TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3663-3p
miRNA Sequence: UGAGCACCACACAGGCCGGGCGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000044chrX2327 273 ------
NM_000052chrX13106 1814 1585 --
NM_000061chrX2403 103 ------
NM_000081chr121281 1157 11468 ----
NM_000084chrX66725 6468 5817 4987 2390 1180 --21294 941 --
NM_000088chr1731061 929 886 ------
NM_000090chr23688 248 52 1339 1615 --
NM_000093chr922529 1800 ----1560
NM_000109chrX22414 416 --11960 --
NM_000134chr421548 1268 ------
NM_000135chr16----1745 1339
NM_000138chr153935 422 326 ----21914 679
NM_000141chr1021031 382 ------
NM_000161chr1431747 1325 658 ------
NM_000163chr51274 ------
NM_000165chr641696 1684 77 56 ------
NM_000168chr762914 2288 2101 2041 714 403 1456 ----
NM_000176chr512748 --1685 --
NM_000183chr22376 162 ------
NM_000192chr1221353 399 11594 ----
NM_000208chr1933835 3617 786 33818 1355 625 --11644
NM_000210chr241966 1925 1575 62 12129 ----
NM_000212chr1711535 --1330 --
NM_000237chr831802 765 100 ------
NM_000245chr711427 ------
NM_000248chr3--12107 ----
NM_000259chr1565619 4759 4749 4434 1466 937 36339 4360 895 14276 --
NM_000264chr92969 879 12449 ----
NM_000272chr221186 575 ------
NM_000275chr15------1105
NM_000276chrX21585 223 ------
NM_000280chr111894 ------
NM_000310chr141208 931 449 194 ------
NM_000314chr102682 353 ------
NM_000319chr122275 160 ------
NM_000321chr132598 280 11468 ----
NM_000332chr622019 767 --17063 --
NM_000335chr321777 191 ----11907
NM_000345chr41827 165 1179 --
NM_000346chr1711892 ------
NM_000361chr2022065 1782 ------
NM_000368chr974404 4089 1902 1311 1249 742 240 --21354 264 --
NM_000378chr1111197 --1144 --
NM_000379chr211484 --11606 --
NM_000386chr172778 158 ------
NM_000389chr61273 11301 --11509
NM_000408chr223095 146 ------
NM_000411chr2152556 2368 2026 2019 170 ------
NM_000421chr172283 238 ------
NM_000430chr1722519 882 23283 458 ----
NM_000461chr321633 1052 ------
NM_000462chr1511818 ------
NM_000476chr91221 ----11338
NM_000480chr1111280 --1664 11219
NM_000484chr2111088 --1742 --
NM_000495chrX4936 434 393 112 ------
NM_000520chr153145 124 24 --1476 --
NM_000523chr211145 ------
NM_000531chrX--1294 ----
NM_000533chrX1735 ------
NM_000539chr3------1364
NM_000554chr1932583 897 294 12280 --1139
NM_000555chrX47739 6867 6431 620 15969 196 --
NM_000609chr1063045 2773 2737 2689 2327 1082 ------
NM_000615chr111383 13025 ----
NM_000617chr1212249 --11425 1671
NM_000618chr1245595 5281 907 320 ------
NM_000618chr1245595 5281 907 320 ------
NM_000619chr121398 --1482 --
NM_000620chr1212132 ------
NM_000633chr18--13405 --1482
NM_000663chr1642844 2696 2085 181 ------
NM_000698chr10--1337 ----
NM_000719chr1264151 2644 2529 2340 1762 681 14054 ----
NM_000721chr152389 2139 749 698 604 ------
NM_000724chr1011503 ------
NM_000725chr121239 ------
NM_000747chr171650 2881 669 ----
NM_000780chr81136 ------
NM_000793chr1475095 5029 3503 1138 1063 552 492 35113 3387 277 ----
NM_000801chr2041114 841 376 149 ------
NM_000806chr521859 405 21670 486 ----
NM_000811chr52572 547 ------
NM_000813chr545245 1562 1378 254 ------
NM_000817chr21180 --11019 --
NM_000818chr102377 181 ------
NM_000826chr421686 798 ------
NM_000829chr1111600 ----12331
NM_000839chr3----1336 --
NM_000841chr62883 128 ------
NM_000842chr111298 155 ----
NM_000844chr31800 ------
NM_000859chr53523 220 206 11635 ----
NM_000861chr342583 2352 1728 1666 ------
NM_000868chrX21630 900 1731 ----
NM_000872chr1021026 178 --1259 --
NM_000876chr6--1952 21291 1207 --
NM_000899chr1243843 1766 1270 1028 --11744 --
NM_000924chr121853 ------
NM_000926chr1149224 6283 3121 2613 ------
NM_000933chr2011381 ------
NM_000944chr432306 1610 662 ------
NM_000945chr231776 536 507 1741 11551 --
NM_000949chr5--1240 ----
NM_000959chr123008 2918 --1884 --
NM_000961chr2042485 1054 104 28 12879 ----
NM_000965chr3----1380 --
NM_000966chr1221014 994 1164 1352 --
NM_001001132chr21----1318 --
NM_001001323chr1233102 2513 861 --32074 1016 475 --
NM_001001331chr312275 12172 ----
NM_001001344chrX32113 1724 509 12458 ----
NM_001001349chr1721552 1148 --11388 --
NM_001001395chr1242844 780 615 355 ------
NM_001001396chr1--11403 22924 166 --
NM_001001419chr555175 5079 4704 1098 620 1557 ----
NM_001001420chr555175 5079 4704 1098 620 1557 ----
NM_001001433chr2023000 2886 --11216 --
NM_001001438chr212268 86 1156 ----
NM_001001549chr732880 2756 2495 11777 ----
NM_001001550chr732880 2756 2495 11777 ----
NM_001001552chr1137 --1327 --
NM_001001555chr732880 2756 2495 11777 ----
NM_001001560chr22----1122 --
NM_001001664chr253582 2544 1651 1484 1386 13687 ----
NM_001001701chr432005 1571 726 ------
NM_001001787chr12470 404 ------
NM_001001938chr973294 3152 1506 761 365 225 163 24067 838 --12647
NM_001001974chr102481 250 1941 ----
NM_001002031chr12155 ------
NM_001002033chr17----1764 --
NM_001002257chr233135 3099 932 ------
NM_001002259chr12----137 --
NM_001002295chr1031092 884 175 ------
NM_001002843chr1521205 77 ------
NM_001002909chr17165 --11695 --
NM_001003406chr2233078 1327 1300 --12377 --
NM_001003652chr1868622 8363 7338 3425 3238 2481 21708 623 17621 18204
NM_001003674chr1846622 5125 4990 2342 26861 1388 14945 --
NM_001003675chr1846622 5125 4990 2342 26861 1388 14945 --
NM_001003688chr42940 344 ------
NM_001003696chr211148 ------
NM_001003697chr211148 ------
NM_001003698chr641695 1605 556 261 --11384 --
NM_001003699chr641695 1605 556 261 --11384 --
NM_001003701chr211148 ------
NM_001003703chr211148 ------
NM_001003712chr1212849 2929 62 ----
NM_001003792chr31942 ------
NM_001003793chr31942 ------
NM_001003800chr932965 978 77 11398 22829 2678 --
NM_001003810chr42871 654 ------
NM_001004051chrX160 ----169
NM_001004065chr953294 3038 2636 977 467 --134 13342
NM_001004317chr624236 4089 11514 ----
NM_001004342chr155706 4744 1804 666 429 ----15522
NM_001004720chr21661 ------
NM_001004722chr21830 ------
NM_001005360chr191225 ------
NM_001005361chr191225 ------
NM_001005362chr191225 ------
NM_001005366chr123869 208 167 ------
NM_001005375chrY11607 ------
NM_001005386chr22896 697 1992 ----
NM_001005404chr1743835 3181 3007 1138 13771 --14509
NM_001005417chr1----1700 --
NM_001005463chr1022104 2069 12226 ----
NM_001005473chr556599 4947 4480 4355 1578 25480 4129 ----
NM_001005476chr21204 ------
NM_001005505chr31187 ----11515
NM_001005609chrX51494 758 662 598 101 --1499 11312
NM_001005781chr21537 ------
NM_001005782chr21986 2315 142 --177
NM_001005845chr81186 ------
NM_001005861chr3--1949 1892 --
NM_001005910chr31541 ----1147
NM_001005911chr31541 ----1147
NM_001005920chr162919 799 156 ----
NM_001006115chr312247 --12735 22302 2224
NM_001006600chr52897 525 --11998 --
NM_001006617chr911142 ------
NM_001006619chr911142 ------
NM_001006620chr911142 ------
NM_001006621chr911142 ------
NM_001006635chr21142 ------
NM_001006935chrX2112 34 ------
NM_001006936chrX2112 34 ------
NM_001006937chrX2112 34 ------
NM_001007023chr1475095 5029 3503 1138 1063 552 492 35113 3387 277 ----
NM_001007075chr41942 ------
NM_001007097chr984453 4338 4057 4016 3221 1967 339 143 --141 --
NM_001007102chr61174 ------
NM_001007156chr1541413 384 218 163 11941 ----
NM_001007237chr142693 2297 1150 131 --1982 --
NM_001007246chr2111375 11349 ----
NM_001007257chr121397 1216 ------
NM_001007466chr624227 2032 22042 1264 1685 --
NM_001007471chr91136 ------
NM_001007565chr31135 ------
NM_001008225chr7----140 --
NM_001008392chr343238 3095 553 107 ------
NM_001008405chr721829 1191 1180 ----
NM_001008408chr775967 5716 2486 2194 1558 637 203 1276 14036 --
NM_001008539chr855298 4509 3992 3719 309 13507 ----
NM_001008541chr1021903 1769 ------
NM_001008541chr1021903 1769 ------
NM_001008564chr131904 11379 ----
NM_001008660chr1111006 144 11169 --
NM_001009552chr81569 ------
NM_001009555chr4121 ------
NM_001009566chr11142 ------
NM_001009567chr101578 ------
NM_001009899chr346189 5845 1618 759 --11147 --
NM_001009958chr71477 ------
NM_001009959chr221975 579 ------
NM_001009960chr712826 11048 ----
NM_001009993chr244196 4083 3764 65 23126 2863 13671 --
NM_001010853chr612947 12562 ----
NM_001010854chr14--1119 ----
NM_001010857chr11103 ------
NM_001010861chr1----1630 1245
NM_001010867chr176504 6394 6262 4947 2694 1960 461 25674 2394 11214 --
NM_001010888chrX----13398 --
NM_001010891chr556589 5822 4484 675 544 --11168 11253
NM_001010895chr9--1467 11775 --
NM_001010971chr1----1993 --
NM_001010986chrX21542 929 --1255 --
NM_001010989chr161507 ------
NM_001010990chr161507 ------
NM_001011513chr412763 ------
NM_001011537chr342313 1876 644 537 --12292 --
NM_001011538chr4------1731
NM_001011553chr71395 --1188 --
NM_001011645chrX2327 273 ------
NM_001011666chr756267 4501 2111 1817 1811 24331 1883 1228 --
NM_001011713chr14--1259 ----
NM_001012329chr121851 1514 --2472 357 --
NM_001012415chr91820 --1198 1101
NM_001012732chr421186 397 --1996 --
NM_001012755chrX31719 1053 710 --13450 11656
NM_001012761chr52305 190 --1549 --
NM_001012977chrX21093 564 ------
NM_001012979chrX2159 86 ------
NM_001013031chr1012449 --43077 2618 1209 205 13365
NM_001013437chr18139 ------
NM_001013438chr33208 148 47 ------
NM_001013439chr3154 ------
NM_001013620chr1248323 5702 3282 1665 11449 --1792
NM_001013635chr1241189 987 899 480 ----1766
NM_001013839chr1752092 1728 1632 878 188 ------
NM_001014283chr1311657 ------
NM_001014797chr1058262 7600 6971 2964 1830 --18126 16348
NM_001014809chr43698 236 98 1208 ----
NM_001015508chr81620 --1645 --
NM_001015877chrX32875 1044 626 ------
NM_001015881chrX1963 1786 ----
NM_001015887chr331479 1167 1151 123 ----
NM_001017396chr2------1842
NM_001017405chr42638 597 1892 ----
NM_001017440chr733310 1591 215 --1653 --
NM_001017523chr1231891 401 138 ------
NM_001017963chr143895 616 343 ------
NM_001017999chr131766 462 130 ------
NM_001017999chr131766 462 130 ------
NM_001018000chr131766 462 130 ------
NM_001018000chr131766 462 130 ------
NM_001018001chr131766 462 130 ------
NM_001018005chr151141 ------
NM_001018056chr9--1560 ----
NM_001018057chr113901 144 66 --1198 --
NM_001018064chr911675 1611 ----
NM_001018067chr155062 4869 3322 1704 1665 ----15012
NM_001018068chr155062 4869 3322 1704 1665 ----15012
NM_001018069chr155062 4869 3322 1704 1665 ----15012
NM_001018072chr1231891 401 138 ------
NM_001018074chr512748 --1685 --
NM_001018075chr512748 --1685 --
NM_001018076chr512748 --1685 --
NM_001018077chr512748 --1685 --
NM_001018090chr1532558 2179 172 ------
NM_001018091chr1532668 2289 282 ------
NM_001018102chr1532558 2179 172 ------
NM_001018108chr1532015 779 151 189 ----
NM_001018111chr733838 3191 972 1419 ----
NM_001019chr16----151 --
NM_001023567chr1551717 1669 930 753 354 ------
NM_001024024chr142801 379 ------
NM_001024070chr142797 375 ------
NM_001024071chr142769 347 ------
NM_001024094chr512748 --1685 --
NM_001024218chr14--1254 ----
NM_001024401chr1632310 2257 1979 --12547 --
NM_001024460chr61192 --1853 --
NM_001024649chr542770 2256 2193 677 ------
NM_001024660chr321515 559 1246 --11065
NM_001024808chr1252357 1097 971 728 671 ------
NM_001024845chr12369 42 1913 ----
NM_001024934chr6----156 --
NM_001024935chr6----156 --
NM_001024936chr6----156 --
NM_001024948chr143485 2690 2613 1162 13167 ----
NM_001024956chr1144307 3846 3750 1450 1379 21966 1479 --
NM_001024959chr32277 145 ------
NM_001024960chr32277 145 ------
NM_001025068chr3----11260 --
NM_001025069chr3----11260 --
NM_001025076chr1045914 4873 4232 1509 11033 1790 15014
NM_001025077chr1047272 6231 5590 2867 12391 12148 26372 481
NM_001025079chr311361 1856 ----
NM_001025108chr213805 ------
NM_001025201chr21213 ------
NM_001025232chr12--1128 ----
NM_001025252chr823199 101 ------
NM_001025253chr823199 101 ------
NM_001025266chr374663 3433 1896 1544 1526 1272 353 ------
NM_001025389chr1111280 --1664 11219
NM_001025390chr1111280 --1664 11219
NM_001025580chrX32819 2681 2658 ------
NM_001025595chr4--11509 1490 --
NM_001025596chr111422 1480 ----
NM_001029860chr8135 ------
NM_001029863chr611016 ------
NM_001029875chr5--32493 2179 454 ----
NM_001030007chr1663739 2852 2845 1379 1205 913 --22817 729 13286
NM_001030009chr16----151 --
NM_001030055chr1434235 3098 3066 --14774 --
NM_001030272chr111348 ------
NM_001030273chr111348 ------
NM_001030287chr121017 466 ------
NM_001031681chr1731945 820 96 --11688 --
NM_001031684chr22527 351 1257 ----
NM_001031690chr742467 2348 1898 1055 23124 336 ----
NM_001031695chr2254658 4575 3696 708 422 2566 307 ----
NM_001031700chr421671 26 ------
NM_001031710chr7294 55 1396 ----
NM_001031717chr3122 ----193
NM_001031748chr121568 1127 ----
NM_001031804chr1663937 3619 3428 3083 1684 41 14313 --1470
NM_001031812chr532150 668 230 ------
NM_001032221chr92449 388 21612 147 11438 --
NM_001032280chr6--1676 ----
NM_001032282chr81945 ------
NM_001032999chr2025244 49 34766 3654 352 13945 --
NM_001033045chr21143 14217 ----
NM_001033047chr44454 404 398 237 --1318 --
NM_001033059chr642016 817 389 88 ------
NM_001033081chr121773 1178 ------
NM_001033082chr121773 1178 ------
NM_001033112chr5--1833 1719 --
NM_001033117chr344225 3455 3162 79 ------
NM_001033507chr121809 1580 --21211 705 --
NM_001033561chr17185 ------
NM_001033566chr171852 1339 ----
NM_001033568chr171852 1339 ----
NM_001033756chr621682 731 ------
NM_001033756chr621682 731 ------
NM_001034194chr41141 ------
NM_001034850chr521587 1299 ------
NM_001035260chr101288 1517 ----
NM_001037132chr721582 674 ------
NM_001037133chr721582 674 ------
NM_001037164chr71181 1341 ----
NM_001037165chr758503 8395 8212 6195 921 ------
NM_001037172chr321301 1247 ------
NM_001037174chr222000 611 21931 582 ----
NM_001037317chr1----1630 1245
NM_001037331chr182788 369 ------
NM_001037332chr521857 246 ------
NM_001037333chr521857 246 ------
NM_001037339chr1--11844 ----
NM_001037340chr1--11844 ----
NM_001037341chr1--11844 ----
NM_001037341chr1--11844 ----
NM_001037872chr22631 49 ------
NM_001037954chr113833 559 246 ------
NM_001038493chr211474 ------
NM_001038707chr1----22220 1708 --
NM_001038707chr1----22220 1708 --
NM_001039091chrX21345 1032 ------
NM_001039457chr1------1101
NM_001039465chr14197 ------
NM_001039467chr202585 64 ------
NM_001039479chr1431678 1571 365 ------
NM_001039538chr21880 ------
NM_001039574chr121024 923 ------
NM_001039577chr183817 3688 3369 3239 3138 1589 184 161 11471 14037 --
NM_001039585chr123265 3175 --11141 --
NM_001039590chrX1979 13713 ----
NM_001039591chrX1979 13713 ----
NM_001039618chr1115268 15556 ----
NM_001039649chr131225 ------
NM_001039690chr1632328 1830 51 --2564 267 --
NM_001039693chr233645 3175 122 11274 1880 --
NM_001039709chr2025244 49 34766 3654 352 13945 --
NM_001039762chr10--12178 ----
NM_001039772chr113546 411 21 ------
NM_001039802chr111003 --1951 --
NM_001039840chrX24679 285 194 ----
NM_001039888chr1--2822 108 ----
NM_001039916chr1221199 797 ----1278
NM_001039917chr1221199 797 ----1278
NM_001039918chr1221199 797 ----1278
NM_001039919chr1221199 797 ----1278
NM_001039920chr1221199 797 ----1278
NM_001040001chr621871 1537 ------
NM_001040057chr721500 213 ------
NM_001040100chr32355 199 ------
NM_001040110chr751321 1221 1211 714 653 --11337 --
NM_001040113chr16--1961 ----
NM_001040142chr2------1655
NM_001040143chr2------1655
NM_001040144chr1632328 1830 51 --2564 267 --
NM_001040146chr1632328 1830 51 --2564 267 --
NM_001040152chr733373 1851 310 --1141 --
NM_001040153chr131353 ------
NM_001040158chr51223 --1372 --
NM_001040159chr42561 326 ------
NM_001040167chr7----21207 842 --
NM_001040181chr31764 ------
NM_001040182chr31764 ------
NM_001040183chr31764 ------
NM_001040199chr31764 ------
NM_001040200chr31764 ------
NM_001040214chr61751 --1955 --
NM_001040272chr921935 1879 --1700 --
NM_001040284chr1635640 2210 1800 15916 14588 --
NM_001040402chr422823 133 12367 ----
NM_001040429chr13----12915 --
NM_001040441chr11395 --24529 4283 14075
NM_001040458chr531502 1333 206 --1604 --
NM_001040624chr832632 200 41 32589 2481 2017 --1232
NM_001040625chr832632 200 41 32589 2481 2017 --1232
NM_001040626chr832632 200 41 32589 2481 2017 --1232
NM_001040627chr832632 200 41 32589 2481 2017 --1232
NM_001040628chr832632 200 41 32589 2481 2017 --1232
NM_001040629chr832632 200 41 32589 2481 2017 --1232
NM_001040630chr832632 200 41 32589 2481 2017 --1232
NM_001040633chr72969 172 ------
NM_001040694chr113810 256 152 ------
NM_001040709chr131986 338 225 --12540 --
NM_001040712chr953510 3382 2817 2707 538 ------
NM_001040875chr852426 2095 1956 1893 1883 1519 ----
NM_001040876chr4----1602 --
NM_001042355chr1634001 1476 600 --14560 --
NM_001042388chr181722 ------
NM_001042406chr6----1917 --
NM_001042412chr1634001 1476 600 --14560 --
NM_001042413chr932790 940 681 21041 891 --13610
NM_001042425chr6--1676 ----
NM_001042437chr21761 ------
NM_001042473chr1022099 1776 --1820 2585 72
NM_001042494chr1533574 106 22 ------
NM_001042495chr1533574 106 22 ------
NM_001042496chr1533574 106 22 ------
NM_001042497chr1533574 106 22 ------
NM_001042498chrX153 ------
NM_001042506chrX21103 564 ------
NM_001042517chr131676 1309 ----
NM_001042537chrX1254 12001 ----
NM_001042555chr1254388 1276 864 599 64 31885 951 423 --11873
NM_001042576chr201472 ------
NM_001042599chr213104 37426 7406 152 16602 --
NM_001042601chr321162 397 ------
NM_001042603chr1253349 1559 1533 579 401 ------
NM_001042604chr344756 3355 911 589 34658 4499 3696 ----
NM_001042646chr331493 737 348 --11267 --
NM_001042681chr162613 2207 837 387 323 164 ------
NM_001042682chr162613 2207 837 387 323 164 ------
NM_001042682chr162613 2207 837 387 323 164 ------
NM_001042728chr1221014 994 1164 1352 --
NM_001043318chr1434049 700 298 --13161 --
NM_001043351chr132269 2010 905 ------
NM_001044305chr6--1523 ----
NM_001044722chr532150 668 230 ------
NM_001044723chr532150 668 230 ------
NM_001046chr522735 1177 ------
NM_001049chr1432445 2223 119 ----1708
NM_001050chr171149 ------
NM_001071775chr1311919 ------
NM_001079874chr131881 1317 303 1597 ----
NM_001083620chr421685 797 ------
NM_001083621chr124663 1213 ----11693
NM_001087chr22303 32 ------
NM_001094chr171841 1637 ----
NM_001100108chr168352 3052 2084 2064 1757 72 26697 1249 ----
NM_001106chr3118143 8057 7567 7032 3905 3181 3114 2226 2211 583 258 23718 1902 27558 6269 --
NM_001113490chrX42812 1427 824 227 1305 1629 --
NM_001116chr1682862 2501 2181 925 815 461 111 74 --130 --
NM_001117chr1832262 736 90 ------
NM_001119chr42978 72 1173 ----
NM_001126chr12957 348 ------
NM_001127chr222376 206 ------
NM_001128chr1663739 2852 2845 1379 1205 913 --22817 729 13286
NM_001144chr161248 ------
NM_001146chr832002 448 281 1206 11540 --
NM_001149chr101108 11042 --11085
NM_001173chr1434235 3098 3066 --14774 --
NM_001175chr121498 158 ----
NM_001178chr111348 ------
NM_001198chr612186 1614 --11482
NM_001204chr217248 ------
NM_001206chr932692 1198 515 ------
NM_001219chr732186 1696 181 ------
NM_001220chr7138 ------
NM_001222chr1031586 691 205 11326 11593 --
NM_001254chr172266 72 ------
NM_001256chr1732854 1847 454 ------
NM_001259chr732108 1734 1322 56203 2485 1672 1546 1526 ----
NM_001271chr1532412 561 365 ------
NM_001277chr11174 ----1441
NM_001294chr191431 ------
NM_001304chr1723679 804 ------
NM_001310chr1232435 2213 2043 ------
NM_001313chr43698 236 98 1208 ----
NM_001331chr1112048 --11890 --
NM_001332chr51272 ------
NM_001358chr4176 1386 ----
NM_001362chr141341 --2689 354 --
NM_001364chr1134464 4192 1596 ------
NM_001379chr191109 ------
NM_001387chr522658 482 --21095 819 13027
NM_001391chr181124 ------
NM_001396chr2142449 1788 395 51 12526 ----
NM_001399chrX51494 758 662 598 101 --1499 11312
NM_001406chr1741629 1502 1302 1171 --149 --
NM_001408chr1178 --11228 --
NM_001419chr1954313 3742 3506 3123 3042 ------
NM_001427chr7--12051 ----
NM_001431chr63849 395 376 --11050 --
NM_001432chr422805 847 23796 293 ----
NM_001438chr143522 3271 2626 2365 ------
NM_001448chrX--127 ----
NM_001449chrX1527 ------
NM_001453chr62603 560 ------
NM_001463chr21688 ------
NM_001482chr152976 100 ------
NM_001490chr912579 22306 328 ----
NM_001491chr621751 770 1433 ----
NM_001493chrX1593 ------
NM_001494chr101577 ------
NM_001495chr81293 ------
NM_001497chr952289 1761 878 243 214 ----12744
NM_001542chr142693 2297 1150 131 --1982 --
NM_001543chr574759 3051 1801 1407 988 729 312 ------
NM_001554chr12511 171 ------
NM_001560chrX1333 ------
NM_001565chr42253 32 ------
NM_001584chr112261 147 ------
NM_001587chrX21585 223 ------
NM_001604chr111894 ------
NM_001608chr21265 ------
NM_001616chr222830 2696 --12551 --
NM_001620chr113590 528 65 ------
NM_001621chr72520 222 --1494 --
NM_001621chr72520 222 --1494 --
NM_001622chr31258 --1314 --
NM_001634chr642016 817 389 88 ------
NM_001635chr72423 235 ------
NM_001649chrX42309 2290 2133 793 189 --1414
NM_001650chr1823037 1627 11036 ----
NM_001656chr521757 1577 ------
NM_001660chr31181 ------
NM_001663chr1422729 921 ------
NM_001674chr121017 466 ------
NM_001675chr22258 30 ------
NM_001677chr131108 1042 857 ------
NM_001679chr31142 1159 ----
NM_001681chr121493 --139 --
NM_001682chr1232816 2227 575 --31788 730 189 --
NM_001683chr312275 12172 ----
NM_001684chr121610 1550 11120 12641 --
NM_001685chr211148 ------
NM_001693chr811109 ------
NM_001699chr191249 --11188 --
NM_001704chr61135 ------
NM_001709chr1122559 500 ------
NM_001718chr631308 915 340 ------
NM_001730chr13--1345 ----
NM_001730chr13--1345 ----
NM_001731chr121647 ------
NM_001746chr542770 2256 2193 677 ------
NM_001755chr1631855 1774 1583 ------
NM_001759chr1223845 912 --11129 --
NM_001761chr1621803 1604 11615 1322 --
NM_001777chr311361 1856 ----
NM_001788chr71395 --1188 --
NM_001791chr111003 --1951 --
NM_001792chr181109 ------
NM_001798chr1211096 --1433 --
NM_001800chr191137 1367 ----
NM_001822chr21213 ------
NM_001826chr11359 ------
NM_001830chrX43938 3888 3754 914 23461 2704 ----
NM_001833chr91244 ------
NM_001839chr11596 ------
NM_001846chr132710 547 ----136
NM_001851chr61174 ----1489
NM_001854chr12942 280 ----1330
NM_001855chr91217 --1895 --
NM_001858chr643409 1904 1806 415 34656 4333 1163 1843 --
NM_001859chr911322 ------
NM_001875chr221083 295 1267 ----
NM_001876chr113500 345 140 1375 ----
NM_001880chr22325 307 1249 ----
NM_001895chr202805 420 ------
NM_001904chr31969 ------
NM_001918chr146030 3289 923 243 27008 6652 ----
NM_001921chr421186 397 --1996 --
NM_001933chr1421072 508 ------
NM_001935chr22736 691 ------
NM_001938chr12416 237 ------
NM_001939chrX43263 3247 1414 531 13072 23824 3139 --
NM_001946chr121329 ------
NM_001950chr161180 1768 ----
NM_001951chr81124 ------
NM_001967chr3271 32 ------
NM_001968chr41259 1175 ----
NM_001982chr1221006 242 ------
NM_001986chr174533 485 68 37 --1478 --
NM_001987chr1233886 3182 313 --1754 --
NM_001995chr41436 ------
NM_001999chr51952 --1506 --
NM_002024chrX11870 ------
NM_002025chrX69069 6983 6698 1760 1314 262 --19145 --
NM_002032chr111168 ------
NM_002035chr1822485 127 21326 600 ----
NM_002037chr61315 ------
NM_002039chr42882 756 --1166 --
NM_002048chr92361 55 1293 ----
NM_002051chr1031092 884 175 ------
NM_002063chrX146 ------
NM_002072chr91956 ------
NM_002074chr1--21434 514 11096 11416
NM_002078chr3--122 ----
NM_002087chr171260 --1239 --
NM_002090chr4--1504 ----
NM_002095chr8151 ------
NM_002103chr19167 --1329 --
NM_002107chr11379 ------
NM_002126chr1773143 1598 1340 1274 971 209 167 1174 ----
NM_002128chr1311712 --12113 --
NM_002138chr42871 654 ------
NM_002140chr9----1147 --
NM_002146chr1711040 ------
NM_002156chr22341 61 ------
NM_002158chr243237 2425 1209 748 13472 ----
NM_002165chr20162 --1295 --
NM_002166chr21678 --1184 --
NM_002167chr1137 ----1165
NM_002182chr31817 11742 139 --
NM_002196chr20--1355 ----
NM_002196chr20--1355 ----
NM_002214chr725710 1833 21854 1590 ----
NM_002223chr1223431 2759 33038 1184 948 ----
NM_002226chr142728 683 ------
NM_002228chr11851 ----11132
NM_002232chr121320 1169 129 ----
NM_002233chr111433 ------
NM_002241chr11461 ------
NM_002247chr1021699 61 12186 1396 --
NM_002254chr212307 --1467 --
NM_002264chr374920 4584 4088 1867 1446 1375 642 23625 1356 25071 1014 --
NM_002265chr17----1403 --
NM_002267chr1332415 1567 757 --11944 --
NM_002271chr13--2392 365 1881 --
NM_002285chr213805 ------
NM_002310chr555592 4092 2628 1804 156 34030 2355 149 --14669
NM_002334chr11297 65 ------
NM_002336chr1264983 4863 4788 3891 1741 606 --14895 13742
NM_002351chrX21336 566 11635 ----
NM_002355chr1211386 ------
NM_002356chr621791 796 ------
NM_002359chr1783183 2778 1692 1282 1259 550 381 291 12862 21713 1206 --
NM_002371chr22166 39 ------
NM_002373chr1531301 1267 856 ------
NM_002374chr21880 ------
NM_002381chr21662 ------
NM_002383chr161852 --1723 --
NM_002397chr521568 272 ------
NM_002399chr1531429 1330 930 ------
NM_002403chr1----172 --
NM_002425chr11131 ------
NM_002427chr11--11166 11115 --
NM_002430chr222961 913 1692 ----
NM_002438chr101578 ------
NM_002442chr1211686 ----11391
NM_002449chr51355 --11219 --
NM_002451chr933552 1109 542 ------
NM_002473chr221160 ------
NM_002478chr112540 233 ------
NM_002480chr1221032 174 1312 ----
NM_002499chr15----1453 --
NM_002500chr2--147 ----
NM_002501chr1923868 1159 --22799 747 --
NM_002515chr141244 12058 ----
NM_002519chr11131 ------
NM_002522chr173669 458 259 12485 ----
NM_002547chrX44040 2922 556 183 ----13468
NM_002553chr71123 157 ----
NM_002556chr112400 93 1518 ----
NM_002563chr31841 1856 ----
NM_002568chr8135 ------
NM_002581chr964755 4470 3904 1843 1469 306 15195 12014 --
NM_002582chr16132 3702 308 250 ----
NM_002586chr61159 --21273 1017 --
NM_002588chr521531 411 ------
NM_002591chr20182 1550 ----
NM_002595chr1231803 1428 716 ------
NM_002600chr1--11844 ----
NM_002607chr731175 1038 464 --2414 101 --
NM_002613chr1655348 3521 1384 517 237 14196 11025 --
NM_002618chr21119 ------
NM_002641chrX2504 309 ------
NM_002655chr844477 3378 2088 478 1184 ----
NM_002656chr61218 1186 ----
NM_002657chr2023371 730 ----13503
NM_002670chr3----11611 --
NM_002693chr15184 ------
NM_002698chr19121 2980 637 ----
NM_002699chr111219 ------
NM_002709chr212287 12826 --11106
NM_002710chr121251 --1384 --
NM_002717chr8----1185 --
NM_002719chr14----11781 --
NM_002731chr142747 1990 332 312 ------
NM_002737chr1731970 1426 1354 1961 24619 2442 --
NM_002745chr2274350 4097 3361 3340 1471 960 562 139 21290 52 --
NM_002748chr15--2867 849 1900 --
NM_002755chr151220 ------
NM_002758chr171408 ------
NM_002765chrX21345 1032 ------
NM_002787chr71682 --1490 --
NM_002822chr1221244 522 ------
NM_002827chr20------11361
NM_002833chr151210 ------
NM_002839chr953510 3382 2817 2707 538 ------
NM_002844chr61272 ----11394
NM_002852chr3----1229 --
NM_002855chr1153655 3445 3219 224 218 ------
NM_002868chr1232357 1699 326 --1614 --
NM_002869chr1141912 791 755 633 12187 ----
NM_002874chr912464 ------
NM_002886chr314809 --11345 --
NM_002892chr141318 ------
NM_002893chrX1295 ------
NM_002897chr22492 84 --2485 25 --
NM_002906chr1121740 701 --1226 1606
NM_002911chr1931591 538 503 ------
NM_002912chr62243 29 146 172 --
NM_002922chr12580 468 ------
NM_002923chr11569 ----1105
NM_002931chr62302 247 ------
NM_002940chr4----1602 --
NM_002941chr321357 265 ----11468
NM_002942chr31173 11250 ----
NM_002948chr3169 ------
NM_002955chr641695 1605 556 261 --11384 --
NM_002958chr3--1949 1892 --
NM_002959chr143346 815 675 351 ------
NM_002968chr161379 ------
NM_002971chr32862 836 1248 ----
NM_002996chr1631546 548 465 --11574 --
NM_002998chr821508 201 ------
NM_002999chr20--1140 11350 --
NM_003010chr1751735 1492 765 695 353 22174 579 1124 --
NM_003011chr91337 1108 11247 --
NM_003015chr10192 ------
NM_003016chr1722032 1667 ------
NM_003017chr631395 1275 902 ------
NM_003026chr92974 211 11039 ----
NM_003027chr152126 61 --175 --
NM_003030chr311356 ------
NM_003035chr11683 ------
NM_003036chr111060 11069 11088 --
NM_003040chr71147 ------
NM_003043chr343847 1351 1320 425 --11172 --
NM_003046chr855298 4509 3992 3719 309 13507 ----
NM_003060chr511067 21185 1125 ----
NM_003063chr111171 ------
NM_003069chrX1728 ------
NM_003070chr91847 --1854 --
NM_003075chr121276 ------
NM_003077chr172761 271 ------
NM_003079chr17270 23 ----1344
NM_003107chr611767 12278 ----
NM_003108chr277183 7177 5140 4552 2602 1997 110 22162 1737 11798 --
NM_003112chr723090 1993 12236 ----
NM_003118chr551890 1800 344 142 109 22021 384 ----
NM_003128chr222695 2315 1361 --21030 341
NM_003131chr622169 2103 12010 ----
NM_003139chr11170 ------
NM_003144chr6--12277 ----
NM_003145chr1--1455 166 --
NM_003155chr8153 --11722 --
NM_003156chr1111304 --149 --
NM_003161chr1722642 1051 ------
NM_003174chr102598 86 ------
NM_003178chr352138 717 486 463 188 --11903 --
NM_003184chr811000 ------
NM_003188chr61106 ------
NM_003199chr1823933 1669 ------
NM_003200chr19147 11801 ----
NM_003201chr10--21040 24 1397 --
NM_003202chr5--11833 ----
NM_003204chr1721718 589 ------
NM_003211chr122549 422 --11424 --
NM_003215chr4----11084 --
NM_003216chr2243056 2908 2400 951 22241 2123 ----
NM_003217chr1241968 1757 613 84 ------
NM_003220chr6--1676 ----
NM_003223chr16--1767 ----
NM_003224chr202853 42 1318 ----
NM_003234chr342215 919 768 253 ------
NM_003238chr11168 ------
NM_003239chr141891 1866 1876 --
NM_003246chr1531987 323 121 11287 ----
NM_003250chr171319 ------
NM_003253chr2121370 452 --11787 --
NM_003270chrX2344 201 ------
NM_003291chr131200 ------
NM_003298chr355886 3811 2428 2281 1726 25743 4625 34197 1694 992 --
NM_003304chr321404 272 11156 ----
NM_003305chr4------1394
NM_003320chr1134453 4173 3212 --12793 --
NM_003330chr1221304 391 1119 ----
NM_003336chrX------1332
NM_003342chr1723262 2837 12577 1680 --
NM_003344chr731503 674 419 ------
NM_003347chr221262 ------
NM_003348chr1221623 339 ------
NM_003352chr21986 2315 142 --177
NM_003371chr91141 ------
NM_003373chr1021822 1803 ------
NM_003383chr9--1560 ----
NM_003387chr2--22552 742 ----
NM_003388chr722057 617 ------
NM_003403chr14------1782
NM_003404chr2021382 746 21523 673 ----
NM_003405chr221238 ------
NM_003406chr831377 1278 537 ------
NM_003409chr1821360 134 --1173 --
NM_003410chrX42196 2142 696 175 12054 12037 --
NM_003411chrY31749 1603 702 ------
NM_003412chr322406 647 12118 ----
NM_003413chrX21799 1393 ------
NM_003418chr31208 ------
NM_003452chr91636 --1277 --
NM_003459chr23669 562 554 ------
NM_003463chr642758 2426 2222 233 11215 ----
NM_003466chr222524 885 ------
NM_003468chr263353 1246 1179 687 480 98 2637 622 ----
NM_003471chr321786 67 ----1873
NM_003474chr1032347 838 290 1407 31647 751 166 --
NM_003477chr111258 ----127
NM_003478chr1122208 47 ------
NM_003489chr2153295 3117 1341 1081 548 ------
NM_003498chr161956 1362 1578 --
NM_003507chr22787 475 ------
NM_003565chr1231438 553 106 ------
NM_003566chr1212112 --21200 563 --
NM_003575chr731157 1107 1059 11128 ----
NM_003581chr21661 ------
NM_003583chr123668 472 222 22712 554 ----
NM_003590chr241598 1220 1186 791 13186 ----
NM_003591chr10158 ------
NM_003597chr212115 ----1404
NM_003615chr331611 411 370 33423 3210 3174 --11136
NM_003618chr2--1200 ----
NM_003620chr1721068 829 ------
NM_003622chr1212642 2366 33 ----
NM_003628chr21204 ------
NM_003629chr162983 2910 1240 1042 987 905 13389 22485 895 --
NM_003631chr10--1307 1824 --
NM_003633chr521899 782 --11591 --
NM_003644chr1745799 4850 1879 252 14938 15856 25781 4625
NM_003653chr17161 ------
NM_003657chr202286 49 1678 ----
NM_003663chr31789 13363 --13038
NM_003672chr111264 ------
NM_003677chr1221589 1561 11894 ----
NM_003684chr11943 11135 11119 --
NM_003685chr193995 946 780 ------
NM_003692chr91881 --1797 --
NM_003701chr131915 ------
NM_003705chr21249 ------
NM_003713chr111762 1243 ----
NM_003714chr542297 415 373 143 12398 1528 --
NM_003735chr521531 411 ------
NM_003736chr521531 411 ------
NM_003743chr211949 ------
NM_003750chr102221 74 ------
NM_003763chr2023000 2886 --11216 --
NM_003766chr171555 ------
NM_003780chr1----1700 --
NM_003787chr18----1165 --
NM_003800chr632205 1542 914 ------
NM_003822chr112641 2704 555 ----
NM_003829chr9--21100 92 ----
NM_003831chr1831827 501 121 --1113 --
NM_003850chr13264 31 ------
NM_003861chr1421164 818 1926 31084 855 443 --
NM_003862chr5----1244 --
NM_003870chr151330 ------
NM_003872chr232050 772 239 12251 ----
NM_003873chr103628 610 244 1177 ----
NM_003876chr172284 103 ------
NM_003877chr122166 82 ------
NM_003884chr311579 --1547 --
NM_003887chr221856 776 ------
NM_003896chr21761 ------
NM_003902chr11338 ------
NM_003913chr632956 2649 561 ------
NM_003927chr181815 ------
NM_003930chr722102 1869 ------
NM_003931chr6----156 --
NM_003932chr2211776 --1119 --
NM_003934chr921257 889 ------
NM_003936chr221070 177 ------
NM_003939chr1023859 3711 ------
NM_003941chr7------1947
NM_003947chr331367 1210 1185 ------
NM_003951chrX165 ------
NM_003968chr32527 172 --1179 --
NM_003972chr1011262 --1284 --
NM_003983chr1623120 1099 22903 139 --11398
NM_003993chr11337 --167 --
NM_003994chr1243843 1766 1270 1028 --11744 --
NM_004006chrX22414 416 --11960 --
NM_004007chrX22414 416 --11960 --
NM_004009chrX22414 416 --11960 --
NM_004010chrX22414 416 --11960 --
NM_004011chrX22414 416 --11960 --
NM_004012chrX22414 416 --11960 --
NM_004013chrX22414 416 --11960 --
NM_004014chrX22414 416 --11960 --
NM_004015chrX22414 416 --11960 --
NM_004016chrX22328 330 --11874 --
NM_004017chrX22414 416 --11960 --
NM_004018chrX22328 330 --11874 --
NM_004020chrX22414 416 --11960 --
NM_004021chrX22328 330 --11874 --
NM_004022chrX22328 330 --11874 --
NM_004023chrX22328 330 --11874 --
NM_004028chr1823037 1627 11036 ----
NM_004036chr2----1476 --
NM_004040chr21533 ------
NM_004047chr1------1101
NM_004071chr2--1221 ----
NM_004080chr7------11266
NM_004081chrY11607 ------
NM_004089chrX1963 1786 ----
NM_004093chr1332796 2590 26 ------
NM_004094chr1412250 --12786 --
NM_004099chr911920 --1110 --
NM_004114chrX21149 51 ------
NM_004116chr22483 164 1175 --1340
NM_004119chr131558 --1664 --
NM_004124chr14--13260 13569 --
NM_004130chr32643 201 ------
NM_004133chr82362 112 ------
NM_004136chr151194 ----1951
NM_004156chr81569 ------
NM_004161chr211090 ------
NM_004162chr3------11324
NM_004163chr18--1162 ----
NM_004170chr921875 1500 21558 646 ----
NM_004171chr1148189 7329 415 175 --12329 11661
NM_004183chr111640 ------
NM_004225chr83929 127 100 --1138 --
NM_004229chrX12205 ------
NM_004236chr151131 ------
NM_004242chr61284 --1344 --
NM_004261chr12905 374 ------
NM_004268chr112285 176 ------
NM_004272chr5--1355 1645 --
NM_004274chr141637 12321 ----
NM_004277chr621631 1378 2414 37 ----
NM_004281chr10142 ------
NM_004293chr933847 682 616 13438 1284 --
NM_004295chr1731275 1024 315 1974 1168 --
NM_004297chr92269 72 ------
NM_004302chr1252244 1839 986 709 358 ------
NM_004311chr1023088 463 12449 12435 --
NM_004319chr122265 333 1370 --12873
NM_004321chr243366 3220 218 174 --12779 12764
NM_004326chr11288 ------
NM_004329chr1011008 1124 1341 --
NM_004330chr1511036 ------
NM_004338chr1846622 5125 4990 2342 26861 1388 14945 --
NM_004349chr821122 1085 ------
NM_004360chr1621932 428 11255 ----
NM_004369chr22260 172 ------
NM_004370chr621453 1400 180 1674 --
NM_004379chr22576 154 1697 ----
NM_004380chr1622629 950 12251 ----
NM_004381chr6------1154
NM_004384chr532150 668 230 ------
NM_004386chr1922246 857 ------
NM_004393chr33724 583 58 12309 1897 --
NM_004397chr1133244 3237 848 --12662 --
NM_004411chr7--1320 ----
NM_004420chr1121575 752 ----1657
NM_004422chr17169 ------
NM_004429chrX--1386 1176 --
NM_004432chr912249 ------
NM_004433chr11440 ------
NM_004442chr1----21061 75 --
NM_004443chr32544 158 ------
NM_004454chr321595 1505 ------
NM_004464chr424118 4076 1983 ----
NM_004469chrX186 ------
NM_004472chr5174 ------
NM_004475chr1721067 865 1133 ----
NM_004491chr1944253 4130 2973 1157 11208 11704 12636
NM_004494chr13953 268 54 1829 ----
NM_004496chr1431119 1075 402 ------
NM_004498chr151279 ------
NM_004499chr51179 ------
NM_004501chr154042 3816 1629 1145 875 ----13667
NM_004503chr121667 ------
NM_004504chr232871 646 395 ------
NM_004505chr1721427 284 ------
NM_004506chr61179 ------
NM_004516chr192885 92 ------
NM_004519chr81188 ------
NM_004521chr10125 ------
NM_004530chr1621151 305 ------
NM_004538chrX3748 659 268 ------
NM_004540chr211306 1904 ----
NM_004554chr142354 186 ------
NM_004566chr1022466 532 11739 ----
NM_004569chr141489 ------
NM_004575chr421565 1155 2626 381 ----
NM_004578chr11868 --1140 --
NM_004586chrX24293 4220 --1724 13857
NM_004587chr201472 ------
NM_004588chr113455 355 89 ----12903
NM_004593chr31696 1584 2806 188 --
NM_004595chrX2388 182 ----1431
NM_004598chr52418 197 12302 11123 12026
NM_004607chr5--185 ----
NM_004612chr934498 3803 3401 23121 845 ----
NM_004626chr111137 ------
NM_004630chr1121148 899 ------
NM_004642chr121510 ------
NM_004643chr141681 ------
NM_004654chrY1938 1346 ----
NM_004655chr1721126 854 ------
NM_004656chr321173 1023 1200 ----
NM_004657chr211456 135 ----
NM_004660chrY22316 1453 ------
NM_004663chr15------11401
NM_004664chr12160 ------
NM_004687chr171475 11988 ----
NM_004689chr141312 ------
NM_004690chr64502 282 112 57 ------
NM_004698chr11169 ------
NM_004703chr1742358 2119 1844 1796 22563 2128 ----
NM_004705chr111319 ------
NM_004709chrX11427 21629 485 ----
NM_004715chr182213 163 ------
NM_004719chr1232676 2311 1767 1582 ----
NM_004726chrX35763 4384 4253 15057 ----
NM_004730chr522164 2000 ----11698
NM_004734chr1352885 2702 2422 905 536 13094 22765 991 --
NM_004739chr111157 ------
NM_004740chr172285 225 ----148
NM_004742chr31715 1590 ----
NM_004744chr422893 112 2882 150 11574 --
NM_004745chr856664 4558 722 451 287 11955 --25767 1233
NM_004747chr102424 219 ----1577
NM_004748chr1532672 837 74 12996 ----
NM_004761chr6------139
NM_004766chr3179 ------
NM_004772chr52639 560 ------
NM_004796chr141897 --12003 1716
NM_004798chr2021380 324 12495 12570 --
NM_004805chr221346 353 ------
NM_004815chr164033 1780 1715 1597 500 58 1395 ----
NM_004822chr1713019 ------
NM_004831chr1921017 851 ------
NM_004834chr272983 2713 2619 2571 2489 259 235 12512 ----
NM_004839chr151614 ----1711
NM_004856chr151540 ------
NM_004859chr1762526 2481 799 692 526 96 ------
NM_004863chr1413410 13985 13936 --
NM_004884chr1511515 ------
NM_004893chr51223 --1372 --
NM_004896chr101203 1432 ----
NM_004902chr202581 286 1168 ----
NM_004904chr756267 4501 2111 1817 1811 24331 1883 1228 --
NM_004911chr72486 140 ------
NM_004930chr1----1602 --
NM_004937chr1722310 461 --12053 --
NM_004945chr191225 ------
NM_004947chr311875 12354 --11867
NM_004952chr11935 1276 ----
NM_004956chr723690 2811 ------
NM_004960chr161281 ------
NM_004961chrX1408 1274 --11380
NM_004974chr1181 ------
NM_004976chr1144789 3344 1823 338 --13534 --
NM_004978chr131687 1586 590 ------
NM_004985chr1234319 3132 977 13201 ----
NM_004992chrX47494 7101 7058 5782 28360 6505 ----
NM_004992chrX47494 7101 7058 5782 28360 6505 ----
NM_004993chr1431343 1013 527 ------
NM_004999chr644384 1623 1028 905 ------
NM_005000chr7172 125 ----
NM_005010chr721582 674 ------
NM_005011chr751321 1221 1211 714 653 --11337 --
NM_005014chr91762 ------
NM_005029chr101111 ------
NM_005032chrX--3873 232 77 ----
NM_005033chr41141 ------
NM_005044chrX84317 4225 3406 1608 1497 1111 634 267 ------
NM_005045chr71755 ------
NM_005056chr1253593 1803 1777 823 645 ------
NM_005057chr11542 21269 1199 ----
NM_005065chr1422051 440 ----11352
NM_005066chr12567 311 ------
NM_005067chr3143 --1617 --
NM_005078chr1521409 368 ------
NM_005079chr823199 101 ------
NM_005080chr22----1940 --
NM_005087chr3154 ------
NM_005088chrX1872 ------
NM_005093chr2025244 49 34766 3654 352 13945 --
NM_005110chr52156 112 ------
NM_005117chr11169 ------
NM_005119chr111086 ------
NM_005121chr1713377 ------
NM_005134chr181722 ------
NM_005135chr1533574 106 22 ------
NM_005154chr151533 ------
NM_005156chr914929 23612 1069 11236 --
NM_005159chr152232 134 12196 ----
NM_005168chr231612 1415 1388 11226 1320 --
NM_005171chr1221289 814 ------
NM_005176chr12155 ------
NM_005180chr1021392 416 11364 ----
NM_005184chr1921133 375 11568 ----
NM_005188chr1155675 3052 2476 1423 979 --26440 648 --
NM_005194chr201225 ------
NM_005197chr1456058 5191 4898 4047 1567 --14852 --
NM_005206chr1711163 ------
NM_005207chr2243288 2772 1396 883 23088 337 --12812
NM_005224chr191696 ------
NM_005235chr213104 37426 7406 152 16602 --
NM_005238chr1122956 2543 --13372 --
NM_005241chr321180 936 ------
NM_005244chr201491 --1665 --
NM_005245chr4183 ------
NM_005261chr81352 ----1256
NM_005277chr461922 1834 1262 610 96 43 ------
NM_005281chr12209 135 ------
NM_005302chr71162 ------
NM_005308chr101443 ------
NM_005311chr732880 2756 2495 11777 ----
NM_005316chr111838 ------
NM_005324chr1711754 ------
NM_005329chr1631684 1660 703 --31714 741 567 --
NM_005330chr11----125 --
NM_005339chr421061 386 --24007 2757 --
NM_005342chrX52615 2353 2041 263 147 11996 ----
NM_005348chr143895 616 343 ------
NM_005358chr1341533 1353 491 328 ------
NM_005375chr61738 ------
NM_005378chr21292 ----1342
NM_005385chr322571 457 --1755 --
NM_005386chr201104 --143 --
NM_005397chr733838 3191 972 1419 ----
NM_005402chr731765 646 340 11459 ----
NM_005406chr182475 273 11475 ----
NM_005407chr1411598 1168 ----
NM_005410chr51258 ------
NM_005418chr111637 --2711 255 --
NM_005435chr72177 170 ------
NM_005436chr1033626 3181 885 ------
NM_005455chr131854 1667 1284 ------
NM_005461chr2011567 --11762 --
NM_005465chr121673 803 ------
NM_005477chr15--1357 ----
NM_005477chr15--1357 ----
NM_005488chr22182 ------
NM_005493chr6--1795 ----
NM_005497chr1744958 2453 186 26 26125 4839 13923 --
NM_005502chr913051 12543 ----
NM_005504chr1234322 2020 189 14336 21967 1472 --
NM_005506chr41281 1394 ----
NM_005520chr51671 ------
NM_005521chr103831 803 780 ------
NM_005523chr731346 1186 405 ----11250
NM_005527chr61380 ------
NM_005530chr151203 ------
NM_005537chr131780 ------
NM_005540chr121511 1062 ------
NM_005542chr711923 ----1399
NM_005544chr21844 ------
NM_005552chr142421 174 1554 ----
NM_005561chr132817 179 --1263 --
NM_005578chr313800 --1391 --
NM_005596chr974208 1878 1766 1310 1047 808 543 15858 11329 --
NM_005604chr612500 ------
NM_005610chr12635 151 1920 ----
NM_005611chr1611258 --1988 --
NM_005613chr152162 641 437 175 92 1185 --1606
NM_005614chr721004 859 ------
NM_005626chr11147 ------
NM_005627chr62737 227 ------
NM_005634chrX--1639 ----
NM_005638chrX1499 --1441 --
NM_005639chr12141 11479 ----
NM_005647chrX42165 2134 922 834 ------
NM_005655chr81945 ------
NM_005659chr222453 360 ------
NM_005668chr544186 3512 2843 172 13531 ----
NM_005686chr111495 --11071 --
NM_005688chr311179 ------
NM_005704chr131128 938 275 ------
NM_005707chr1521225 149 ------
NM_005715chr622797 2753 12338 ----
NM_005717chr11940 11172 --11102
NM_005718chr32277 145 ------
NM_005721chr21960 1922 ----
NM_005722chr22896 697 1992 ----
NM_005724chr151116 ------
NM_005731chr21166 ------
NM_005734chr11--1805 ----
NM_005737chr222829 931 --1722 --
NM_005738chr71181 1341 ----
NM_005746chr712079 ------
NM_005751chr7173 ------
NM_005754chr531214 1118 156 ------
NM_005759chr274024 3784 3477 3414 1860 1037 886 13940 ----
NM_005765chrX175 ------
NM_005776chr141250 ------
NM_005779chr533628 1063 817 --13449 --
NM_005786chr181236 ------
NM_005789chr1721470 399 11866 11854 --
NM_005795chr222237 35 ------
NM_005796chr161147 ------
NM_005797chr112474 169 1247 ----
NM_005808chr343238 3095 553 107 ------
NM_005819chr12666 331 22183 398 ----
NM_005822chr62855 97 ------
NM_005828chr1741840 1480 1121 1081 --21022 693 --
NM_005832chr31343 1949 ----
NM_005840chrX66645 6593 3053 1611 1473 1033 22470 835 11899 --
NM_005841chr4----1953 --
NM_005857chr11321 1406 ----
NM_005859chr531507 1333 1291 ------
NM_005864chr14------1610
NM_005868chr7--192 ----
NM_005870chr131213 --11292 --
NM_005873chr202585 64 ------
NM_005877chr2232196 2111 1699 ------
NM_005880chr161288 ------
NM_005882chr42638 597 1892 ----
NM_005895chr1254146 4006 2781 2761 1531 33416 3377 2806 13900 --
NM_005898chr11--12824 --22183 1163
NM_005900chr42940 344 ------
NM_005901chr1868622 8363 7338 3425 3238 2481 21708 623 17621 18204
NM_005902chr1524007 815 23245 633 ----
NM_005903chr555175 5079 4704 1098 620 1557 ----
NM_005904chr1861450 1434 1199 408 160 83 ------
NM_005909chr534226 4109 3670 ------
NM_005911chr241287 1047 543 199 ------
NM_005917chr21132 ------
NM_005920chr12664 113 1544 1988 12693
NM_005934chr1921958 262 ------
NM_005941chr812691 ------
NM_005955chr155429 4987 4914 546 411 1560 11513 1576
NM_005962chr1021903 1769 ------
NM_005962chr1021903 1769 ------
NM_005964chr1721308 1212 1414 ----
NM_005967chr121469 ------
NM_005977chr131137 1790 ----
NM_005986chr1322334 238 --32774 2541 2503 --
NM_006011chr1521004 853 ----1198
NM_006016chr61499 1184 ----
NM_006030chr31187 ----11515
NM_006036chr232209 475 126 21751 831 ----
NM_006037chr254453 4352 3382 3088 993 13548 --21315 418
NM_006040chr162520 481 ------
NM_006042chr171464 ------
NM_006047chr2032898 2342 1328 --1364 12775
NM_006048chr111157 ------
NM_006049chr151269 ------
NM_006054chr111134 ------
NM_006064chrX1426 ------
NM_006070chr31135 ------
NM_006080chr732009 1893 1142 12776 ----
NM_006089chrX31871 1577 651 --1518 --
NM_006094chr831656 1555 39 ------
NM_006095chr422866 1016 ------
NM_006106chr1132578 1168 1126 33181 3140 2704 ----
NM_006113chr131881 1317 303 1597 ----
NM_006116chr2221580 470 --11316 --
NM_006133chr111557 1592 ----
NM_006135chr131297 1290 178 ------
NM_006141chr1622661 717 12127 ----
NM_006145chr192976 435 11071 ----
NM_006148chr1732887 2333 1849 ------
NM_006154chr1512749 --12038 --
NM_006156chr142213 192 ------
NM_006157chr111146 ------
NM_006158chr811578 ------
NM_006180chr911675 1611 ----
NM_006186chr2--11033 ----
NM_006194chr14--11138 ----
NM_006195chr911357 2908 532 ----
NM_006196chr2--1105 ----
NM_006201chrX31013 902 199 ------
NM_006203chr514810 ------
NM_006206chr41289 --12265 --
NM_006211chr8175 ------
NM_006224chr1772307 2094 920 886 459 305 285 11788 ----
NM_006237chr131201 12056 ----
NM_006238chr611955 --11859 --
NM_006239chr41165 ------
NM_006241chr312272 12259 ----
NM_006242chr2021562 1336 ------
NM_006243chr11377 ------
NM_006245chr6--1240 1965 1191
NM_006251chr523118 1151 ------
NM_006252chr157342 7039 6789 1204 926 ----14769
NM_006255chr142744 392 1916 ----
NM_006258chr1031350 179 95 ------
NM_006265chr81206 144 ----
NM_006267chr231580 1190 515 ------
NM_006275chr2032511 2397 722 ------
NM_006277chr2--1226 ----
NM_006283chr824762 1973 ----11694
NM_006290chr651518 1268 1220 183 64 ------
NM_006300chr191564 --1193 --
NM_006306chrX44235 1104 603 222 ------
NM_006312chr121756 --1239 --
NM_006325chr121116 ------
NM_006328chr112604 162 ------
NM_006330chr811419 1464 ----
NM_006335chr14799 348 263 172 ------
NM_006336chr911383 --21264 550 --
NM_006338chr11110 --1164 --
NM_006350chr5--1363 ----
NM_006352chr11210 11630 ----
NM_006359chrX1254 12001 ----
NM_006363chr202433 231 145 ----
NM_006371chr334234 3686 3275 24161 1134 12001 --
NM_006375chrX--21371 712 ----
NM_006379chr721929 83 ------
NM_006380chr1734418 3735 2782 ------
NM_006386chr2252307 1775 1759 512 448 ------
NM_006389chr112933 495 ------
NM_006391chr11249 29 ------
NM_006393chr1034164 3602 230 1244 11006 --
NM_006403chr62646 258 1487 11546 --
NM_006420chr2033175 3162 788 ------
NM_006439chr42506 43 ------
NM_006457chr412763 ------
NM_006459chr1021746 1636 --21939 139 --
NM_006460chr172617 168 ------
NM_006469chr121599 560 ------
NM_006482chr123668 472 222 22712 554 ----
NM_006489chr141244 12058 ----
NM_006496chr131988 1268 289 ------
NM_006516chr111608 11401 --11128
NM_006517chrX42194 1523 853 359 11426 2667 158 --
NM_006526chr2032211 1559 506 146 ----
NM_006534chr2043196 2197 1159 522 --12321 1227
NM_006538chr243499 3346 890 291 --11352 --
NM_006540chr811382 ------
NM_006544chr1426036 1821 ----11262
NM_006546chr1755945 2197 1037 362 61 ------
NM_006547chr721907 527 ------
NM_006548chr321725 1317 1342 ----
NM_006549chr1232959 2722 2290 11965 ----
NM_006554chr21142 ------
NM_006555chr731968 1908 784 11286 ----
NM_006560chr111422 1480 ----
NM_006561chr1045914 4873 4232 1509 11033 1790 15014
NM_006570chr9--187 ----
NM_006599chr1687341 6695 2651 2350 1721 1647 1196 1055 --11365 15669
NM_006606chr2053156 3068 2852 1277 1097 12597 ----
NM_006609chr222381 868 12004 ----
NM_006614chr343609 3425 3285 1359 --12801 1222
NM_006618chr121092 117 --1630 --
NM_006621chr12741 403 ------
NM_006624chr1022018 757 ------
NM_006625chr121048 60 ------
NM_006625chr121048 60 ------
NM_006625chr121048 60 ------
NM_006626chr922362 251 ------
NM_006629chr1821822 1765 131 ----
NM_006634chr2171 ------
NM_006646chr1321070 359 ------
NM_006654chr1254388 1276 864 599 64 31885 951 423 --11873
NM_006667chrX31180 838 469 ------
NM_006670chr61168 ------
NM_006675chr1243140 3040 2321 918 --23087 2467 --
NM_006695chr171305 1324 ----
NM_006698chr2021449 227 --1178 --
NM_006699chr122178 232 ------
NM_006703chr62319 161 ------
NM_006704chr131129 1156 ----
NM_006706chr52750 546 ------
NM_006708chr651300 1241 865 432 193 ------
NM_006717chr921328 547 13207 ----
NM_006718chr61218 1186 ----
NM_006722chr3--12107 ----
NM_006726chr42859 443 ------
NM_006729chrX25323 219 --13432 15166
NM_006738chr1563409 3303 1418 1039 928 724 12815 --11512
NM_006749chr841043 917 70 46 ------
NM_006750chr1667940 7301 7250 6151 2816 437 1394 ----
NM_006751chr22977 710 ------
NM_006763chr131856 1664 234 136 --11310
NM_006772chr631100 293 216 ------
NM_006790chr51419 ------
NM_006791chr152418 82 ----1440
NM_006802chr11259 ------
NM_006805chr5----1157 --
NM_006807chr172900 153 ------
NM_006813chr61269 ------
NM_006815chr1211120 ------
NM_006823chr821304 1117 1413 ----
NM_006827chr1433194 3186 3076 1631 ----
NM_006838chr1221427 382 ------
NM_006852chr1741917 1045 491 352 12320 1117 --
NM_006854chr71722 --141 1786
NM_006861chr1231820 1615 182 ------
NM_006874chr42450 425 11008 ----
NM_006884chr311356 ------
NM_006885chr1664029 3461 3054 2995 1693 854 ------
NM_006888chr1453291 2733 2488 901 564 ------
NM_006892chr2011208 --11075 1239
NM_006892chr2011208 --11075 1239
NM_006897chr123606 558 201 ------
NM_006898chr21641 ------
NM_006908chr741098 1064 962 523 ------
NM_006914chr91241 2971 66 ----
NM_006918chr1144307 3846 3750 1450 1379 21966 1479 --
NM_006920chr2--11765 1675 --
NM_006922chr222096 503 ------
NM_006924chr1774186 4144 4099 3474 2973 814 302 34078 3396 759 12845 --
NM_006925chr14197 ------
NM_006930chr531856 1419 534 ------
NM_006931chr1232010 656 409 ----11593
NM_006939chr1431160 404 322 ------
NM_006943chr2032788 2614 1124 ----13325
NM_006950chrX1787 ------
NM_006951chr10----1240 --
NM_006981chr921941 882 1733 ----
NM_006990chr142223 980 648 158 --11994 1690
NM_007005chr9--11427 ----
NM_007006chr1612790 13392 ----
NM_007007chr1254104 3549 3032 1316 1269 1492 ----
NM_007008chr21606 1185 ----
NM_007010chr1711484 ------
NM_007011chr1556707 6644 6352 5816 1379 1191 15066 --
NM_007013chr8--1900 ----
NM_007026chr17------1131
NM_007034chr121035 917 ------
NM_007038chr2114912 24457 2436 ----
NM_007039chr1422192 2046 ----1206
NM_007040chr19196 1752 ----
NM_007050chr2057817 1979 410 352 141 11795 26693 692 --
NM_007064chr321515 559 1246 --11065
NM_007067chr1751554 1181 1097 439 364 ------
NM_007096chr91244 ------
NM_007118chr52366 151 1142 ----
NM_007124chr61133 ------
NM_007129chr131762 ------
NM_007137chrX24432 459 --15057 11735
NM_007146chr1722803 2588 ------
NM_007149chr61392 ------
NM_007159chr311122 1433 ----
NM_007166chr1111006 144 11169 --
NM_007174chr1211739 199 ----
NM_007175chr83582 551 384 ------
NM_007191chr122708 216 ------
NM_007192chr1411051 --1222 --
NM_007200chr1563409 3303 1418 1039 928 724 12815 --11512
NM_007203chr953294 3038 2636 977 467 --134 13342
NM_007212chr11772 11816 ----
NM_007214chr611128 ------
NM_007217chr31304 ------
NM_007231chrX22296 2101 1188 --12316
NM_007232chr201351 --1323 --
NM_007245chr161325 ------
NM_007246chr41350 ------
NM_007249chr1377955 7938 7480 2036 1504 1345 825 13632 1764 --
NM_007260chr11756 ------
NM_007269chr11225 ------
NM_007275chr321114 173 ------
NM_007276chr72899 333 ------
NM_007308chr4--165 1179 --
NM_007315chr211418 ------
NM_007347chr1511099 ----12623
NM_007350chr1223350 3230 ------
NM_007358chr13797 747 288 ------
NM_007375chr111125 ------
NM_012081chr543613 871 753 646 ------
NM_012089chr141406 1347 1149 595 ------
NM_012092chr21125 21559 257 21724 1677 --
NM_012096chr312429 ------
NM_012097chr222000 611 21931 582 ----
NM_012102chr162613 2207 837 387 323 164 ------
NM_012110chr42228 111 --166 --
NM_012117chr121125 1114 ----
NM_012120chr622855 2521 ------
NM_012137chr112773 ------
NM_012153chr1131837 906 322 1790 ----
NM_012154chr81572 ------
NM_012155chr192213 199 ------
NM_012156chr2053404 3384 2287 1156 931 11314 ----
NM_012164chr956998 6833 6724 6245 422 17441 ----
NM_012193chr1135015 3406 580 ----11336
NM_012199chr123503 2854 --24110 2828 --
NM_012207chr10----1991 --
NM_012210chr941402 1145 404 238 ----11059
NM_012214chr255675 4759 4421 2415 994 ------
NM_012215chr102747 249 ------
NM_012234chr31253 1390 1541 --
NM_012238chr1021090 641 ------
NM_012242chr103758 650 268 ------
NM_012249chr221438 608 ------
NM_012250chr1111388 1272 ----
NM_012252chr734015 205 51 13827 ----
NM_012257chr74965 762 718 289 ------
NM_012262chr11177 14563 33707 3225 910 --
NM_012264chr22--1103 --11456
NM_012264chr22--1103 --11456
NM_012272chr12------1170
NM_012279chr531302 648 301 --1763 --
NM_012281chr7--2685 598 ----
NM_012286chrX1404 --1426 --
NM_012288chr674776 4500 4252 3928 3548 1128 543 15405 12259 11078
NM_012293chr261893 1728 1543 515 285 134 ------
NM_012294chr722940 2525 23127 151 12924 --
NM_012300chr53853 829 737 12416 ----
NM_012301chr72593 159 ------
NM_012302chr11817 ------
NM_012307chr18--1707 ----
NM_012308chr114621 572 534 309 ------
NM_012309chr1144742 4454 3312 3280 ------
NM_012316chr12510 131 ------
NM_012319chr182944 359 ------
NM_012325chr2021537 1080 154 ----
NM_012326chr22279 192 1815 1101 --
NM_012328chr731305 907 246 ------
NM_012329chr1731304 1266 155 ------
NM_012347chr621880 242 12590 12710 --
NM_012382chr533568 3353 1513 ------
NM_012388chr1532978 2699 958 ------
NM_012399chr221141 --1586 --
NM_012402chr112897 314 2971 542 ----
NM_012414chr11565 ------
NM_012416chr91213 11230 ----
NM_012421chr1----1400 --
NM_012424chr11257 1773 ----
NM_012431chr733345 3245 132 11469 ----
NM_012434chr6--11558 ----
NM_012448chr1762137 2089 818 561 432 235 ------
NM_012453chr71447 --1216 --
NM_012464chr442931 1099 540 338 ------
NM_012479chr752593 2520 2294 1715 1087 ------
NM_013231chr1414285 11580 ----
NM_013233chr2----11360 --
NM_013253chr113901 144 66 --1198 --
NM_013261chr443011 2725 2377 342 22709 1040 13188 --
NM_013281chr2021441 300 ------
NM_013309chr1512272 ------
NM_013330chr1--173 ----
NM_013354chr811008 ------
NM_013357chr81895 ------
NM_013365chr22----1122 --
NM_013372chr1542588 1306 455 182 11357 ----
NM_013377chr121530 ------
NM_013381chr1222275 375 --1210 --
NM_013382chr1431845 953 795 12185 12231 --
NM_013396chr2121380 1275 1362 ----
NM_013423chrX31273 504 93 ------
NM_013427chrX31273 504 93 ------
NM_013444chrX1970 ------
NM_013446chr731145 113 81 ------
NM_013449chr1272950 2843 2650 2479 2435 2109 1062 ------
NM_013450chr21270 ------
NM_013951chr222524 885 ------
NM_013952chr222601 962 ------
NM_013953chr222601 962 ------
NM_013989chr1475095 5029 3503 1138 1063 552 492 35113 3387 277 ----
NM_013992chr222601 962 ------
NM_013999chr1721303 1137 ------
NM_014000chr1021822 1803 ------
NM_014007chr91188 --1922 --
NM_014011chr21695 ----1206
NM_014016chr321223 129 ------
NM_014023chr1032716 892 863 --21171 115 12221
NM_014028chr6--23156 1112 ----
NM_014043chr31591 ------
NM_014048chr1654918 4382 3279 1410 589 41771 1739 1698 177 ----
NM_014059chr131289 ------
NM_014071chr201190 ------
NM_014080chr1521491 425 ------
NM_014089chr131904 11379 ----
NM_014112chr824587 1286 ------
NM_014117chr162663 583 --12017 --
NM_014141chr7--24684 3426 1314 --
NM_014153chr16161 ------
NM_014154chr32219 166 ------
NM_014155chr1176855 2743 2280 2035 1196 319 210 15700 ----
NM_014176chr1135 ------
NM_014181chr222416 737 ------
NM_014186chr112567 506 --11477 --
NM_014189chr42978 72 1173 ----
NM_014190chr421330 424 1525 ----
NM_014232chr1721584 1230 ------
NM_014232chr1721584 1230 ------
NM_014234chr6----1141 --
NM_014240chr364193 2889 1630 1346 566 200 ------
NM_014241chr101156 --124 --
NM_014263chr1011272 ------
NM_014268chr18----1432 --
NM_014279chr9--1759 ----
NM_014280chr12886 254 ------
NM_014289chrX11109 ------
NM_014292chr2281833 1443 1362 1342 707 348 126 101 ------
NM_014294chr84984 537 460 102 11217 ----
NM_014309chr2254648 4565 3686 698 412 2556 297 ----
NM_014319chr1211504 ------
NM_014323chr22------1314
NM_014325chr1252243 810 769 601 50 ------
NM_014331chr427668 7580 37046 2363 1305 ----
NM_014333chr1122355 2292 11110 ----
NM_014342chr111129 ------
NM_014350chr511081 ------
NM_014376chr521857 246 ------
NM_014379chr81184 ------
NM_014393chr821864 348 ------
NM_014405chr1742007 1696 1466 233 --1600 --
NM_014423chr532227 2002 1081 --14769 --
NM_014426chr202715 483 ------
NM_014431chr1041647 1523 526 93 1253 21163 65 --
NM_014447chr4--11508 1490 --
NM_014452chr621228 165 ------
NM_014456chr101437 21359 1237 ----
NM_014460chr221143 11688 1501 --
NM_014489chr111265 --1651 --
NM_014494chr16----1473 --
NM_014496chrX--1201 ----
NM_014498chr3----1348 --
NM_014500chrX153 ------
NM_014504chr721800 273 ------
NM_014548chr1521378 435 ------
NM_014554chr1221442 206 ------
NM_014574chr14--21286 629 1398 --
NM_014585chr2191 154 ----
NM_014587chr1611585 ------
NM_014600chr22424 353 11631 ----
NM_014606chr441568 1023 371 229 ------
NM_014607chr21152 ------
NM_014608chr15----1115 --
NM_014615chr1613417 23440 3360 1772 --
NM_014620chr121260 ------
NM_014630chr1563591 2603 2576 1532 460 340 ----11545
NM_014636chr943761 732 322 100 1937 ----
NM_014646chr1823013 363 --22594 113 --
NM_014647chr1641657 722 423 133 21966 492 2903 301 --
NM_014660chr7--1830 ----
NM_014667chr352479 2167 802 368 152 --1702 --
NM_014671chr73973 562 41 ------
NM_014677chr82414 143 ------
NM_014679chr1141330 1239 384 117 ------
NM_014682chr811778 12315 ----
NM_014685chr161507 ------
NM_014686chr1952394 2353 2347 1992 1866 ------
NM_014689chr22558 105 ------
NM_014690chr742467 2348 1898 1055 23124 336 ----
NM_014694chr93492 248 173 1620 ----
NM_014705chr721950 1598 11685 ----
NM_014709chr22104 87 --1507 --
NM_014711chr1631987 1722 1371 1220 --11947
NM_014717chr191660 --1707 --
NM_014720chr102605 120 ------
NM_014721chr621438 154 27183 6534 --16149
NM_014726chr1741385 944 363 338 ------
NM_014729chr821624 351 ------
NM_014730chr1254626 3229 3223 1912 195 ------
NM_014730chr1254626 3229 3223 1912 195 ------
NM_014732chr1635821 4787 1713 --14183 15646
NM_014733chr512002 --1670 --
NM_014735chrX31860 1692 1465 ------
NM_014738chr172955 943 ------
NM_014739chr623913 717 ------
NM_014742chr201125 ------
NM_014743chr43797 561 267 ------
NM_014751chr822057 744 ------
NM_014754chr82873 595 ------
NM_014755chr222859 820 1926 ----
NM_014757chr51235 130 --12077
NM_014760chr321825 1406 ------
NM_014764chr1211166 1893 ----
NM_014766chr753792 3549 3226 3058 148 23038 648 12987 --
NM_014773chr511366 11110 --1290
NM_014776chr1232986 2345 1124 --1764 --
NM_014779chr3----165 --
NM_014787chr121745 945 ------
NM_014790chr5122 ------
NM_014803chr1032419 1891 253 ------
NM_014806chr9--1147 --1504
NM_014810chr13978 656 95 ------
NM_014819chr5--3702 661 384 ----
NM_014820chr341468 1272 154 120 ----11589
NM_014822chr41521 ----1159
NM_014824chr1121975 1232 ------
NM_014827chr121647 325 ------
NM_014828chr1432204 1936 1637 ------
NM_014829chr51923 --12165 --
NM_014830chr122408 67 ------
NM_014832chr132119 32 1154 --11953
NM_014839chr142334 2282 457 63 ------
NM_014840chr1252916 2851 2532 2314 1360 --11253 --
NM_014841chr631205 963 280 ------
NM_014850chr344225 3455 3162 79 ------
NM_014864chr134369 4169 1674 ------
NM_014870chr124663 1213 ----11693
NM_014872chr932357 1773 575 --1220 --
NM_014873chr164566 4245 2996 851 661 611 13956 14177 --
NM_014877chr1726336 1966 27707 5723 --1809
NM_014884chr19145 --165 --
NM_014893chrY1714 ------
NM_014897chr172914 22 12423 1777 --
NM_014900chr2----21193 1037 --
NM_014901chr521919 697 ------
NM_014903chr1251943 1837 813 622 447 ------
NM_014904chr102612 263 12570 --13211
NM_014906chr1753707 3366 1446 1189 93 24083 1427 23893 720 --
NM_014909chr1433789 3682 130 1301 12725 --
NM_014912chr1053249 2569 1330 364 84 --22823 1166 --
NM_014913chr181140 1450 ----
NM_014916chr71645 1263 ----
NM_014918chr1511347 ----11367
NM_014920chr613780 --169 --
NM_014923chr1321494 728 1143 ----
NM_014924chr142954 366 12205 ----
NM_014926chr3127 ------
NM_014938chr1212377 ----12177
NM_014944chr11142 ------
NM_014947chr122781 783 ------
NM_014949chr11260 ------
NM_014962chr2032765 2711 271 ------
NM_014969chr13176 162 152 ----1436
NM_014974chr1031675 1634 305 ------
NM_014988chr432717 2181 1773 ------
NM_014989chr612032 ------
NM_014990chr141934 ------
NM_014991chr422521 2389 --12193 --
NM_014992chr142714 240 ------
NM_014994chr151266 1116 ----
NM_014996chr31143 ------
NM_014997chr741154 723 561 187 12138 ----
NM_015000chr1222950 472 ----1109
NM_015002chr122439 163 ------
NM_015017chr11281 ------
NM_015020chr1643206 2794 982 322 ------
NM_015024chr811441 ------
NM_015025chr242725 2543 228 80 --12113 --
NM_015026chr1254019 3835 1244 1053 383 ------
NM_015027chr1621859 111 1738 11735 --
NM_015032chr132572 300 ------
NM_015035chr2096281 5943 5629 4465 4406 2100 1609 1197 549 35142 4236 1667 --12624
NM_015042chr1551314 765 497 101 67 ----13314
NM_015051chr942304 2092 1140 360 --12522 --
NM_015052chr7----11181 --
NM_015057chr131237 ------
NM_015064chr1221134 796 --21083 816 --
NM_015068chr721009 703 ------
NM_015069chr161232 ------
NM_015071chr545045 4334 2150 1171 16105 14862 11928
NM_015074chr124285 1666 24462 3199 13309 --
NM_015075chrX32294 1567 255 ------
NM_015076chr674357 3723 1770 1456 1074 649 225 14377 ----
NM_015087chr13--12477 ----
NM_015091chr141730 ------
NM_015092chr1623342 1304 13760 ----
NM_015093chr6--11468 2305 124 --
NM_015094chr2254283 1426 858 464 416 ------
NM_015107chrX2390 100 ------
NM_015110chr922475 1579 ------
NM_015115chr422823 133 12367 ----
NM_015116chr1321646 30 ------
NM_015129chrX21789 1580 --1440 --
NM_015137chr842421 2200 1836 765 12588 ----
NM_015144chr16----1114 --
NM_015149chr121790 1782 11949 187 --
NM_015155chr103962 849 526 ----1222
NM_015156chr1433700 2934 146 13185 1832 --
NM_015163chr1411747 11675 ----
NM_015170chr832369 2237 1802 12040 ----
NM_015172chr131141 492 221 ------
NM_015173chr41102 ------
NM_015184chr3--1660 ----
NM_015185chrX12839 12683 ----
NM_015192chr2013008 ----11936
NM_015199chr321949 48 ------
NM_015200chr421884 952 ------
NM_015206chr15----23757 1315 --
NM_015209chr131766 462 130 ------
NM_015215chr132082 951 540 ------
NM_015216chr5--180 11084 --
NM_015219chr1752092 1728 1632 878 188 ------
NM_015231chr112185 173 ----1205
NM_015238chr52114 78 ------
NM_015246chr163731 642 584 12004 ----
NM_015247chr1634001 1476 600 --14560 --
NM_015250chr931267 531 495 ------
NM_015252chr2------1289
NM_015263chr151431 ------
NM_015265chr211711 ------
NM_015270chr122890 143 163 ----
NM_015271chr421379 649 ------
NM_015282chr252802 2578 498 404 393 12848 ----
NM_015284chr121553 1503 ------
NM_015289chr1511818 ------
NM_015291chr133451 2868 221 ------
NM_015294chr171936 --1371 166
NM_015299chr1432868 992 935 --2665 117 --
NM_015308chr11--148 --1585
NM_015317chr222053 1791 ------
NM_015326chr12767 736 12193 12312 --
NM_015329chr1921893 89 --12846 --
NM_015335chr122540 516 1167 ----
NM_015343chr17--1214 ----
NM_015344chr821876 671 --1124 --
NM_015347chr121710 ------
NM_015349chr61669 1275 ----
NM_015355chr1711862 ------
NM_015361chr21813 1113 ----
NM_015365chrX32819 2681 2658 ------
NM_015367chr2211627 --1623 --
NM_015375chr133827 3200 1602 11808 2268 116 --
NM_015382chr141513 1304 ----
NM_015393chr411348 154 ----
NM_015396chr321077 555 11030 ----
NM_015426chr3--1561 ----
NM_015435chr811274 1138 ----
NM_015443chr1721272 938 21509 551 1410 --
NM_015444chr3180 ------
NM_015446chr111167 ------
NM_015449chr12518 256 ------
NM_015455chr51160 --13347 --
NM_015458chr821766 232 --15262 --
NM_015461chr18--1639 ----
NM_015469chr92153 105 ----163
NM_015475chr211077 ------
NM_015483chr72392 39 --11080 --
NM_015509chr1211552 1576 ----
NM_015525chr61991 ------
NM_015527chr163641 614 271 ------
NM_015532chr1532558 2179 172 ------
NM_015534chr12451 135 ------
NM_015535chr23559 434 55 13095 13431 --
NM_015550chr742832 1103 513 45 1114 ----
NM_015553chr6114997 4947 4909 3718 3591 1970 1154 636 602 491 242 11087 --15161
NM_015554chr1511076 32911 623 477 ----
NM_015560chr322716 387 --12490 --
NM_015570chr721621 567 ------
NM_015571chr612332 32447 548 85 ----
NM_015575chr211355 1281 ----
NM_015576chr342739 2486 874 538 ------
NM_015577chr511528 --11447 --
NM_015584chr171520 1255 ----
NM_015601chr102876 824 1136 ----
NM_015602chr1--1123 ----
NM_015607chr11155 ------
NM_015609chr122326 1125 --12599 --
NM_015630chr221092 914 ------
NM_015640chr155062 4869 3322 1704 1665 ----15012
NM_015642chr31256 ------
NM_015686chrX32303 1911 1883 --11958 --
NM_015696chr1----176 --
NM_015719chr193669 162 58 ------
NM_015726chr121783 1551 ------
NM_015850chr832369 1638 449 ------
NM_015866chr121397 1216 ------
NM_015878chr82858 469 11383 --11577
NM_015879chr1838596 7488 1967 --1936 16026
NM_015881chr113901 144 66 --1198 --
NM_015885chr11----1193 --
NM_015886chr884585 4203 4020 4006 3901 3498 1227 962 1718 15401 --
NM_015888chr122157 1056 ------
NM_015898chr1921947 1570 --21559 749 --
NM_015905chr71406 ------
NM_015906chr132937 1715 1451 ------
NM_015912chr811019 --22204 150 --
NM_015915chr142278 85 ------
NM_015948chr61382 ------
NM_015987chr12178 ------
NM_015990chr41942 ------
NM_015995chr1523857 3799 24800 442 12176 --
NM_015999chr1143 ------
NM_016009chr154940 3871 3183 1950 812 ------
NM_016025chr1621475 1257 170 ----
NM_016040chr112548 12454 ----
NM_016045chr20--21779 1304 ----
NM_016048chr52233 204 ------
NM_016061chr221183 615 ------
NM_016107chr52353 201 1562 ----
NM_016129chr41313 ------
NM_016131chr21404 ------
NM_016132chr1512748 1914 ----
NM_016141chr32614 96 ------
NM_016152chr3----1380 --
NM_016185chr17----1764 --
NM_016201chr332084 713 555 ------
NM_016203chr72969 172 ------
NM_016206chr357968 6519 2798 2351 576 ------
NM_016219chr91458 ------
NM_016224chr63876 736 35 1552 ----
NM_016231chr171194 ------
NM_016248chr1332902 2792 1038 13788 1813 --
NM_016252chr22890 191 ------
NM_016255chr641280 924 914 450 ------
NM_016271chr1821678 1662 ------
NM_016281chr12--11191 ----
NM_016287chr1----1173 --
NM_016308chr11717 --11761 1219
NM_016316chr22631 49 ------
NM_016322chr91861 21235 590 --22611 2425
NM_016333chr161208 --1379 --
NM_016339chr1721503 584 --1623 --
NM_016374chr1--21416 1180 ----
NM_016374chr1--21416 1180 ----
NM_016376chr1734118 2777 1271 1645 --13730
NM_016396chr15--1888 1377 --
NM_016424chr171645 ------
NM_016436chr2042343 2012 943 430 ------
NM_016441chr232273 1778 324 --11939 --
NM_016470chr201118 ------
NM_016480chr5--1833 1719 --
NM_016485chr622126 649 22023 1903 1764 --
NM_016505chr1------1503
NM_016507chr172774 440 1474 ----
NM_016512chr81101 ----1244
NM_016513chr613780 --169 --
NM_016522chr1111662 ------
NM_016529chr131267 1223 ----
NM_016545chr11744 ------
NM_016577chr363986 1114 1045 807 754 342 --24181 2827 --
NM_016587chr72899 333 ------
NM_016592chr20147 11035 ----
NM_016598chr311479 ------
NM_016603chr51480 1887 --1873
NM_016604chr52970 910 ------
NM_016605chr51670 --12532 --
NM_016612chr82492 100 ------
NM_016620chr1--1237 ----
NM_016621chr1134524 1696 1556 ----11844
NM_016630chr15141 ------
NM_016656chrX1426 ------
NM_016823chr1711033 ------
NM_016836chr22492 84 --2485 25 --
NM_016839chr22492 84 --2485 25 --
NM_016930chr42818 58 ----1182
NM_016931chr111344 ------
NM_016936chr1622161 212 2553 469 21813 102 --
NM_016937chrX1624 ------
NM_016946chr132930 996 49 ------
NM_016950chr42561 326 ------
NM_017410chr1221138 1085 ------
NM_017413chrX4738 500 389 170 12056 ----
NM_017415chr5123258 3086 1677 1340 1223 1029 787 673 333 268 148 43 --34433 4345 199 13654
NM_017420chr1423281 2455 13721 ----
NM_017449chr1----21061 75 --
NM_017459chr1----172 --
NM_017544chrX----1837 --
NM_017548chr331976 790 231 1624 ----
NM_017551chr1012436 ------
NM_017558chr161343 ------
NM_017582chr141625 1280 731 308 ------
NM_017586chr922060 717 ------
NM_017590chr2232434 1796 1693 12146 ----
NM_017594chr9--22345 595 ----
NM_017595chr1721552 1148 --11388 --
NM_017596chr134670 3412 2898 ------
NM_017602chrX1908 ------
NM_017628chr435112 797 432 --14878 --
NM_017629chr111717 ----1331
NM_017633chr61530 1720 13761 --
NM_017634chr8--11769 ----
NM_017635chr1121487 1423 ------
NM_017637chr958350 8013 6084 2476 749 13041 1190 --
NM_017641chr12--1182 ----
NM_017644chr313974 --24709 1083 --
NM_017650chr755879 5614 5165 2033 353 25531 819 21916 558 --
NM_017651chr61343 ------
NM_017658chr1454049 3763 928 765 403 33793 1046 912 ----
NM_017661chr1521205 77 ------
NM_017662chr921328 30 ------
NM_017667chr7----1159 --
NM_017672chr15--1462 ----
NM_017699chr321209 45 11468 --1680
NM_017714chr201328 ------
NM_017715chr73703 619 295 --1181 --
NM_017719chr3------22576 1966
NM_017737chr132194 1399 435 11876 ----
NM_017744chr121605 739 11927 11849 --
NM_017754chr654751 3852 3090 1416 149 13350 13750 --
NM_017758chr1721525 396 ------
NM_017763chr173345 334 35 ------
NM_017768chr11214 1251 ----
NM_017772chr611701 ------
NM_017776chrX21142 1048 ------
NM_017778chr8----1599 --
NM_017787chr1042714 2016 1918 385 1981 ----
NM_017799chr14----11357 --
NM_017813chr835466 5020 1609 ------
NM_017824chr101555 ------
NM_017831chr1844357 4200 4176 3977 ------
NM_017848chrX34409 4328 884 ------
NM_017850chr12611 280 ------
NM_017873chr942567 629 612 533 ------
NM_017896chr2063152 2640 2411 2154 630 275 1955 ----
NM_017902chr1044710 2212 1762 144 ------
NM_017913chr92454 85 ------
NM_017915chr1221055 881 ------
NM_017916chr19121 ------
NM_017919chr985719 5653 4100 3941 3809 3588 1237 1136 --15822 1172
NM_017925chr9--11205 ----
NM_017955chr1431066 972 870 ------
NM_017966chr1131494 1434 242 --21027 103 --
NM_017988chr121335 ------
NM_017994chr733005 656 202 ------
NM_018010chr321609 390 ------
NM_018014chr21426 1388 ----
NM_018027chr1022989 1156 ------
NM_018030chr18122 ------
NM_018032chr163927 784 53 ------
NM_018036chr1433923 3667 2903 2498 100 ----
NM_018061chr12405 177 ------
NM_018062chr21414 ------
NM_018078chr41129 ------
NM_018084chr242521 2082 807 312 ------
NM_018085chr157227 5952 2248 2179 1490 31987 843 426 ----
NM_018086chr211390 11554 1366 --
NM_018087chr1--123 ----
NM_018092chr16--11232 ----
NM_018120chr82995 429 ------
NM_018126chr4184 ------
NM_018133chr31697 ------
NM_018150chr12758 584 ----1592
NM_018157chr1232913 2199 1043 22345 1218 ----
NM_018164chr121239 ------
NM_018171chr12----1214 --
NM_018178chr131534 1302 288 ------
NM_018179chr121268 ------
NM_018181chr1841576 1490 1414 607 ------
NM_018182chr1711695 --1459 1378
NM_018191chr1351657 776 537 68 33 ------
NM_018192chr321040 819 ------
NM_018195chr1142042 1508 1451 1393 1723 1473 --
NM_018198chr12955 177 --11426 --
NM_018200chr1512602 22282 1973 --1656
NM_018201chr932540 1752 159 --1376 --
NM_018206chr16--1198 ----
NM_018223chr12185 --1132 --
NM_018237chr10131 ------
NM_018241chr42998 71 ------
NM_018243chr433067 2884 73 ------
NM_018247chr6--1848 ----
NM_018254chr132134 2017 1523 157 ----
NM_018265chr141838 1761 528 360 ------
NM_018293chr322854 663 12218 ----
NM_018303chr611366 1470 ----
NM_018307chr171852 1339 ----
NM_018312chr11----1551 --
NM_018313chr332523 2005 564 ------
NM_018320chr11----1108 --
NM_018330chr1021372 1241 --1567 --
NM_018351chr1233171 420 168 13183 ----
NM_018364chr114022 12733 ----
NM_018369chr53309 293 25 ------
NM_018371chr81282 1317 11115 --
NM_018375chr1421219 360 --1456 --
NM_018388chrX1534 1583 ----
NM_018403chr363847 3634 3563 2545 1151 271 ------
NM_018413chr121248 ------
NM_018425chr1022567 185 12068 --11860
NM_018440chr888338 6751 6582 5960 5938 5791 1527 523 ----17274
NM_018448chr12--11129 11268 --
NM_018452chr6_random33535 1515 539 ------
NM_018486chrX1487 ------
NM_018569chr41449 21258 78 ----
NM_018571chr21470 ------
NM_018584chr13981 412 402 ------
NM_018602chr151297 1117 ----
NM_018638chr1215301 35537 5066 4284 ----
NM_018640chr1242844 780 615 355 ------
NM_018644chr1111442 --1278 --
NM_018649chr101396 --1440 --
NM_018650chr121832 1622 22128 1663 ----
NM_018653chr171263 ------
NM_018657chr31711 ------
NM_018667chr1612832 --22814 87 --
NM_018684chrX1204 11268 ----
NM_018686chr122268 134 ------
NM_018689chr1531645 214 165 --1260 --
NM_018695chr52897 525 --11998 --
NM_018697chr732277 2079 242 --21817 674 --
NM_018700chr531207 300 93 ------
NM_018704chr131703 662 543 ----11358
NM_018708chr1941666 1283 179 162 --1611 --
NM_018713chr11815 2328 123 ----
NM_018715chr132127 1781 494 11611 ----
NM_018841chr143620 3533 844 449 ------
NM_018844chr722071 1433 1422 ----
NM_018846chr7294 55 1396 ----
NM_018847chr911211 ------
NM_018890chr741098 1064 962 523 ------
NM_018898chr552361 2284 1467 325 196 1779 ----
NM_018899chr552361 2284 1467 325 196 1779 ----
NM_018900chr552361 2284 1467 325 196 1779 ----
NM_018901chr552361 2284 1467 325 196 1779 ----
NM_018902chr552361 2284 1467 325 196 1779 ----
NM_018903chr552361 2284 1467 325 196 1779 ----
NM_018904chr552361 2284 1467 325 196 1779 ----
NM_018905chr552361 2284 1467 325 196 1779 ----
NM_018906chr552361 2284 1467 325 196 1779 ----
NM_018907chr552361 2284 1467 325 196 1779 ----
NM_018908chr552361 2284 1467 325 196 1779 ----
NM_018909chr552361 2284 1467 325 196 1779 ----
NM_018910chr552361 2284 1467 325 196 1779 ----
NM_018911chr552361 2284 1467 325 196 1779 ----
NM_018912chr521531 411 ------
NM_018913chr521531 411 ------
NM_018914chr521531 411 ------
NM_018915chr521531 411 ------
NM_018916chr521531 411 ------
NM_018917chr521531 411 ------
NM_018918chr521531 411 ------
NM_018919chr521531 411 ------
NM_018920chr521531 411 ------
NM_018921chr521531 411 ------
NM_018922chr521531 411 ------
NM_018923chr521531 411 ------
NM_018924chr521531 411 ------
NM_018925chr521531 411 ------
NM_018926chr521531 411 ------
NM_018927chr521531 411 ------
NM_018928chr521531 411 ------
NM_018929chr521531 411 ------
NM_018945chr633451 1425 709 --1298 --
NM_018948chr1----11163 11225
NM_018972chr852426 2095 1956 1893 1883 1519 ----
NM_018977chrX1965 --1357 --
NM_018979chr1242594 2564 2306 570 --11833 --
NM_018981chr2--1886 ----
NM_018983chr4------1238
NM_018999chr1034271 1549 1049 ------
NM_019000chr521587 1299 ------
NM_019001chr344756 3355 911 589 34658 4499 3696 ----
NM_019004chr73866 668 469 ------
NM_019024chr21120 ------
NM_019036chr6----1917 --
NM_019045chrX170 ------
NM_019049chr12506 194 ----1268
NM_019063chr23621 544 189 ------
NM_019071chr71790 ------
NM_019091chr21819 ------
NM_019096chr631132 219 117 1235 ----
NM_019102chr72398 88 ------
NM_019102chr72398 88 ------
NM_019116chr1621476 446 --1737 --
NM_019555chr31355 ------
NM_019556chrX1469 ------
NM_019558chr21143 ------
NM_019590chr101568 ------
NM_019593chr2063178 2374 2233 1223 816 766 ------
NM_019594chr91221 --11089 1430
NM_019595chr2--1226 ----
NM_019605chr12657 491 ------
NM_019609chr20------195
NM_019860chr1021105 257 --1338 --
NM_019884chr191230 ------
NM_019891chr121347 1018 ------
NM_019895chr31764 ------
NM_020116chr41402 ------
NM_020122chr234302 3869 1859 24228 4209 11503 13838
NM_020134chr22202 167 --1750 --
NM_020151chr221379 451 --132 --
NM_020152chr211724 ------
NM_020168chr15--11387 ----
NM_020177chr562647 1266 1154 519 287 115 ------
NM_020182chr2023082 646 ------
NM_020185chr63422 363 52 ------
NM_020205chr123372 2344 ------
NM_020214chr151264 165 ----
NM_020226chr41517 ------
NM_020228chr111633 1338 ----
NM_020234chr15162 ------
NM_020235chr32112 30 ------
NM_020238chr113810 256 152 ------
NM_020239chr1----22220 1708 --
NM_020245chr634133 2050 1938 21948 1170 1591 --
NM_020248chr121851 1514 --2472 357 --
NM_020311chr21599 ------
NM_020337chr432343 371 215 22534 193 ----
NM_020338chr1033317 2515 1194 11460 --13643
NM_020340chr631545 807 287 ------
NM_020342chr241800 1632 720 429 --1729 1155
NM_020382chr1221443 273 ------
NM_020401chr121182 ------
NM_020403chr1331711 681 370 ------
NM_020416chr4------2901 758
NM_020420chrY11607 ------
NM_020438chr921145 906 --11213 --
NM_020443chr175644 5442 5194 2786 2502 2292 160 --16611 --
NM_020456chr131349 12319 ----
NM_020465chr1672042 1941 1916 1462 560 371 168 --31649 1338 541 --
NM_020473chrX2504 309 ------
NM_020474chr1831746 691 99 ------
NM_020532chr21606 1185 ----
NM_020546chr532862 2130 199 22482 446 ----
NM_020640chr31507 ------
NM_020647chr821632 203 21951 766 ----
NM_020672chr12429 30 --1564 --
NM_020686chr1642844 2696 2085 181 ------
NM_020696chr3--149 ----
NM_020697chr82357 324 ------
NM_020699chr122155 646 --14808 --
NM_020704chr721713 57 ------
NM_020708chr2032402 1830 687 12365 1941 --
NM_020711chr221975 579 ------
NM_020715chr1422236 770 11965 ----
NM_020717chrX43362 1975 1106 52 14215 ----
NM_020718chr1696292 6031 5905 5059 1822 1473 1233 956 83 --12608 --
NM_020727chr2163710 3628 3586 3403 3007 1531 ------
NM_020728chr732571 507 300 --12239 --
NM_020734chr121776 ----13288
NM_020739chr1532672 837 74 12996 ----
NM_020742chrX6741 729 694 580 329 188 ------
NM_020747chr5178 ------
NM_020760chr221758 141 ------
NM_020762chr122944 886 199 ----
NM_020766chrX34518 2950 648 ----23037 188
NM_020769chrX1803 ------
NM_020772chr1746763 5495 5402 625 22546 2242 26574 914 --
NM_020774chr1821373 170 ------
NM_020778chr1543238 3039 925 837 33744 1800 632 11047 --
NM_020782chr1244476 3373 1900 1101 2590 515 24505 3514 --
NM_020791chr1711064 ------
NM_020795chr1741668 1637 1446 291 1472 ----
NM_020801chr522560 1724 --11796 --
NM_020805chr1821349 756 1401 ----
NM_020806chr14--1254 ----
NM_020807chr1611567 --1119 --
NM_020808chr12291 83 --1454 --
NM_020809chr1131992 1580 696 ------
NM_020813chr1912699 32537 2354 2324 1194 --
NM_020819chr631214 1037 150 ------
NM_020825chr1653760 2832 1374 1295 294 1998 ----
NM_020839chr331606 637 605 ------
NM_020841chr1212849 2929 62 ----
NM_020845chr1242497 2148 150 36 ------
NM_020854chr181521 --11198 --
NM_020858chr1532129 608 214 ------
NM_020871chrX11826 ------
NM_020872chr32709 57 ------
NM_020873chr31349 1310 ----
NM_020888chr131469 578 161 --1711 --
NM_020914chr1731889 1675 861 11934 ----
NM_020918chr1052790 2753 741 534 357 --12339 --
NM_020948chr113065 11077 ----
NM_020952chr91136 ------
NM_020962chr152941 669 ------
NM_020981chr2160 ------
NM_020983chr122890 143 163 ----
NM_020987chr101108 11042 --11085
NM_020993chr1252357 1097 971 728 671 ------
NM_021007chr2------1655
NM_021033chr1323103 97 --12896 11271
NM_021038chr323239 49 ------
NM_021072chr5----1522 --
NM_021076chr22--1576 ----
NM_021088chr2------1842
NM_021090chr2254628 3858 3682 1963 1337 14450 11604 14308
NM_021096chr2233078 1327 1300 --12377 --
NM_021111chr921004 948 ------
NM_021129chr10--145 ----
NM_021132chr101122 ------
NM_021136chr14----1298 --
NM_021148chr712102 ------
NM_021156chr2011040 ------
NM_021159chr4----1435 --
NM_021165chr1197 --1267 --
NM_021168chr1621306 1102 --2530 216 11175
NM_021174chr8--1631 ----
NM_021183chrX22054 465 12131 ----
NM_021192chr21354 ------
NM_021202chr2042926 2680 982 781 ------
NM_021215chr2022480 892 12161 ----
NM_021216chr1931281 1102 1035 ------
NM_021227chr4----1444 --
NM_021238chr1221278 488 21597 1364 ----
NM_021240chr91121 ------
NM_021249chr1421676 203 ------
NM_021255chr1433466 2814 414 ------
NM_021269chr1921991 1699 ------
NM_021622chr102481 250 1941 ----
NM_021629chr345116 4625 3143 599 --24738 3764 --
NM_021637chrX11244 ------
NM_021638chr434559 3822 256 13829 23648 859 --
NM_021643chr241764 1555 1441 524 --11869 --
NM_021644chr10----1991 --
NM_021728chr14----1365 --
NM_021729chr111300 ------
NM_021738chr102598 86 ------
NM_021784chr202584 95 ------
NM_021785chrX1305 ------
NM_021813chr645516 4959 4265 199 --15214 --
NM_021814chr61294 11659 ----
NM_021871chr4129 ------
NM_021905chr631685 1409 668 ------
NM_021911chr545245 1562 1378 254 ------
NM_021913chr191249 --11188 --
NM_021914chr1412337 1597 ----
NM_021932chr11139 1280 ----
NM_021940chr6--1523 ----
NM_021943chr632108 374 331 ------
NM_021946chrX31462 595 421 ------
NM_021949chrX32408 2019 804 12753 ----
NM_021954chr1322382 784 21265 165 ----
NM_021956chr611234 ------
NM_021958chr11257 170 ----
NM_021960chr121733 175 1535 ----
NM_021961chr1197388 7258 6127 5535 5376 4644 1958 1584 1286 25383 182 22782 2407 --
NM_021964chr356244 4537 2306 1799 1394 12054 16500 --
NM_021965chr911342 141 ----
NM_021970chr42669 579 199 ----
NM_021976chr62996 718 --123 --
NM_021980chr10167 ------
NM_021984chrX1408 1274 --11380
NM_021987chrX1408 1274 --11380
NM_021990chrX1408 1274 --11380
NM_021991chr172646 159 ----1543
NM_022003chr1111211 ------
NM_022036chr171263 ------
NM_022048chr1545460 4184 1652 1519 15402 ----
NM_022058chr22310 72 ------
NM_022060chr141855 --11347 --
NM_022072chr31222 ------
NM_022079chr102876 824 1136 ----
NM_022114chr124804 1703 1387 ----
NM_022124chr101642 ------
NM_022130chr511348 ------
NM_022140chr542344 2323 840 775 12312 ----
NM_022153chr1031382 750 222 --23540 3031 --
NM_022166chr1675582 5427 2435 2428 1624 1076 384 ----15343
NM_022170chr72425 346 11392 ----
NM_022346chr431212 1202 964 ------
NM_022373chr72246 115 ------
NM_022374chr2--138 ----
NM_022451chr101590 ------
NM_022459chr1366314 4923 1895 1823 978 598 --15620 --
NM_022461chr31257 ------
NM_022462chr1943646 3532 3429 1120 ------
NM_022465chr1232575 2361 2063 ------
NM_022474chr141444 ----1841
NM_022491chr1243486 2727 2629 2589 12878 --13086
NM_022495chr141389 ------
NM_022497chr322881 1108 22466 520 11383 --
NM_022552chr2----1869 --
NM_022574chr732208 2093 1510 ------
NM_022652chr121329 ------
NM_022658chr1231222 1141 335 ------
NM_022719chr2262656 1413 931 848 473 445 ------
NM_022726chr651242 1203 605 426 118 ------
NM_022728chr71104 ------
NM_022735chr11224 21807 1468 --11520
NM_022737chr1921022 40 ------
NM_022744chr1621054 1039 ------
NM_022745chr162703 2596 2238 2227 238 127 ------
NM_022753chr1185 ------
NM_022758chr63968 457 210 ------
NM_022763chr342646 2231 1168 1147 ------
NM_022771chr121891 ------
NM_022780chr231664 1450 166 --1752 --
NM_022781chr953089 2760 1257 1135 328 11143 22527 35 --
NM_022810chrX165 ------
NM_022817chr232096 400 318 22086 1969 151 11865
NM_022824chr5--1114 ----
NM_022831chr11613 1332 11623 --
NM_022838chrX1266 ------
NM_022841chr1522597 2559 12756 ----
NM_022844chr16--1961 ----
NM_022845chr1631809 1728 1537 ------
NM_022893chr232639 2044 170 --12779 --
NM_022898chr1444611 1161 776 435 14047 24428 1019 --
NM_022910chr1672042 1941 1916 1462 560 371 168 --31649 1338 541 --
NM_022912chr252876 2802 2762 957 159 32682 1964 637 12523 --
NM_022918chr11--11727 ----
NM_022970chr1021031 382 ------
NM_023000chr141318 ------
NM_023001chr141318 ------
NM_023012chr122164 99 ------
NM_023018chr11227 11472 ----
NM_023035chr191574 ------
NM_023067chr321358 148 2932 211 ----
NM_023079chr1721714 1223 ------
NM_023105chr832369 1638 449 ------
NM_023106chr832369 1638 449 ------
NM_023110chr832369 1638 449 ------
NM_023111chr832369 1638 449 ------
NM_023924chr52673 536 ------
NM_023925chr12----137 --
NM_023929chr812266 ------
NM_024007chr531235 1120 198 ------
NM_024016chr171695 ------
NM_024036chr11125 ----1202
NM_024060chr11------1293
NM_024061chr71477 ------
NM_024076chr1932255 389 34 ----11640
NM_024089chr13----135 --
NM_024092chr1121212 386 ------
NM_024117chr911142 ------
NM_024293chr22831 727 ------
NM_024294chr63968 457 210 ------
NM_024308chr17170 ------
NM_024332chrX21298 706 ------
NM_024337chr51252 ------
NM_024345chr936031 4351 37 ----11691
NM_024408chr133259 695 537 --1472 --
NM_024415chr51207 ------
NM_024423chr1833829 3794 1182 --13787 --
NM_024424chr1111197 --1144 --
NM_024425chr1111197 --1144 --
NM_024426chr1111197 --1144 --
NM_024429chr72969 172 ------
NM_024430chr1821622 36 ------
NM_024511chr432994 888 178 ------
NM_024513chr343250 3033 2903 2455 1158 ----
NM_024524chr352930 2076 732 579 314 --1671 --
NM_024529chr11121 ------
NM_024539chrX21296 982 1118 --1422
NM_024545chr22301 109 ------
NM_024548chr321274 664 ------
NM_024551chr1242280 1830 1658 896 ------
NM_024551chr1242280 1830 1658 896 ------
NM_024563chr511927 ----1416
NM_024565chr52425 133 11231 1459 --
NM_024567chr83577 289 81 ------
NM_024572chr2----141 --
NM_024582chr41336 ------
NM_024586chr1--1640 ----
NM_024612chr1721112 53 ------
NM_024624chr221457 1358 ------
NM_024636chr742769 2602 2181 2014 ------
NM_024639chr622701 636 ------
NM_024645chr811547 11355 ----
NM_024646chr133294 937 267 11032 ----
NM_024657chrX1622 ------
NM_024665chr321726 1250 23988 1481 ----
NM_024674chr152895 1168 783 537 490 ------
NM_024676chr121257 353 1867 ----
NM_024686chr11497 ------
NM_024692chr231832 711 442 11379 ----
NM_024700chr12413 392 --2300 99 --
NM_024704chr201260 ------
NM_024713chr15--11665 ----
NM_024715chr51168 ------
NM_024721chr8--125 ----
NM_024740chr1134143 2689 1498 12825 1132 --
NM_024742chr16----11499 --
NM_024744chr21830 ----12632
NM_024749chr111463 --140 --
NM_024753chr23173 93 22 ------
NM_024759chr81282 ------
NM_024761chr944258 3261 366 167 ------
NM_024771chr111989 11943 22022 688 --
NM_024789chr102955 696 1685 ----
NM_024798chr1522354 750 ------
NM_024811chr111772 11698 1298 --
NM_024824chr142689 197 ------
NM_024830chr51294 ------
NM_024834chr1021859 386 ------
NM_024863chrX2112 34 ------
NM_024887chr111627 --1107 --
NM_024900chr43626 554 436 ------
NM_024900chr43626 554 436 ------
NM_024940chr81406 ------
NM_024945chr911171 ------
NM_024947chr3109193 8910 8769 7238 6160 5974 2910 1425 1138 540 ----15854
NM_024953chr1242528 1800 1095 150 ------
NM_024971chr91136 ------
NM_025054chr824206 685 ------
NM_025074chr443011 2360 2004 962 21214 601 ----
NM_025099chr1721149 896 --2824 149 --
NM_025133chr22293 202 ------
NM_025154chr731501 1196 334 ----1183
NM_025160chr164340 3855 3249 1402 1275 830 12770 ----
NM_025187chr161928 --1152 --
NM_025191chr133384 2165 1305 ------
NM_025196chr4123 ------
NM_025222chr332922 2095 659 12682 --12701
NM_025230chr1431529 473 291 1192 --11252
NM_025235chr1041686 888 840 354 ------
NM_025248chr1732838 2709 174 ------
NM_025263chr641239 616 312 164 ------
NM_030594chr151523 1514 ----
NM_030621chr1432623 1406 268 1294 13337 --
NM_030625chr1031004 784 57 --1290 1408
NM_030627chr533514 451 157 ------
NM_030640chr121308 ------
NM_030647chr745998 5680 4453 2042 --11287 --
NM_030648chr434347 1828 368 24363 1621 25209 1975 --
NM_030650chr233551 804 486 11231 12880 --
NM_030660chr1431343 1013 527 ------
NM_030665chr1721324 404 ------
NM_030674chr1234091 3619 671 ------
NM_030758chr221462 ------
NM_030795chr82458 147 ------
NM_030802chr171889 ------
NM_030806chr199251 9117 8144 7903 7026 6293 3044 2290 2246 28261 1204 17127 --
NM_030816chr11697 --23386 2921 --
NM_030820chr61113 1962 138 --
NM_030881chr2252307 1775 1759 512 448 ------
NM_030914chr93956 909 157 ------
NM_030918chr154786 3796 1537 1336 302 --13832 --
NM_030937chr13333 203 102 --11001 --
NM_030939chr61928 11160 ----
NM_030949chr621201 1177 --21395 1143 --
NM_030962chr1141540 531 502 172 ------
NM_030963chr61196 --1563 --
NM_030964chr542477 1423 957 26 12510 1729 --
NM_030979chr13135 ------
NM_031206chrX--125 ----
NM_031216chr1831844 1585 764 ------
NM_031244chr611110 ------
NM_031262chr9----190 --
NM_031263chr9----1147 --
NM_031266chr51179 ------
NM_031268chr1655348 3521 1384 517 237 14196 11025 --
NM_031292chr121661 ------
NM_031369chr42871 654 ------
NM_031370chr42871 654 ------
NM_031371chr1--21416 1180 ----
NM_031371chr1--21416 1180 ----
NM_031407chrX1423 1324 ----
NM_031411chr552361 2284 1467 325 196 1779 ----
NM_031431chr1311627 11778 ----
NM_031438chr52565 143 ------
NM_031442chrX42545 2150 1076 630 ------
NM_031445chr243286 3178 3017 1063 ------
NM_031453chr1012307 1241 ----
NM_031459chr1--11615 ----
NM_031461chr8----1309 --
NM_031468chr733310 1591 215 --1653 --
NM_031469chr643194 2609 472 136 ------
NM_031476chr1642741 2670 1772 323 --11780 1196
NM_031477chr161270 ------
NM_031844chr154042 3816 1629 1145 875 ----13667
NM_031845chr21880 ------
NM_031847chr21880 ------
NM_031849chr552361 2284 1467 325 196 1779 ----
NM_031857chr552361 2284 1467 325 196 1779 ----
NM_031860chr552361 2284 1467 325 196 1779 ----
NM_031866chr102958 785 ------
NM_031890chr2232069 791 322 12578 1134 --
NM_031935chr11116 1854 ----
NM_031992chr72425 346 11392 ----
NM_032012chr944106 1257 1210 1004 ------
NM_032021chr1111084 1286 1259 --
NM_032041chr832632 200 41 32589 2481 2017 --1232
NM_032042chr542800 1867 1042 204 ------
NM_032047chr321946 591 --12186 --
NM_032050chr22------1314
NM_032088chr521531 411 ------
NM_032092chr521531 411 ------
NM_032102chr1132822 1171 1009 ------
NM_032104chr1151 ------
NM_032105chr146126 2922 2713 51 17650 16861 --
NM_032124chr181313 11162 ----
NM_032139chr192353 92 ------
NM_032144chr251768 643 607 485 277 ------
NM_032146chr31384 ------
NM_032151chr5--1496 ----
NM_032156chr12----137 --
NM_032174chr121168 508 ------
NM_032186chr1--1237 ----
NM_032192chr172604 87 ------
NM_032208chr233398 2885 647 ------
NM_032239chr4--1468 ----
NM_032242chr353088 2919 2603 2282 613 --199 1251
NM_032246chr1521331 453 ------
NM_032256chr12------1133
NM_032268chr1632401 978 348 ----12428
NM_032288chr342313 1876 644 537 --12292 --
NM_032289chr511805 ------
NM_032345chr121375 ------
NM_032373chr1033824 806 364 25790 4810 15309 --
NM_032379chr111150 ------
NM_032403chr521531 411 ------
NM_032410chr821228 506 11136 ----
NM_032421chr722057 617 ------
NM_032438chr61174 ------
NM_032439chr101348 ------
NM_032440chr1012276 21819 648 ----
NM_032445chr152182 31 ------
NM_032449chr132126 1812 280 ------
NM_032457chr412601 ------
NM_032458chrX43205 1374 956 285 ------
NM_032482chr1982310 2227 1835 1693 819 703 415 372 --21819 1764 --
NM_032491chr122497 409 ------
NM_032494chr2--161 ----
NM_032505chr331717 722 527 22690 701 ----
NM_032552chr9----11911 --
NM_032557chr41133 ------
NM_032558chr931293 471 81 ------
NM_032569chr16--1266 ----
NM_032575chr1641267 221 212 142 ------
NM_032578chr1031431 607 132 ------
NM_032582chr1721450 296 ------
NM_032590chr1231041 380 339 ------
NM_032626chr161332 ------
NM_032632chr1421442 749 ------
NM_032646chr171368 --41498 1449 1363 235 --
NM_032682chr332583 1009 722 --11205 --
NM_032711chr1783183 2778 1692 1282 1259 550 381 291 12862 21713 1206 --
NM_032727chr102479 299 ------
NM_032737chr1932662 949 894 ------
NM_032777chr82531 401 ------
NM_032784chr62670 219 --168 --
NM_032800chr132536 2156 1981 ------
NM_032804chr10----12205 --
NM_032810chr102340 84 --1227 --
NM_032812chr10143 ------
NM_032819chr201614 1729 ----
NM_032827chr2--31130 1100 1070 ----
NM_032833chr11248 --12419 --
NM_032867chr112555 255 ------
NM_032873chr1124462 196 13331 ----
NM_032875chr17192 ------
NM_032883chr201888 ------
NM_032900chr1023622 59 41275 348 293 205 13016 --
NM_032905chr1031051 830 292 ------
NM_032932chr1755983 4289 4275 2048 1846 1512 --26045 4297
NM_032943chr111150 ------
NM_032961chr41422 ------
NM_032978chr181124 ------
NM_032979chr181124 ------
NM_032981chr181124 ------
NM_032982chr722203 1926 1331 --12467
NM_032993chr4------1238
NM_033012chr131915 ------
NM_033018chrX31013 902 199 ------
NM_033020chr132937 1715 1451 ------
NM_033023chr731151 1014 440 --2390 77 --
NM_033030chr211341 ------
NM_033055chr11332 ------
NM_033056chr102716 558 ------
NM_033081chr2011221 1571 ----
NM_033088chr13475 455 85 ------
NM_033121chr1221488 1385 11828 1382 11871
NM_033132chr1331865 860 155 ------
NM_033136chr521236 201 ------
NM_033137chr521236 201 ------
NM_033143chr424449 4407 11314 ----
NM_033198chr172544 54 ------
NM_033211chr51118 1795 11850 --
NM_033225chr862670 2582 2545 2091 1253 412 1585 ----
NM_033228chr51147 ------
NM_033259chr31638 ------
NM_033260chr6--1807 ----
NM_033267chr51726 --145 --
NM_033285chr842726 1727 1351 682 143 ----
NM_033290chrX23221 3114 12718 ----
NM_033326chr1112131 12065 ----
NM_033360chr1234440 3253 1098 13322 ----
NM_033380chrX4936 434 393 112 ------
NM_033381chrX4936 434 393 112 ------
NM_033389chr1764452 4352 1308 894 825 143 13478 34686 4186 569 --
NM_033425chr113833 559 246 ------
NM_033429chr1532973 1058 70 --22470 2299 --
NM_033430chr443372 3316 2600 46 ------
NM_033437chr443372 3316 2600 46 ------
NM_033480chr621880 242 12590 12710 --
NM_033481chr621880 242 12590 12710 --
NM_033495chrX1154 1378 ----
NM_033505chr245810 5545 1277 958 25982 4418 ----
NM_033512chr843037 2947 654 251 2928 402 ----
NM_033624chr122439 163 ------
NM_033631chr143258 3232 2387 1246 --13704 --
NM_033637chr1023859 3711 ------
NM_033642chrX21149 51 ------
NM_033644chr53853 829 737 12416 ----
NM_033645chr53853 829 737 12416 ----
NM_048368chr181282 ------
NM_052818chr1332122 1570 173 ------
NM_052827chr1211096 --1433 --
NM_052840chr1511267 11213 21336 1225 --
NM_052869chr171368 --41498 1449 1363 235 --
NM_052876chr1931063 456 111 --11993 --
NM_052880chr2241340 349 198 87 ------
NM_052885chr1234128 3769 1061 11759 21883 418 --
NM_052898chr811718 --11413 --
NM_052900chr81321 1222 ----
NM_052904chr641127 1045 253 76 ------
NM_052905chr21669 11260 ----
NM_052907chr1232858 963 347 ------
NM_052913chr6160 ------
NM_052918chr1012648 --43276 2817 1408 404 13564
NM_052927chr521991 409 ------
NM_052932chr112527 424 ------
NM_052934chr141557 915 552 202 ------
NM_052950chr131294 ------
NM_052962chr621758 246 11704 11254 --
NM_053002chr31156 1906 1290 --
NM_053016chr957405 5737 1010 368 190 17848 ----
NM_053023chr1121085 348 ----1682
NM_053025chr3--11610 ----
NM_053026chr3--11610 ----
NM_053027chr3--11610 ----
NM_053028chr3--11610 ----
NM_053031chr3--11610 ----
NM_053032chr3--11610 ----
NM_053043chr775967 5716 2486 2194 1558 637 203 1276 14036 --
NM_053056chr1152813 2630 1175 981 512 --163 --
NM_053064chr1421142 655 --1736 --
NM_054025chr1111442 --1278 --
NM_054033chr21612 ----1469
NM_054035chr171640 ------
NM_057089chr7149 ----1159
NM_057161chr6----2222 133 --
NM_057164chr22260 172 ------
NM_057165chr22260 172 ------
NM_057166chr22260 172 ------
NM_057167chr22260 172 ------
NM_057169chr1232986 2345 1124 --1764 --
NM_057170chr1232986 2345 1124 --1764 --
NM_057175chr432476 1962 1813 --1649 1601
NM_058172chr421644 539 ------
NM_058237chr141285 ------
NM_078467chr61273 11301 --11509
NM_078485chr61174 ----1489
NM_078625chr61255 --1916 --
NM_079421chr191137 1367 ----
NM_080546chr911547 --21617 919 --
NM_080597chr18122 ------
NM_080618chr201414 123 ----
NM_080629chr12942 280 ----1330
NM_080630chr12942 280 ----1330
NM_080645chr621453 1400 180 1674 --
NM_080679chr61624 ------
NM_080680chr61624 ------
NM_080681chr61624 ------
NM_080717chr1221353 399 11594 ----
NM_080723chr61399 2448 111 1226 --
NM_080738chr1----1633 --
NM_080764chr221236 ------
NM_080792chr202857 835 ------
NM_080872chr813939 ------
NM_080927chr32659 174 13316 ----
NM_130391chr953510 3382 2817 2707 538 ------
NM_130392chr953510 3382 2817 2707 538 ------
NM_130393chr953510 3382 2817 2707 538 ------
NM_130436chr2142449 1788 395 51 12526 ----
NM_130438chr2143026 2365 972 628 23103 2113 ----
NM_130439chr1021903 1769 ------
NM_130439chr1021903 1769 ------
NM_130831chr322716 387 --12490 --
NM_130832chr322716 387 --12490 --
NM_130833chr322716 387 --12490 --
NM_130834chr322716 387 --12490 --
NM_130835chr322716 387 --12490 --
NM_130836chr322716 387 --12490 --
NM_130837chr322716 387 --12490 --
NM_130838chr1511818 ------
NM_130839chr1511818 ------
NM_133170chr2057817 1979 410 352 141 11795 26693 692 --
NM_133177chr131128 938 275 ------
NM_133178chr131128 938 275 ------
NM_133264chr171774 13540 11010 11496
NM_133265chrX42812 1427 824 227 1305 1629 --
NM_133334chr446404 5566 2126 1177 25591 2407 25013 1550 --
NM_133433chr51330 ------
NM_133457chr731319 1264 263 --21487 1200 --
NM_133468chr722492 277 --11679 --
NM_133476chr1221199 797 ----1278
NM_133477chr423188 513 ------
NM_133494chr12111 82 ------
NM_133496chr143332 1644 1148 224 13193 ----
NM_133499chrX1857 ------
NM_133509chr141462 11171 ----
NM_133631chr321357 265 ----11468
NM_133638chr51320 --1154 --
NM_133647chr1533574 106 22 ------
NM_134442chr22576 154 1697 ----
NM_138357chr101663 --1303 --
NM_138396chr12190 ------
NM_138426chr742201 839 745 412 1881 ----
NM_138437chrX160 ----169
NM_138459chr622528 1267 ------
NM_138462chr9--1176 ----
NM_138473chr1295102 4562 4490 3968 3590 3551 3430 3173 118 44262 1848 1088 881 14800 --
NM_138492chr5----2384 319 --
NM_138494chr712826 11048 ----
NM_138555chr151540 ------
NM_138559chr21416 1378 ----
NM_138569chr62105 56 ------
NM_138576chr1444611 1161 776 435 14047 24428 1019 --
NM_138609chr51223 --1372 --
NM_138610chr51223 --1372 --
NM_138621chr243499 3346 890 291 --11352 --
NM_138638chr1412337 1597 ----
NM_138713chr1687341 6695 2651 2350 1721 1647 1196 1055 --11365 15669
NM_138714chr1687341 6695 2651 2350 1721 1647 1196 1055 --11365 15669
NM_138727chr121605 739 11927 11849 --
NM_138728chr121605 739 11927 11849 --
NM_138730chr61309 --1369 --
NM_138731chr1413909 13712 ----
NM_138771chr7--1459 ----
NM_138775chr111695 ------
NM_138782chr522406 1863 1811 ----
NM_138795chr141545 1387 1079 612 ------
NM_138927chr2111066 ------
NM_138970chr141897 --12003 1716
NM_139014chr621848 881 ------
NM_139015chr1231691 1265 169 ------
NM_139035chrX1728 ------
NM_139045chr91847 --1854 --
NM_139057chr1592651 2598 2144 778 593 449 355 315 155 ------
NM_139067chr121276 ------
NM_139072chr23856 248 232 ------
NM_139126chr61716 ------
NM_139136chr121250 --1235 --
NM_139157chr111637 --2711 255 --
NM_139168chr51440 11721 ----
NM_139283chr1232225 2150 669 ----1277
NM_139312chr1011272 ------
NM_139316chr72423 235 ------
NM_139319chr121691 --1439 --
NM_139321chr2034082 3416 181 12664 22847 1541 --
NM_139323chr2021382 746 21523 673 ----
NM_144568chr141676 ------
NM_144571chr436570 6319 6039 25633 5058 15682 16867
NM_144574chr14--1416 ----
NM_144578chr1424575 1804 21174 574 ----
NM_144579chr232571 2047 1954 1133 22759 807 --
NM_144580chr11238 ------
NM_144586chr231244 870 125 11052 ----
NM_144590chr1032828 2151 2116 --1408 --
NM_144595chr131353 ------
NM_144599chr15104950 4653 3933 3854 3417 2138 1661 1647 617 98 34683 4009 3533 ----
NM_144635chr331243 1049 448 ------
NM_144636chr31547 ------
NM_144641chr321006 386 1858 ----
NM_144657chrX----1587 --
NM_144658chrX1129 ------
NM_144664chr1122354 282 --1507 --
NM_144671chr1231807 587 166 --1695 --
NM_144732chr19196 1752 ----
NM_144767chr1563409 3303 1418 1039 928 724 12815 --11512
NM_144775chr1744751 1768 1717 1462 34921 4266 730 ----
NM_144778chr1321774 630 ------
NM_144949chr21695 ----1206
NM_144963chr81194 12563 ----
NM_144967chrX2744 242 ------
NM_145005chr91184 ------
NM_145008chr112857 193 ------
NM_145012chr10----1758 --
NM_145013chr1152263 1978 922 393 30 ------
NM_145113chr1411051 ------
NM_145117chr112610 527 --2632 540 --
NM_145159chr142728 683 ------
NM_145185chr1921292 697 ------
NM_145251chr14----11479 --
NM_145259chr255688 4635 1445 792 565 ------
NM_145287chr181172 ----148
NM_145296chr191156 ------
NM_145303chr6----1484 --
NM_145307chr1034020 3941 738 14417 ----
NM_145320chr742832 1103 513 45 1114 ----
NM_145321chr742832 1103 513 45 1114 ----
NM_145322chr742832 1103 513 45 1114 ----
NM_145331chr61106 ------
NM_145341chr101437 21359 1237 ----
NM_145349chr1711553 --1591 --
NM_145649chr621751 770 1433 ----
NM_145655chr621751 770 1433 ----
NM_145686chr272983 2713 2619 2571 2489 259 235 12512 ----
NM_145687chr272983 2713 2619 2571 2489 259 235 12512 ----
NM_145690chr831377 1278 537 ------
NM_145698chr1022099 1776 --1820 2585 72
NM_145727chr62390 48 ------
NM_145730chr222376 206 ------
NM_145735chr1352665 625 519 492 118 2594 209 22536 234 --
NM_145753chr311221 --11606 --
NM_145799chrX33120 2911 1224 1633 ----
NM_145800chrX--2803 206 ----
NM_145802chrX--2752 155 ----
NM_145808chr733000 1916 433 --11228 --
NM_145859chr31304 ------
NM_145860chr31304 ------
NM_145861chr1----1633 --
NM_145891chr16----1603 --
NM_145892chr16----1603 --
NM_145893chr16----1725 --
NM_145909chr61212 ------
NM_147127chr4167 ------
NM_147150chr953294 3038 2636 977 467 --134 13342
NM_147161chr131126 884 296 1808 --1158
NM_147171chr7173 ------
NM_147185chr7173 ------
NM_147189chr831615 1589 696 32348 1836 41 ----
NM_147202chr9--32638 968 176 ----
NM_147223chr222132 35 ------
NM_147233chr211949 ------
NM_148174chr82858 469 11383 --11577
NM_148571chr1741826 1820 1697 229 152 ----
NM_148894chr4--1810 ----
NM_148904chr1--1640 ----
NM_148905chr1--1640 ----
NM_148906chr1--1640 ----
NM_148907chr1--1640 ----
NM_148908chr1--1640 ----
NM_148909chr1--1640 ----
NM_152227chr202715 483 ------
NM_152233chr1421676 203 ------
NM_152253chr222555 420 --23669 122 --
NM_152261chr1211988 ------
NM_152263chr136087 5514 5069 ------
NM_152265chr11234 ------
NM_152267chr2232268 1794 69 1649 ----
NM_152277chr532154 2075 593 ------
NM_152282chr321301 1247 ------
NM_152291chr4124 ----1794
NM_152300chr1711484 ------
NM_152346chr17139 11107 ----
NM_152384chr21384 1678 ----
NM_152390chr21192 1606 ----
NM_152400chr441927 1673 1361 709 ------
NM_152410chr63478 414 40 ------
NM_152414chr81344 ------
NM_152418chr83639 140 101 ------
NM_152422chr921496 284 ------
NM_152423chrX21579 543 1295 ----
NM_152455chr1522197 2056 11077 1266 --
NM_152470chr1884107 3086 1547 1501 1327 1157 1045 992 --1460 13015
NM_152495chr111146 --1397 --
NM_152515chr2130 ------
NM_152520chr2--1480 ----
NM_152523chr2----1719 --
NM_152529chr21143 14217 ----
NM_152538chr331479 1167 1151 123 ----
NM_152588chr1231661 1192 94 ------
NM_152608chr122122 1870 ------
NM_152622chr522810 312 ------
NM_152624chr575838 5536 5451 2005 1542 1266 89 37007 2324 216 26943 2625 14984
NM_152629chr932790 940 681 21041 891 --13610
NM_152636chr11----22453 2287 --
NM_152641chr1222751 2547 --12594 --
NM_152653chr31651 1462 ----
NM_152663chr12327 321 ------
NM_152678chr32343 261 ------
NM_152699chr343641 3228 430 109 ------
NM_152716chr1111572 ------
NM_152744chr723574 2720 12467 ----
NM_152754chr712756 --1339 1682
NM_152755chr7------1577
NM_152756chr524103 3255 23583 3076 ----
NM_152758chr822679 849 --11911 --
NM_152774chr722752 2404 ------
NM_152780chrX21228 31 ------
NM_152787chrX1448 1150 ----
NM_152789chr721500 213 ------
NM_152793chr774996 4174 4106 1738 1601 1582 1492 ------
NM_152835chr132625 2464 1988 12244 ----
NM_152838chr2032898 2342 1328 --1364 12775
NM_152857chr62985 968 ------
NM_152858chr62985 968 ------
NM_152862chr21166 ------
NM_152888chr83646 380 99 ----1993
NM_152890chr121306 523 ------
NM_152896chr92565 553 ------
NM_152910chr13150 1541 ----
NM_152924chr1556707 6644 6352 5816 1379 1191 15066 --
NM_152988chr1911480 ----2368 141
NM_153015chr82911 793 ------
NM_153029chr1684105 4029 3948 3555 3217 2899 1386 1150 1460 --14157
NM_153035chr142794 2280 207 183 12306 ----
NM_153047chr61315 ------
NM_153048chr61315 ------
NM_153050chr2254628 3858 3682 1963 1337 14450 11604 14308
NM_153051chr2254628 3858 3682 1963 1337 14450 11604 14308
NM_153184chr321794 251 ------
NM_153207chr1233580 2870 549 1580 ----
NM_153211chr181442 ------
NM_153252chrX----1118 --
NM_153260chr1521221 320 ------
NM_153261chr161178 11460 ----
NM_153262chr132857 2774 429 --12170 --
NM_153273chr312247 --12735 22302 2224
NM_153347chr1131700 947 890 --12473 1298
NM_153360chr201554 ------
NM_153365chr422309 1038 ------
NM_153367chr1032466 1033 508 --23686 862 --
NM_153464chr191268 ------
NM_153498chr101228 1174 ----
NM_153607chr5--13082 ----
NM_153616chr1532129 608 214 ------
NM_153617chr1532129 608 214 ------
NM_153618chr1532129 608 214 ------
NM_153619chr1553367 2251 1452 977 356 11075 ----
NM_153633chr121260 ------
NM_153649chr132269 2010 905 ------
NM_153675chr202584 95 ------
NM_153689chr211634 ------
NM_153690chr31769 ------
NM_153693chr121667 ------
NM_153748chr121250 --1235 --
NM_153756chr1----11519 --
NM_153757chr431266 298 223 1401 ----
NM_153759chr2----1869 --
NM_153810chr1023128 1167 13370 14916 --
NM_153812chr1--1695 2931 384 --
NM_153828chr21606 1185 ----
NM_153836chr2127 --1614 --
NM_170665chr1254328 3631 1437 1287 272 --13874 --
NM_170674chr1531429 1330 930 ------
NM_170675chr1521105 1006 ------
NM_170676chr1521105 1006 ------
NM_170677chr1531429 1330 930 ------
NM_170721chr1711281 ------
NM_170731chr1122559 500 ------
NM_170732chr1122559 500 ------
NM_170733chr1122559 500 ------
NM_170734chr1122559 500 ------
NM_170735chr1122559 500 ------
NM_170768chr1131305 1134 457 ------
NM_171999chr181237 ------
NM_172070chr211911 --1149 --
NM_172071chr12895 852 35233 2947 1243 1505 --
NM_172078chr7138 ------
NM_172079chr7138 ------
NM_172080chr7138 ------
NM_172081chr7138 ------
NM_172082chr7138 ------
NM_172083chr7138 ------
NM_172084chr7138 ------
NM_172110chr201491 --1665 --
NM_172111chr201491 --1665 --
NM_172112chr201491 --1665 --
NM_172113chr201491 --1665 --
NM_172127chr441929 1485 1426 1322 ------
NM_172128chr441885 1441 1382 1278 ------
NM_172159chr321786 67 ----1873
NM_172160chr321786 67 ----1873
NM_172169chr1031586 691 205 11326 11593 --
NM_172170chr1031586 691 205 11326 11593 --
NM_172171chr1031586 691 205 11326 11593 --
NM_172173chr1031586 691 205 11326 11593 --
NM_172216chr1232959 2722 2290 11965 ----
NM_172315chr1531429 1330 930 ------
NM_172316chr1531429 1330 930 ------
NM_172337chr14----1365 --
NM_173054chr71755 ------
NM_173078chrX2327 110 ------
NM_173156chr152034 1804 1730 755 523 --1718 --
NM_173163chr161417 1128 1377 --
NM_173171chr2--11033 ----
NM_173172chr2--11341 ----
NM_173173chr2--11033 ----
NM_173198chr921941 882 1733 ----
NM_173200chr921941 882 1733 ----
NM_173214chr1687341 6695 2651 2350 1721 1647 1196 1055 --11365 15669
NM_173354chr211122 ------
NM_173465chr51994 ------
NM_173468chr446040 2391 2272 294 ------
NM_173473chr1022304 583 ------
NM_173495chrX22298 1974 ------
NM_173500chr1521395 1313 ------
NM_173510chr2232925 1995 803 151 --12378
NM_173511chr24815 720 526 100 1195 13380 --
NM_173515chr62686 197 ------
NM_173536chr455146 2026 1639 1217 63 ------
NM_173552chr311836 ----1507
NM_173562chr622553 251 1319 ----
NM_173570chr332236 2005 221 ------
NM_173576chr103879 510 44 ------
NM_173595chr1265006 4362 1807 1442 1379 1029 13631 14720 --
NM_173602chr1243762 2758 2679 215 --13315 --
NM_173611chr15260 28 ------
NM_173618chr16186 ------
NM_173642chr168227 7907 2236 1151 966 534 ------
NM_173667chr541892 1525 497 23 ------
NM_173683chr841686 1171 481 405 --11285 --
NM_173685chr81203 ------
NM_173694chrX21608 995 --1321 --
NM_173808chr123112 1114 23404 109 ----
NM_173812chr1221017 502 ------
NM_173822chr221580 857 ------
NM_173825chr343132 2388 496 196 168 ----
NM_173833chr821263 183 ------
NM_173851chr82943 935 42989 689 559 216 ----
NM_174890chr10--1647 ----
NM_174934chr1163548 3374 3196 2999 1322 755 --11422 --
NM_174938chr9--1498 1103 --
NM_175056chr32783 69 ------
NM_175061chr732056 588 230 ------
NM_175607chr311535 ------
NM_175612chr311535 ------
NM_175624chr1236925 6107 6093 14856 ----
NM_175625chr1236925 6107 6093 14856 ----
NM_175629chr2----1869 --
NM_175634chr821122 1085 ------
NM_175635chr821122 1085 ------
NM_175636chr821122 1085 ------
NM_175733chr112520 434 ------
NM_175736chr1256861 6453 6110 4834 2875 --22831 186 --
NM_175747chr61393 ------
NM_175848chr2011208 --11075 1239
NM_175848chr2011208 --11075 1239
NM_175849chr2011208 --11075 1239
NM_175849chr2011208 --11075 1239
NM_175850chr2011208 --11075 1239
NM_175850chr2011208 --11075 1239
NM_175854chr1312383 ------
NM_175856chr51160 ------
NM_175866chr12495 260 ------
NM_175873chr5--1526 ----
NM_175884chr72499 403 1516 ----
NM_175907chr1821068 125 ----11780
NM_175921chr513743 12627 24250 2922 13926
NM_176801chr421330 424 1525 ----
NM_176812chr20----1624 --
NM_176814chr731471 1322 65 ------
NM_176823chr143802 3351 615 418 11029 ----
NM_176863chr1721470 399 11866 11854 --
NM_177398chr121809 1580 --21211 705 --
NM_177399chr121809 1580 --21211 705 --
NM_177401chr1911615 ------
NM_177414chr111762 1243 ----
NM_177424chr1148 ------
NM_177438chr1432623 1406 268 1294 13337 --
NM_177539chr13260 118 40 ------
NM_177559chr202805 420 ------
NM_177560chr202805 420 ------
NM_177968chr211502 --22238 2046 --
NM_177972chr1134453 4173 3212 --12793 --
NM_177976chr31384 ------
NM_177985chr222000 611 21931 582 ----
NM_177995chr921496 284 ------
NM_177996chr2053404 3384 2287 1156 931 11314 ----
NM_178011chr1013261 173 ----
NM_178037chr1221134 796 --21083 816 --
NM_178038chr1221134 796 --21083 816 --
NM_178039chr122769 431 --2718 451 --
NM_178040chr122769 431 --2718 451 --
NM_178120chr211296 ------
NM_178126chr1732200 308 223 1336 ----
NM_178135chr411375 1238 ----
NM_178140chr51861 22335 133 ----
NM_178148chr62442 103 ------
NM_178151chrX47739 6867 6431 620 15969 196 --
NM_178152chrX47739 6867 6431 620 15969 196 --
NM_178153chrX47739 6867 6431 620 15969 196 --
NM_178313chr211964 12104 ----
NM_178496chr321315 1265 11393 ----
NM_178517chr17173 ------
NM_178539chr121403 1225 ----
NM_178544chr191257 ------
NM_178565chr811690 ------
NM_178585chr422521 2389 --12193 --
NM_178586chr14----11781 --
NM_178812chr821541 442 ------
NM_178830chr191236 ------
NM_178860chr1711026 ------
NM_178864chr112666 585 ------
NM_180976chr6--1240 1965 1191
NM_180977chr6--1240 1965 1191
NM_181077chr1551715 1667 930 753 354 ------
NM_181302chr14--1416 ----
NM_181308chr14--1416 ----
NM_181332chrX6741 729 694 580 329 188 ------
NM_181336chr64519 481 390 86 ------
NM_181351chr111383 13025 ----
NM_181353chr201136 --1552 --
NM_181354chr81105 --1318 --
NM_181357chr1431529 473 291 1192 --11252
NM_181358chr111239 23465 3179 ----
NM_181361chr31343 1949 ----
NM_181443chr2032765 2711 271 ------
NM_181458chr2--11096 1916 --
NM_181460chr2--1909 ----
NM_181481chr1846622 5125 4990 2342 26861 1388 14945 --
NM_181482chr1846622 5125 4990 2342 26861 1388 14945 --
NM_181483chr1846622 5125 4990 2342 26861 1388 14945 --
NM_181486chr1221353 399 11594 ----
NM_181504chr513472 1216 1338 --
NM_181505chr172604 87 ------
NM_181523chr513472 1216 1338 --
NM_181524chr513472 1216 1338 --
NM_181532chrX1229 ------
NM_181598chr142278 85 ------
NM_181644chr11464 ------
NM_181659chr2043196 2197 1159 522 --12321 1227
NM_181659chr2043196 2197 1159 522 --12321 1227
NM_181670chr1221000 953 ------
NM_181672chrX31433 749 606 ------
NM_181673chrX31433 749 606 ------
NM_181689chr201104 --143 --
NM_181702chr81352 ----1256
NM_181714chr621475 448 ------
NM_181762chrX------1332
NM_181777chrX------1332
NM_181782chr612222 ------
NM_181783chr121270 ----1681
NM_181784chr22977 238 21750 1667 ----
NM_181787chr81890 --13112 --
NM_181839chr821304 1117 1413 ----
NM_181844chr171604 --11330 --
NM_181876chr4------2901 758
NM_182314chrX--21371 712 ----
NM_182485chr433509 2700 614 ------
NM_182498chr191312 ------
NM_182526chr1483149 3142 2538 921 668 619 182 161 --1439 --
NM_182540chrX1704 ------
NM_182551chr233135 3099 932 ------
NM_182557chr1121744 1496 ------
NM_182580chr122420 1960 ------
NM_182643chr831656 1555 39 ------
NM_182646chr433509 2700 614 ------
NM_182663chr122037 365 ------
NM_182664chr122167 495 ------
NM_182665chr122037 365 ------
NM_182691chr71560 --11418 --
NM_182692chr71560 --11418 --
NM_182697chr731503 674 419 ------
NM_182717chr1011190 ----11002
NM_182720chr1011190 ----11002
NM_182721chr1011190 ----11002
NM_182722chr1011190 ----11002
NM_182723chr1011190 ----11002
NM_182729chr1221304 391 1119 ----
NM_182742chr1221304 391 1119 ----
NM_182743chr1221304 391 1119 ----
NM_182758chr1563438 3182 2930 2867 2858 857 ------
NM_182763chr121722 164 1524 ----
NM_182765chr1022034 1866 ------
NM_182797chr2011401 ------
NM_182810chr22258 30 ------
NM_182830chr1411940 --1246 --
NM_182848chr1321025 151 ------
NM_182853chr1011190 ----11002
NM_182894chr1421719 61 ------
NM_182898chr756267 4501 2111 1817 1811 24331 1883 1228 --
NM_182899chr756267 4501 2111 1817 1811 24331 1883 1228 --
NM_182907chr612186 1614 --11482
NM_182920chr341434 1377 586 431 ------
NM_182944chr141115 ------
NM_182948chr142747 1990 332 312 ------
NM_182964chr112610 527 --2632 540 --
NM_182972chr152493 2461 2153 1093 239 ------
NM_182975chr12389 138 ------
NM_182976chr11270 ------
NM_183011chr1011190 ----11002
NM_183012chr1011190 ----11002
NM_183013chr1011190 ----11002
NM_183043chr131137 1790 ----
NM_183044chr131137 1790 ----
NM_183377chr171841 1637 ----
NM_183397chr2084327 4244 3825 3196 3184 1469 330 88 --14882 --
NM_183419chr811274 1138 ----
NM_184234chr202581 286 1168 ----
NM_194247chr224379 455 11484 ----
NM_194272chr152984 342 ------
NM_194278chr1434049 700 298 --13161 --
NM_194285chr1123363 221 ------
NM_194286chr1214870 --26250 4299 --
NM_194292chr12683 643 ----152
NM_194301chr141762 ------
NM_194314chr114007 24860 971 13587 --
NM_194328chr953089 2760 1257 1135 328 11143 22527 35 --
NM_194329chr953089 2760 1257 1135 328 11143 22527 35 --
NM_194330chr953089 2760 1257 1135 328 11143 22527 35 --
NM_194332chr953089 2760 1257 1135 328 11143 22527 35 --
NM_194439chr421259 1139 ------
NM_194449chr181868 ------
NM_194452chr11----1108 --
NM_194453chr11----1108 --
NM_194463chrX21296 982 1118 --1422
NM_197941chr532083 1174 282 ------
NM_197970chr211341 ------
NM_197972chr1--173 ----
NM_197977chr91636 --1277 --
NM_198056chr321777 191 ----11907
NM_198057chrX1963 1786 ----
NM_198081chr632930 957 908 22526 203 12797 --
NM_198123chr81321 1222 ----
NM_198124chr81321 1222 ----
NM_198128chr1821678 1662 ------
NM_198158chr3--12107 ----
NM_198159chr3--12107 ----
NM_198177chr3--12107 ----
NM_198178chr3--12107 ----
NM_198181chr1522728 763 21867 1135 ----
NM_198195chr32527 172 --1179 --
NM_198217chr131780 ------
NM_198218chr131780 ------
NM_198219chr131780 ------
NM_198261chr122164 99 ------
NM_198262chr122164 99 ------
NM_198268chr111239 23465 3179 ----
NM_198269chr111239 23465 3179 ----
NM_198279chrX1961 11157 ----
NM_198336chr711835 ----1311
NM_198337chr711970 --124 1446
NM_198391chr2021441 300 ------
NM_198392chr62386 149 --11724 --
NM_198395chr531214 1118 156 ------
NM_198399chr3----11260 --
NM_198400chr1512749 --12038 --
NM_198446chr12152 49 ------
NM_198513chr81396 ------
NM_198581chr242859 2359 1557 1051 25130 828 12107 --
NM_198595chr434559 3822 256 13829 23648 859 --
NM_198700chr111422 1480 ----
NM_198793chr311357 1852 ----
NM_198829chr741098 1064 962 523 ------
NM_198859chr345008 4005 3501 3355 ----1974
NM_198896chr1141912 791 755 633 12187 ----
NM_198900chr1256861 6453 6110 4834 2875 --22831 186 --
NM_198902chr151116 ------
NM_198904chr521972 1830 11409 ----
NM_198935chr2042453 2125 1044 212 32035 137 42 12629 --
NM_198963chr2122 ------
NM_199000chr722078 637 ------
NM_199039chr41942 ------
NM_199050chr2123410 1279 1257 --12988
NM_199051chr1151 ------
NM_199169chr2023082 646 ------
NM_199170chr2023082 646 ------
NM_199171chr2023082 646 ------
NM_199205chr8--1631 ----
NM_199324chr422654 371 --12614 --
NM_199327chr4----1953 --
NM_199330chr151614 ----1711
NM_199331chr151614 ----1711
NM_199332chr151614 ----1711
NM_199342chr1149 ------
NM_199355chr1621690 522 --1510 --
NM_199437chr111633 1338 ----
NM_199438chr111633 1338 ----
NM_199439chr111633 1338 ----
NM_199440chr22341 61 ------
NM_199454chr124804 1703 1387 ----
NM_199461chr1021179 794 11128 ----
NM_199462chr133827 3200 1602 11808 2268 116 --
NM_199478chrX1735 ------
NM_201266chr232050 772 239 12251 ----
NM_201269chr1--1237 ----
NM_201279chr232050 772 239 12251 ----
NM_201280chr61566 ------
NM_201412chr161161 ------
NM_201413chr2111088 --1742 --
NM_201414chr2111088 --1742 --
NM_201428chr111134 ------
NM_201429chr111134 ------
NM_201430chr11160 ------
NM_201432chr1745799 4850 1879 252 14938 15856 25781 4625
NM_201433chr1745799 4850 1879 252 14938 15856 25781 4625
NM_201520chr17----21596 1533 --
NM_201568chr152034 1804 1730 755 523 --1718 --
NM_201569chr152034 1804 1730 755 523 --1718 --
NM_201570chr1011503 ------
NM_201571chr1011503 ------
NM_201572chr1011503 ------
NM_201590chr1011503 ------
NM_201591chr461922 1834 1262 610 96 43 ------
NM_201592chr461922 1834 1262 610 96 43 ------
NM_201593chr1011503 ------
NM_201596chr1011503 ------
NM_201597chr1011503 ------
NM_201624chr11281 ------
NM_201630chr11110 --1164 --
NM_201632chr5--11833 ----
NM_201634chr5196 11932 ----
NM_201995chr111719 ------
NM_201998chr112784 535 ------
NM_201999chr42450 425 11008 ----
NM_202002chr121180 125 ----
NM_203282chr1911387 1670 --11184
NM_203350chr131749 1562 1179 ------
NM_203364chr11----11098 --
NM_203406chr531136 639 93 ------
NM_203434chr93958 945 283 ------
NM_203459chr12666 572 12511 12264 --
NM_203487chr1331711 681 370 ------
NM_203494chr151133 ------
NM_205768chr11210 11630 ----
NM_205846chr5----2384 319 --
NM_205848chr1----11882 --
NM_205860chr112641 2704 555 ----
NM_205861chr111627 --1107 --
NM_206594chr143522 3271 2626 2365 ------
NM_206595chr143522 3271 2626 2365 ------
NM_206839chr152418 82 ----1440
NM_206852chr14----1298 --
NM_206853chr613977 --11213 --
NM_206854chr635238 3392 142 ------
NM_206855chr646203 4357 1107 888 ------
NM_206857chr14----1298 --
NM_206876chr212287 12826 --11106
NM_206907chr523118 1151 ------
NM_206914chr121132 12098 --12082
NM_206927chr111150 ------
NM_206928chr111150 ------
NM_206929chr111150 ------
NM_206930chr111150 ------
NM_206944chr91136 ------
NM_206945chr91136 ------
NM_206946chr91136 ------
NM_206947chr91136 ------
NM_207015chr3--21942 445 ----
NM_207043chr12439 429 11743 ----
NM_207044chr12439 429 11743 ----
NM_207047chr12439 429 11743 ----
NM_207123chr42882 756 --1166 --
NM_207292chr323239 49 ------
NM_207293chr323239 49 ------
NM_207294chr323239 49 ------
NM_207295chr323239 49 ------
NM_207296chr323239 49 ------
NM_207297chr323264 74 ------
NM_207303chr1033975 3821 3048 24103 3511 ----
NM_207304chr1321661 517 ------
NM_207337chr122274 175 ------
NM_207343chr11------1422
NM_207344chr1221283 522 ------
NM_207361chr1324184 318 11298 --1782
NM_207520chr21606 1185 ----
NM_207521chr21606 1185 ----
NM_207577chr11102880 2867 2801 2668 2483 2153 700 409 327 130 ------
NM_207645chr1121323 885 ------
NM_207660chr142689 197 ------
NM_207661chr142689 197 ------
NM_207662chr142689 197 ------
NM_212460chr71181 1341 ----
NM_212469chr11174 ----1441
NM_213589chr244485 1389 984 972 24252 1711 21306 275 182
NM_213594chr122497 409 ------
NM_213618chr111637 --2711 255 --
NM_213648chr5--11833 ----
NM_213654chr32219 166 ------
NM_213662chr171324 ------