TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-365a-5p
miRNA Sequence: AGGGACUUUUGGGGGCAGAUGUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX96368 5227 4890 4852 4222 2169 1217 984 894 22605 1595 ----
NM_000176chr523142 326 1834 11312 13129
NM_000208chr19104344 4268 4007 3514 1530 815 613 559 413 181 24436 3931 11032 --
NM_000210chr232335 2218 890 ----11798
NM_000216chrX22983 209 --1616 13322
NM_000259chr1576077 5341 4909 4637 3881 2117 1985 15081 21868 439 --
NM_000337chr586516 5976 5781 5173 5113 2278 1600 972 36281 5420 4864 12313 --
NM_000351chrX94136 4104 4069 4063 3810 3246 1640 1240 887 --24089 970 22911 545
NM_000368chr9114118 3562 1520 1193 999 629 542 441 383 130 105 24606 1688 ----
NM_000390chrX12700 13228 23042 2522 23218 964
NM_000489chrX73361 2857 896 702 627 508 105 23380 3285 1261 --
NM_000555chrX86971 6683 5574 5031 4932 4775 922 24 12176 12500 12629
NM_000610chr1192292 2199 817 794 744 602 379 247 171 ----12079
NM_000618chr1284806 2293 2107 1172 1118 1091 761 288 --24061 1049 --
NM_000618chr1284806 2293 2107 1172 1118 1091 761 288 --24061 1049 --
NM_000633chr1843621 3198 975 551 21963 275 25152 4448 11540
NM_000719chr1266119 5867 4327 1272 1162 222 24522 2638 45703 5195 5106 827 14392
NM_000926chr11109179 8543 8339 7874 7819 7797 7159 6185 6094 3414 38317 8191 7715 18988 47384 7082 3278 2548
NM_001001389chr1192292 2199 817 794 744 602 379 247 171 ----12079
NM_001001390chr1192292 2199 817 794 744 602 379 247 171 ----12079
NM_001001391chr1192292 2199 817 794 744 602 379 247 171 ----12079
NM_001001392chr1192338 2245 863 840 790 648 425 293 217 ----12125
NM_001001974chr1012168 --11912 1950
NM_001002243chr21109 ----1182
NM_001002860chr1433449 3108 631 21276 997 24242 4003 1599
NM_001003407chr1064562 3791 3762 1696 1441 133 ----1925
NM_001003408chr1064562 3791 3762 1696 1441 133 ----1925
NM_001003652chr18108540 7875 7294 6211 5834 3162 2531 1823 99 72 --48315 6325 6286 866 17586
NM_001003674chr1856838 5176 2506 695 633 --15617 1862
NM_001003675chr1856838 5176 2506 695 633 --15617 1862
NM_001004304chr12102986 2899 2835 2546 2304 2091 2071 450 243 211 31111 968 77 --22346 1061
NM_001004360chr271470 1451 1235 591 387 170 164 --11519 --
NM_001004419chr1254311 4118 4089 3596 1349 1340 34209 4100 1425 --
NM_001005473chr555663 5547 4692 4113 99 --16654 14016
NM_001007097chr953511 1880 1050 917 632 --1688 14500
NM_001007102chr621499 1487 --195 11421
NM_001008895chr1341386 1220 1015 906 11329 1290 --
NM_001009554chr451712 1268 1152 1028 506 --11282 13603
NM_001009554chr451712 1268 1152 1028 506 --11282 13603
NM_001010862chrX83130 2938 2921 2825 2671 2144 235 59 23139 1037 13098 --
NM_001010888chrX64439 4309 4067 3444 3011 1064 --21260 263 21330 279
NM_001010984chr151827 1751 1675 519 85 11685 1277 11774
NM_001011513chr433145 3033 149 11300 --1971
NM_001011666chr746281 6009 1697 970 11358 --16257
NM_001012393chr11105199 4844 4837 4467 3708 3524 3341 1490 1455 751 14332 13157 --
NM_001013620chr1267956 7866 6343 3148 993 828 17692 22849 502 --
NM_001014797chr1032572 1495 1458 27705 2811 --11066
NM_001017368chr1732090 1115 897 12421 41934 1025 480 405 --
NM_001018065chr975566 4903 4455 3871 3718 1515 294 12030 14113 11655
NM_001018066chr975566 4903 4455 3871 3718 1515 294 12030 14113 11655
NM_001018067chr133761 3522 3254 --24509 389 1979
NM_001018068chr133761 3522 3254 --24509 389 1979
NM_001018069chr133761 3522 3254 --24509 389 1979
NM_001018074chr523142 326 1834 11312 13129
NM_001018075chr523142 326 1834 11312 13129
NM_001018076chr523142 326 1834 11312 13129
NM_001018077chr523142 326 1834 11312 13129
NM_001024094chr523142 326 1834 11312 13129
NM_001024847chr312291 ----22422 1715
NM_001025076chr1086181 5552 5520 5234 5213 4470 2104 1873 15398 24755 501 --
NM_001025077chr1087539 6910 6878 6592 6571 5828 1037 978 16756 26113 1859 154
NM_001025616chr431762 289 106 --1693 11251
NM_001029858chr653313 3182 2371 2335 1125 22649 1219 1731 --
NM_001029955chr452995 1047 717 640 485 22592 421 22834 207 --
NM_001032280chr641336 305 162 152 ----1571
NM_001034841chr1684952 3707 1835 1633 1468 1450 504 310 --1347 --
NM_001037174chr221936 484 ----1165
NM_001039111chr3--1107 --1174
NM_001039693chr273892 3746 3716 3195 1468 633 214 23142 2959 --23905 812
NM_001040152chr784866 4522 3579 3569 1456 1448 768 333 14404 23640 39 --
NM_001040284chr1645383 5320 5046 422 24644 1039 --15333
NM_001040446chr542031 943 841 433 1749 --1560
NM_001040712chr953551 3149 1217 750 57 --33207 493 89 13586
NM_001042355chr1685081 4870 4780 4747 2141 1628 819 233 144 ----
NM_001042412chr1685081 4870 4780 4747 2141 1628 819 233 144 ----
NM_001042413chr994067 3966 2965 2707 1592 1582 1405 1217 833 31606 1389 1249 13730 11358
NM_001042425chr641336 305 162 152 ----1571
NM_001042599chr275541 5217 3093 2455 2113 1686 1486 --25158 2546 15199
NM_001042603chr1255084 3884 1956 1805 749 --1127 13806
NM_001042604chr364310 4132 3645 2951 1549 1532 --13873 1950
NM_001042669chr431762 289 106 --1693 11251
NM_001099678chr365339 2372 2228 1845 173 76 34898 4011 180 --15884
NM_001106chr3118977 8132 8010 7278 6899 3831 2660 2114 1684 1124 805 48542 8072 7656 7102 ----
NM_001204chr296916 6856 6696 6365 6013 3073 2771 2759 223 35379 4985 1669 11238 27035 5337
NM_001259chr7116117 5799 5703 5387 5173 4974 2362 1628 1309 762 61 26013 1243 14445 12177
NM_001329chr1071381 1192 598 417 408 318 301 11604 ----
NM_001364chr1164160 3405 3272 1821 903 893 ------
NM_001419chr1984266 3300 3218 3048 1938 1085 527 276 14787 2500 483 --
NM_001424chr161524 ----3596 502 255
NM_001543chr584520 1701 1678 1308 799 488 281 229 64024 3128 2955 1111 1085 502 13868 11793
NM_001663chr1441957 722 698 470 --2763 331 --
NM_001699chr1951566 1479 1405 1181 272 1439 2359 150 11152
NM_001753chr721761 1316 ----173
NM_001859chr983867 2570 2484 1557 1280 811 503 171 --13117 --
NM_001969chr1483672 2803 2711 1224 522 439 420 179 13119 ----
NM_002006chr474820 1417 1182 800 521 501 474 ------
NM_002015chr1363373 2749 2725 2418 1197 1174 --12102 13112
NM_002025chrX52404 2162 1669 1211 279 28379 1922 --18981
NM_002092chr434629 3240 877 34059 778 84 24917 1422 --
NM_002158chr211368 ----22478 207
NM_002264chr354392 3083 981 75 54 ----24123 3664
NM_002270chr535493 5055 1748 126 34250 4113 1026 --
NM_002313chr1064562 3791 3762 1696 1441 133 ----1925
NM_002336chr1244664 3747 1656 404 13869 1670 --
NM_002508chr141676 1567 1309 544 31785 1279 524 1193 --
NM_002545chr11105199 4844 4837 4467 3708 3524 3341 1490 1455 751 14332 13157 --
NM_002547chrX54217 3961 3574 3215 237 --23182 1432 11265
NM_002581chr985669 4694 4405 3746 1746 1094 564 220 1252 ----
NM_002731chr13916 653 101 ----12697
NM_002839chr953551 3149 1217 750 57 --33207 493 89 13586
NM_002857chr152376 2245 2127 1019 102 130 --1245
NM_003034chr1297497 7180 6570 4960 4914 1721 1339 909 647 12267 --38094 7116 4938
NM_003048chr212527 32689 1117 192 --22360 817
NM_003112chr723015 637 11067 13068 1557
NM_003199chr1844466 1263 376 122 --12230 22038 1446
NM_003220chr641336 305 162 152 ----1571
NM_003242chr312291 ----22422 1715
NM_003298chr365708 5339 3996 2235 1273 867 --34206 2459 376 --
NM_003330chr1221620 1611 1262 --11789
NM_003387chr222369 2130 --32767 1822 355 --
NM_003566chr1253211 3116 2710 2456 880 --22303 2156 --
NM_003574chr1874909 3606 1861 1001 925 841 247 --11590 1743
NM_003589chr1341386 1220 1015 906 11329 1290 --
NM_003607chr173973 3873 3654 3200 2706 731 420 2374 363 ----
NM_003615chr364032 2886 2610 1605 1306 869 23813 1347 ----
NM_003872chr212373 1605 --22444 2269
NM_003895chr211275 --1590 1580
NM_003909chr842810 2647 2396 180 11989 --1981
NM_003939chr1053037 3002 2673 1005 553 ----12614
NM_003966chr596558 6432 1900 1499 1121 799 427 267 40 --32590 1531 1401 --
NM_004035chr1743544 3179 1248 537 11876 --11014
NM_004090chr1783215 2544 2238 833 623 530 144 31 --42910 2613 2448 352 11057
NM_004096chr1071518 1480 821 634 389 121 109 12078 --12162
NM_004100chr652628 2297 2256 1781 268 1465 --1991
NM_004112chr1761711 1238 367 359 308 74 1671 11221 21326 121
NM_004117chr652101 1369 774 311 263 31748 547 27 1622 --
NM_004171chr1169016 8501 8323 6181 2283 1249 --25949 2635 18857
NM_004232chr1873789 3414 3337 3195 1282 300 204 13057 11547 --
NM_004279chr761881 1871 888 820 698 670 --32254 1735 373 --
NM_004338chr1856838 5176 2506 695 633 --15617 1862
NM_004370chr6--11939 11680 1262
NM_004380chr1682014 1853 1811 1798 1747 1709 1634 340 11716 11655 12587
NM_004392chr1352238 1737 1698 238 71 --189 --
NM_004411chr71782 1638 170 1611
NM_004438chr242924 2082 907 703 11267 --1508
NM_004485chr163205 2929 1707 1200 579 265 24240 1089 146 --
NM_004514chr1732649 2573 607 --23070 887 12996
NM_004586chrX64681 4587 4015 1363 867 53 23883 608 --11008
NM_004598chr553308 2730 2589 2578 2314 --2864 815 --
NM_004612chr944700 4644 1695 1038 --31610 1581 698 14293
NM_004719chr1232578 2209 719 11805 1502 12254
NM_004742chr32653 31 ----11533
NM_004748chr1534068 3446 1141 1708 --13984
NM_004815chr1104606 4353 4117 4012 3837 3034 1622 1489 1085 270 24482 331 13507 --
NM_004904chr746281 6009 1697 970 11358 --16257
NM_004976chr1194332 3698 2005 1886 562 463 313 301 62 12046 24713 3284 15134
NM_004992chrX157180 6129 5919 5891 5839 5207 3416 2605 1788 1705 1441 1351 1061 672 569 37362 2419 2332 22476 2009 15797
NM_004992chrX157180 6129 5919 5891 5839 5207 3416 2605 1788 1705 1441 1351 1061 672 569 37362 2419 2332 22476 2009 15797
NM_005056chr1275328 4128 3481 2200 2049 993 177 --1371 14050
NM_005095chr131790 1751 87 --194 --
NM_005116chr2052918 2863 1318 315 52 ----23580 260
NM_005156chr934281 1423 461 11789 --14227
NM_005188chr11158242 8206 7359 7284 6569 2648 2320 2299 1964 1507 1396 581 233 107 83 58004 6590 5956 3313 2823 17926 --
NM_005197chr1445490 1331 934 615 --14567 24584 4239
NM_005235chr275541 5217 3093 2455 2113 1686 1486 --25158 2546 15199
NM_005238chr1162586 2504 2344 1189 1109 931 11048 21124 999 --
NM_005359chr1896496 6458 6060 5916 5111 1974 1679 1370 394 ----16450
NM_005373chr171496 1446 1420 1325 416 322 25 ------
NM_005497chr1765119 5103 4799 4036 768 579 --24524 401 --
NM_005596chr985703 5515 4940 4851 4144 2498 2005 368 --1924 12344
NM_005604chr612462 ----11788
NM_005759chr263723 3102 3049 2955 1570 1435 11467 3998 817 658 --
NM_005779chr532539 767 250 12945 --12577
NM_005828chr1784221 2022 1714 1675 701 676 557 148 33642 3118 1414 11539 --
NM_005840chrX65705 5542 5198 5092 2354 42 12620 27031 6668 --
NM_005898chr1112070 11999 --12363
NM_005901chr18108540 7875 7294 6211 5834 3162 2531 1823 99 72 --48315 6325 6286 866 17586
NM_005909chr554330 1530 1513 1200 879 24302 2959 ----
NM_005910chr1733012 1624 1322 33313 2868 1363 22818 1107 13999
NM_005941chr861309 1120 1111 574 362 219 ----13352
NM_006047chr2073534 2981 1144 1086 747 648 556 --2885 462 --
NM_006060chr733834 876 422 23322 1694 --24045 3047
NM_006095chr463790 3311 1127 1023 607 225 ------
NM_006108chr1162291 2276 2054 1472 960 509 21907 359 42038 1843 1771 490 --
NM_006158chr82673 356 185 --11717
NM_006202chr1951738 1701 1387 615 427 --1227 2565 396
NM_006203chr552200 2187 1957 873 501 13457 23830 1651 --
NM_006206chr42998 310 12345 32447 1793 121 1991
NM_006252chr166308 5179 4626 1820 1662 878 --17604 --
NM_006375chrX31689 1518 1476 11282 3440 263 98 --
NM_006379chr711886 ----1404
NM_006393chr1034321 3298 660 24266 673 13949 --
NM_006457chr433145 3033 149 11300 --1971
NM_006504chr1052407 2376 689 547 495 ----11098
NM_006544chr1485859 5684 5468 5381 5189 4890 1412 34 15063 ----
NM_006546chr17106245 6215 5934 4151 2423 2361 1547 1151 911 27 15491 25104 971 --
NM_006561chr1086181 5552 5520 5234 5213 4470 2104 1873 15398 24755 501 --
NM_006572chr1792992 2979 2518 2491 2305 1408 1160 485 245 2983 390 --13164
NM_006599chr1642828 2240 1067 436 --16703 15107
NM_006614chr383686 2635 2444 1434 1366 543 477 386 12610 1282 13205
NM_006621chr141972 1926 200 148 ----1492
NM_006626chr942502 909 321 53 1158 1789 1225
NM_006717chr963296 3062 1198 700 660 213 ------
NM_006720chr1064562 3791 3762 1696 1441 133 ----1925
NM_006729chrX74753 4570 4354 1846 1362 1227 934 34648 3515 1695 --12167
NM_006750chr16117862 7023 6819 6580 6337 6055 1986 1920 1742 1503 1430 15898 56707 6222 6065 3150 533 27882 1832
NM_006766chr832153 1864 1030 ----1789
NM_006777chrX62890 2293 2037 1174 1014 752 --22331 576 --
NM_006811chr202956 627 ----1977
NM_006888chr1443061 2266 1352 94 22405 2170 --1270
NM_006924chr1744404 4335 1219 328 23663 937 13836 22701 982
NM_007050chr2098020 7354 6562 2608 2270 1368 1091 934 30 11698 47756 5111 2005 1312 --
NM_007249chr1388832 7668 6957 6329 5832 3319 2731 2390 35892 3566 1511 1722 1524
NM_007292chr1743544 3179 1248 537 11876 --11014
NM_007350chr1254391 3579 1504 502 99 11638 23598 1423 --
NM_012097chr221936 484 ----1165
NM_012104chr1143284 2986 2824 1510 1670 --33034 2816 839
NM_012104chr1143284 2986 2824 1510 1670 --33034 2816 839
NM_012164chr966782 6270 6080 685 542 94 36295 2845 799 15997 27158 5660
NM_012306chr1293428 2654 2493 2400 2186 1225 1146 1004 963 22318 1239 23517 2932 13149
NM_012316chr185670 5560 5216 4602 4167 2011 1445 1157 25326 2069 43802 996 695 621 --
NM_012334chr564472 4053 3077 1367 1290 832 44236 3767 1503 719 13966 --
NM_012479chr722325 351 --1552 11788
NM_013269chr1254238 4045 4016 3523 1276 1267 34136 4027 1352 --
NM_013313chr2263361 2758 2727 2262 831 238 --12649 1873
NM_013374chr323138 2576 2548 162 --1710
NM_014112chr855319 4977 1740 709 485 24717 3830 ----
NM_014155chr1176911 6037 5370 5093 2207 1903 543 12552 36071 5849 4772 15417
NM_014331chr477534 6988 6966 6179 2623 239 79 25018 939 15473 --
NM_014554chr122690 309 11812 1546 2681 673
NM_014584chr1431347 1122 175 --1299 11111
NM_014614chr22571 367 1309 1517 1258
NM_014707chr721886 344 1532 32284 1706 1639 --
NM_014721chr645438 2800 1023 641 --25461 1153 15699
NM_014746chr244010 3772 3483 373 21529 1086 11092 --
NM_014826chr173973 3873 3654 3200 2706 731 420 2374 363 ----
NM_014877chr1797724 7694 7364 6774 5929 5830 4703 1974 94 16849 --26964 5419
NM_014891chr71500 ----21528 1226
NM_014939chr1881388 1035 521 462 415 389 294 288 11090 ----
NM_014961chr431493 351 30 --21460 218 12071
NM_015026chr1274180 3958 3621 3589 3046 1697 882 13351 14740 --
NM_015027chr16156 --1669 11572
NM_015032chr1342781 2365 650 643 ----12568
NM_015042chr1532976 2826 1358 11289 23470 815 --
NM_015068chr783718 3374 2431 2421 1489 1101 308 300 13256 22492 1314 --
NM_015076chr683950 3132 1796 1723 820 784 713 504 --13912 --
NM_015092chr1654091 3525 2921 1281 732 34704 3667 1677 ----
NM_015100chr131848 1792 1315 --11641 1592
NM_015144chr1673375 3064 1557 1364 1207 1043 74 1393 11236 23492 779
NM_015147chr252932 2909 2323 1006 752 22062 1288 178 11068
NM_015208chr1843357 2757 840 113 13968 --12784
NM_015247chr1685081 4870 4780 4747 2141 1628 819 233 144 ----
NM_015282chr2112861 2169 2074 1949 1224 1106 942 820 650 528 137 --1689 --
NM_015288chr593781 2587 1341 1061 946 885 874 81 38 1567 1239 11172
NM_015310chr8137819 7567 7091 7011 6221 3205 3185 3040 1338 1328 1261 1193 97 27035 5782 --16618
NM_015313chr1144322 3446 3041 1522 ----1141
NM_015332chr763557 3337 2304 2218 1169 664 --32866 1380 890 22506 2291
NM_015335chr1272519 2420 2144 838 271 119 34 ------
NM_015338chr2031843 1778 1349 ----11663
NM_015520chr362790 1887 552 503 276 41 11832 32736 1796 459 1636
NM_015553chr663957 3603 1689 1485 1040 104 13374 14568 --
NM_015568chr2093973 3302 3140 2970 1522 1358 1302 563 541 42787 1684 1460 479 1600 --
NM_015576chr342332 2222 867 842 12518 --124
NM_015609chr1--11837 --2751 448
NM_015640chr133761 3522 3254 --24509 389 1979
NM_015713chr872502 2247 1441 1361 629 529 365 ------
NM_015886chr855737 4866 1074 656 625 21659 683 --12136
NM_016072chr1211996 ----22371 696
NM_016083chr633563 3067 289 12908 --1247
NM_016132chr1573199 1341 1062 1014 752 604 202 12363 ----
NM_016206chr378888 7193 6895 6556 2667 2112 1497 1173 28150 1207 25464 2903
NM_016224chr651899 1830 1397 485 342 --1361 --
NM_016257chr183274 3168 2540 2327 498 195 124 23 1365 22470 981 13049
NM_016260chr296697 6264 5250 5048 2890 1985 1140 662 375 --21453 1411 --
NM_016297chr231199 720 532 133 13162 11000
NM_016376chr1784238 2973 2902 1629 1040 739 513 366 24383 1108 11192 13276
NM_016834chr1733012 1624 1322 33313 2868 1363 22818 1107 13999
NM_016835chr1733012 1624 1322 33313 2868 1363 22818 1107 13999
NM_016841chr1733012 1624 1322 33313 2868 1363 22818 1107 13999
NM_017415chr583482 2857 1726 1538 1190 968 908 498 23947 1559 ----
NM_017628chr464773 3953 3926 1907 1260 1005 ----24306 1667
NM_017637chr9109129 9098 8138 7910 7483 6226 6191 2983 2455 1773 --38747 7399 3075 --
NM_017650chr755770 4488 3942 3862 855 --145 14322
NM_017657chr21109 ----1182
NM_017658chr1413841 --11581 24287 4256
NM_017666chrX61419 745 600 356 67 60 --153 --
NM_017709chr193113 3029 2930 2751 2729 2717 2635 1227 931 ------
NM_017778chr82381 45 ----11369
NM_017873chr942725 1924 906 788 12161 62961 2836 2444 1933 1027 231 11081
NM_017919chr995139 5044 4334 4112 3890 3831 2333 762 493 24790 1931 ----
NM_018045chr132090 788 104 2762 82 12407 12036
NM_018121chr1043071 2221 2031 824 11967 --23173 430
NM_018243chr423676 1109 12735 23624 1535 11161
NM_018348chr16--1848 --21138 129
NM_018374chr784696 4492 4485 3716 1681 1673 1296 399 --11850 --
NM_018424chr951802 1607 491 264 115 ----11562
NM_018440chr8118152 7703 6681 5991 5766 5503 5487 2138 2108 654 575 26303 3204 26892 6719 --
NM_018555chr1941826 1559 427 318 1882 --1127
NM_018958chr1573905 3863 3253 2542 1186 563 468 32880 855 198 ----
NM_018979chr123991 295 172 --1637 1750
NM_018999chr1064962 3433 3068 1869 1274 305 23862 1065 34924 3618 338 --
NM_019001chr364310 4132 3645 2951 1549 1532 --13873 1950
NM_019098chr841142 601 583 37 --21549 1169 --
NM_020122chr255797 5208 4609 2080 1523 15511 24538 1408 --
NM_020346chr112562 113 ----1186
NM_020390chr324819 612 23512 945 14340 --
NM_020466chr674562 4149 4119 1628 747 654 573 24723 461 134 --
NM_020647chr842262 2183 1806 313 12031 21838 24 --
NM_020717chrX84678 4518 4186 3464 3410 1619 1118 628 25034 4845 ----
NM_020718chr1674300 2438 1727 1510 1134 764 275 14983 12167 --
NM_020739chr1534068 3446 1141 1708 --13984
NM_020766chrX44339 1771 839 160 13521 --12898
NM_020772chr17107363 6855 2863 2339 2296 2229 2119 1990 1050 692 22604 1862 1350 --
NM_020774chr1835370 4683 79 11619 31575 1521 265 1487
NM_020868chr271470 1451 1235 591 387 170 164 --11519 --
NM_020975chr1031609 112 62 11410 11872 11297
NM_021116chr766756 5929 5570 2408 2156 1769 27010 6406 17230 18136
NM_021202chr20102595 2264 2020 1190 1178 575 357 313 274 208 22887 2553 --12404
NM_021622chr1012168 --11912 1950
NM_021629chr343739 1396 1348 611 --21293 462 --
NM_021638chr494543 4433 4334 4161 3561 3270 1697 944 492 23419 1378 1964 --
NM_021647chr451712 1268 1152 1028 506 --11282 13603
NM_021813chr643768 3587 1901 1455 24197 2203 24091 490 35095 4575 1291
NM_021913chr1951566 1479 1405 1181 272 1439 2359 150 11152
NM_021954chr1353299 2527 1055 531 351 1125 --1100
NM_021960chr162635 2026 1120 716 526 216 --21841 1771 --
NM_021961chr1187378 6525 5388 5157 2705 1993 1815 207 --25668 308 --
NM_022166chr1675721 4376 2212 1429 767 461 214 26102 4304 12482 26061 259
NM_022497chr353853 3782 3623 2993 471 33537 2554 1125 --11441
NM_022756chr131462 1366 1226 ----1943
NM_022802chr1071381 1192 598 417 408 318 301 11604 ----
NM_022836chr121397 261 --11277 1273
NM_022898chr1433994 3253 1630 11260 --24460 161
NM_022912chr273086 3042 2959 2837 2604 438 301 11977 ----
NM_024017chr1751474 1378 1106 117 24 --1130 1321
NM_024524chr31395 --12728 1211
NM_024665chr364720 4664 4172 3057 3038 1825 24587 86 ----
NM_024721chr81254 22504 79 --12537
NM_024740chr1132552 161 149 ----11655
NM_024770chr245116 559 377 63 22294 806 14737 12582
NM_024818chr331338 1237 593 ----11262
NM_024947chr3109613 9181 9132 8681 7515 6004 5831 3508 1627 1485 28079 7835 17903 18740
NM_024949chr494853 4376 4028 3973 3114 1712 1563 1542 504 14347 14296 --
NM_024989chr2118131 7417 6384 6177 5935 5228 2819 1557 441 308 111 32205 2011 350 --12557
NM_025134chr1642415 2146 1735 1709 ----11653
NM_025160chr131583 1549 1442 --33944 3900 1562 --
NM_025179chr144202 3067 1525 1131 33741 182 62 34535 4317 3055 --
NM_030621chr1441104 946 441 387 12835 1930 --
NM_030674chr12135847 5677 5650 5243 5194 4812 4792 4485 4248 3887 3865 1625 1055 14374 35539 5031 49 --
NM_030806chr187877 7499 7055 6477 3780 3362 3079 2880 27482 3392 48243 6687 5700 3584 18989
NM_030817chr1263150 2930 944 788 635 319 12382 53611 1382 680 405 147 21159 388
NM_031305chr431762 289 106 --1693 11251
NM_031427chr1461663 1407 976 793 499 478 21686 250 24404 1296 21996 522
NM_031445chr282622 2420 1306 888 784 710 564 138 124 13171 --
NM_031483chr2053128 2608 1395 1205 648 --23526 363 1308
NM_032012chr954825 4474 3574 1631 36 24124 3684 11022 --
NM_032042chr512657 --1729 2801 525
NM_032199chr1053471 3128 2916 1256 613 33267 598 123 ----
NM_032373chr1074775 4161 3638 1672 1269 1228 526 --1547 24292 1002
NM_032438chr621499 1487 --195 11421
NM_032509chr832367 1851 544 --12045 1553
NM_032521chr2082409 2271 1265 898 725 590 397 198 --12115 --
NM_032833chr142405 1630 770 625 ----12471
NM_032982chr732430 2033 2007 1337 12512 1689
NM_033133chr1742925 2451 1265 921 13512 1712 23148 1045
NM_033181chr633563 3067 289 12908 --1247
NM_033221chr97918 670 623 359 335 225 77 32431 1981 579 2788 249 --
NM_033224chr797941 7805 7639 7092 6978 6933 2880 1204 1147 26442 5237 37543 5541 5443 1199
NM_033394chr241576 1167 583 485 1443 11400 --
NM_033512chr842577 2335 2285 1893 12707 11881 12661
NM_033637chr1053037 3002 2673 1005 553 ----12614
NM_052885chr1264902 4329 4156 3116 1724 1648 21504 921 --13455
NM_052966chr183808 3571 2370 1139 994 910 416 23 42888 2478 1435 1364 --11080
NM_057178chr1732090 1115 897 12421 41934 1025 480 405 --
NM_080546chr932316 2029 1671 --12113 1455
NM_080645chr6--11939 11680 1262
NM_080759chr1352238 1737 1698 238 71 --189 --
NM_080760chr1352238 1737 1698 238 71 --189 --
NM_080867chr1445061 4355 3586 456 24400 1706 --11840
NM_080872chr853704 3645 3432 2996 2979 12788 --13207
NM_130387chr331111 926 871 ----1103
NM_130391chr953551 3149 1217 750 57 --33207 493 89 13586
NM_130392chr953551 3149 1217 750 57 --33207 493 89 13586
NM_130393chr953551 3149 1217 750 57 --33207 493 89 13586
NM_130435chr1052407 2376 689 547 495 ----11098
NM_133170chr2098020 7354 6562 2608 2270 1368 1091 934 30 11698 47756 5111 2005 1312 --
NM_133334chr465867 5839 4495 2290 430 269 46238 3894 2082 1773 25633 4715 --
NM_133646chr245504 3768 1656 1188 35158 3417 557 --15391
NM_138270chrX73361 2857 896 702 627 508 105 23380 3285 1261 --
NM_138323chr152317 115 ----2737 362
NM_138348chr565901 5436 4529 2270 1553 181 34598 895 677 ----
NM_138459chr663324 1174 943 650 413 314 ------
NM_138468chr256218 5341 4625 2021 1936 24291 1520 --12081
NM_138576chr1433994 3253 1630 11260 --24460 161
NM_138713chr1642828 2240 1067 436 --16703 15107
NM_138714chr1642828 2240 1067 436 --16703 15107
NM_138959chr196620 6532 6349 6329 5355 5280 4940 1079 998 21972 787 35266 1866 342 --
NM_138971chr1143284 2986 2824 1510 1670 --33034 2816 839
NM_138971chr1143284 2986 2824 1510 1670 --33034 2816 839
NM_138972chr1143284 2986 2824 1510 1670 --33034 2816 839
NM_138972chr1143284 2986 2824 1510 1670 --33034 2816 839
NM_138973chr1143284 2986 2824 1510 1670 --33034 2816 839
NM_138973chr1143284 2986 2824 1510 1670 --33034 2816 839
NM_144571chr466827 4896 4835 4574 2303 932 11456 ----
NM_144599chr1565146 4561 3392 2087 1553 84 --11830 11885
NM_144642chr31468 --2309 149 1452
NM_144721chr412386 ----21089 612
NM_145206chr1033312 2072 840 23209 980 12618 --
NM_152261chr122927 279 1335 --1201
NM_152437chr1232419 1650 1634 12316 11555 1227
NM_152622chr521101 628 13502 23227 3077 --
NM_152624chr586410 6061 5682 5280 5271 1026 796 619 25463 1746 12907 --
NM_152629chr994067 3966 2965 2707 1592 1582 1405 1217 833 31606 1389 1249 13730 11358
NM_152638chr121815 193 --11095
NM_152688chr62833 87 1362 --1638
NM_152699chr353064 1503 1357 478 26 11035 --12517
NM_152756chr513884 13645 23474 2977 23652 1561
NM_152838chr2073534 2981 1144 1086 747 648 556 --2885 462 --
NM_153188chr535493 5055 1748 126 34250 4113 1026 --
NM_153235chr642315 2266 2106 1905 ----22028 400
NM_153259chr1126 186 --1161
NM_153262chr181171 725 715 655 572 422 245 136 --12376 177
NM_153332chr862848 2055 490 460 234 77 ------
NM_153810chr10104899 4201 4156 4027 3994 2033 1827 1054 983 524 --24299 1508 --
NM_172071chr166996 6417 5823 5759 1582 1556 24587 2124 1722 --
NM_172103chr652628 2297 2256 1781 268 1465 --1991
NM_172105chr652628 2297 2256 1781 268 1465 --1991
NM_173214chr1642828 2240 1067 436 --16703 15107
NM_173468chr465651 3841 1229 1031 958 852 --24052 359 --
NM_173602chr1253224 2499 2359 1240 374 13614 23139 2913 --
NM_173642chr158193 7362 5655 3178 2173 47179 6704 6684 2847 16696 16148
NM_173808chr131624 600 398 11776 13054 33037 2724 1030
NM_173829chr585963 5086 4750 4234 2397 2118 728 305 14042 ----
NM_174911chr863964 3041 1268 1251 570 355 11378 13841 --
NM_175736chr12147124 5630 5452 4880 4736 2291 2246 2240 1987 1966 1551 1207 1111 49 2442 42 22053 178 12155
NM_175854chr1352770 2441 1806 828 491 ------
NM_177402chr15812 618 339 264 187 2876 229 --2930 658
NM_177438chr1441104 946 441 387 12835 1930 --
NM_177985chr221936 484 ----1165
NM_178151chrX86971 6683 5574 5031 4932 4775 922 24 12176 12500 12629
NM_178152chrX86971 6683 5574 5031 4932 4775 922 24 12176 12500 12629
NM_178153chrX86971 6683 5574 5031 4932 4775 922 24 12176 12500 12629
NM_178498chr1163802 3383 1044 772 569 298 12561 --23894 2652
NM_181481chr1856838 5176 2506 695 633 --15617 1862
NM_181482chr1856838 5176 2506 695 633 --15617 1862
NM_181483chr1856838 5176 2506 695 633 --15617 1862
NM_181504chr543231 1185 1065 33 12761 --23590 3423
NM_181523chr543231 1185 1065 33 12761 --23590 3423
NM_181524chr543231 1185 1065 33 12761 --23590 3423
NM_182314chrX31689 1518 1476 11282 3440 263 98 --
NM_182493chr161685 14798 13968 13287
NM_182503chr675007 4928 4917 4731 2039 1654 174 --44698 4547 3428 994 --
NM_182729chr1221620 1611 1262 --11789
NM_182742chr1221620 1611 1262 --11789
NM_182743chr1221620 1611 1262 --11789
NM_182758chr1573658 3323 1237 1109 1055 910 348 1562 ----
NM_182762chr734245 2423 1217 25229 2141 25495 4183 --
NM_182763chr162624 2015 1109 705 515 205 --21830 1760 --
NM_182898chr746281 6009 1697 970 11358 --16257
NM_182899chr746281 6009 1697 970 11358 --16257
NM_182948chr13916 653 101 ----12697
NM_183004chr1483672 2803 2711 1224 522 439 420 179 13119 ----
NM_183238chr1273300 3068 2947 922 913 902 756 1430 ----
NM_183397chr2085074 4634 3894 1578 1540 1299 670 138 14968 34770 3368 638 --
NM_194247chr233203 2798 1556 64247 4199 3958 3771 3297 811 ----
NM_194285chr1132698 2162 1192 22512 1203 --11246
NM_194286chr1244529 3866 1929 1591 45468 4217 2385 1503 36235 4585 1260 --
NM_194314chr135666 1469 791 25416 339 1113 --
NM_194434chr1874909 3606 1861 1001 925 841 247 --11590 1743
NM_198329chr331338 1237 593 ----11262
NM_198468chr613030 1999 --11668
NM_198581chr287253 6787 4702 2086 1548 1345 674 50 25794 5165 ----
NM_198595chr494543 4433 4334 4161 3561 3270 1697 944 492 23419 1378 1964 --
NM_198900chr12147124 5630 5452 4880 4736 2291 2246 2240 1987 1966 1551 1207 1111 49 2442 42 22053 178 12155
NM_199262chr1772270 1459 927 853 541 461 170 1863 1746 1338
NM_199421chr1445061 4355 3586 456 24400 1706 --11840
NM_201266chr212373 1605 --22444 2269
NM_201279chr212373 1605 --22444 2269
NM_203327chr2052918 2863 1318 315 52 ----23580 260
NM_203437chr21109 ----1182
NM_203459chr152225 2140 928 917 195 ------
NM_203463chr264795 4640 4045 1898 442 77 --24506 1308 122
NM_206853chr651590 1523 1166 770 417 163 12608 --
NM_206855chr634708 2158 1512 22289 733 14834 24050 280
NM_206909chr8137819 7567 7091 7011 6221 3205 3185 3040 1338 1328 1261 1193 97 27035 5782 --16618
NM_207171chr131848 1792 1315 --11641 1592
NM_207406chr495955 4610 4376 2065 1834 1783 332 169 82 21139 47 16574 11489