TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-365a-3p
miRNA Sequence: UAAUGCCCCUAAAAAUCCUUAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51935 ------
NM_000038chr52757 400 ------
NM_000081chr11296 ------
NM_000084chrX64560 2261 2053 1264 757 494 ------
NM_000092chr224130 1507 23299 1329 ----
NM_000109chrX--1203 ----
NM_000138chr1511879 ------
NM_000142chr411167 ------
NM_000165chr621286 222 ------
NM_000170chr91205 ------
NM_000176chr543058 2943 2885 1564 23857 3625 ----
NM_000214chr2011617 ------
NM_000259chr1525247 1183 16137 --25515 4467
NM_000264chr923160 937 11310 ----
NM_000330chrX12096 ------
NM_000337chr544900 1669 1066 492 ------
NM_000408chr243429 2425 1294 977 ------
NM_000439chr542541 2307 1677 204 ------
NM_000461chr364621 4295 4232 2991 1391 655 ------
NM_000555chrX77541 7454 7109 6909 5681 5675 2108 15438 ----
NM_000618chr1224196 598 14956 24186 126 --
NM_000618chr1224196 598 14956 24186 126 --
NM_000640chrX129 ------
NM_000702chr142252 2014 154 95 ------
NM_000719chr1275253 2482 2237 2071 1938 1507 527 11453 --14989
NM_000806chr511615 ------
NM_000813chr542151 1975 638 402 ------
NM_000814chr1542654 588 487 375 14149 ----
NM_000817chr21811 ------
NM_000826chr421673 567 ------
NM_000827chr512595 ------
NM_000829chr11--1893 11520 --
NM_000844chr32826 705 ------
NM_000868chrX42541 636 602 347 ------
NM_000875chr1556674 6563 5459 2001 1815 12433 15346 --
NM_000891chr1722334 1137 --1299 1610
NM_000902chr31711 --12792 --
NM_000950chrX53584 1187 642 632 400 ------
NM_000958chr51465 ------
NM_000964chr17--1496 ----
NM_001001323chr1212199 ------
NM_001001395chr1221076 850 ------
NM_001001436chr161314 ------
NM_001001549chr742815 658 457 233 12724 ----
NM_001001550chr742815 658 457 233 12724 ----
NM_001001555chr742815 658 457 233 12724 ----
NM_001001701chr431456 862 629 1826 ----
NM_001001852chr221921 ------
NM_001001995chrX------11191
NM_001002860chr1454700 3682 2868 1456 236 ------
NM_001003652chr1837187 1059 257 28257 2092 ----
NM_001003681chr2221983 1798 ------
NM_001003712chr1222608 136 13212 ----
NM_001003800chr953040 2850 2790 2298 1264 --33463 2359 141 --
NM_001003927chr17163 ------
NM_001004051chrX1224 ------
NM_001004317chr624547 2990 14173 ----
NM_001004346chr41105 --1249 --
NM_001004356chr411295 ------
NM_001004358chr411295 ------
NM_001005473chr535366 740 57 ------
NM_001006600chr522291 2039 1418 ----
NM_001006636chr21675 1654 ----
NM_001006945chr12604 192 ------
NM_001006946chr221805 758 ------
NM_001007024chr1734152 3209 2747 --12943 --
NM_001007025chr1734152 3209 2747 --12943 --
NM_001007466chr634779 1672 327 15080 24699 632 11275
NM_001008239chr184750 715 482 109 32614 1179 762 21000 438 --
NM_001008408chr754788 4476 2093 1546 1249 14223 ----
NM_001008495chr81170 ------
NM_001008541chr10--1455 ----
NM_001008541chr10--1455 ----
NM_001008564chr1331759 646 434 --1866 --
NM_001008660chr1111378 ------
NM_001008738chr5----1129 --
NM_001009554chr424003 3060 14699 ----
NM_001009554chr424003 3060 14699 ----
NM_001009881chr1171 ------
NM_001009882chr1171 ------
NM_001009909chr1123716 668 22713 510 11072 --
NM_001009959chr242442 2111 2033 375 1427 1214 --
NM_001010862chrX53226 3078 2582 2209 1204 1725 ----
NM_001010867chr1106529 6456 5964 5795 5503 4837 2552 1666 1126 845 --1517 --
NM_001010891chr536098 5610 5563 197 ----
NM_001011713chr141530 ------
NM_001012393chr1143905 1871 1588 715 ------
NM_001012420chr1532345 1104 979 12904 ----
NM_001012423chr1532345 1104 979 12904 ----
NM_001012732chr4----11247 --
NM_001012751chr101287 ------
NM_001013031chr1033334 2339 1330 ------
NM_001013843chr15------1809
NM_001014797chr1087569 7331 7191 5145 5031 2631 1846 931 18059 ----
NM_001015877chrX23088 1116 12271 ----
NM_001017368chr171228 ------
NM_001017371chr21341 ------
NM_001018074chr543058 2943 2885 1564 23857 3625 ----
NM_001018075chr543058 2943 2885 1564 23857 3625 ----
NM_001018076chr543058 2943 2885 1564 23857 3625 ----
NM_001018077chr543058 2943 2885 1564 23857 3625 ----
NM_001018088chr151174 ------
NM_001018090chr1512130 1216 ----
NM_001018091chr1512240 1326 ----
NM_001018102chr1512130 1216 ----
NM_001018676chr81119 ------
NM_001018677chr81119 ------
NM_001020825chr53533 418 360 21332 1100 ----
NM_001023567chr1542435 2412 1856 987 12296 ----
NM_001024094chr543058 2943 2885 1564 23857 3625 ----
NM_001024463chr15--1769 151 --
NM_001024649chr52817 438 --22685 744 --
NM_001024666chrX1627 ------
NM_001024809chr17--1496 ----
NM_001024916chr92118 59 ------
NM_001024948chr11100 --1953 11362
NM_001025076chr1021944 388 --26164 1160 --
NM_001025077chr1011746 --27522 2518 --
NM_001025105chr541549 1158 1075 979 ------
NM_001025108chr253380 920 578 171 149 ------
NM_001025580chrX31339 525 181 --24169 3020 --
NM_001025780chr911281 11048 ----
NM_001030001chr14--1138 ----
NM_001030006chr171318 ------
NM_001030007chr1642602 1096 487 101 1566 1435 --
NM_001030055chr1421501 142 ------
NM_001031695chr2235028 3459 1038 11576 11841 15038
NM_001031804chr1653998 3098 1708 1222 1074 ------
NM_001032280chr621570 1240 ------
NM_001032289chrX----1139 --
NM_001033507chr111591 ------
NM_001033925chr1011457 11739 ----
NM_001034841chr1664972 3786 3608 2123 1945 106 ------
NM_001035260chr101410 ------
NM_001037132chr71747 22109 658 1218 --
NM_001037133chr71747 22109 658 1218 --
NM_001037872chr2159 ------
NM_001039348chr22833 28 --1158 --
NM_001039349chr22833 28 --1158 --
NM_001039457chr11277 ------
NM_001039547chr337381 1589 1527 --1956 --
NM_001039577chr11889 --13645 --
NM_001039585chr1187 ------
NM_001039762chr1032335 893 179 ----12002
NM_001039840chrX34947 4415 4357 11398 15755 --
NM_001040152chr734551 4204 3868 1547 ----
NM_001040440chr51191 1140 ----
NM_001040441chr164594 4148 3757 3610 1771 917 ------
NM_001040450chr1512645 1584 ----
NM_001040453chr1512645 1584 ----
NM_001040633chr71121 ------
NM_001040665chr723616 3249 ------
NM_001042403chr122797 342 ------
NM_001042425chr621570 1240 ------
NM_001042493chr612018 11424 ----
NM_001046chr532679 2386 2246 ------
NM_001083620chr421672 566 ------
NM_001106chr397933 7519 7343 3846 3048 2388 2147 876 250 --23582 1691 --
NM_001113490chrX33082 1399 1075 ------
NM_001122679chr51935 ------
NM_001123chr101146 ------
NM_001128chr1642602 1096 487 101 1566 1435 --
NM_001148chr442165 623 304 134 ------
NM_001149chr101445 --21282 1109 --
NM_001167chrX56723 6151 5316 4158 1607 15223 --1185
NM_001172chr14255 37 ----1206
NM_001173chr1421501 142 ------
NM_001204chr217410 15784 14775 --
NM_001256chr1742841 2139 706 568 ------
NM_001257chr161392 --11555 --
NM_001273chr12----1397 --
NM_001282chr171318 ------
NM_001357chr11268 ------
NM_001396chr2121717 998 ------
NM_001402chr612016 ------
NM_001430chr221806 84 21836 1752 11844 --
NM_001465chr5179 ------
NM_001483chr71717 ------
NM_001497chr9----1899 --
NM_001530chr141225 ------
NM_001616chr2----22391 2239 --
NM_001659chr1231810 776 111 --2974 312 1630
NM_001665chr11----1218 --
NM_001742chr711562 ------
NM_001746chr52817 438 --22685 744 --
NM_001755chr16--42083 1472 839 304 ----
NM_001806chr1921003 741 12688 ----
NM_001830chrX61211 811 775 406 255 186 --13042 --
NM_001854chr111235 ------
NM_001858chr645099 3203 1673 1320 25072 132 ----
NM_001892chr541549 1158 1075 979 ------
NM_001921chr4----11247 --
NM_001924chr1----1353 --
NM_001938chr11118 ------
NM_001942chr1812033 ------
NM_001967chr32464 219 ------
NM_001981chr122058 1718 ------
NM_002009chr1511840 --1666 --
NM_002027chr81119 ------
NM_002056chr21766 ------
NM_002072chr91993 ------
NM_002073chr2211161 ------
NM_002107chr11166 ------
NM_002139chrX1418 ------
NM_002145chr17--1119 ----
NM_002147chr172906 601 ------
NM_002149chr25790 758 719 629 119 1768 ----
NM_002193chr211684 ------
NM_002210chr232437 1232 219 1124 ----
NM_002222chr321307 56 --1523 --
NM_002228chr11124 ------
NM_002247chr1011535 ------
NM_002266chr17146 ------
NM_002267chr131795 ------
NM_002270chr532274 957 740 25000 4972 ----
NM_002285chr253380 920 578 171 149 ------
NM_002336chr1223946 3829 13316 --14643
NM_002356chr632801 2586 2267 ------
NM_002399chr1511293 ------
NM_002469chr121485 --1380 --
NM_002545chr1143905 1871 1588 715 ------
NM_002577chr343532 1604 1235 688 11263 1345 --
NM_002581chr924777 59 1748 25117 3806 --
NM_002590chr131154 ------
NM_002608chr22147 ------
NM_002649chr751596 1255 242 165 107 ------
NM_002655chr833778 791 681 12099 1204 --
NM_002657chr2033847 3089 2790 1236 ----
NM_002698chr1912080 ------
NM_002707chr2196 ------
NM_002709chr212668 --11097 --
NM_002717chr81605 ------
NM_002729chr101117 ------
NM_002731chr142721 2676 2487 1032 1803 12875 --
NM_002745chr2223740 3607 ----14295
NM_002760chrY34439 1823 669 1365 14182 --
NM_002764chrX163 ------
NM_002786chr111230 ------
NM_002827chr20----1683 --
NM_002834chr1232880 1599 1232 1589 --12782
NM_002837chr1234567 4344 4036 ------
NM_002851chr71252 ------
NM_002886chr353938 3670 1725 1689 1290 ------
NM_002971chr3140 1235 ----
NM_002997chr221805 758 ------
NM_002998chr812061 ------
NM_003034chr1211787 --136 --
NM_003054chr101276 ------
NM_003072chr191408 ------
NM_003077chr171708 ------
NM_003095chr12--1385 ----
NM_003111chr21341 ------
NM_003112chr712743 ----13150
NM_003113chr21189 ------
NM_003178chr311865 ------
NM_003182chr7--1403 ----
NM_003182chr7--1403 ----
NM_003199chr1845418 4690 1204 471 ------
NM_003220chr621570 1240 ------
NM_003222chr20------11026
NM_003239chr1421026 908 ----1826
NM_003262chr341682 1048 828 85 --11574 --
NM_003272chr11213 ------
NM_003274chr2112893 ------
NM_003290chr19----1270 --
NM_003291chr133706 75 55 ------
NM_003292chr1----1661 11952
NM_003298chr336046 765 75 16201 1951 --
NM_003330chr1231446 730 229 21857 1211 ----
NM_003340chr41513 ------
NM_003341chr3----1104 --
NM_003367chr191525 ------
NM_003380chr101238 ------
NM_003404chr203475 208 166 ------
NM_003410chrX12656 ------
NM_003452chr91868 ------
NM_003453chr13------1134
NM_003468chr243142 3094 1751 336 --33908 143 50 --
NM_003478chr112993 179 1608 ----
NM_003567chr11298 ------
NM_003574chr1854546 2260 792 571 433 ----15729
NM_003620chr172892 195 1745 ----
NM_003626chr1111182 ------
NM_003629chr13577 394 35 --173 1166
NM_003663chr323302 811 12166 ----
NM_003670chr3--11192 ----
NM_003718chr71429 ------
NM_003722chr31493 22623 936 1380 --
NM_003750chr101297 ------
NM_003796chr191148 ------
NM_003812chr2149 ------
NM_003872chr212920 ------
NM_003885chr171682 --12532 --
NM_003895chr2121766 438 ----166
NM_003998chr41575 ------
NM_004006chrX--1203 ----
NM_004007chrX--1203 ----
NM_004009chrX--1203 ----
NM_004010chrX--1203 ----
NM_004011chrX--1203 ----
NM_004012chrX--1203 ----
NM_004013chrX--1203 ----
NM_004014chrX--1203 ----
NM_004015chrX--1203 ----
NM_004016chrX--1117 ----
NM_004017chrX--1203 ----
NM_004018chrX--1117 ----
NM_004020chrX--1203 ----
NM_004021chrX--1117 ----
NM_004022chrX--1117 ----
NM_004023chrX--1117 ----
NM_004047chr11277 ------
NM_004061chr51447 ------
NM_004075chr121478 ------
NM_004077chr121893 ----21028 947
NM_004086chr141625 ------
NM_004093chr13----1976 --
NM_004098chr101418 ------
NM_004105chr22833 28 --1158 --
NM_004162chr311184 ------
NM_004172chr5----11302 11520
NM_004215chr81518 ------
NM_004229chrX11833 ------
NM_004235chr91303 ------
NM_004279chr71763 ------
NM_004293chr912476 ----1710
NM_004326chr11248 ------
NM_004330chr15----1850 --
NM_004331chr822073 174 11958 ----
NM_004342chr7--1548 ----
NM_004354chr4--1689 ----
NM_004356chr11--1104 ----
NM_004376chr1011284 ------
NM_004379chr21546 ------
NM_004415chr6--1562 ----
NM_004429chrX21007 562 ------
NM_004432chr932299 2236 2223 ------
NM_004457chr2----1438 --
NM_004458chrX--1543 ----
NM_004499chr51462 ------
NM_004501chr122870 970 ------
NM_004575chr421188 218 ------
NM_004586chrX65249 4901 4818 4403 4120 1623 24344 3765 ----
NM_004593chr31715 --1319 --
NM_004612chr934586 1070 806 1872 --13971
NM_004615chrX1645 ------
NM_004690chr61727 ------
NM_004723chr11370 ------
NM_004725chr101218 ------
NM_004726chrX65293 4863 3988 1485 1288 1028 1263 14327 14565
NM_004734chr1312987 ----12316
NM_004745chr865792 5575 5440 2070 1962 952 1430 11617 --
NM_004748chr1543921 3888 3345 810 ------
NM_004774chr171875 ------
NM_004779chr511284 ------
NM_004788chr1122281 774 ------
NM_004801chr211356 ------
NM_004871chr1734152 3209 2747 --12943 --
NM_004872chr11165 ------
NM_004890chr17----1224 --
NM_004891chr2----1220 --
NM_004896chr101325 ------
NM_004922chr102875 282 ------
NM_004938chr911190 ------
NM_004947chr322493 2311 ------
NM_004949chr182737 480 --12066 --
NM_004956chr744189 1542 548 373 --2436 26 --
NM_005010chr71747 22109 658 1218 --
NM_005034chr81479 ------
NM_005044chrX32958 932 539 24173 182 ----
NM_005065chr1453863 3587 3554 1007 375 --15036 --
NM_005121chr1753197 1438 1293 1136 854 --13640 --
NM_005159chr1542158 1990 1760 1613 146 ----
NM_005160chr2265997 5575 5470 1932 1097 673 ------
NM_005188chr1147050 6066 1805 732 1507 ----
NM_005233chr31423 --1203 --
NM_005241chr31318 ------
NM_005249chr14182 ------
NM_005257chr18----11144 --
NM_005302chr71399 ------
NM_005311chr742815 658 457 233 12724 ----
NM_005313chr15----1268 --
NM_005339chr423094 101 --14217 --
NM_005342chrX72156 1049 543 504 456 323 304 ------
NM_005349chr4--1450 ----
NM_005358chr13----1342 --
NM_005392chr911230 ------
NM_005399chr133983 3404 2972 14152 ----
NM_005406chr1821511 1406 ------
NM_005475chr1213203 ------
NM_005487chr2221983 1798 ------
NM_005503chr151178 ------
NM_005570chr18--11147 ----
NM_005578chr344978 3439 749 342 14602 ----
NM_005596chr926043 4401 11025 15578 11014
NM_005626chr11536 ------
NM_005668chr523796 2967 --13519 14595
NM_005734chr11163 ------
NM_005746chr752599 2355 2245 1976 253 11789 ----
NM_005751chr7----1470 --
NM_005759chr224275 378 24635 3114 ----
NM_005776chr141776 1214 ----
NM_005779chr543336 2446 1450 1009 ------
NM_005840chrX47082 5309 4967 270 27403 1119 ----
NM_005841chr411074 --1245 --
NM_005850chr11158 ------
NM_005853chr161438 ------
NM_005859chr511398 ------
NM_005868chr742071 1627 805 106 ------
NM_005872chr11196 ------
NM_005875chr31159 ------
NM_005880chr1611268 ------
NM_005899chr1731297 480 66 ------
NM_005901chr1837187 1059 257 28257 2092 ----
NM_005906chr611332 11713 --11509
NM_005909chr53660 538 308 24139 3808 ----
NM_005911chr211118 ------
NM_005935chr413993 14844 ----
NM_005941chr833307 1512 1250 ------
NM_005955chr121175 898 --14645 --
NM_005962chr10--1455 ----
NM_005962chr10--1455 ----
NM_005966chr212249 ------
NM_005985chr201735 ------
NM_005994chr17--1653 ----
NM_006016chr611886 ------
NM_006054chr11--11665 ----
NM_006055chr2--11127 --1395
NM_006073chr632015 1518 449 ------
NM_006095chr43822 677 215 ------
NM_006106chr1122182 1184 --12757 --
NM_006153chr3--1501 ----
NM_006216chr21167 ------
NM_006223chrX2377 207 2473 55 ----
NM_006226chr2----1115 --
NM_006237chr133920 659 50 11808 ----
NM_006241chr312129 ------
NM_006257chr101976 ------
NM_006279chr1----1590 --
NM_006330chr8--1510 ----
NM_006375chrX31247 759 324 ------
NM_006380chr1733018 1342 418 ------
NM_006393chr1044023 3093 1522 1177 ------
NM_006469chr121401 90 ------
NM_006471chr18----149 --
NM_006486chr221109 ------
NM_006521chrX21358 218 ----1976
NM_006534chr2032949 1262 250 --1132 12971
NM_006544chr1424429 1312 13929 ----
NM_006558chr81442 ------
NM_006561chr1021944 388 --26164 1160 --
NM_006570chr9--1364 ----
NM_006575chr1421013 308 ------
NM_006599chr1636577 1805 839 --17059 --
NM_006609chr242796 2306 1977 1158 ------
NM_006624chr1022087 507 1483 --1214
NM_006629chr1851750 1083 901 767 386 12397 ----
NM_006646chr13177 22990 2376 1656 --
NM_006721chr101146 ------
NM_006729chrX1737 11617 15499 --
NM_006750chr1636945 6198 5875 ----18064
NM_006751chr21275 ------
NM_006772chr611260 ------
NM_006777chrX22738 2345 ------
NM_006805chr511374 ------
NM_006826chr21289 ------
NM_006914chr91268 ------
NM_006915chrX1579 21643 30 ----
NM_006922chr21185 12441 ----
NM_006939chr142396 38 ------
NM_006951chr10--1211 ----
NM_006965chr1811096 ------
NM_007006chr16--13448 --1694
NM_007013chr81755 ------
NM_007052chrX1129 ------
NM_007054chr523953 1172 --13185 --
NM_007078chr10----1443 --
NM_007107chr312054 ------
NM_007112chr1------1191
NM_007137chrX54916 2082 1858 1253 1225 ------
NM_007159chr311374 ------
NM_007166chr1111378 ------
NM_007185chr11280 --1835 --
NM_007212chr121919 535 174 11931 --
NM_007218chr8132 ------
NM_007236chr15--11968 --1181
NM_007282chr31157 ------
NM_007287chr31711 --12792 --
NM_007288chr31711 --12792 --
NM_007289chr31711 --12792 --
NM_007331chr422303 25 12731 ----
NM_007363chrX--1171 ----
NM_012081chr522957 248 ------
NM_012120chr612310 ------
NM_012153chr1122347 2286 ----1360
NM_012158chr13--1588 ----
NM_012183chr11575 ------
NM_012199chr164402 4161 4034 3356 3233 1657 ------
NM_012223chr2--11167 ----
NM_012229chr1021129 436 ----11354
NM_012234chr342826 927 148 39 ------
NM_012244chr1411727 ------
NM_012250chr1111309 ------
NM_012262chr175189 5142 3550 2032 1834 192 167 11409 ----
NM_012300chr5------12489
NM_012302chr11248 ------
NM_012327chr183517 236 127 11359 ----
NM_012329chr1711486 ------
NM_012333chr1----11432 11031
NM_012345chr13----11564 --
NM_012416chr91459 ------
NM_012428chr151647 ------
NM_012464chr432873 2676 236 1215 ----
NM_013254chr12--1492 --161
NM_013255chr768590 8150 5616 5562 2444 1080 16488 ----
NM_013261chr433342 2562 618 11425 ----
NM_013281chr201536 1421 ----
NM_013354chr8------11441
NM_013374chr3--1542 ----
NM_013381chr12--12265 --1440
NM_013411chr142703 2388 2177 926 12058 ----
NM_013438chr911745 --11672 --
NM_013441chr1----1428 --
NM_013448chr14--1509 ----
NM_013995chrX21007 498 2665 555 21881 751 1811
NM_013996chr7--1403 ----
NM_013996chr7--1403 ----
NM_013997chr7--1403 ----
NM_013997chr7--1403 ----
NM_013998chr7--1403 ----
NM_013998chr7--1403 ----
NM_014011chr24713 617 518 269 1676 1293 --
NM_014048chr1624652 841 14736 ----
NM_014089chr1331759 646 434 --1866 --
NM_014106chr1532071 231 116 12460 ----
NM_014117chr1622418 157 ------
NM_014141chr7--22101 684 1377 --
NM_014155chr1146788 6016 5934 1844 15684 22775 864 --
NM_014181chr242796 2406 2085 1889 12807 1414 --
NM_014210chr17163 ------
NM_014213chr21174 ------
NM_014250chr2221983 1798 ------
NM_014253chrX1153 ------
NM_014263chr10--11465 ----
NM_014282chr911289 ------
NM_014317chr101259 ------
NM_014415chr3--11272 ----
NM_014423chr555543 5451 4416 3481 637 ------
NM_014504chr742094 1571 488 284 ------
NM_014515chr12145 ------
NM_014521chr21408 ------
NM_014615chr1623603 3087 ------
NM_014616chr333096 677 282 13113 ----
NM_014659chr15--1769 151 --
NM_014700chr1611341 ------
NM_014711chr1611434 ------
NM_014713chr21411 ------
NM_014717chr191864 ------
NM_014721chr677401 6964 6867 5419 5053 2252 1628 ----12935
NM_014739chr631622 1273 1078 13815 ----
NM_014746chr233102 494 468 13863 ----
NM_014747chr151732 953 874 358 228 11603 12153 --
NM_014772chr1813090 ------
NM_014795chr2----1176 --
NM_014810chr132806 669 319 1166 ----
NM_014819chr512308 ------
NM_014840chr1243220 710 277 228 13232 ----
NM_014877chr171630 --16554 12716
NM_014892chr61457 ------
NM_014899chr523097 2312 --1388 --
NM_014903chr12163 ------
NM_014904chr1012519 --13862 --
NM_014912chr1013115 1710 ----
NM_014923chr1351535 1436 831 104 91 ------
NM_014926chr31988 ------
NM_014969chr11813 ----11167
NM_014996chr3138 ------
NM_015000chr1232468 2016 1151 1825 ----
NM_015011chr13--1466 ----
NM_015025chr21275 ------
NM_015032chr13--12738 ----
NM_015052chr71105 ------
NM_015062chr101190 ------
NM_015068chr733403 3056 2720 --11087 --
NM_015090chr135449 4118 1110 25150 1839 ----
NM_015100chr13434 295 80 --195 --
NM_015155chr1042824 559 501 294 ------
NM_015156chr14--161 ----
NM_015158chr91582 ------
NM_015173chr441754 1575 1457 170 ------
NM_015176chr12717 504 ------
NM_015187chr44630 235 76 55 ------
NM_015199chr332629 1111 926 2415 142 ----
NM_015200chr412308 ------
NM_015206chr1532815 700 117 --23692 3573 1498
NM_015245chr62231 48 --11924 1871
NM_015250chr921342 600 --21765 661 --
NM_015252chr21278 ------
NM_015267chr1211790 ------
NM_015269chr1171 ------
NM_015271chr433191 1067 331 1472 ----
NM_015272chr1611925 ------
NM_015278chr61758 ------
NM_015285chr1811018 --11627 --
NM_015288chr523195 271 ----1364
NM_015291chr142574 838 572 63 ------
NM_015310chr868011 7757 5749 5336 3067 948 17906 ----
NM_015328chr71686 ------
NM_015338chr2041955 1707 483 198 ------
NM_015344chr8--11796 1114 --
NM_015355chr1711246 ------
NM_015365chrX31339 525 181 --24169 3020 --
NM_015429chr32995 256 ------
NM_015436chr443174 1008 633 32 ------
NM_015458chr833910 3579 3508 --14856 11647
NM_015477chr151235 ------
NM_015532chr1512130 1216 ----
NM_015548chr6--1906 ----
NM_015550chr712668 12687 ----
NM_015554chr1532874 2226 199 12413 22354 180 --
NM_015564chr553572 3380 2634 774 467 ------
NM_015571chr621920 60 12392 ----
NM_015680chr21600 ------
NM_015702chr21247 ------
NM_015852chr713352 13218 ----
NM_015874chr4--1450 ----
NM_015888chr142114 2088 1016 123 ------
NM_015902chr81769 ------
NM_016018chr811884 1668 1501 --
NM_016025chr1611328 ------
NM_016073chr15--11169 ----
NM_016078chr171899 1980 ----
NM_016083chr6--23078 1322 ----
NM_016120chrX11115 ------
NM_016203chr71121 ------
NM_016206chr348688 7875 7143 6624 --22624 1054 12309
NM_016260chr246846 6727 1044 721 12335 16981 --
NM_016270chr192351 84 --1419 --
NM_016275chr312696 ------
NM_016287chr13636 155 22 ------
NM_016300chr31125 ------
NM_016308chr141795 686 596 234 ------
NM_016312chr12----2177 104 --
NM_016315chr211712 184 ----
NM_016316chr2159 ------
NM_016319chr121736 ------
NM_016410chr9--1426 1540 --
NM_016507chr1742535 1953 871 717 --11249 --
NM_016607chrX1623 --21660 1362 --
NM_016620chr111234 ----1470
NM_016953chr224787 487 23810 1175 ----
NM_017412chr8----1527 --
NM_017455chr151647 ------
NM_017563chr356194 4584 4262 1702 1322 --11836 --
NM_017590chr22--11871 ----
NM_017607chr191507 ------
NM_017632chr4137 ------
NM_017634chr811692 ------
NM_017641chr122453 150 ------
NM_017644chr323495 3158 ----13211
NM_017650chr755954 5300 5053 4277 1860 14845 13761 1697
NM_017686chr121080 127 ------
NM_017704chr111283 --1348 --
NM_017737chr1--1643 --171
NM_017742chr18178 --11695 --
NM_017758chr1721099 208 ------
NM_017769chr141906 23181 2279 ----
NM_017770chr62625 414 ------
NM_017779chr142532 862 790 103 ------
NM_017780chr8--1298 ----
NM_017786chr82219 115 ------
NM_017812chr71667 ------
NM_017826chr13------1710
NM_017848chrX23547 320 13423 11390 --
NM_017919chr975159 3800 2202 1155 1015 972 211 14444 14343 --
NM_017953chr1----186 --
NM_018011chr13------1445
NM_018030chr181154 ------
NM_018064chr61293 ------
NM_018080chr151174 ------
NM_018131chr102827 775 --166 --
NM_018133chr312159 ------
NM_018211chr11648 11440 ----
NM_018214chr61476 ------
NM_018238chr71950 11308 1110 --
NM_018247chr62238 185 12747 12978 --
NM_018328chr2170 ------
NM_018362chr1122855 1537 --11393 --
NM_018364chr112794 ------
NM_018372chr12604 192 ------
NM_018374chr723671 70 14969 15038 --
NM_018409chr433136 2766 2666 --22472 114 --
NM_018426chr61128 ------
NM_018439chr18--12592 ----
NM_018440chr823106 685 --18518 --
NM_018444chr812137 --11751 12028
NM_018488chr17194 --1698 --
NM_018489chr131674 355 75 ------
NM_018557chr221165 191 ------
NM_018640chr1221076 850 ------
NM_018641chr71167 ------
NM_018695chr522291 2039 1418 ----
NM_018837chr20198 ------
NM_018898chr532370 429 410 11973 ----
NM_018899chr532370 429 410 11973 ----
NM_018900chr532370 429 410 11973 ----
NM_018901chr532370 429 410 11973 ----
NM_018902chr532370 429 410 11973 ----
NM_018903chr532370 429 410 11973 ----
NM_018904chr532370 429 410 11973 ----
NM_018905chr532370 429 410 11973 ----
NM_018906chr532370 429 410 11973 ----
NM_018907chr532370 429 410 11973 ----
NM_018908chr532370 429 410 11973 ----
NM_018909chr532370 429 410 11973 ----
NM_018910chr532370 429 410 11973 ----
NM_018911chr532370 429 410 11973 ----
NM_018970chr732922 2499 1242 12956 ----
NM_019042chr731115 1100 1000 ------
NM_019106chr2242554 2084 218 111 ------
NM_019593chr2053060 2620 889 494 32 --152 --
NM_019610chr1------12154
NM_020135chr6----1415 --
NM_020148chr1843041 3032 2630 411 ----11987
NM_020178chr1711138 ------
NM_020245chr634685 1578 233 14986 24605 538 11181
NM_020342chr2--12072 ----
NM_020354chr101340 ----1748
NM_020390chr354360 3969 3592 1504 364 ----14767
NM_020425chr612018 11424 ----
NM_020526chr111230 ------
NM_020655chr161146 ------
NM_020665chrX1254 ------
NM_020711chr242442 2111 2033 375 1427 1214 --
NM_020717chrX44688 3700 3537 1018 14199 1462 --
NM_020727chr2133552 1470 543 11220 ----
NM_020734chr1243072 3029 1257 220 --1962 --
NM_020739chr1543921 3888 3345 810 ------
NM_020752chr10--1588 ----
NM_020768chr543092 2719 2523 376 ------
NM_020772chr1718473 --31535 1481 685 12756
NM_020774chr1814309 ----11133
NM_020794chr111054 ------
NM_020800chr311181 ------
NM_020807chr1621209 150 ------
NM_020819chr6------1398
NM_020824chr101233 ------
NM_020834chr1411868 ------
NM_020841chr1222608 136 13212 ----
NM_020856chr1941201 1025 534 362 ------
NM_020871chrX12376 ------
NM_020925chr111274 --11194 11366
NM_020940chr1021074 364 11809 ----
NM_020948chr122646 2307 --22539 202 --
NM_020962chr1522476 501 ----12272
NM_020977chr442165 623 304 134 ------
NM_020981chr2166 ------
NM_020987chr101445 --21282 1109 --
NM_021033chr1343037 1073 951 285 ------
NM_021101chr321676 1610 1115 194 --
NM_021174chr82643 270 ------
NM_021180chr11793 ------
NM_021252chr102608 374 ------
NM_021620chr61742 ------
NM_021647chr424003 3060 14699 ----
NM_021825chr11----1342 --
NM_021911chr542151 1975 638 402 ------
NM_021912chr1542654 588 487 375 14149 ----
NM_021923chr411295 ------
NM_021961chr1157080 7023 6362 5622 4533 1715 12915 --
NM_021964chr365255 4792 2101 2075 2069 943 --11154 12567
NM_022048chr1546329 4908 2543 662 11335 12316 --
NM_022060chr14--11334 ----
NM_022080chr201280 --12082 --
NM_022105chr201592 ------
NM_022166chr1633835 1792 475 --25775 2127 --
NM_022336chr2--1594 ----
NM_022374chr22374 130 ------
NM_022465chr1252381 2225 1209 951 54 1518 ----
NM_022658chr121383 ------
NM_022716chr113097 ------
NM_022739chr171818 ------
NM_022742chr7137 ------
NM_022763chr332872 2517 2246 --1731 --
NM_022771chr12187 ------
NM_022778chr1----11414 --
NM_022828chr511721 ------
NM_022845chr16--42037 1426 793 258 ----
NM_022893chr212249 ------
NM_022898chr1444604 1516 1030 321 14284 ----
NM_022901chr951779 1682 680 329 101 ------
NM_022965chr411167 ------
NM_022977chrX--1543 ----
NM_023012chr121705 ------
NM_023929chr83851 838 608 1582 ----
NM_023943chr31218 ------
NM_024007chr511033 ------
NM_024052chr1713152 ------
NM_024429chr71121 ------
NM_024529chr11988 1400 ----
NM_024558chr1441013 1003 815 286 ------
NM_024573chr62667 383 ------
NM_024641chr612647 ------
NM_024659chr21675 1654 ----
NM_024665chr324110 4046 ----1737
NM_024692chr221465 1247 ------
NM_024721chr812639 ------
NM_024755chr15------1809
NM_024761chr934031 1576 877 25051 3752 25345 3882 --
NM_024828chr92636 302 ------
NM_024900chr431474 854 712 22273 1843 ----
NM_024900chr431474 854 712 22273 1843 ----
NM_024911chr1----1601 --
NM_024915chr862095 1832 1036 905 848 688 ------
NM_024989chr237663 6910 776 18144 ----
NM_025047chr31388 ------
NM_025054chr833988 1127 878 --11022 --
NM_025074chr422957 66 ------
NM_025133chr211030 ------
NM_025147chr211130 ------
NM_025191chr132698 454 28 22957 2423 ----
NM_030594chr152347 339 ------
NM_030634chr132450 2018 1887 ------
NM_030647chr745780 5533 1838 1363 ------
NM_030648chr435282 4274 221 14421 --1718
NM_030755chr1442936 950 623 332 ------
NM_030768chr2134 ------
NM_030786chr11562 ------
NM_030791chr1441797 1564 604 36 ------
NM_030801chrX1174 ------
NM_030806chr188840 7897 6426 5795 5756 3316 1386 1146 --28539 8437 --
NM_030816chr1--13019 ----
NM_030912chr101897 ------
NM_030920chr111957 ------
NM_030948chr6171 ------
NM_030963chr61118 ------
NM_031216chr1821614 651 ------
NM_031266chr51462 ------
NM_031267chr71429 ------
NM_031411chr532370 429 410 11973 ----
NM_031442chrX1961 ------
NM_031844chr122870 970 ------
NM_031849chr532370 429 410 11973 ----
NM_031857chr532370 429 410 11973 ----
NM_031858chr1731297 480 66 ------
NM_031860chr532370 429 410 11973 ----
NM_031862chr1731297 480 66 ------
NM_031935chr11158 ------
NM_031936chr13547 535 227 ------
NM_032120chr7196 ------
NM_032121chrX1194 ------
NM_032131chr6--1176 ----
NM_032147chr122797 342 ------
NM_032186chr111234 ----1470
NM_032199chr1053146 2364 1170 661 363 --12405 --
NM_032233chr142289 282 ------
NM_032327chr101464 ------
NM_032352chr1431113 943 236 ------
NM_032420chr51125 ------
NM_032434chr21329 ------
NM_032445chr1512036 12527 ----
NM_032452chr14--11237 ----
NM_032456chr4--1655 ----
NM_032458chrX13418 12601 ----
NM_032505chr332507 876 121 ----1331
NM_032558chr911330 ------
NM_032826chr713906 --25387 1375 --
NM_032859chr1333368 1594 457 --1360 --
NM_032905chr1011025 11291 ----
NM_032949chr131154 ------
NM_032968chrX13429 23488 3004 --12610
NM_032969chrX13429 23488 3004 --12610
NM_032973chrY--23484 2999 --12609
NM_033016chr22147 ------
NM_033029chr31364 ------
NM_033138chr7--1548 ----
NM_033139chr7--1548 ----
NM_033140chr7--1548 ----
NM_033157chr7--1548 ----
NM_033181chr6--23078 1322 ----
NM_033224chr755214 5093 3105 1631 1557 11775 ----
NM_033254chr3186 ------
NM_033389chr1744717 4341 3787 795 11109 13595 --
NM_033495chrX1307 ------
NM_033549chr51900 ------
NM_033644chr5------12489
NM_033645chr5------12489
NM_033656chr2135167 2190 45 11571 ----
NM_052834chr1811018 --11627 --
NM_052879chr1233582 3377 2761 ------
NM_052913chr62925 32 ------
NM_052923chr6129 ------
NM_052927chr512041 1183 ----
NM_052932chr1142485 1926 391 350 1782 1288 --
NM_053043chr754788 4476 2093 1546 1249 14223 ----
NM_057178chr171228 ------
NM_057749chr81378 ------
NM_058191chr211152 ------
NM_080546chr922042 638 11487 ----
NM_080597chr181154 ------
NM_080618chr201275 ------
NM_080629chr111235 ------
NM_080630chr111235 ------
NM_080669chr1754600 4405 4095 3485 1389 ------
NM_080742chr6190 ------
NM_080745chr15146 ------
NM_080764chr2222347 609 32512 268 179 ----
NM_080796chr201592 ------
NM_130395chr6----1415 --
NM_130436chr2121717 998 ------
NM_130438chr2112294 ------
NM_130439chr10--1455 ----
NM_130439chr10--1455 ----
NM_130830chr312580 ------
NM_133265chrX33082 1399 1075 ------
NM_133372chr5----1129 --
NM_133646chr233705 1079 1050 15319 ----
NM_134421chr25790 758 719 629 119 1768 ----
NM_134442chr21546 ------
NM_134447chr191148 ------
NM_138288chr1432189 1533 473 ------
NM_138340chr18----1441 --
NM_138437chrX1224 ------
NM_138444chr1313101 ----1929
NM_138473chr1211965 ------
NM_138576chr1444604 1516 1030 321 14284 ----
NM_138713chr1636577 1805 839 --17059 --
NM_138714chr1636577 1805 839 --17059 --
NM_138731chr1434165 3390 453 12806 ----
NM_138735chr211338 ------
NM_139245chr311421 ------
NM_139312chr10--11465 ----
NM_139321chr2054116 3665 3327 2690 72 21612 1556 ----
NM_139323chr203475 208 166 ------
NM_144578chr1445351 4843 4358 4016 --1101 --
NM_144599chr1522216 39 21241 1058 13894 --
NM_144778chr131498 1751 ----
NM_144949chr24713 617 518 269 1676 1293 --
NM_144963chr812729 ----1504
NM_144979chr41116 ------
NM_145029chr6--1272 ----
NM_145055chr184750 715 482 109 32614 1179 762 21000 438 --
NM_145117chr1121086 651 ------
NM_145174chr2221394 153 --11511 --
NM_145203chr131655 ------
NM_145251chr14--1289 ----
NM_145259chr235925 4885 2531 ------
NM_145284chrX12067 1920 ----
NM_145307chr1033847 2878 940 164 ----
NM_145313chr1011611 ------
NM_145320chr712668 12687 ----
NM_145321chr712668 12687 ----
NM_145322chr712668 12687 ----
NM_145330chr2----1146 --
NM_145799chrX53095 821 729 405 129 ------
NM_145802chrX2353 205 ------
NM_145804chr1131191 477 66 11296 1979 --
NM_145891chr1621449 1112 ------
NM_145892chr1621449 1112 ------
NM_145893chr1621571 1234 ------
NM_147171chr7----1470 --
NM_147175chrX31926 1872 1550 --11667 --
NM_147185chr7----1470 --
NM_147223chr211606 ------
NM_148976chr111230 ------
NM_152261chr1251897 1807 880 472 49 --12415 --
NM_152265chr12564 314 --21071 278 --
NM_152409chr53509 193 180 1592 ----
NM_152512chr221434 ------
NM_152520chr21342 ------
NM_152522chr21998 ------
NM_152549chr51191 1140 ----
NM_152588chr1231233 739 269 21724 1672 ----
NM_152641chr1222096 982 ------
NM_152666chr11763 ------
NM_152671chr2----1100 --
NM_152678chr352713 2065 554 318 230 --11947 12659
NM_152682chr42502 83 ------
NM_152695chrX41632 1521 679 661 ------
NM_152699chr31937 ----1442
NM_152707chr101123 1963 ----
NM_152716chr1111320 --11644 --
NM_152739chr71209 --1748 1261
NM_152756chr523055 1202 1497 13659 14316
NM_152758chr81898 12511 12493 --
NM_152774chr71589 1796 --1827
NM_152787chrX13893 --23647 533 --
NM_152793chr724988 610 12021 ----
NM_152835chr132288 2220 2111 ------
NM_152860chr121153 --1514 --
NM_152896chr91664 ------
NM_152999chr723616 3249 ------
NM_153042chr631325 685 560 ------
NM_153183chrX11260 11027 11019 --
NM_153186chr91582 ------
NM_153188chr532274 957 740 25000 4972 ----
NM_153218chr134634 586 321 127 ------
NM_153261chr16----11544 --
NM_153453chr61726 ------
NM_153634chr121634 ------
NM_153702chr41290 ------
NM_153810chr1025087 389 22001 1842 24954 4675 --
NM_170674chr1511293 ------
NM_170675chr151969 ------
NM_170676chr151969 ------
NM_170677chr1511293 ------
NM_172069chr222165 106 1612 ----
NM_172071chr146027 2413 1813 52 1390 --12499
NM_172240chr1231328 958 121 ------
NM_172315chr1511293 ------
NM_172316chr1511293 ------
NM_173039chr111182 ------
NM_173214chr1636577 1805 839 --17059 --
NM_173463chr484438 4292 4215 3416 3244 1206 929 661 ------
NM_173470chrX2205 62 ------
NM_173478chr173710 298 256 ------
NM_173511chr233895 2431 1369 ------
NM_173582chr1155823 5500 4811 1831 35 1496 ----
NM_173589chr111183 ------
NM_173808chr124162 4137 ------
NM_173814chr151170 ------
NM_173834chrX1107 ------
NM_173851chr833176 1227 1193 11553 ----
NM_174963chr1----1590 --
NM_174964chr1----1590 --
NM_174965chr1----1609 --
NM_174966chr1----1590 --
NM_174967chr1----1609 --
NM_174968chr1----1590 --
NM_174969chr1----1590 --
NM_174970chr1----1609 --
NM_174971chr1----1590 --
NM_175619chr41136 ------
NM_175922chr6------1584
NM_176787chr183517 236 127 11359 ----
NM_177398chr111591 ------
NM_177399chr111591 ------
NM_177535chrX1174 ------
NM_177947chrX1623 --21660 1362 --
NM_177948chrX1623 --21660 1362 --
NM_177983chr2196 ------
NM_178140chr512404 ------
NM_178151chrX77541 7454 7109 6909 5681 5675 2108 15438 ----
NM_178152chrX77541 7454 7109 6909 5681 5675 2108 15438 ----
NM_178153chrX77541 7454 7109 6909 5681 5675 2108 15438 ----
NM_178313chr211450 ------
NM_178527chr1------131
NM_178812chr811607 ------
NM_181354chr831528 660 574 --1394 --
NM_181358chr133332 3121 939 --11516 --
NM_181504chr542911 2557 2549 1484 13643 ----
NM_181523chr542911 2557 2549 1484 13643 ----
NM_181524chr542911 2557 2549 1484 13643 ----
NM_181659chr2032949 1262 250 --1132 12971
NM_181659chr2032949 1262 250 --1132 12971
NM_181670chr1221160 278 ------
NM_181672chrX1411 ------
NM_181673chrX1411 ------
NM_181782chr61708 ------
NM_181836chr531766 616 293 12354 ----
NM_181869chr122424 58 ------
NM_181886chr41513 ------
NM_181887chr41513 ------
NM_181888chr41513 ------
NM_181889chr41513 ------
NM_181890chr41513 ------
NM_181891chr41513 ------
NM_181892chr41560 ------
NM_181893chr41513 ------
NM_182314chrX31247 759 324 ------
NM_182485chr41801 ------
NM_182645chr61726 ------
NM_182646chr41801 ------
NM_182648chr14--1509 ----
NM_182666chr3----1104 --
NM_182728chr1411727 ------
NM_182729chr1231446 730 229 21857 1211 ----
NM_182742chr1231446 730 229 21857 1211 ----
NM_182743chr1231446 730 229 21857 1211 ----
NM_182765chr1021566 293 --11583 --
NM_182894chr1411752 ------
NM_182948chr142721 2676 2487 1032 1803 12875 --
NM_182964chr1121086 651 ------
NM_182972chr142303 1114 500 484 ------
NM_182975chr11151 ------
NM_183353chrX11115 ------
NM_183380chr6--1906 ----
NM_183381chr31157 ------
NM_183383chr31157 ------
NM_183384chr31157 ------
NM_194247chr211776 --23901 672 --
NM_194286chr1245190 2466 1390 225 ----14892
NM_194291chr822132 1213 --12827 --
NM_194314chr135174 3537 2135 --15323 1719
NM_194434chr1854546 2260 792 571 433 ----15729
NM_197941chr532131 837 677 1212 11103 --
NM_197968chr13------1134
NM_197977chr91868 ------
NM_198043chr101464 ------
NM_198044chr101464 ------
NM_198045chr101464 ------
NM_198046chr101464 ------
NM_198120chr81518 ------
NM_198173chr11793 ------
NM_198174chr11793 ------
NM_198181chr1531973 1123 996 12669 12777 --
NM_198261chr121705 ------
NM_198262chr121705 ------
NM_198268chr133332 3121 939 --11516 --
NM_198269chr133332 3121 939 --11516 --
NM_198270chrX32895 1400 395 ------
NM_198324chr121893 ----21028 947
NM_198334chr11----1911 --
NM_198391chr201536 1421 ----
NM_198404chr131623 --1312 --
NM_198443chr16199 ------
NM_198467chr71587 ------
NM_198485chr321818 566 12198 ----
NM_198507chr51437 --1102 --
NM_198581chr257386 7075 1024 528 165 ------
NM_198597chr102875 282 ------
NM_198794chr1421013 308 ------
NM_198859chr334665 3110 1753 21856 960 11408 --
NM_199188chr1233582 3377 2761 ------
NM_199190chr1233582 3377 2761 ------
NM_199205chr82643 270 ------
NM_199245chr12------12293
NM_199262chr172781 29 --11559 --
NM_199327chr411074 --1245 --
NM_199461chr102870 707 --1609 --
NM_201266chr212920 ------
NM_201269chr111234 ----1470
NM_201279chr212920 ------
NM_201428chr11--11665 ----
NM_201429chr11--11665 ----
NM_201430chr11--11591 ----
NM_201453chr92118 59 ------
NM_201627chr51296 ------
NM_203283chr4--1450 ----
NM_203284chr4--1450 ----
NM_203301chr14----1168 --
NM_203372chr2----1438 --
NM_203394chr1242427 1831 1107 553 12572 ----
NM_203406chr522146 1896 --11934 --
NM_203458chr11720 ------
NM_206808chr13----137 --
NM_206855chr634343 3909 1879 12147 ----
NM_206876chr212668 --11097 --
NM_206909chr868011 7757 5749 5336 3067 948 17906 ----
NM_207171chr13434 295 80 --195 --
NM_207291chr191525 ------
NM_207304chr131385 1638 ----
NM_212558chr942949 1508 1427 483 1598 ----
NM_212559chrX3807 670 201 ------
NM_213589chr224510 382 ------