------
NM_014636chr974344 4120 3342 3172 2684 1723 568 1210 ----
NM_014647chr1631544 318 38 --12233 --
NM_014659chr1521167 1024 ----1120
NM_014663chr151079 1052 944 238 80 --2712 48 --
NM_014666chr531339 1228 188 ------
NM_014667chr362260 2106 2008 1859 883 756 --11774 --
NM_014670chr241658 1484 1304 1158 11088 ----
NM_014671chr731591 1304 1286 182 ----
NM_014676chr131573 1511 533 ------
NM_014679chr111979 21103 86 ----
NM_014682chr842186 1881 532 122 1644 --22280 1641
NM_014683chr1711429 ------
NM_014685chr161235 ------
NM_014686chr1952378 1685 838 566 313 1873 ----
NM_014689chr23512 455 424 ------
NM_014690chr763132 2924 1106 977 178 105 11021 ----
NM_014702chr633096 856 572 ------
NM_014705chr752081 1561 604 563 366 11800 11780 --
NM_014706chr1251182 1060 948 490 360 ------
NM_014707chr74680 642 608 451 --21743 918 --
NM_014709chr21546 ------
NM_014711chr1651977 1933 643 571 104 ------
NM_014713chr22553 138 ------
NM_014715chr114667 613 279 91 ------
NM_014717chr192894 834 ------
NM_014720chr1041478 1442 634 273 11698 ----
NM_014721chr6117056 6668 6541 6500 6068 5921 5291 5015 4614 2920 753 12227 22056 561 --
NM_014726chr171985 ----159
NM_014729chr832053 432 117 ----1536
NM_014732chr1675474 5306 4612 2226 2200 2132 1237 11950 11496 --
NM_014733chr562105 2027 1919 409 82 59 ------
NM_014735chrX32136 365 117 1630 1572 --
NM_014739chr663941 3211 1652 1448 953 799 --31400 678 539 13850
NM_014741chr1132140 1567 402 ------
NM_014743chr482557 2545 2264 2221 2006 1243 886 581 12931 ----
NM_014746chr274228 3745 3605 1581 843 666 622 11688 21418 433 --
NM_014747chr143800 2287 1580 1208 --25744 2219 --
NM_014750chr142155 23 ------
NM_014751chr821583 1576 ------
NM_014755chr273362 2976 1575 1472 1380 864 195 12689 ----
NM_014765chr132365 2099 380 22481 2254 ----
NM_014767chr1043658 1266 1001 688 23521 345 11182 --
NM_014772chr1841412 778 684 582 --12427 13451
NM_014774chr142577 1274 673 661 12934 ----
NM_014779chr33978 829 405 --11094 --
NM_014781chr84429 417 410 24 ------
NM_014784chr111100 --191 --
NM_014787chr131961 990 521 11039 1866 --
NM_014795chr251247 1142 971 307 66 ------
NM_014798chr173472 362 322 187 11596 --
NM_014800chr731043 760 123 --11153 --
NM_014802chr1221018 831 --1403 11053
NM_014803chr1052326 2318 1931 900 115 1190 1642 --
NM_014810chr193191 3176 3065 2697 1445 1247 998 501 24 1809 --13581
NM_014812chr171886 1845 1823 1439 1266 718 353 ------
NM_014819chr552505 2253 577 325 181 11695 --1811
NM_014820chr342099 1881 622 70 ----11497
NM_014826chr174339 3929 3774 2751 2650 852 265 23283 3048 2937 796 --
NM_014827chr131689 1623 71 ------
NM_014832chr1341931 493 113 43 ------
NM_014835chr2041576 1420 312 175 11460 21593 871 --
NM_014839chr142311 2223 2145 956 21854 149 ----
NM_014840chr1272941 2803 2684 2499 2264 607 371 1289 ----
NM_014841chr631007 164 112 ----1475
NM_014848chr1562202 2083 1959 536 65 48 ------
NM_014850chr373817 1954 1796 1676 1353 1284 328 --24328 995 --
NM_014853chr1721526 1497 ------
NM_014864chr1103890 3215 3093 3016 2745 1060 812 514 319 197 13472 21632 398 --
NM_014873chr173644 1548 984 655 639 558 230 ------
NM_014877chr17107189 6881 5527 5378 5080 2629 2500 2483 1343 718 14760 11917 --
NM_014883chr431556 792 295 ----1329
NM_014888chr731495 1226 1009 11467 11592 --
NM_014890chr32317 309 ------
NM_014893chrY52043 1515 396 339 238 21864 363 ----
NM_014895chr62299 131 --1692 --
NM_014897chr1753208 2345 2212 861 549 ----2892 269
NM_014900chr22311 66 ------
NM_014901chr5----1595 --
NM_014903chr1242218 801 741 561 ------
NM_014904chr10113733 2647 1582 1482 1380 1370 1243 852 548 430 414 ----13906
NM_014906chr1783933 3510 3492 3271 3256 3233 3189 2981 22885 2706 13461 --
NM_014912chr1062958 2894 2526 2464 1397 775 --2727 452 1974
NM_014913chr1831472 1370 376 ------
NM_014914chr2----21270 424 --
NM_014917chr15979 952 625 339 63 ------
NM_014918chr1531292 345 199 --2384 317 --
NM_014920chr653557 3109 2367 2340 858 --1112 --
NM_014923chr1362294 2022 1583 1455 737 98 1912 ----
NM_014924chr1472902 1137 600 384 154 70 59 --12713 --
NM_014926chr341017 907 822 86 1210 ----
NM_014927chrX----187 --
NM_014932chr311459 1240 ----
NM_014933chr4--1147 ----
NM_014934chr1383988 3932 3724 3201 2600 2588 1226 950 32607 1358 716 ----
NM_014935chr193391 3345 2767 2652 1509 473 438 121 58 --1356 --
NM_014937chr1031254 531 231 --1867 --
NM_014939chr1841488 1333 172 122 11345 1180 11555
NM_014942chr612547 ----11885
NM_014947chr122712 601 21250 792 ----
NM_014951chr1052253 1784 1769 1754 883 --21643 87 --
NM_014961chr41560 --1821 --
NM_014962chr2052739 2624 1961 1760 1011 --1587 12149
NM_014969chr131001 913 272 --1787 --
NM_014978chr1021716 1703 21487 714 1368 --
NM_014982chr14105420 4829 4661 4178 3676 1886 1860 1697 604 236 ------
NM_014988chr4102505 2227 2197 2062 2007 1926 954 718 569 535 --1379 12853
NM_014989chr621771 1304 --12022 --
NM_014990chr1431117 1087 299 ------
NM_014991chr432684 2126 1001 12479 32774 2281 237 --
NM_014992chr144788 749 350 323 ------
NM_014999chr1241524 1497 1385 141 ------
NM_015000chr1253085 1977 705 480 399 1737 2672 90 13116
NM_015001chr12702 405 ----1944
NM_015002chr1241436 370 309 279 1782 ----
NM_015008chr373647 3562 3538 3411 3320 683 457 12984 12831 1794
NM_015009chr31582 ------
NM_015017chr11203 --173 --
NM_015020chr1683593 2922 1540 1523 1511 1284 919 879 ----11367
NM_015024chr81350 31305 1038 174 11120 --
NM_015025chr242601 1779 998 760 ----11878
NM_015026chr1284697 4130 3966 2996 1279 966 826 244 --1447 13612
NM_015027chr1631640 1356 695 --3397 376 267 --
NM_015032chr1362611 2535 2464 2402 2081 190 ------
NM_015035chr2086414 5512 5299 4166 1949 1600 808 366 1982 --12036
NM_015039chr164026 3751 2679 1147 1060 330 ----1623
NM_015040chr233168 2520 2259 1756 1918 --
NM_015042chr1574203 4065 1703 1378 1330 748 414 23940 3539 --1637
NM_015045chr1062093 1915 1784 1621 835 438 1810 --1104
NM_015049chr243230 2498 306 245 ------
NM_015051chr943039 1029 598 434 ----12462
NM_015055chr1162987 2858 937 788 530 123 --12845 --
NM_015057chr132631 480 ------
NM_015059chr1543462 1106 527 316 11348 ----
NM_015061chr91275 --1730 --
NM_015068chr741222 1168 375 196 ------
NM_015069chr16172 ------
NM_015071chr5105662 4711 4003 2504 2300 1711 1165 806 542 454 35852 1764 294 16114 --
NM_015074chr174932 4087 3115 1697 1317 1107 136 23691 1523 ----
NM_015076chr654136 4100 841 464 269 11738 ----
NM_015079chr1543237 2629 2618 2161 --22306 1053 --
NM_015090chr196253 5984 5749 3869 2197 1898 1810 1512 1173 34754 2235 327 ----
NM_015091chr143690 630 623 ------
NM_015092chr1654255 3120 1760 1546 941 21190 178 23260 479 --
NM_015093chr621323 402 ------
NM_015097chr321625 389 12053 ----
NM_015100chr131423 468 151 --1559 --
NM_015115chr463149 2492 2208 2101 2008 449 13105 22609 755 --
NM_015122chr19----1224 --
NM_015124chr2252447 2122 886 827 612 ------
NM_015130chr421262 198 ----11411
NM_015132chr751997 1368 1310 228 81 ------
NM_015137chr852508 2499 2466 2357 1828 ------
NM_015138chr1522518 2069 --1422 --
NM_015141chr372787 1916 1742 765 721 703 473 --11972 --
NM_015143chr44452 337 256 196 ------
NM_015144chr1663586 2874 2828 1380 671 470 --23533 1343 23527 2786
NM_015155chr1041209 1170 746 56 --1859 12183
NM_015156chr1463945 1290 1149 1092 683 220 23892 1410 123 --
NM_015170chr852272 1796 425 395 357 --1876 --
NM_015173chr431779 1693 631 ------
NM_015176chr131209 415 150 11334 ----
NM_015191chr1132596 847 275 2707 303 ----
NM_015192chr2062353 2323 2158 725 517 411 21947 763 12711 --
NM_015194chr1751894 1641 1345 809 38 ----11614
NM_015197chr1463454 2397 1294 965 490 69 12165 12614 --
NM_015198chr711080 1308 --1302
NM_015199chr392481 2275 1138 753 509 345 319 295 287 12921 12101 --
NM_015200chr432284 399 120 --1292 --
NM_015203chr1143 ------
NM_015205chr1375130 5068 4999 1545 378 318 77 23539 3502 ----
NM_015206chr1583748 2808 2360 1197 1108 946 206 161 --1603 --
NM_015208chr1854051 3836 1530 141 66 ----187
NM_015209chr132255 2048 455 11467 11885 --
NM_015213chr111194 1114 ----
NM_015225chr952995 2864 2599 1262 263 12493 12608 12570
NM_015231chr11--1289 --1119
NM_015234chr661441 1277 1251 564 504 381 ------
NM_015239chr91525 ------
NM_015245chr652355 1839 1828 987 797 --32636 315 203 --
NM_015247chr1634347 580 197 23611 3392 25272 4301 15104
NM_015252chr26939 896 794 369 96 32 --1320 --
NM_015262chr102173 102 ------
NM_015263chr152786 270 ------
NM_015265chr262262 1802 1782 723 256 242 1812 ----
NM_015269chr1--197 --1580
NM_015271chr4144173 4086 4073 4030 3830 3528 3493 3321 3254 3164 2834 2704 1676 1262 22820 306 23138 1221 --
NM_015272chr162387 299 ----11328
NM_015275chr1272179 2070 1956 1950 1706 1323 646 ----1691
NM_015278chr693274 3206 2837 2614 2447 1251 1114 774 236 1472 ----
NM_015285chr1842282 421 346 334 1671 1292 --
NM_015286chr1551560 859 669 426 353 1915 1238 --
NM_015288chr563866 3292 3173 1256 538 450 1896 13410 --
NM_015291chr163397 2918 2889 2727 2351 1049 13188 ----
NM_015292chr121806 ------
NM_015294chr17--2895 270 ----
NM_015296chr132942 372 --11223 1877
NM_015299chr1483615 3464 2847 1619 1357 1115 1073 780 --24053 890 --
NM_015310chr8147767 6808 6750 6730 6530 5741 5319 5099 3137 2837 2274 1243 1002 558 --12247 37492 480 382
NM_015313chr1154649 4525 4445 3646 1341 ------
NM_015314chr751803 1592 571 315 247 --11994 --
NM_015315chr573364 3340 3274 2529 2147 1311 460 --13497 --
NM_015317chr272836 2524 2439 1827 1049 742 617 12481 22112 2083 --
NM_015321chr1954855 4782 4124 4031 559 --1979 --
NM_015323chr661290 1120 633 584 504 235 --1451 --
NM_015326chr152757 2670 2088 2060 2023 --12132 --
NM_015328chr762748 2424 2199 2064 859 356 11130 23032 634 --
NM_015332chr743193 3048 1395 222 ------
NM_015335chr1242659 878 191 73 ------
NM_015336chr1262702 2427 2181 682 491 74 1259 1150 --
NM_015338chr2031930 1896 24 11878 2114 97 --
NM_015339chr201292 ------
NM_015344chr81730 2530 223 1325 11481
NM_015345chr642800 1022 947 477 12337 ----
NM_015347chr1272862 970 941 790 622 480 280 --1472 1799
NM_015349chr653000 1040 314 180 70 --12329 12556
NM_015355chr1751966 1360 765 609 32 --1215 --
NM_015358chr212949 852 --1469 11113
NM_015361chr23690 604 87 1654 ----
NM_015365chrX54286 2925 2868 822 774 ------
NM_015367chr2211584 1179 199 --
NM_015375chr1164831 4640 4543 4506 4362 3961 3925 3892 3679 3130 3103 1980 937 725 348 98 1862 ----
NM_015378chr132922 2205 847 ------
NM_015381chr221471 --11300 --
NM_015382chr144734 216 102 43 1686 ----
NM_015384chr5161 ------
NM_015386chr162313 34 ------
NM_015387chr262132 2089 1533 564 152 42 1196 ----
NM_015393chr433405 3106 359 31496 1304 1137 32844 2578 1378 --
NM_015396chr31168 ----11300
NM_015397chr951921 1415 611 289 251 ------
NM_015409chr1262692 2418 1982 852 104 59 1774 --12164
NM_015415chr11212 ------
NM_015423chr1141778 1555 628 296 --11210 --
NM_015429chr341099 224 128 58 ------
NM_015435chr881483 1371 1158 568 466 457 325 265 1970 ----
NM_015436chr493146 2709 2646 2069 1136 1045 879 708 326 1281 12461 --
NM_015443chr1741176 983 964 210 ------
NM_015446chr131697 1505 358 ------
NM_015454chr44258 191 81 28 ------
NM_015455chr5103047 1204 1159 1031 1021 968 918 836 623 345 ----23985 1637
NM_015458chr8105096 4652 4527 4150 3938 3897 1473 978 681 147 --23562 416 --
NM_015461chr181107 ------
NM_015464chr72994 918 ------
NM_015475chr221041 980 ------
NM_015477chr152932 366 164 ----
NM_015483chr741093 763 451 271 ------
NM_015493chr1952096 1679 742 297 100 22215 1420 ----
NM_015508chr331356 263 248 11378 ----
NM_015509chr1231514 1476 1307 1145 ----
NM_015520chr372764 2691 2628 2516 829 715 526 --1318 --
NM_015526chr192385 163 1451 1338 --
NM_015530chr23717 623 389 ----1378
NM_015534chr121030 777 1110 1195 --
NM_015535chr294168 3609 3058 3022 2887 2746 1689 746 616 11629 13244 --
NM_015542chr1011196 ------
NM_015553chr664937 4771 4031 3247 1137 645 11627 33898 1718 373 11923
NM_015559chr181308 1855 1404 --
NM_015564chr563401 3348 2810 1111 974 214 --21153 545 --
NM_015567chr131192 --11336 --
NM_015568chr2022915 688 ----14038
NM_015569chr1104869 4099 4068 3824 3727 3197 1392 1111 869 407 11521 ----
NM_015570chr721316 502 ------
NM_015571chr612165 12053 --11904
NM_015575chr233072 1258 622 --12254 174
NM_015576chr352442 2351 2022 1110 359 ------
NM_015578chr1982117 1727 793 694 640 569 117 58 --11938 11383
NM_015595chr31214 145 1121 --
NM_015601chr101763 ------
NM_015602chr121835 53 ------
NM_015609chr121862 623 ------
NM_015610chr752864 2084 1754 161 40 12501 ----
NM_015626chr173918 405 386 145 ----
NM_015635chr912233 1481 ----
NM_015640chr174206 3704 1812 1505 1141 514 272 --14558 --
NM_015641chr731131 938 362 1314 ----
NM_015646chr122273 165 ------
NM_015657chr22805 73 1219 1860 --
NM_015676chr141356 ------
NM_015678chr1341446 1195 1092 112 11310 ----
NM_015686chrX41847 1828 934 415 ------
NM_015691chrX52686 1145 933 487 380 1546 ----
NM_015695chr651630 1533 1443 456 395 --11834 --
NM_015713chr842350 2254 1448 423 --2921 496 --
NM_015726chr131827 1295 563 184 ----
NM_015833chr2132192 2111 1962 --22019 1527 --
NM_015866chr131355 1295 70 1424 --21486 140
NM_015874chr41563 1523 ----
NM_015878chr8----160 --
NM_015879chr18148426 7621 5866 3427 2975 2805 2150 2029 1868 1685 1415 1204 1196 857 26438 2826 38210 6135 5745 --
NM_015888chr1113278 2723 2555 2228 2095 1339 1095 563 376 361 254 --13085 --
NM_015891chr631778 1416 1337 2741 265 ----
NM_015892chr1021988 419 1519 2924 533 --
NM_015902chr84666 185 176 139 ------
NM_015906chr183817 3681 3432 1936 1015 635 355 180 23449 1113 1742 --
NM_015912chr852421 869 796 636 281 ------
NM_015915chr141108 ----177
NM_015932chr134765 654 180 79 ------
NM_015948chr6------1447
NM_015955chr2243 35 ------
NM_015975chrX51206 1183 454 369 265 ------
NM_015990chr421114 236 ------
NM_015994chr142253 37 ------
NM_015995chr15104660 4321 4137 3886 3570 1861 1070 756 719 324 14848 21182 622 --
NM_016003chr752864 2084 1754 161 40 12501 ----
NM_016004chr201191 ----1146
NM_016018chr832047 1012 390 11068 --22785 2173
NM_016021chr672840 2566 1159 1149 1121 566 295 1158 2532 50 --
NM_016022chr1190 ------
NM_016023chr831675 1623 288 ------
NM_016025chr1651520 677 400 256 144 11311 ----
NM_016039chr14155 ------
NM_016040chr152618 2399 2155 630 26 1678 11820 --
NM_016045chr2021526 406 ------
NM_016057chr1231314 1200 332 ----11082
NM_016072chr1252352 2246 2156 2088 684 ------
NM_016073chr151375 ----1355
NM_016075chr1363210 2657 2449 1218 983 862 12651 12348 --
NM_016076chr133233 3205 1163 32818 901 23 ----
NM_016081chr471704 823 480 234 178 171 105 ------
NM_016083chr6113761 3658 3257 3026 2652 2615 2506 1490 1241 1180 638 12672 13387 --
NM_016089chr3101924 1736 1502 1334 809 712 699 557 389 292 4642 222 138 54 ----
NM_016096chr832025 1810 862 ----1128
NM_016097chr1811107 ------
NM_016101chr1651430 1225 910 324 225 --1100 --
NM_016106chr142200 178 ------
NM_016120chrX2468 272 ------
NM_016123chr1241310 1097 473 401 1376 1316 1183
NM_016124chr121489 1275 ----188
NM_016127chr82188 24 ------
NM_016131chr242064 1828 871 291 ----1468
NM_016132chr1572665 2405 2376 1069 959 922 546 --124 --
NM_016144chr52173 32 --1231 --
NM_016152chr331152 158 72 1401 2847 27 1268
NM_016156chr1162286 1862 390 347 245 37 ------
NM_016166chr15----1225 --
NM_016185chr171111 1241 1317 --
NM_016192chr2------1280
NM_016201chr342019 1674 1460 227 22244 119 ----
NM_016205chr411274 11091 1496 --
NM_016206chr3108759 8573 8342 6788 6258 5818 3533 1809 1430 517 17099 18233 18397
NM_016211chr4--1147 ----
NM_016216chr32874 687 --1611 1583
NM_016217chr643701 3615 2630 1369 --175 --
NM_016218chr53410 369 311 ------
NM_016221chr572154 1592 1578 1475 1453 937 608 --11909 11567
NM_016224chr621687 557 --11701 --
NM_016226chr12168 ------
NM_016227chr121226 466 --11563 1584
NM_016230chr62488 76 ------
NM_016231chr1761726 1677 1628 1495 1290 1070 ------
NM_016235chr1621368 162 ------
NM_016248chr13103642 3576 3346 3016 2550 1490 607 582 305 195 13328 ----
NM_016252chr23904 850 694 1616 ----
NM_016255chr653366 2679 2607 2466 426 --12302 12783
NM_016257chr183384 3071 2983 2849 2836 2801 849 94 12169 1965 12488
NM_016260chr2187473 7224 6835 6627 6566 6091 5957 5892 5084 5034 2278 1929 1919 1857 1716 1437 692 58 15790 26384 6252 16648
NM_016262chr63207 67 22 1553 ----
NM_016264chr193556 544 142 144 ----
NM_016271chr1842250 2061 1492 539 ------
NM_016275chr3112628 2510 2504 2049 1872 1064 858 794 464 294 221 32079 1912 204 ----
NM_016281chr1241122 1031 937 79 1740 ----
NM_016289chr272097 941 910 864 752 90 68 ----12019
NM_016298chr383380 2835 2770 2450 1008 768 734 399 ------
NM_016299chr10146 ------
NM_016300chr3------1106
NM_016308chr141886 1284 726 341 ------
NM_016315chr241812 715 649 487 ------
NM_016316chr21605 ------
NM_016322chr962484 2189 918 689 292 151 12417 ----
NM_016334chr11139 --1427 1219
NM_016338chr5------11090
NM_016339chr1761681 1586 1415 640 210 56 150 ----
NM_016340chr531210 1105 952 ------
NM_016351chr71630 ------
NM_016357chr1261243 957 943 405 190 182 --11211 --
NM_016374chr13380 97 22 11373 ----
NM_016374chr13380 97 22 11373 ----
NM_016376chr1774018 3819 3538 3253 3195 1567 307 22710 1385 13153 --
NM_016395chr1591959 1785 1659 1534 1394 1342 729 711 529 --31627 1572 144 --
NM_016396chr1552783 2204 1891 1115 70 ------
NM_016410chr9--1634 ----
NM_016422chr11103208 3028 2688 2072 1276 1187 978 816 437 314 12511 1294 --
NM_016424chr1721570 186 11356 11473 --
NM_016436chr2072601 2394 2181 2112 2089 990 180 ------
NM_016441chr262420 2167 1817 1675 767 670 ------
NM_016442chr562191 2125 2001 1945 799 30 --11557 11718
NM_016472chr143410 377 309 1228 ----
NM_016480chr51185 1104 ----
NM_016486chr11488 ------
NM_016507chr1723086 220 --1590 --
NM_016513chr653557 3109 2367 2340 858 --1112 --
NM_016516chr24879 732 690 232 ------
NM_016519chr4------183
NM_016521chrX138 ------
NM_016522chr111162 --1365 --
NM_016526chr1112503 --1262 --
NM_016529chr1331241 400 292 --1979 --
NM_016530chr1593846 3417 3263 2882 2842 2535 1336 791 351 ----13364
NM_016531chr4114153 4067 3861 3581 3467 3352 3346 1228 936 788 406 1838 22886 222 --
NM_016542chrX41739 655 210 116 ------
NM_016559chr341363 1225 1068 383 --21154 271 --
NM_016569chr1241150 1104 1091 267 ------
NM_016577chr354244 4021 3723 547 32 ----13345
NM_016578chr11--1591 --1446
NM_016587chr741105 767 236 173 ------
NM_016588chr6--139 --1120
NM_016591chr551194 907 846 261 81 --1455 1244
NM_016604chr561245 931 520 507 295 162 ----155
NM_016613chr482543 2360 1987 490 399 345 305 161 --12340 --
NM_016614chr62185 153 ------
NM_016617chr1372079 2060 1418 737 709 328 157 ------
NM_016620chr151316 1097 902 151 94 ------
NM_016621chr11104619 3822 3096 3088 2978 2956 2844 1329 665 55 22964 2887 ----
NM_016622chr232127 1315 129 1839 ----
NM_016623chr82494 191 ------
NM_016626chr1861708 1596 1121 415 168 23 ------
NM_016628chr10166 ------
NM_016631chr212130 118 ------
NM_016648chr44258 191 81 28 ------
NM_016651chr1421035 94 1797 ----
NM_016653chr23885 450 248 --2931 112 --
NM_016654chr1531165 897 503 ------
NM_016819chr32553 150 ------
NM_016820chr3168 ------
NM_016948chr161107 ------
NM_017412chr82897 191 --1366 --
NM_017415chr574519 4319 4007 3464 3300 2844 839 13665 14477 --
NM_017420chr1473839 3711 2930 1336 1043 870 74 13589 197 --
NM_017423chr471928 1720 1372 631 462 369 169 1328 ----
NM_017425chr111213 --1112 --
NM_017437chr1451813 945 823 343 157 ------
NM_017440chr12134 ------
NM_017444chr851863 1831 1345 753 77 11250 1649 --
NM_017447chr2193829 3773 3629 3431 2828 1578 984 288 166 --11476 --
NM_017451chr1711042 ------
NM_017452chr2031352 997 54 ------
NM_017453chr2031352 997 54 ------
NM_017454chr2031352 997 54 ------
NM_017455chr1531038 875 379 1766 ----
NM_017488chr241549 616 564 453 --11322 --
NM_017491chr41408 --2987 287 --
NM_017516chr113364 122 65 ------
NM_017522chr151272 1042 931 228 54 --1471 --
NM_017548chr312185 1353 1558 --
NM_017563chr356251 5938 5481 5135 2057 24864 1471 15111 --
NM_017577chr351220 477 149 134 94 ------
NM_017588chr921943 217 11709 ----
NM_017590chr2242578 1774 1677 503 ------
NM_017594chr962051 1029 1010 492 476 108 1228 ----
NM_017599chr1252044 1459 660 362 356 ------
NM_017610chr1542035 789 552 481 ------
NM_017628chr464983 4133 3604 2012 1672 422 11765 11119 --
NM_017629chr151787 1608 1466 732 153 ------
NM_017632chr41130 ------
NM_017633chr673370 2644 2476 1518 1138 981 964 12406 11364 --
NM_017634chr82122 96 ----2739 208
NM_017637chr9119217 7337 6098 5974 3175 3089 2688 2587 2367 1135 182 12785 21504 1094 27003 1303
NM_017640chr62846 820 --1263 --
NM_017641chr1241100 726 284 242 --145 --
NM_017643chr1732730 697 312 --11157 --
NM_017644chr3135107 4874 4337 4305 3331 1933 1741 1650 1487 1308 1298 1000 572 ----24401 3199
NM_017645chr973173 2825 955 727 689 676 101 --1459 --
NM_017650chr7166095 5928 5574 5485 5362 4349 4205 2427 2158 2001 1993 1888 1801 1094 835 171 --1944 --
NM_017657chr21223 ------
NM_017658chr1484272 3962 3421 3086 1720 1231 1153 560 11474 12917 13828
NM_017661chr1521156 126 --11265 --
NM_017664chr1361096 1048 942 664 278 264 ------
NM_017666chrX31919 291 118 11610 ----
NM_017700chr42518 54 ------
NM_017709chr152710 1000 288 266 224 23512 1512 ----
NM_017712chr1975913 5042 4610 2322 1479 999 786 --16357 --
NM_017714chr202809 368 ------
NM_017719chr362516 1864 1585 412 293 181 1225 ----
NM_017730chr32658 603 ------
NM_017736chr1652487 1952 984 507 402 12098 ----
NM_017742chr1851834 1443 435 355 293 132 ----
NM_017745chrX3621 268 91 ------
NM_017749chr111955 ------
NM_017752chrX52011 1974 1917 1770 178 --142 11521
NM_017762chr1541930 1639 62 22 1167 ----
NM_017768chr12957 69 ----1831
NM_017779chr151969 842 478 216 28 --11930 --
NM_017784chr351211 1164 947 280 165 2379 287 ----
NM_017811chr942477 2395 983 762 ------
NM_017812chr72218 54 ----1720
NM_017824chr1042722 2356 2290 137 --12001 1520
NM_017826chr133278 223 25 1151 --1804
NM_017831chr1894646 3755 3556 1691 1098 867 785 628 567 21494 416 21175 310 14242
NM_017845chr44776 674 642 66 --2565 159 --
NM_017847chr162284 1957 1671 1426 95 40 1792 ----
NM_017848chrX64667 4172 3102 1630 1180 632 1385 ----
NM_017849chr232863 2062 1052 1245 ----
NM_017856chrX2674 52 11671 --12168
NM_017893chr1021369 977 2984 477 --1297
NM_017902chr1085753 4840 3694 3593 3586 1950 1083 171 12050 ----
NM_017915chr123412 240 155 --11039 --
NM_017919chr9125602 4364 3975 2196 2125 1727 1410 1319 1179 961 910 67 35578 4403 1258 25713 4727 --
NM_017923chr41321 ------
NM_017925chr941878 1706 1376 452 ----21887 64
NM_017926chr143872 272 95 ------
NM_017938chrX52099 1988 1486 688 214 11453 --21895 1703
NM_017943chr141384 1319 11015 --
NM_017944chr1143103 1088 602 117 12541 ----
NM_017969chr22187 81 ------
NM_017972chr143872 272 95 ------
NM_017974chr23957 262 202 ------
NM_017994chr742344 2272 630 406 ----12360
NM_018010chr341632 1436 1037 525 1122 ----
NM_018015chrX2820 749 --1170 --
NM_018017chr1072674 2189 2152 1030 800 463 283 --11993 1396
NM_018018chr1241384 674 376 52 11328 ----
NM_018027chr1082713 2264 2109 1248 753 539 275 218 ----13307
NM_018028chr1951247 1059 542 405 156 ------
NM_018030chr182253 227 2966 841 --1117
NM_018036chr1464388 3696 3202 2890 2712 517 --54464 3333 1698 1102 330 --
NM_018043chr1131401 1267 994 11501 11044 --
NM_018045chr122118 48 --1200 1557
NM_018046chr531873 1643 770 ------
NM_018048chr1231998 1428 695 ------
NM_018056chr11186 ------
NM_018061chr151703 1356 1254 1150 92 31658 679 561 1511 --
NM_018072chr1124 143 ----
NM_018078chr441072 922 364 92 ------
NM_018079chr21217 --2579 135 --
NM_018084chr273260 3127 2223 2036 1069 702 206 22853 1188 --13305
NM_018086chr231864 677 435 ----1254
NM_018094chrX----1408 --
NM_018098chr34434 337 121 89 150 ----
NM_018105chr821064 89 ------
NM_018110chr1631104 468 258 --21407 912 --
NM_018120chr821460 481 ----1572
NM_018121chr1042021 1017 918 757 ----1709
NM_018126chr421354 1249 11332 1457 --
NM_018128chr1741418 1106 294 260 --11170 --
NM_018131chr105688 272 254 119 40 ------
NM_018133chr31284 ------
NM_018137chr141384 1178 1171 272 1944 ----
NM_018144chr10172 --2328 44 1320
NM_018151chr23825 807 119 ------
NM_018155chr311229 13480 23068 234 --
NM_018156chr132922 2205 847 ------
NM_018157chr1262696 1319 1256 699 574 83 11189 ----
NM_018159chrX51375 329 142 88 41 --1406 --
NM_018169chr122554 529 ------
NM_018172chr1191361 1152 594 542 490 438 386 334 315 ------
NM_018178chr131697 250 198 ------
NM_018181chr1861759 1422 563 509 484 228 ------
NM_018184chr351887 1540 1395 414 408 ----11431
NM_018195chr1142028 1485 1321 413 12112 ----
NM_018214chr631142 944 833 1958 ----
NM_018223chr123987 394 32 ------
NM_018227chr472605 2584 1133 1097 187 167 90 --1704 13029
NM_018243chr494102 3647 2605 1512 1419 923 762 571 471 ------
NM_018244chr2021129 268 --1840 --
NM_018246chr832802 2699 938 --21915 370 --
NM_018247chr662674 2555 1918 1053 474 218 --12066 2915 886
NM_018263chr252412 1766 1676 1003 274 --12474 22447 878
NM_018266chr32985 686 1722 ----
NM_018287chr1051088 1015 852 389 249 ------
NM_018293chr372692 2606 2550 1148 831 726 53 11178 ----
NM_018299chr882695 1023 968 931 883 658 481 55 --12398 --
NM_018307chr17251 38 ------
NM_018310chr8121 --2580 51 --
NM_018312chr1131442 745 297 1102 11536 --
NM_018315chr441400 1059 632 45 ------
NM_018321chr5166 ------
NM_018325chr941634 1488 422 91 ------
NM_018327chr2031323 744 256 --11304 --
NM_018328chr21407 ------
NM_018330chr1031644 400 300 ------
NM_018332chr1621215 242 11386 11330 --
NM_018348chr1671245 979 899 887 494 233 110 ------
NM_018351chr1284652 4021 3322 3274 1519 1196 291 94 14297 ----
NM_018362chr11104000 3102 2570 1544 1294 977 828 663 324 180 --11404 --
NM_018364chr193752 3727 3310 1575 1048 964 768 581 129 13208 ----
NM_018367chr1142501 1619 884 222 12209 11608 1452
NM_018368chr6175 ------
NM_018370chr1281927 1800 1593 1546 541 532 467 199 ----12229
NM_018371chr8129 ----11492
NM_018372chr13564 544 525 ----1538
NM_018373chr1495742 4463 4236 4221 1996 1809 1529 1312 758 --45836 2594 2067 24 35326 5106 4359
NM_018374chr794219 4080 3495 3394 1612 728 708 115 54 25080 1517 --23174 589
NM_018375chr141780 2590 327 ----
NM_018383chr22595 564 ------
NM_018394chr32488 375 11430 ----
NM_018403chr384002 3988 3643 2994 2908 1297 155 82 --1860 --
NM_018409chr463209 3008 2960 2550 2178 322 ------
NM_018416chr1232318 1758 504 ------
NM_018423chr12------124
NM_018424chr91526 1557 ----
NM_018429chr572095 963 773 627 379 168 125 --12137 12686
NM_018439chr1862650 1805 957 862 131 50 --1767 --
NM_018440chr8198406 7945 7933 7529 7494 6915 6386 6380 6170 5879 5858 5453 3252 2695 2607 2149 1249 1163 1049 25308 335 ----
NM_018442chr13348 140 22 ------
NM_018444chr85654 597 258 123 84 ------
NM_018445chr153557 503 201 ------
NM_018448chr123980 958 244 ------
NM_018452chr6_random63278 2656 2596 1197 1007 728 12714 ----
NM_018453chr142237 32 ------
NM_018460chr21159 ------
NM_018462chr31239 1275 ----
NM_018465chr9------1163
NM_018469chr1741533 1273 434 81 ------
NM_018475chr43642 109 94 ------
NM_018482chr832514 409 245 ------
NM_018489chr182319 2155 1942 1936 1868 1649 959 584 11684 ----
NM_018553chr1731469 307 42 ------
NM_018557chr221713 1566 ------
NM_018566chr1144291 3499 3223 1963 1826 1645 1605 1543 1202 1142 989 865 267 139 1581 23933 3650 --
NM_018569chr4--11639 11080 --
NM_018571chr22493 38 --1599 --
NM_018590chr103377 201 43 ------
NM_018638chr1275251 4603 4137 4114 3589 1861 1547 21147 561 34501 1893 419 11125
NM_018640chr1282211 1979 1013 691 536 527 42 36 ------
NM_018650chr141749 1448 1384 371 12101 ----
NM_018660chr82762 173 12646 --1144
NM_018682chr72703 539 --1218 --
NM_018685chr731068 1015 831 158 ----
NM_018689chr1512631 --12544 1235
NM_018695chr542091 2056 1715 1651 ------
NM_018700chr551507 1173 592 309 223 11599 --1666
NM_018704chr141981 646 500 32 --11656 1324
NM_018710chr831318 536 270 ------
NM_018715chr172301 2087 822 757 486 334 229 ------
NM_018718chr721542 367 32074 1793 637 22252 2220 --
NM_018719chr761190 1036 561 554 545 320 1891 11410 11404
NM_018834chr53760 350 80 --1411 --
NM_018840chr201323 ------
NM_018841chr173801 3315 2770 1332 1255 1074 757 1485 ----
NM_018847chr931282 385 47 ------
NM_018890chr761241 1224 536 428 363 222 1114 ----
NM_018912chr521743 106 ------
NM_018913chr521743 106 ------
NM_018914chr521743 106 ------
NM_018915chr521743 106 ------
NM_018916chr521743 106 ------
NM_018917chr521743 106 ------
NM_018918chr521743 106 ------
NM_018919chr521743 106 ------
NM_018920chr521743 106 ------
NM_018921chr521743 106 ------
NM_018922chr521743 106 ------
NM_018923chr521743 106 ------
NM_018924chr521743 106 ------
NM_018925chr521743 106 ------
NM_018926chr521743 106 ------
NM_018927chr521743 106 ------
NM_018928chr521743 106 ------
NM_018929chr521743 106 ------
NM_018940chr51983 --1423 --
NM_018945chr673019 2808 2770 2380 1107 883 809 ------
NM_018947chr794913 4898 4868 4375 4163 4071 3353 3246 367 13567 23738 1048 --
NM_018948chr111474 --11045 --
NM_018958chr1573226 2776 2723 2682 1051 987 581 --23642 1127 1344
NM_018970chr752152 858 759 528 430 11176 1128 12647
NM_018976chr1272575 2327 1878 1062 618 453 429 --1473 --
NM_018979chr1262409 1753 869 787 681 144 1267 11656 --
NM_018993chr2031482 955 584 --11059 1318
NM_018999chr1084291 4280 4150 3845 3657 3032 1703 169 ------
NM_019000chr52527 171 --11465 --
NM_019001chr334504 1556 298 ------
NM_019004chr782420 2329 1818 1702 883 341 328 285 --11492 --
NM_019006chr151160 ------
NM_019022chr1842768 2333 830 711 1589 22976 213 --
NM_019027chr4102585 2507 2316 684 650 627 484 412 349 52 --11900 --
NM_019028chr11--1435 ----
NM_019035chr441921 1745 1634 141 ------
NM_019036chr63357 336 325 ----155
NM_019042chr72322 232 ------
NM_019045chrX2209 199 --1967 --
NM_019049chr13731 616 121 1655 ----
NM_019050chr472224 1884 1772 1640 1488 826 531 --22068 1456 --
NM_019053chr101184 ------
NM_019057chr52384 277 ------
NM_019058chr102783 600 1765 ----
NM_019063chr282089 2064 1899 1624 1565 381 285 216 --1794 21671 748
NM_019072chr563308 3009 1019 952 605 256 ----13247
NM_019084chr1072487 2411 2338 2282 2176 2069 945 31933 1927 933 12142 21767 745
NM_019087chr531665 1324 289 --11569 --
NM_019106chr2213449 13398 ----
NM_019114chr91950 --1980 1486
NM_019116chr1642337 725 627 417 --22508 289 --
NM_019556chrX2277 176 ------
NM_019590chr1041279 929 531 134 1218 ----
NM_019594chr921466 397 11279 ----
NM_019595chr21596 ------
NM_019596chr2182399 1840 1051 715 675 668 458 319 --1110 --
NM_019597chrX4657 608 545 286 ----1296
NM_019610chr151811 1734 1706 1392 665 ------
NM_019852chr141104 ------
NM_019854chr12196 --1689 --
NM_019859chr101339 ------
NM_019862chr1631745 677 484 1605 11413 --
NM_019891chr14845 502 356 82 169 ----
NM_019895chr331047 995 53 2160 142 ----
NM_019898chr1631745 677 484 1605 11413 --
NM_019899chr1631745 677 484 1605 11413 --
NM_019900chr1631745 677 484 1605 11413 --
NM_020039chr1241680 1382 338 102 --11265 --
NM_020066chr12945 311 --1361 --
NM_020122chr2135778 5237 4941 4734 4319 3892 3794 3739 2165 2119 914 609 482 2272 128 25608 264 --
NM_020123chr1011083 21222 1194 ----
NM_020135chr62396 111 ------
NM_020141chr131659 831 169 ------
NM_020143chr241080 447 377 51 1173 ----
NM_020144chr752098 1941 1464 1412 292 --11333 --
NM_020148chr1872599 2223 2022 1069 514 465 58 11919 ----
NM_020156chr73615 80 40 --1113 --
NM_020159chr421512 94 153 --1175
NM_020177chr593108 2681 2610 2549 2490 607 155 66 23 ----33366 1002 227
NM_020178chr172260 211 1191 ----
NM_020182chr2033628 3611 1444 --152 --
NM_020190chr11458 ------
NM_020192chr73153 132 42 ------
NM_020193chr112517 88 1917 ----
NM_020194chr24556 451 443 26 --1458 --
NM_020198chr1731075 525 466 ------
NM_020200chr1041002 872 375 267 1977 1229 --
NM_020204chr13756 709 698 ------
NM_020205chr153131 2391 2315 1202 1055 --12641 --
NM_020208chr323351 3212 12626 --12348
NM_020214chr151181 ------
NM_020226chr4--2238 125 ----
NM_020228chr1132496 2426 2217 22509 2082 11009 --
NM_020235chr3124 ------
NM_020239chr132005 1530 795 ------
NM_020240chr562520 2471 2061 784 498 269 1848 --22291 1775
NM_020307chr35382 371 329 135 79 ------
NM_020310chr1752780 2762 2137 323 83 ------
NM_020336chr2083490 3138 2767 2608 2348 1129 975 207 12776 ----
NM_020337chr493189 3160 2848 2786 2541 2390 2201 1189 242 --12553 --
NM_020338chr10103715 3703 3214 2901 2277 1330 1297 496 63 33 1643 ----
NM_020340chr632282 2065 346 --21645 575 1432
NM_020341chr2072022 1911 1868 606 520 398 349 ------
NM_020342chr242395 1980 713 289 --12221 --
NM_020346chr1111305 ----1615
NM_020357chr311115 --11397 --
NM_020360chr171256 1627 ----
NM_020379chr11216 1862 ----
NM_020381chr641685 1474 1272 224 11317 ----
NM_020383chr10----1262 --
NM_020390chr344003 1974 1846 24 13412 1898 13860
NM_020403chr132500 215 --21401 1212 --
NM_020405chr1763989 3335 2777 1205 994 362 24007 3257 ----
NM_020416chr442123 1778 846 101 ------
NM_020420chrY41673 1320 400 242 11167 11616 --
NM_020424chr162885 658 --173 --
NM_020432chr782130 2093 1820 1665 897 673 654 427 1815 12338 --
NM_020443chr175578 5112 4587 4434 349 90 40 --26648 1254 --
NM_020445chr73779 657 323 ------
NM_020449chrX1535 ------
NM_020455chr642856 2715 2280 854 22052 431 ----
NM_020456chr1352205 1995 1491 814 171 ------
NM_020463chr231048 395 233 1476 ----
NM_020466chr6134805 3957 3717 3711 3448 3343 3234 3090 1842 1699 1356 783 158 33678 3384 613 54245 4231 3608 3570 1983 24178 1414
NM_020473chrX4480 286 221 32 1373 --11328
NM_020474chr1842038 490 278 72 1639 ----
NM_020475chr842239 944 544 71 21675 571 ----
NM_020476chr842239 944 544 71 21675 571 ----
NM_020477chr842239 944 544 71 21675 571 ----
NM_020478chr852302 1007 607 134 76 21738 634 ----
NM_020480chr842239 944 544 71 21675 571 ----
NM_020546chr573177 993 938 922 290 248 56 11979 ----
NM_020640chr362110 1486 1418 460 234 219 ------
NM_020647chr842163 1478 903 859 ----1517
NM_020651chr281831 1405 1335 1316 669 603 375 131 ------
NM_020654chr331282 464 129 1552 11094 --
NM_020666chr53764 622 94 --175 --
NM_020673chr20147773 7718 7381 6906 6845 5796 4792 2723 2581 1066 967 548 345 324 12517 25298 1363 --
NM_020689chr2031525 1474 323 11674 ----
NM_020690chr5------1333
NM_020697chr821282 1065 1223 ----
NM_020699chr145303 3855 2165 1914 1484 ----
NM_020704chr792529 2510 2441 2296 2128 2059 1646 1018 567 ------
NM_020714chr1964585 4312 3037 3004 2977 186 --12956 13205
NM_020715chr1452256 1895 1737 1409 713 ------
NM_020717chrX64928 4716 4133 1850 1709 239 ------
NM_020718chr1665914 5765 5644 1352 559 227 21864 582 35307 4128 2225 --
NM_020726chr52417 170 1585 ----
NM_020727chr21123779 3764 3476 3412 2964 2468 1296 1227 933 519 382 346 23755 984 11576 1612
NM_020728chr762975 2856 2638 2378 2115 600 12347 12353 11998
NM_020734chr1272953 2302 2147 898 825 687 301 12489 ----
NM_020739chr1583696 3627 3497 3277 3022 1463 622 149 13713 ----
NM_020742chrX52111 1861 414 379 356 11931 ----
NM_020748chr1711945 ----12172
NM_020752chr1072751 2491 2318 2199 1942 448 224 --12474 --
NM_020760chr251841 1657 1302 1272 73 1449 ----
NM_020762chr12--1762 --1235
NM_020766chrX84265 4065 3591 1686 1349 1290 1078 907 11284 11454 1762
NM_020771chr621453 314 ------
NM_020772chr17127673 7129 6751 6066 5915 5283 2887 2629 975 940 636 475 --28589 2478 12830
NM_020773chr452394 2108 124 102 23 --12593 --
NM_020774chr18106020 5776 5473 4978 4788 4134 2428 2193 1186 642 11712 ----
NM_020775chr11207 ------
NM_020778chr1584896 3699 3568 1753 1039 947 637 293 --14161 --
NM_020783chr1841961 1568 643 282 ------
NM_020794chr161307 1151 359 139 126 106 ------
NM_020801chr562208 2193 1986 1812 984 417 1237 1175 --
NM_020802chr1173017 2295 2159 2118 1031 698 115 13325 33042 2089 1073 --
NM_020805chr1831263 508 35 ------
NM_020806chr141808 ------
NM_020809chr1172097 2004 1669 411 303 172 125 --1790 --
NM_020810chr143689 527 176 --12993 12439
NM_020818chr141107 --131 --
NM_020819chr62858 388 11127 ----
NM_020826chr11103704 3388 3112 2828 2288 1407 776 609 539 142 ------
NM_020830chr243171 2684 366 122 1530 23312 961 --
NM_020831chr222999 875 ------
NM_020832chr13632 238 95 1474 ----
NM_020839chr351394 1117 650 422 396 --31096 1042 336 --
NM_020841chr1283829 3717 3038 2928 1006 748 704 357 ----1523
NM_020843chr151105 --165 --
NM_020853chr1242769 2342 1095 345 --12811 --
NM_020854chr182981 29 21380 1348 ----
NM_020856chr1941505 1178 1144 405 ----11048
NM_020858chr15122184 2123 2113 2011 1878 1847 1775 1681 1480 699 385 325 --21950 1499 --
NM_020859chr493927 3089 2827 2775 1089 1022 649 470 47 --12812 --
NM_020860chr431010 893 299 ----1838
NM_020866chr1321035 180 ------
NM_020868chr221378 801 1130 1421 --
NM_020871chrX31933 423 158 11033 --12554
NM_020872chr351584 1421 1275 296 270 ------
NM_020886chr1111225 ------
NM_020898chr12--369 51 35 ----
NM_020899chr1742030 717 447 103 ------
NM_020909chr2134211 4137 3692 3194 2867 2811 2761 1630 1428 1246 810 542 488 11186 23393 1654 1721
NM_020917chr1983935 3786 3723 2750 2471 1135 926 619 1804 1756 --
NM_020918chr1063028 2978 2966 2524 2284 1458 --22735 205 --
NM_020922chrX61766 1260 399 317 265 200 --11747 --
NM_020925chr11255 --1570 --
NM_020927chr1662308 1977 1532 829 409 221 21926 792 1449 --
NM_020940chr1052854 2639 2166 373 157 12649 22922 1891 --
NM_020948chr142783 2514 2237 648 ------
NM_020952chr92339 226 --1578 --
NM_020962chr1582454 2171 1749 1673 904 728 405 177 ------
NM_020975chr1041420 1388 1363 1326 --21261 308 1337
NM_020977chr4112197 2141 2081 1880 1849 1673 1409 720 513 394 87 1207 ----
NM_020981chr21737 --1582 --
NM_020987chr104876 502 452 385 ------
NM_020988chr161236 ------
NM_020993chr1252581 2297 719 366 170 ----1200
NM_021005chr1521080 985 ------
NM_021007chr282482 2063 1861 1679 1663 1551 332 235 ------
NM_021032chr361649 1391 807 732 532 492 3401 234 141 ----
NM_021033chr1353219 3182 2984 2296 168 ----12508
NM_021038chr341161 264 207 170 11126 12599 23108 2345
NM_021045chr1041847 1629 836 23 1884 --2759 752
NM_021069chr4----11607 --
NM_021072chr532405 2211 1978 156 134 --
NM_021083chrX53516 2951 2335 1249 52 ------
NM_021090chr2283469 3190 2003 1867 1704 792 512 325 14165 ----
NM_021097chr282669 2540 2071 1993 1964 1031 246 132 12688 ----
NM_021109chrX134 ------
NM_021109chrX134 ------
NM_021111chr931159 1114 209 162 ----
NM_021116chr7118912 8609 8286 6900 6489 6271 5922 5598 824 287 229 18824 --16797
NM_021120chrX53045 2805 2316 737 558 ----12982
NM_021133chr161629 1388 1344 1251 423 224 --168 --
NM_021137chr1772380 2019 2013 1622 590 190 168 11908 --11821
NM_021140chrX3758 469 376 ------
NM_021144chr91443 ------
NM_021155chr1922640 1985 ------
NM_021168chr1651585 1563 1430 1167 54 --1315 1613
NM_021180chr13682 551 500 1784 ----
NM_021183chrX62467 1862 1828 972 781 512 11651 --21908 359
NM_021190chr111226 ------
NM_021227chr42543 338 ------
NM_021228chr191242 ------
NM_021238chr1231699 1564 1413 ------
NM_021239chr1411437 1209 ----
NM_021242chrX3821 776 377 ------
NM_021249chr1451359 1153 1125 1066 233 1243 11034 --
NM_021252chr1051522 1465 1425 1409 795 1245 1347 --
NM_021255chr1432846 1001 445 23349 740 ----
NM_021269chr1932027 641 367 11377 --1445
NM_021572chr63437 176 96 ------
NM_021574chr2282490 2127 1669 825 771 537 501 419 ------
NM_021619chr951312 1061 994 876 187 ------
NM_021622chr1062379 2333 2205 1951 1517 411 1888 ----
NM_021629chr3134903 4442 4012 3898 3427 3222 1961 1867 1845 1138 1102 861 764 1837 24778 1498 --
NM_021633chr151213 957 940 273 155 ------
NM_021639chr13671 315 102 2358 235 ----
NM_021643chr221280 110 --11751 --
NM_021647chr4114373 4058 3942 3921 3207 3201 1841 1431 1322 748 482 ------
NM_021705chr661547 1154 1105 537 299 94 ------
NM_021722chr71589 ------
NM_021723chr71630 ------
NM_021809chr2031698 405 103 --11006 --
NM_021813chr695142 4885 4660 4623 2100 1529 962 239 139 14946 1558 1984
NM_021814chr651715 1447 322 259 196 ----11634
NM_021815chr293117 2835 2784 1978 1222 970 669 523 40 23012 2265 --11242
NM_021818chr1441354 1259 946 218 --1209 --
NM_021907chr2197 ------
NM_021911chr574769 3867 3749 2125 1304 418 359 14293 24857 4352 --
NM_021912chr1573879 3811 3706 1640 987 453 39 --11152 --
NM_021913chr1921316 47 21378 704 1256 --
NM_021914chr14102460 1933 1763 786 722 510 494 317 277 190 ------
NM_021935chr32887 127 ------
NM_021940chr641464 1450 454 43 11039 ----
NM_021943chr612157 ------
NM_021945chr662970 2363 2353 1232 690 263 13174 23386 2639 12284
NM_021952chr11160 ------
NM_021954chr1383499 3239 3209 1451 1140 868 440 186 --23140 1165 13538
NM_021956chr621482 1205 ------
NM_021960chr162655 2230 1869 1741 613 402 ----11110
NM_021961chr11136835 6744 6057 5212 4989 4963 2503 2306 1858 1140 1002 679 64 26790 4865 11257 --
NM_021962chr1731679 356 278 1694 21753 105 --
NM_021964chr3145939 5798 5391 5207 5135 4860 1420 1196 925 907 830 325 317 27 12396 11354 --
NM_021972chr171266 ------
NM_021977chr653259 1221 1182 938 119 23243 1387 --13047
NM_021979chr141386 ------
NM_021998chrX41101 294 202 118 11238 ----
NM_022037chr21867 ------
NM_022041chr1632520 2123 319 --12607 --
NM_022048chr1556391 4322 4250 2038 895 --11528 1967
NM_022068chr182594 36 1456 ----
NM_022073chr1461639 1590 1303 588 281 191 ------
NM_022079chr101763 ------
NM_022090chr51478 ------
NM_022114chr143581 1489 309 224 --13535 --
NM_022130chr541275 1036 577 518 ----11379
NM_022133chr861521 760 661 269 260 61 11420 ----
NM_022145chr52250 84 ------
NM_022154chr421161 478 1317 ----
NM_022160chr92551 219 ------
NM_022166chr1696359 6289 6270 6238 5554 5135 1573 1435 533 --15373 --
NM_022170chr72385 174 11710 --21701 1539
NM_022173chr21867 ------
NM_022334chr211140 ------
NM_022361chr61561 ------
NM_022374chr2--144 ----
NM_022405chr323351 3212 12626 --12348
NM_022454chr82771 51 1782 ----
NM_022455chr5----1111 --
NM_022456chr12156913 6367 6279 5380 5168 4705 2971 2527 2385 2121 1361 1199 1190 1044 502 27028 6996 26307 5330 11714
NM_022458chr793068 2647 2578 2534 1961 1142 785 617 60 1825 ----
NM_022459chr13106003 5194 4955 4532 3989 2524 2262 2165 1799 809 11441 ----
NM_022461chr3--31296 1022 38 11438 --
NM_022465chr1252694 2634 2318 2197 801 1739 ----
NM_022469chr1102900 2850 2775 2544 2250 1214 1041 804 383 126 ------
NM_022470chr351247 1131 1035 215 95 --1782 --
NM_022474chr1431855 677 72 1669 41782 1727 1069 615 1404
NM_022475chr4191 2564 198 ----
NM_022476chr1641049 860 420 331 1797 ----
NM_022477chr202663 66 --1213 --
NM_022483chr571500 774 691 621 585 395 63 --11686 --
NM_022491chr1243509 728 395 131 11178 --13459
NM_022496chr122406 120 ------
NM_022550chr54482 430 416 191 ------
NM_022644chr172355 22 ------
NM_022650chr53396 110 100 ------
NM_022652chr122980 160 ------
NM_022658chr122359 270 1119 ----
NM_022716chr142773 2252 1090 671 1942 12398 12730
NM_022719chr2273842 3518 3375 1489 947 432 172 --11475 12935
NM_022726chr621579 201 1465 11717 11293
NM_022739chr172846 146 2307 224 1102 --
NM_022748chr71108 ------
NM_022763chr373018 2487 1040 966 625 105 66 --12322 --
NM_022771chr122766 32 --2911 213 1321
NM_022776chr31152 --11276 --
NM_022781chr963348 2419 2227 2182 2139 582 12192 2667 257 --
NM_022782chr121134 ------
NM_022802chr1021017 36 ------
NM_022818chr1641634 1548 1088 261 1190 ----
NM_022824chr541771 765 735 443 ------
NM_022826chr251203 1074 1038 979 822 21178 808 ----
NM_022831chr131862 749 311 --11633 --
NM_022832chr462595 2327 2240 1576 168 49 1786 22390 2254 --
NM_022835chr1972997 2572 2458 1223 440 207 83 --22665 720 --
NM_022836chr141843 216 144 28 ------
NM_022841chr1572798 2513 2448 1793 1708 1075 89 ------
NM_022843chr1321543 454 ------
NM_022893chr262847 2670 1133 583 492 283 12189 11991 --
NM_022898chr1473850 3459 1877 1703 1525 662 133 --13085 2696 492
NM_022900chr71191 --11198 --
NM_022902chr51170 ------
NM_022912chr243093 2898 1997 1024 12394 ----
NM_022913chr52255 231 ------
NM_022918chr112778 116 1321 ----
NM_022965chr4----11338 --
NM_022977chrX41916 899 839 429 12661 12242 11964
NM_023000chr1421524 482 --1417 184
NM_023001chr1421524 482 --1417 184
NM_023016chr282715 2533 2060 1921 1915 1056 538 55 ----2772 668
NM_023035chr19--2836 537 ----
NM_023076chr1662731 2004 1197 991 384 342 --22937 1971 --
NM_023079chr171767 1430 ----
NM_023112chr141327 22695 2031 22982 63 1538
NM_023923chr162487 1415 949 759 135 82 1581 21200 197 --
NM_023927chr521209 285 --1322 11184
NM_023929chr842501 2451 2241 2096 2322 231 --12746
NM_024007chr572957 2793 2673 944 906 349 163 --12175 --
NM_024015chr1721094 130 ------
NM_024034chr20----2150 93 --
NM_024060chr111329 ------
NM_024063chr152193 74 ------
NM_024090chr451320 1227 683 443 222 11290 ----
NM_024094chr81589 1338 ----
NM_024095chr1211360 ------
NM_024122chrX144 ------
NM_024345chr974691 3930 2120 1786 1575 1341 138 15707 24861 4436 --
NM_024408chr173281 3157 2469 1166 739 451 313 13713 23630 3469 --
NM_024411chr2031293 584 509 ------
NM_024415chr51183 --193 --
NM_024416chr921385 1226 --11110 --
NM_024420chr12412 155 1120 ----
NM_024422chr1851709 1505 652 383 160 ------
NM_024491chr32445 46 ------
NM_024513chr393852 3815 3611 3556 3463 3364 983 639 42 --1164 13351
NM_024524chr372804 2611 2015 1262 1231 1017 333 33172 3158 1202 ----
NM_024525chr11131 ----1535
NM_024529chr13982 945 382 ------
NM_024539chrX2373 238 1250 ----
NM_024545chr23689 526 91 ------
NM_024546chr1361288 1244 1210 802 458 158 ------
NM_024548chr341750 1567 1250 48 --185 11619
NM_024551chr123925 873 410 --11035 --
NM_024551chr123925 873 410 --11035 --
NM_024557chr1161651 1381 1369 1162 570 477 ------
NM_024567chr83689 478 175 ------
NM_024582chr451046 949 861 745 708 --1759 31077 914 48
NM_024583chr26999 918 844 835 827 319 ------
NM_024590chr471868 1596 1367 1289 717 528 305 1212 1702 --
NM_024595chr161221 1006 913 805 460 58 ----1115
NM_024612chr1761049 911 327 300 105 82 2973 962 ----
NM_024613chr851835 619 506 462 187 ------
NM_024617chr92686 111 1735 121 --
NM_024624chr251278 494 481 409 344 11320 ----
NM_024626chr121557 1531 ------
NM_024638chr352431 2312 612 577 458 ------
NM_024639chr642945 1998 1917 1812 --1175 --
NM_024643chr143484 175 83 ------
NM_024645chr83419 105 35 ------
NM_024646chr193393 2978 2767 2476 1580 1452 1227 778 387 --1787 --
NM_024665chr354381 3768 3742 1670 1176 24569 1881 24184 3363 12943
NM_024670chr1041548 1363 525 56 ----1454
NM_024680chr113390 95 83 ------
NM_024692chr231721 1693 618 ------
NM_024698chr1131251 1090 237 ------
NM_024704chr2021034 425 1991 1713 --
NM_024713chr1541334 662 513 291 --11075 1440
NM_024721chr842145 1944 1923 435 ------
NM_024725chr112168 161 1612 1790 --
NM_024744chr282472 2197 2183 1958 1890 906 769 368 ------
NM_024745chr164718 453 310 31 --1168 --
NM_024749chr151939 1866 777 625 312 1871 ----
NM_024755chr153893 644 272 ------
NM_024757chr92752 237 ----11049
NM_024761chr9154886 4758 4636 4010 3827 3642 3572 3437 1350 1074 945 939 646 529 147 34662 4528 3365 ----
NM_024770chr2116588 5839 5684 5614 5500 4507 2007 1947 1220 1070 676 12300 25670 2546 12480
NM_024780chr161216 --1429 --
NM_024817chr1565641 4640 3745 1223 1174 356 --15728 1891
NM_024824chr1441749 1633 190 66 11272 11207 --
NM_024834chr101564 ------
NM_024835chr17------137
NM_024837chr1531909 1643 753 11840 1228 --
NM_024841chr1112456 11923 ----
NM_024852chr11115 1671 ----
NM_024854chr121211 --11283 11437
NM_024881chr1983577 3405 2428 2319 1468 1289 1084 340 ----1366
NM_024884chr14104278 3918 3508 3200 3024 1750 1410 556 364 287 14327 ----
NM_024896chr971642 838 516 200 155 138 40 ------
NM_024900chr431741 610 71 --2209 36 --
NM_024900chr431741 610 71 --2209 36 --
NM_024908chr152580 116 ------
NM_024913chr751632 656 521 422 112 21531 328 31344 678 171 --
NM_024915chr811138 1589 22439 2083 1357
NM_024921chrX42011 1746 1646 277 ----1209
NM_024930chr53750 681 273 12317 12764 --
NM_024945chr911187 ------
NM_024947chr3259515 9444 9416 9314 9059 8507 7989 7870 7175 7164 7124 5950 3392 3283 2853 2641 1442 1330 1287 986 930 556 229 195 138 193 19165 16823
NM_024948chr104668 634 301 89 ------
NM_024949chr4104979 4559 4481 4241 3320 3166 1667 1026 708 669 1934 --11624
NM_024953chr1242825 2474 936 393 ------
NM_024971chr92339 226 --1578 --
NM_024989chr2147272 7083 6509 6061 6047 5374 3175 3098 3089 2886 2622 1691 1223 1144 12693 15503 27833 5117
NM_025027chr192768 436 ----1934
NM_025054chr863323 3217 3128 2973 2618 583 1530 ----
NM_025057chr142896 186 31267 1165 214 11273 --
NM_025065chr1----178 --
NM_025073chr1134624 4449 3920 3793 2892 1237 1070 918 837 733 602 362 188 11049 24331 1499 --
NM_025074chr453002 2528 882 848 60 ------
NM_025076chr2140 ------
NM_025126chr126553 485 307 163 110 51 ----1248
NM_025133chr23841 422 137 --155 --
NM_025134chr1652304 2184 618 325 108 --12165 --
NM_025138chr1311289 --1175 --
NM_025146chr382728 2672 1937 545 524 349 282 158 --3505 448 83 --
NM_025147chr231066 730 261 21101 383 ----
NM_025151chr842041 851 331 193 --11440 --
NM_025152chr1431272 612 319 21604 710 ----
NM_025160chr184082 4040 3989 3683 3061 2693 1342 154 23677 263 1591 14277
NM_025164chr1122065 508 ------
NM_025179chr153935 1678 1315 1183 1164 --44912 4596 3184 639 --
NM_025191chr183392 3170 3103 3008 2802 735 239 75 22359 2282 23266 482 --
NM_025195chr831841 685 661 1519 11750 1502
NM_025201chr151377 ------
NM_025208chr1131881 943 607 --32375 1898 1824 --
NM_025214chr1852600 2559 2097 1882 1710 12128 12473 --
NM_025219chr2041849 882 475 273 --12276 --
NM_025221chr43583 233 101 ------
NM_025234chr15158 ------
NM_025235chr1062237 1938 1472 718 348 208 --1146 --
NM_025236chr61699 2644 93 ----
NM_030571chr531242 1221 1025 ------
NM_030579chr1663733 3068 1400 1272 357 336 13084 13606 --
NM_030594chr1531324 410 399 ------
NM_030621chr1493258 3233 3038 1669 1510 1346 729 590 161 --13210 --
NM_030623chr241731 1686 1626 468 11602 183 1313
NM_030625chr102901 625 22105 808 1912 --
NM_030627chr5113404 2875 2544 1636 1490 1297 1062 412 381 280 46 ----1961
NM_030629chr1641929 1891 1428 1264 --11747 --
NM_030634chr121639 97 --12378 --
NM_030639chrX61435 695 518 435 214 22 2596 416 ----
NM_030647chr7146252 5502 5156 5126 4953 4811 4533 3856 2503 1731 1167 852 719 113 --24729 772 --
NM_030648chr493952 3512 3438 2239 1185 1143 1125 405 288 ------
NM_030650chr254114 3276 3079 2712 1386 ----13109
NM_030664chr1042186 2082 1795 687 --12261 153
NM_030670chr1262156 1588 1571 785 541 431 1893 12310 --
NM_030671chr1262156 1588 1571 785 541 431 1893 12310 --
NM_030674chr1295886 5349 5106 4948 4623 4366 4229 4085 657 --25610 869 --
NM_030755chr1462848 2135 1215 1113 725 158 1143 1915 --
NM_030759chr101530 ------
NM_030762chr1261638 1401 1268 683 274 174 --21725 780 --
NM_030763chrX2928 173 --1356 --
NM_030767chr932783 2017 1806 ------
NM_030780chr821364 304 ------
NM_030786chr161232 632 575 489 386 145 ------
NM_030799chr571985 1909 1465 1359 816 639 427 ------
NM_030803chr23957 262 202 ------
NM_030806chr1199197 8699 8196 7834 6578 6059 3708 3647 3595 2622 2564 2429 2297 1448 1126 853 754 669 100 18000 ----
NM_030808chr1731085 949 190 ------
NM_030816chr153282 1019 848 502 311 --1371 --
NM_030820chr62678 669 2706 326 ----
NM_030881chr2262486 2342 1803 621 222 54 ------
NM_030911chr1341487 1388 1275 1183 11326 ----
NM_030918chr175366 4631 4282 1681 774 461 36 --25482 1780 14932
NM_030920chr142093 1816 1733 1560 ----11909
NM_030934chr161786 701 687 598 579 223 ----11526
NM_030939chr63471 425 116 1326 ----
NM_030945chr562065 2029 1869 1779 400 73 1224 12572 --
NM_030949chr621042 427 1278 ----
NM_030952chr141305 1293 515 434 --1350 --
NM_030953chr51595 --1102 --
NM_030962chr1131280 1138 205 11596 ----
NM_030963chr63654 553 69 176 ----
NM_030968chr1721676 1639 ------
NM_031157chr12------1143
NM_031216chr1851990 1822 1811 1724 201 --21708 688 --
NM_031243chr742239 2222 2060 206 11781 12019 --
NM_031262chr92309 192 --2847 71 --
NM_031263chr92366 249 --2904 128 --
NM_031268chr1675341 5063 4606 4389 3270 1810 1232 13447 12077 --
NM_031284chr152152 123 ------
NM_031291chr41156 ------
NM_031296chr452442 2103 718 109 45 11697 ----
NM_031305chr421937 503 ------
NM_031314chr1441868 1700 812 194 ------
NM_031362chr262836 2572 2066 1133 779 563 --11005 --
NM_031365chr262972 2708 2202 915 699 60 --11141 --
NM_031366chr262972 2708 2202 915 699 60 --11141 --
NM_031369chr41580 ------
NM_031370chr41580 ------
NM_031371chr13380 97 22 11373 ----
NM_031371chr13380 97 22 11373 ----
NM_031418chr1162759 2373 2077 1939 1066 34 --12013 11043
NM_031419chr331330 316 256 --11320 134
NM_031427chr1485840 5627 4751 4165 3968 1769 1556 398 --14473 --
NM_031431chr1341275 1176 538 410 --1419 11688
NM_031435chr12103522 3015 2981 2893 2875 2816 2794 1155 967 113 ----1395
NM_031442chrX72905 2510 1108 923 768 539 365 12643 32096 556 91 12667
NM_031445chr253376 2944 2398 693 442 12087 13424 --
NM_031461chr861950 1863 1572 1523 343 77 --31937 772 666 --
NM_031468chr797097 6548 5809 5604 5278 5041 4983 1273 194 1894 ----
NM_031483chr2063416 2469 700 681 675 341 --1773 13478
NM_031492chr11------2588 420
NM_031844chr1123938 3809 3703 3566 3379 2856 1497 1466 1323 1181 858 480 12663 33599 1540 91 --
NM_031845chr293511 3265 2316 1478 1472 1400 531 327 208 --43144 2328 2289 1427 --
NM_031847chr293511 3265 2316 1478 1472 1400 531 327 208 --43144 2328 2289 1427 --
NM_031882chr54374 300 103 69 --191 --
NM_031886chr1952535 2114 1901 1701 133 --12139 --
NM_031922chr62507 101 179 ----
NM_031953chr42394 56 --1363 --
NM_031989chr121128 ------
NM_031992chr72385 174 11710 --21701 1539
NM_032012chr9104419 4311 4290 3553 2055 1701 1675 1453 707 528 --23729 811 13428
NM_032013chr202663 66 --1213 --
NM_032042chr522190 534 1901 22028 1895 --
NM_032047chr34920 676 429 369 12107 11678 --
NM_032088chr521743 106 ------
NM_032092chr521743 106 ------
NM_032102chr1173038 2920 2261 2049 407 386 122 161 ----
NM_032109chr541228 577 571 448 1590 ----
NM_032116chr1374069 3663 1816 1042 1033 617 146 ----24743 430
NM_032119chr52277 31 ------
NM_032120chr73491 109 39 ------
NM_032121chrX62584 2532 2486 1729 247 26 12645 ----
NM_032144chr241671 1351 424 122 ------
NM_032145chr641960 1876 1519 440 ------
NM_032153chr352483 811 706 657 644 ------
NM_032160chr1864295 4093 3919 1721 363 37 23938 464 54128 4116 3597 1331 946 12821
NM_032175chr561652 1646 1634 604 512 298 ------
NM_032177chr54470 192 168 46 --2509 359 --
NM_032181chr22906 248 --1805 --
NM_032182chr1041475 1336 1195 30 21603 1120 ----
NM_032186chr151316 1097 902 151 94 ------
NM_032189chr1364932 4870 4801 1347 180 120 23341 3304 ----
NM_032199chr1043734 3463 517 490 ----13768
NM_032208chr243201 2627 1298 111 23494 3449 ----
NM_032211chr10--11164 ----
NM_032217chr421026 164 ------
NM_032221chr2031797 1291 654 ------
NM_032228chr1193570 2913 2809 2438 2343 1012 413 294 150 --11343 --
NM_032229chr1321165 313 ------
NM_032236chr11726 --1414 --
NM_032239chr431361 571 443 1268 ----
NM_032246chr1531228 1020 295 --1132 --
NM_032250chr91290 1626 ----
NM_032256chr121415 1199 ----
NM_032271chr16--11156 11544 --
NM_032288chr332243 1959 1724 --1796 --
NM_032290chr51539 ------
NM_032291chr121300 275 11768 ----
NM_032293chr9152 ----1279
NM_032299chr111235 ------
NM_032312chr21935 ------
NM_032321chr253296 3189 2833 2562 268 1440 121 12163
NM_032352chr143952 580 268 11009 --21297 1190
NM_032373chr10135699 5113 4939 4437 4425 4205 4136 3924 2205 1726 974 605 579 13775 ----
NM_032403chr521743 106 ------
NM_032408chr71452 ------
NM_032410chr851210 1013 264 116 67 --1986 --
NM_032413chr15154 ------
NM_032438chr651191 511 386 345 117 11637 ----
NM_032439chr1041238 1164 460 238 ------
NM_032440chr1062867 2741 2735 721 100 44 12160 ----
NM_032441chrX--1125 ----
NM_032445chr1542551 2063 1660 247 ------
NM_032446chr563649 3030 2600 1540 973 579 --1541 --
NM_032449chr142877 2786 2724 559 11044 --11974
NM_032457chr483856 3677 3337 2983 1406 1355 1287 956 1705 13834 2628 240
NM_032458chrX82725 2704 2334 2237 1053 570 270 258 2778 689 23330 1170 --
NM_032466chr861216 484 398 219 124 55 11420 2587 473 --
NM_032468chr861216 484 398 219 124 55 11420 2587 473 --
NM_032471chr63767 752 101 ------
NM_032503chr62952 876 --1912 1654
NM_032505chr382748 2466 2011 1758 925 669 446 308 ------
NM_032510chr1861604 733 521 308 209 113 1885 ----
NM_032521chr2042553 2304 2097 277 --12454 --
NM_032523chr2135 ------
NM_032525chr181424 ------
NM_032550chr1031152 1043 440 --11099 --
NM_032557chr451022 848 652 393 45 1127 ----
NM_032558chr93963 233 183 ------
NM_032560chr1441106 901 453 128 ------
NM_032569chr1621922 1810 --12021 --
NM_032575chr1611889 ------
NM_032582chr17--11825 ----
NM_032590chr1261177 758 425 348 257 181 1828 ----
NM_032601chr22247 53 ------
NM_032622chr441387 1226 232 61 ------
NM_032626chr16--1127 ----
NM_032638chr331583 1507 31 ------
NM_032664chr821520 225 1350 11501 --
NM_032682chr373598 3453 2761 1110 1081 865 357 --22371 825 --
NM_032687chr8----144 --
NM_032727chr1051582 1181 494 148 141 21626 1291 --11240
NM_032778chr393251 3029 2720 2643 2164 1321 1257 670 493 12458 --1623
NM_032784chr62728 247 --1124 --
NM_032787chr31276 ------
NM_032810chr102431 125 ----11023
NM_032813chr133904 350 167 ------
NM_032833chr132388 2048 982 --22497 826 1167
NM_032838chr195796 375 276 198 102 11021 21271 158 --
NM_032856chr153607 536 479 ------
NM_032857chr15155 1184 ----
NM_032859chr13133919 3651 3556 3470 2922 2799 2759 2653 1555 880 787 504 486 ------
NM_032861chr641402 1149 1123 145 ----1433
NM_032867chr111643 ------
NM_032869chr841966 1930 203 136 ------
NM_032873chr11104118 3927 3524 3336 1454 1204 711 693 595 86 44127 1011 723 132 ----
NM_032875chr175826 715 693 674 45 1649 ----
NM_032884chr1--1323 ----
NM_032905chr1021273 1074 ----11040
NM_032918chr121217 --139 --
NM_032968chrX113556 3506 3454 3198 3070 3038 3017 1503 1352 604 555 ------
NM_032969chrX113556 3506 3454 3198 3070 3038 3017 1503 1352 604 555 ------
NM_032973chrY113552 3502 3450 3193 3065 3033 3012 1503 1352 604 555 ------
NM_032975chr18103667 3495 3452 3153 2838 2580 2330 766 462 24 22228 1241 1912 --
NM_032980chr18103667 3495 3452 3153 2838 2580 2330 766 462 24 22228 1241 1912 --
NM_032998chr13775 743 357 --1325 --
NM_033012chr1331043 430 48 ------
NM_033014chr921385 1226 --11110 --
NM_033020chr183817 3681 3432 1936 1015 635 355 180 23449 1113 1742 --
NM_033023chr7153 --2197 134 --
NM_033030chr241564 629 442 433 21147 137 ----
NM_033044chr121163 955 ------
NM_033055chr12404 73 --2865 749 11086
NM_033081chr2031190 1049 118 ------
NM_033103chr1921158 35 ------
NM_033116chr14--160 ----
NM_033117chr9----1284 --
NM_033132chr1331563 1446 596 ------
NM_033133chr1753725 3476 2529 1077 194 12756 13534 12356
NM_033135chr1131881 943 607 --32375 1898 1824 --
NM_033138chr721927 496 --22211 463 --
NM_033139chr721927 496 --22211 463 --
NM_033140chr721927 496 --22211 463 --
NM_033143chr463671 3335 1627 1322 1187 540 11737 11468 11374
NM_033147chr2197 ------
NM_033148chr2197 ------
NM_033157chr721927 496 --22211 463 --
NM_033181chr6113761 3658 3257 3026 2652 2615 2506 1490 1241 1180 638 12672 13387 --
NM_033207chr1052608 2285 851 619 501 --21085 132 --
NM_033211chr541907 1510 538 458 1308 ----
NM_033222chr93995 368 158 --130 --
NM_033224chr798021 7778 7583 5849 5320 5198 2655 1959 1188 --26241 5122 --
NM_033225chr832813 1284 258 1296 2770 458 --
NM_033227chr53220 165 45 ------
NM_033228chr52205 85 ------
NM_033240chr1521572 1226 --11726 11400
NM_033247chr15----1322 --
NM_033254chr33554 488 444 ------
NM_033285chr8114405 4371 3850 3486 3422 2795 474 413 212 194 138 1869 ----
NM_033290chrX43531 2477 1048 732 ----11083
NM_033300chr151272 1042 931 228 54 --1471 --
NM_033326chr1142444 1626 670 617 1915 1372 --
NM_033331chr93932 606 511 33331 2964 2213 ----
NM_033360chr1284526 4310 3995 3816 3237 1482 1467 558 24071 1791 11494 --
NM_033364chr321380 234 11637 11668 --
NM_033389chr1734125 1842 1490 --23835 1124 --
NM_033425chr1153266 2911 2694 2219 1126 ------
NM_033426chr144624 582 566 551 12745 12148 --
NM_033429chr1563087 2853 1086 984 655 114 ----33278 2610 536
NM_033430chr471196 1154 1062 1003 587 540 431 11173 13569 14076
NM_033437chr471196 1154 1062 1003 587 540 431 11173 13569 14076
NM_033449chr542070 1598 852 584 ------
NM_033450chr63304 113 85 ------
NM_033480chr632970 2495 823 --23032 892 --
NM_033481chr632970 2495 823 --23032 892 --
NM_033495chrX21087 138 1979 ----
NM_033503chr1553734 3257 1385 220 76 1160 12537 --
NM_033505chr265258 5043 4891 2370 506 349 11552 --1360
NM_033540chr311078 11045 ----
NM_033551chr573364 3340 3274 2529 2147 1311 460 --13497 --
NM_033624chr1241436 370 309 279 1782 ----
NM_033631chr153935 2632 2581 1340 1315 1648 ----
NM_033632chr441400 1059 632 45 ------
NM_033637chr1083951 3834 3249 3207 3140 2622 1282 866 --1773 --
NM_033644chr562277 2209 1674 1616 837 757 --22575 2553 --
NM_033645chr562277 2209 1674 1616 837 757 --22575 2553 --
NM_033656chr2195855 4884 4864 3669 2384 2036 1234 456 282 22021 1217 ----
NM_052818chr1351502 1437 785 573 554 ------
NM_052821chr921943 217 11709 ----
NM_052832chr862791 2690 2495 731 368 343 ------
NM_052834chr1842282 421 346 334 1671 1292 --
NM_052851chr1331830 617 593 12063 ----
NM_052879chr1273854 3357 3136 2771 1586 1007 603 1728 13271 --
NM_052880chr2241146 898 287 34 11204 ----
NM_052885chr12104710 4436 4403 4000 3489 3470 1658 1197 649 135 13978 ----
NM_052886chr862008 1984 1807 803 786 444 --197 --
NM_052898chr851655 1577 1324 1200 72 ------
NM_052900chr841740 1493 210 91 ------
NM_052904chr64442 320 299 284 ----1196
NM_052905chr241589 1373 1164 572 ----11657
NM_052907chr12114324 4179 4080 3012 2665 1493 1206 1060 864 836 751 1390 24333 3362 --
NM_052910chr1311486 --22182 1623 21769 1432
NM_052911chr1831023 873 819 ------
NM_052918chr1043441 1183 1113 741 --43169 2400 424 368 1289
NM_052932chr1152000 1985 1603 995 517 --1562 1378
NM_052937chr812129 ------
NM_052940chr11215 ------
NM_052953chr32239 92 ------
NM_052954chr2172228 1937 1638 910 596 494 100 1251 ----
NM_052966chr173835 3766 2971 2774 1157 816 333 162 23886 3090 --
NM_052996chr1631105 630 576 11392 11340 11316
NM_053002chr31911 ------
NM_053016chr9117962 7798 7350 6615 6177 2856 2431 1203 1069 766 84 27059 1825 37642 5583 1348 --
NM_053023chr1162940 2868 2493 2177 1056 277 32227 2209 453 ----
NM_053024chr331379 1046 995 1272 ----
NM_053025chr331747 1401 1280 11127 11272 --
NM_053026chr331747 1401 1280 11127 11272 --
NM_053027chr331747 1401 1280 11127 11272 --
NM_053028chr331747 1401 1280 11127 11272 --
NM_053031chr331747 1401 1280 11127 11272 --
NM_053032chr331747 1401 1280 11127 11272 --
NM_053042chr483077 2834 2695 2478 1217 1003 676 666 11244 1549 --
NM_053043chr7126077 5546 5187 5028 4801 4450 1570 1147 884 676 352 219 11254 23974 2028 --
NM_053056chr1142113 1018 876 434 ------
NM_053067chr91314 ------
NM_054014chr202362 54 ------
NM_054016chr151648 732 521 421 305 --1107 11272
NM_054016chr151648 732 521 421 305 --1107 11272
NM_054016chr151648 732 521 421 305 --1107 11272
NM_057164chr22224 125 --1273 --
NM_057165chr22224 125 --1273 --
NM_057166chr22