TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3661
miRNA Sequence: UGACCUGGGACUCGGACAGCUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000208chr1993614 3595 1639 1613 1403 1273 1250 825 476 24181 3727 11281 --
NM_000217chr1254496 3842 2035 762 293 15250 11291 14923
NM_000332chr657078 7070 6365 4650 2705 1894 11738 --
NM_000337chr546449 5135 4745 4259 26639 921 ----
NM_000555chrX55890 2185 1409 904 530 15372 15006 15459
NM_000719chr1255644 5150 4244 1864 675 11589 14332 16010
NM_000831chr185659 5092 4800 4300 1802 1559 1381 1116 24333 3963 --12507
NM_000875chr1575190 2742 2071 1325 1039 804 754 25104 1643 24322 2175 --
NM_000926chr1179221 8986 8290 2367 2127 1859 390 12659 37796 7164 6658 --
NM_000950chrX53610 2534 1429 1184 1111 11340 ----
NM_001002233chr831760 871 482 --1791 1162
NM_001005404chr1744002 3407 1060 699 14377 --22862 584
NM_001005502chr1254905 4063 4034 3400 1872 1931 14856 162
NM_001008220chr563351 3110 2658 2470 726 686 13228 --1419
NM_001008408chr786094 5775 5357 4633 1776 1756 1498 96 1427 25802 4122 --
NM_001009554chr443671 1642 1279 385 --24199 1027 --
NM_001009554chr443671 1642 1279 385 --24199 1027 --
NM_001010867chr176077 5792 5383 1903 1413 577 526 11471 36227 2074 266 --
NM_001010888chrX54075 3656 2821 1287 536 11086 14023 --
NM_001011666chr734895 4836 1470 --15186 16510
NM_001012755chrX74900 3407 1651 1418 578 363 81 ------
NM_001014380chr1364188 3980 3670 2211 2109 1180 --12339 1646
NM_001015045chr421723 586 ----2757 697
NM_001025079chr394088 3396 3137 2743 1454 655 440 331 308 13366 12936 --
NM_001025580chrX53117 2813 1092 522 300 ------
NM_001039690chr1641920 951 846 501 --1459 2674 437
NM_001039693chr273774 3012 2752 1447 1418 631 546 --21514 809 --
NM_001040144chr1641920 951 846 501 --1459 2674 437
NM_001040146chr1641920 951 846 501 --1459 2674 437
NM_001040429chr1323129 2460 ----13599
NM_001042494chr1553646 2748 1361 894 747 2954 871 13412 --
NM_001042495chr1553646 2748 1361 894 747 2954 871 13412 --
NM_001042496chr1553646 2748 1361 894 747 2954 871 13412 --
NM_001042497chr1553646 2748 1361 894 747 2954 871 13412 --
NM_001046chr532163 2046 1092 1556 12510 --
NM_001071775chr1311585 --1339 1639
NM_001106chr387340 6423 6161 3084 2994 1148 916 733 49216 2784 2610 939 16501 --
NM_001219chr762005 1787 1725 1690 909 553 11624 ----
NM_001304chr1733006 1512 502 --11538 12914
NM_001396chr2122017 778 12306 12735 11991
NM_001420chr192447 421 1712 11189 22393 1050
NM_001432chr453295 1520 1292 582 516 1101 --21428 315
NM_001656chr521936 1468 1679 --1764
NM_001695chr862638 1034 765 452 208 123 ------
NM_001777chr394088 3396 3137 2743 1454 655 440 331 308 13366 12936 --
NM_001874chr1254905 4063 4034 3400 1872 1931 14856 162
NM_002737chr1775640 5275 2438 2258 2083 1368 260 12406 25885 4771 --
NM_003099chr1544688 2303 481 448 26411 391 11288 --
NM_003211chr1221499 665 --11094 11347
NM_003298chr354364 4023 2102 1315 730 --25971 4927 12324
NM_003374chr5----1247 1127
NM_003983chr165963 794 661 410 321 --13964 11105
NM_004227chr762900 2286 2233 2119 140 24 21046 1038 ----
NM_004229chrX1378 --12136 1522
NM_004272chr521826 1668 ----1336
NM_004397chr1123563 586 ----12713
NM_004738chr2041861 1675 972 114 --11058 22266 1613
NM_004742chr31323 ----1640
NM_004863chr1435162 3941 1293 --2978 458 --
NM_004904chr734895 4836 1470 --15186 16510
NM_004992chrX98317 8024 7673 6082 5729 5205 3205 1495 210 17631 37426 5757 2714 13394
NM_004992chrX98317 8024 7673 6082 5729 5205 3205 1495 210 17631 37426 5757 2714 13394
NM_005135chr1553646 2748 1361 894 747 2954 871 13412 --
NM_005207chr2243504 3285 905 805 1894 ----
NM_005296chrX3819 254 21 1176 --1897
NM_005339chr453767 3247 2741 723 673 --1855 --
NM_005359chr1875915 5110 4574 4005 2171 1973 1328 15582 ----
NM_005477chr1541847 253 153 59 ----1679
NM_005477chr1541847 253 153 59 ----1679
NM_005611chr1611201 --1496 1512
NM_005665chr164494 4291 4264 3099 3023 1810 13131 1588 --
NM_005996chr1231449 1029 618 ----11072
NM_006047chr2033055 2542 992 ----184
NM_006166chr1232502 2412 2035 12424 --11648
NM_006380chr1743779 3532 3015 2837 11272 --24068 1156
NM_006534chr202916 452 11029 --12245
NM_006565chr1621152 496 ----1958
NM_006599chr1636329 5287 5104 25695 2620 --16883
NM_006650chr563351 3110 2658 2470 726 686 13228 --1419
NM_006731chr965745 4953 2098 529 327 198 ------
NM_006750chr16107437 7310 7247 5737 2337 2136 2052 823 480 434 17201 --11699
NM_007011chr1576328 5813 2661 1697 1419 1011 71 12640 45765 1737 1036 639 --
NM_007050chr2087555 7524 6689 6158 5486 3176 2738 1820 37952 7021 5387 --16858
NM_007175chr832324 586 198 1865 11157 11211
NM_007249chr1347741 5928 3569 1436 12010 12054 --
NM_007347chr1562461 2174 1157 940 818 211 --12319 11221
NM_007350chr1224374 1562 ----14401
NM_012316chr155072 4296 2105 2015 1975 21382 1192 13800 --
NM_012334chr544211 3963 1825 1640 ----12909
NM_013374chr342908 2867 2176 213 ------
NM_014155chr1176247 6125 5931 5908 2032 370 110 12309 ----
NM_014388chr155602 4292 4231 4209 3923 45647 5555 1138 155 11214 --
NM_014735chrX31959 1682 197 ----1803
NM_014877chr1767401 7168 6543 2778 1522 1463 26935 6296 ----
NM_014883chr421723 586 ----2757 697
NM_014906chr1754090 3889 3020 2925 851 12850 11112 --
NM_014953chr1353613 3520 1211 633 493 33549 3289 2795 1991 --
NM_015074chr153844 3773 3617 1490 371 ----11760
NM_015271chr424044 3460 11435 --1427
NM_015288chr532683 1175 1169 --23020 237 12697
NM_015365chrX53117 2813 1092 522 300 ------
NM_015458chr875124 5005 4853 4601 4042 3464 759 13458 13757 --
NM_015569chr133817 1421 330 13802 13900 11148
NM_015576chr322395 939 --31995 1845 691 --
NM_016206chr357478 6291 5950 2795 583 18033 --11960
NM_016217chr643461 3066 832 802 ----13287
NM_016569chr1231449 1029 618 ----11072
NM_017644chr374705 3757 3492 3177 1503 992 867 --14117 --
NM_017902chr1063953 2085 1989 828 141 30 24813 515 11113 --
NM_018048chr1231702 1535 1475 12037 --11889
NM_018085chr167661 5761 5633 3249 2671 1973 16448 26023 2085 --
NM_018364chr153516 3446 2971 1072 423 ------
NM_018374chr751848 1778 1520 1438 1402 23903 571 ----
NM_018708chr1941569 1362 1259 636 --11505 --
NM_019593chr2072854 2284 1073 820 799 356 180 ------
NM_020150chr1061804 1653 671 651 531 255 1217 ----
NM_020443chr166618 6213 5967 5091 2664 151 11940 25827 2756 --
NM_020772chr1768414 5399 3269 2862 2781 2220 11466 27838 1836 --
NM_020778chr1543176 1803 1239 796 --11016 24044 3945
NM_020781chr772915 2878 2254 2164 593 359 336 ------
NM_021116chr7108889 8029 7690 5954 2966 2719 2653 695 455 314 18389 1325 --
NM_021647chr443671 1642 1279 385 --24199 1027 --
NM_021809chr2042007 1708 551 395 --12207 22149 1804
NM_021964chr345413 5284 2303 2027 ----12368
NM_022091chr622756 320 ----11822
NM_022719chr2283543 2950 1441 928 632 406 367 255 11216 22412 558 11302
NM_024761chr943258 492 434 344 ----13921
NM_024989chr288140 3219 2503 2269 1555 1105 1076 900 ------
NM_025151chr831760 871 482 --1791 1162
NM_025235chr101743 --11795 1231
NM_030648chr451742 1653 1073 642 153 ----12064
NM_030791chr1431435 720 68 ----180
NM_030806chr1149375 9132 8573 8517 8241 8141 6498 6488 3563 3361 3153 1870 623 269 17447 11417 --
NM_032105chr185725 3249 3088 3078 2184 1570 1503 48 15049 16318 --
NM_032116chr1364188 3980 3670 2211 2109 1180 --12339 1646
NM_032281chr192447 421 1712 11189 22393 1050
NM_032287chr2252886 1003 821 805 40 --23512 623 --
NM_032373chr1024388 4028 14382 --25644 1929
NM_033224chr757939 1628 1581 1202 548 35156 5146 590 1490 --
NM_053043chr786094 5775 5357 4633 1776 1756 1498 96 1427 25802 4122 --
NM_130436chr2122017 778 12306 12735 11991
NM_130438chr2142594 2232 1355 467 12883 13312 12568
NM_133170chr2087555 7524 6689 6158 5486 3176 2738 1820 37952 7021 5387 --16858
NM_133647chr1553646 2748 1361 894 747 2954 871 13412 --
NM_138713chr1636329 5287 5104 25695 2620 --16883
NM_138714chr1636329 5287 5104 25695 2620 --16883
NM_148955chr1544688 2303 481 448 26411 391 11288 --
NM_152332chr1452796 2224 2157 2108 438 ------
NM_152608chr141867 1606 571 437 1918 --1308
NM_152624chr557042 2528 1047 873 86 12329 ----
NM_152826chr1544688 2303 481 448 26411 391 11288 --
NM_152838chr2033055 2542 992 ----184
NM_152924chr1576328 5813 2661 1697 1419 1011 71 12640 45765 1737 1036 639 --
NM_153605chr3--1429 --11573
NM_170686chr772915 2878 2254 2164 593 359 336 ------
NM_173214chr1636329 5287 5104 25695 2620 --16883
NM_173468chr476037 5360 5072 2150 1228 665 103 1776 ----
NM_175736chr1256967 5787 1206 1036 176 --1168 15391
NM_177999chr943127 2468 699 569 1608 32721 2368 1018 11145
NM_178011chr101655 ----12631
NM_178151chrX55890 2185 1409 904 530 15372 15006 15459
NM_178152chrX55890 2185 1409 904 530 15372 15006 15459
NM_178153chrX55890 2185 1409 904 530 15372 15006 15459
NM_181521chr1674878 4510 1999 1783 1279 775 163 --1235 15061
NM_181659chr202916 452 11029 --12245
NM_181659chr202916 452 11029 --12245
NM_181705chr565772 4727 3863 3818 1978 1573 13532 12281 --
NM_182526chr1452413 2323 1126 435 179 12896 12181 11053
NM_182758chr1563740 3018 2456 1287 1107 772 13329 ----
NM_182898chr734895 4836 1470 --15186 16510
NM_182899chr734895 4836 1470 --15186 16510
NM_194071chr754924 4556 3818 1645 1232 25273 2048 ----
NM_198320chr1254905 4063 4034 3400 1872 1931 14856 162
NM_198581chr235071 2030 919 12350 47135 6504 5229 4932 27195 7026
NM_198793chr394084 3392 3133 2739 1450 651 436 327 304 13362 12932 --
NM_198859chr344885 3467 1852 151 34689 1218 1182 13804 --
NM_198900chr1256967 5787 1206 1036 176 --1168 15391
NM_206921chr6129 ----143
NM_213589chr265213 3554 1876 1302 110 77 11296 ----