TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3663-5p
miRNA Sequence: GCUGGUCUGCGUGGUGCUCGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX75545 4310 2127 2010 1057 870 45 11611 46222 6145 4622 1120 36232 6054 4862
NM_000217chr1243803 3576 1805 1321 --1495 14373
NM_000332chr666774 6718 6690 4664 2809 1667 25309 2882 --15780
NM_000337chr594561 4538 4017 2445 2064 1893 1344 917 338 --14646 14511
NM_000368chr9104502 4348 3662 3405 2976 1043 880 681 335 255 11587 1414 --
NM_000555chrX66884 6092 5226 4899 3009 1155 45361 5128 2249 1227 25308 3053 12148
NM_000609chr1073024 2866 2001 714 419 241 235 22418 948 1581 --
NM_000610chr1163058 2467 1882 854 610 598 ------
NM_000615chr1182562 2330 2229 1876 1011 435 372 27 --32672 2129 403 --
NM_000618chr1266306 5499 4798 4585 2163 704 22354 1979 12360 --
NM_000618chr1266306 5499 4798 4585 2163 704 22354 1979 12360 --
NM_000629chr2183255 3217 2581 1637 573 422 249 134 33279 3123 1194 33242 1694 272 12849
NM_000719chr1296085 5945 5686 5604 5141 4077 2421 616 589 26046 134 46581 5210 5148 1969 --
NM_000793chr1454847 4753 1662 1619 472 ----2814 327
NM_000831chr1115211 5000 1790 1734 1524 1301 1137 1102 271 244 126 34668 2411 102 55429 3942 2404 2276 174 26019 415
NM_000875chr15106245 5315 5188 4678 4392 4313 2164 2130 1175 740 34954 4760 772 14592 --
NM_000926chr1148532 8432 8371 601 13511 --27186 6996
NM_001001389chr1163058 2467 1882 854 610 598 ------
NM_001001390chr1163058 2467 1882 854 610 598 ------
NM_001001391chr1163058 2467 1882 854 610 598 ------
NM_001001392chr1163104 2513 1928 900 656 644 ------
NM_001001396chr183756 3488 3130 3117 1498 1422 1298 159 11269 11128 34396 3840 1470
NM_001001433chr2072304 2127 1168 1133 960 649 261 1586 32641 2501 2159 --
NM_001001668chr1984110 4079 3860 1719 1548 643 392 367 ------
NM_001002860chr1422854 883 --3908 828 77 14166
NM_001003682chr16958 914 460 64 56 42 --1302 --
NM_001004065chr953532 2693 2552 2534 43 --1331 1130
NM_001004304chr1263151 2713 2079 1201 290 191 134 12793 1133
NM_001005473chr556157 6098 4785 4562 1811 11858 1249 --
NM_001007023chr1454847 4753 1662 1619 472 ----2814 327
NM_001008539chr874902 4740 4708 3412 996 920 907 1865 33624 3538 679 --
NM_001009899chr386338 5312 4539 4188 2181 1856 937 291 15966 15263 --
NM_001010867chr1145955 5886 5712 5420 5077 4409 4366 2186 2021 1944 1576 676 524 322 --34448 1511 1014 --
NM_001012393chr1174276 3992 3607 1879 1554 1211 1190 --11272 --
NM_001012751chr1041564 1480 365 259 11888 11447 --
NM_001013620chr1275772 2450 2037 1933 1641 1250 47 --17712 1823
NM_001013693chr1102946 2665 2510 2346 2076 2054 2034 912 772 74 --42224 1961 494 106 --
NM_001013693chr1102946 2665 2510 2346 2076 2054 2034 912 772 74 --42224 1961 494 106 --
NM_001014797chr10138113 7354 6944 6650 6326 6263 6148 5619 2862 1992 1731 638 68 37774 2614 916 26793 846 21714 146
NM_001017440chr797886 7654 7292 7206 6286 5673 5612 1751 1140 --28045 6443 11890
NM_001018111chr773709 2716 2485 1216 899 245 46 --13186 12695
NM_001024649chr512093 ----21194 663
NM_001024956chr1143600 582 394 326 --24611 1580 --
NM_001025076chr10105637 4956 4356 3810 2319 2280 1798 1618 560 456 --14780 --
NM_001025079chr364027 3803 3471 3427 1633 1034 --23482 1043 --
NM_001025108chr231687 1182 995 2284 270 12739 23409 1594
NM_001025233chr1262690 2242 1743 375 296 272 ----12407
NM_001031679chr1262710 2479 1362 907 755 719 1182 --22455 376
NM_001031695chr2285241 4356 4266 3955 3559 3496 1323 780 34955 943 385 --14104
NM_001032999chr2094624 4501 3739 2014 1990 1976 1568 927 302 54617 4381 4133 3731 1826 13648 --
NM_001033045chr274407 4238 3505 3138 3059 2815 1448 13730 21275 430 --
NM_001033117chr384727 4192 3205 3061 1625 1244 832 825 1218 13674 11850
NM_001033564chr681877 1212 517 260 241 138 50 32 --1784 --
NM_001037954chr1143426 3130 913 204 --12744 1988
NM_001039479chr1492405 2365 2269 2225 1666 795 552 251 198 1427 12392 12309
NM_001039547chr397456 7420 5523 5381 5304 5122 2819 2584 2285 --35562 5480 5420 --
NM_001039570chr22104136 3865 3720 3442 3240 3024 1688 1585 818 589 23705 461 33972 843 147 --
NM_001039571chr22104136 3865 3720 3442 3240 3024 1688 1585 818 589 23705 461 33972 843 147 --
NM_001039618chr1165518 5062 4781 3637 1388 944 35761 5225 3620 ----
NM_001039709chr2094624 4501 3739 2014 1990 1976 1568 927 302 54617 4381 4133 3731 1826 13648 --
NM_001039762chr1062093 1872 1622 811 691 531 11472 ----
NM_001040152chr774814 1881 1253 1016 880 598 298 125 ----
NM_001040284chr1695454 5185 5073 4019 1727 1672 1663 1279 515 11905 ----
NM_001040441chr195386 5241 5051 4807 4536 3677 1010 568 152 13830 45090 4523 3522 1715 --
NM_001042355chr1675285 5094 3793 3717 3672 1097 377 13285 44528 4484 1507 1117 --
NM_001042412chr1675285 5094 3793 3717 3672 1097 377 13285 44528 4484 1507 1117 --
NM_001042599chr2116856 6840 6804 5748 5273 5086 4980 4935 3130 1810 1399 1268 34916 1279 96 --
NM_001042603chr1245126 4577 843 41 21388 686 1947 2674 266
NM_001083621chr194363 3988 3216 1593 1525 1447 1159 883 338 11681 14168 --
NM_001099678chr384968 4793 4736 4162 2336 2033 1056 906 --14818 11458
NM_001106chr3159090 8631 8034 7946 6895 6488 3826 3651 3538 3345 2953 1738 1441 847 193 --12056 --
NM_001167chrX85810 5685 5052 4077 2060 1101 693 234 --26096 4102 --
NM_001191chr2051098 1030 1016 560 524 11008 11201 21085 396
NM_001204chr2127791 7546 7451 5807 5524 4903 2685 2304 1290 1054 527 346 ------
NM_001259chr746178 5076 1843 1766 --25635 5537 --
NM_001364chr1174278 3977 1658 1461 1170 799 785 ------
NM_001438chr123019 138 --1811 13172
NM_001650chr1853172 2599 1600 1199 504 12832 --12630
NM_001663chr1421819 458 --21017 603 --
NM_001684chr183473 3205 2847 2834 1630 1215 1139 1015 1986 1845 34113 3557 1187
NM_001746chr512093 ----21194 663
NM_001777chr364027 3803 3471 3427 1633 1034 --23482 1043 --
NM_001821chr144504 4167 3302 829 --14022 --
NM_001987chr12104282 4008 3480 1134 1013 818 763 523 146 30 ------
NM_002025chrX78583 8207 6428 3608 3245 2186 405 26795 1603 28999 7630 --
NM_002061chr141932 1745 1457 1285 --21783 1308 1673
NM_002069chr72560 402 ----171
NM_002285chr231687 1182 995 2284 270 12739 23409 1594
NM_002310chr545269 5110 983 666 --1401 22054 798
NM_002336chr1254759 3844 3799 345 107 --33186 1272 626 --
NM_002481chr1126907 6521 6105 6016 5606 5409 4878 2128 2106 1144 1089 870 17179 25015 2701 --
NM_002545chr1174276 3992 3607 1879 1554 1211 1190 --11272 --
NM_002577chr373294 2621 1373 1312 1096 713 556 ------
NM_002581chr962184 1887 1176 828 710 492 --11702 1411
NM_002613chr1674925 4100 3544 1042 866 414 84 --1313 21576 1340
NM_002645chr1172983 2924 2048 1970 1939 1245 174 --11056 --
NM_002655chr865182 5084 4876 4207 3567 1749 11317 1547 --
NM_002731chr15701 596 551 223 74 ----1641
NM_002737chr17116531 5273 5158 4884 4090 2505 2436 1935 763 714 87 12314 14112 --
NM_002822chr1261511 1477 1342 696 394 293 --1582 --
NM_002834chr1263262 1444 1098 790 172 65 23697 2692 --12481
NM_002886chr384426 4241 3965 3820 2082 973 111 96 24581 3501 ----
NM_002959chr164201 3304 2894 2747 595 588 21056 758 23014 2902 --
NM_003046chr874902 4740 4708 3412 996 920 907 1865 33624 3538 679 --
NM_003079chr172748 132 1787 --2951 909
NM_003108chr257037 6792 1455 790 598 --15162 1773
NM_003128chr252588 2013 1836 1119 536 ----1219
NM_003137chr651647 1406 866 232 29 ----21842 764
NM_003262chr365172 4356 3853 3510 817 335 24707 3574 11040 13581
NM_003489chr2142260 2252 946 920 ----13042
NM_003590chr24587 213 134 125 --12824 --
NM_003629chr183355 2625 2431 2380 2220 679 352 60 --11406 22633 755
NM_003644chr1765471 5297 4875 4141 2096 393 26179 435 66401 5454 5406 5319 892 691 15315
NM_003663chr31643 22808 1254 21120 373 2965 892
NM_003763chr2072304 2127 1168 1133 960 649 261 1586 32641 2501 2159 --
NM_003768chr151771 1323 608 454 44 ----11203
NM_003939chr1083944 3848 3772 2907 1442 1321 1241 125 33294 1145 513 33918 2813 755 13455
NM_004028chr1853172 2599 1600 1199 504 12832 --12630
NM_004035chr17114792 4601 4512 4122 3715 3151 1789 1708 1642 641 278 15108 ----
NM_004171chr1179403 7760 7402 6833 6039 5993 2720 26468 2237 12408 37444 6632 3037
NM_004296chr1463799 3565 3187 3140 2478 1066 13590 21072 642 22630 175
NM_004331chr831916 1744 80 --1407 1337
NM_004440chr631738 406 209 11859 --1721
NM_004459chr1711708 ----1220
NM_004726chrX54356 3939 3667 1317 1254 25139 4655 25031 2196 --
NM_004730chr541400 1358 679 395 ----11853
NM_004798chr2073256 2952 2709 1422 421 274 136 --159 --
NM_004857chr1444596 693 678 635 14730 21419 717 --
NM_004992chrX128139 6489 6452 5243 3403 2711 2311 1963 1775 782 527 313 45455 1875 298 232 27671 7324 --
NM_004992chrX128139 6489 6452 5243 3403 2711 2311 1963 1775 782 527 313 45455 1875 298 232 27671 7324 --
NM_004999chr653758 2913 2867 1343 287 13472 13911 --
NM_005056chr1255370 4821 1087 285 164 21632 930 21191 240 2918 510
NM_005065chr1455246 4435 401 86 26 23433 3412 ----
NM_005093chr2094624 4501 3739 2014 1990 1976 1568 927 302 54617 4381 4133 3731 1826 13648 --
NM_005116chr2043941 3614 2881 707 34530 3677 1180 11082 13620
NM_005156chr995036 4801 4114 4057 3942 2147 654 81 34 11638 1335 --
NM_005160chr2246187 5523 4447 588 22359 2314 --12219
NM_005235chr2116856 6840 6804 5748 5273 5086 4980 4935 3130 1810 1399 1268 34916 1279 96 --
NM_005238chr111290 22646 209 1753 22949 2675
NM_005339chr463892 3593 1341 1248 1183 489 --1307 --
NM_005347chr971681 1558 1310 1177 1141 565 384 ----1414
NM_005397chr773709 2716 2485 1216 899 245 46 --13186 12695
NM_005504chr1276343 5644 5554 4190 2613 1315 996 ----14208
NM_005665chr164548 3965 3011 1824 42 21 ------
NM_005730chr12103352 3173 2814 2643 934 533 389 315 177 67 12431 1569 23341 2529
NM_005739chr1552221 1822 1510 966 93 --11539 --
NM_005779chr583215 2518 2384 1180 785 336 147 136 11317 13232 --
NM_005840chrX56619 5250 5109 1940 302 --15284 16831
NM_006011chr1533904 3306 221 21708 136 --11648
NM_006141chr1652241 2057 1099 368 332 --165 1441
NM_006282chr2064773 4452 1390 1240 1115 1046 11661 --21484 1215
NM_006315chr464347 4173 4114 3117 3082 760 2903 99 --21284 746
NM_006544chr1455446 5291 3977 1176 796 ----12181
NM_006547chr731635 1472 134 1415 --21842 1618
NM_006561chr10105637 4956 4356 3810 2319 2280 1798 1618 560 456 --14780 --
NM_006572chr1752710 2236 1211 1063 914 --1276 --
NM_006591chr11151 --1603 21456 23
NM_006595chr1151760 1689 1620 405 218 --11716 --
NM_006599chr1696879 6807 6785 6691 2956 2805 2633 1473 325 15594 ----
NM_006609chr252805 2655 2342 2328 827 ------
NM_006682chr752493 1948 1089 806 385 --2949 410 --
NM_006699chr142454 1806 880 50 1591 --12326
NM_006731chr994924 4073 4024 3939 2122 1912 1152 809 779 1495 35092 5078 2228 --
NM_006750chr1666787 6751 5968 5346 1243 931 1186 26826 5817 --
NM_006888chr1483469 2471 2346 2317 1266 883 306 202 13145 1958 --
NM_006918chr1143600 582 394 326 --24611 1580 --
NM_006930chr531949 621 258 ----1357
NM_007011chr15156924 6858 6336 5614 5439 5262 5204 5054 4979 4814 4331 2165 1008 572 443 --15464 1499
NM_007050chr20157749 7172 6059 5644 5498 3101 3075 1755 1231 1194 775 659 547 519 298 --23185 2161 11568
NM_007054chr532851 1034 116 --22832 1250 1406
NM_007073chr662741 2627 1547 1525 1237 956 --11391 1936
NM_007203chr953532 2693 2552 2534 43 --1331 1130
NM_007249chr1348411 7590 6179 5990 21234 184 16455 --
NM_007292chr17114792 4601 4512 4122 3715 3151 1789 1708 1642 641 278 15108 ----
NM_007347chr1541150 1044 923 35 --1494 12775
NM_012098chr961407 1226 1105 1072 535 114 11160 1958 11134
NM_012104chr1173434 3157 2959 2781 1505 420 39 197 13564 13573
NM_012104chr1173434 3157 2959 2781 1505 420 39 197 13564 13573
NM_012164chr976656 6302 4775 2412 1713 1202 154 17411 1760 16640
NM_012199chr173925 3116 964 520 262 178 166 1483 13706 --
NM_012249chr242761 2644 1303 532 --1462 12576
NM_012287chr383416 3275 3239 1472 1439 886 649 264 ------
NM_012297chr431049 636 606 ----1727
NM_012316chr1104984 4844 4614 4427 4237 4207 4029 1348 1335 1260 1663 24694 1830 --
NM_013231chr14104200 4034 3558 3332 2880 2874 1664 1054 970 761 ------
NM_013286chr393767 3252 3146 2902 2820 2364 1399 1185 1099 12750 --11142
NM_013313chr2273426 2993 2956 2586 840 592 403 --21077 442 11419
NM_013372chr1553256 3139 3065 728 677 1353 12386 1101
NM_013374chr322248 1924 ----22901 36
NM_013989chr1454847 4753 1662 1619 472 ----2814 327
NM_014011chr232020 1896 215 --11872 1850
NM_014112chr854116 3895 941 404 334 --14987 1306
NM_014155chr11117529 5951 2528 2373 2041 1738 1479 1347 1066 941 579 ----16424
NM_014309chr2285231 4346 4256 3945 3549 3486 1313 770 34945 933 375 --14094
NM_014331chr41752 25931 1839 47066 4984 2242 1428 1276
NM_014614chr2------2303 265
NM_014636chr953871 3789 2994 1476 947 1289 12767 11718
NM_014721chr656932 5485 1713 1114 1042 12962 15615 --
NM_014730chr1265071 4880 4397 1969 1251 399 14363 34259 1781 1626 24241 4146
NM_014730chr1265071 4880 4397 1969 1251 399 14363 34259 1781 1626 24241 4146
NM_014772chr1863018 2493 1254 985 808 136 22278 60 23172 2948 13414
NM_014810chr183534 2366 1206 815 714 532 188 124 1283 1314 --
NM_014819chr542150 1756 1683 1576 1572 125 --
NM_014838chr2242182 1778 1117 176 1251 1107 127
NM_014850chr384727 4192 3205 3061 1625 1244 832 825 1218 13674 11850
NM_014870chr194363 3988 3216 1593 1525 1447 1159 883 338 11681 14168 --
NM_014873chr184804 4133 4103 4088 1669 1407 995 296 ------
NM_014877chr1787044 6731 6110 1882 1594 1475 576 426 --17323 14792
NM_014897chr1742821 2668 1067 166 --1814 1788
NM_014906chr1753761 3523 1082 759 515 11622 11388 --
NM_014932chr341535 1494 1319 433 --11904 --
NM_014938chr1292574 2350 2329 2288 1754 1630 981 846 145 1648 --21782 900
NM_015020chr1673655 2642 1341 1125 766 746 313 ----11142
NM_015035chr20106393 6380 5900 5310 4132 1791 794 772 602 32 15793 35349 4796 1397 --
NM_015042chr1573756 3070 2649 2641 1598 1093 662 34182 4036 1581 12757 --
NM_015071chr596069 5222 4289 3990 2546 1302 1292 1133 72 26348 5335 --12125
NM_015074chr174343 4223 3885 3268 1777 1132 501 14248 53924 3252 1756 1155 1141 --
NM_015077chr17104563 4460 4443 3410 2864 1709 1604 1549 1425 865 11787 24354 3370 13439
NM_015082chr531602 1005 420 --22023 801 22379 1979
NM_015090chr1156190 5372 5325 5276 5254 5037 4546 4360 4269 3967 3815 1707 1536 1040 144 34767 1770 1463 35261 4588 1774 15645
NM_015092chr1621593 513 11808 --11448
NM_015101chr141922 663 404 395 --22322 953 --
NM_015247chr1675285 5094 3793 3717 3672 1097 377 13285 44528 4484 1507 1117 --
NM_015288chr583732 3127 3065 2488 870 784 594 384 1912 1815 1917
NM_015326chr152348 2209 1166 884 339 2641 358 22474 555 --
NM_015375chr195042 4650 4349 3758 3604 1967 1269 924 608 13348 24199 693 --
NM_015393chr483710 2371 1105 957 752 685 611 234 33569 3365 925 --1255
NM_015455chr553842 3835 2513 1375 380 --2575 361 22764 724
NM_015535chr244001 1447 1173 842 13160 --2583 285
NM_015568chr2063621 3335 2769 1166 381 317 13903 33043 1022 57 14012
NM_015879chr18147757 7444 6892 6882 6573 5483 5459 2783 2705 2487 1647 1118 1097 878 45552 2083 409 318 35202 2436 1102 12185
NM_015888chr153034 2693 2421 1362 963 12482 --12261
NM_015906chr153461 1641 1534 907 395 --11008 --
NM_015995chr1585365 5290 4895 4840 1969 1302 1045 411 --33831 3725 373 11065
NM_016021chr642916 2833 2753 584 1198 --12772
NM_016206chr368490 7592 5588 2883 2217 866 --12563 --
NM_016231chr1741427 1266 654 645 ------
NM_016260chr287311 6956 6944 6167 5164 4887 3016 485 ----16001
NM_016530chr1573578 3237 2877 1641 1409 1199 569 12644 ----
NM_016577chr394089 3995 3861 3626 1790 1381 996 789 638 33885 3381 605 34337 4137 3385 12978
NM_016621chr1193362 3279 2806 1761 1551 1494 1315 858 208 --13198 14415
NM_016953chr285357 4459 4106 2404 2340 2311 2156 836 23778 1074 12077 --
NM_017563chr3136344 5925 5737 5430 5383 5104 4493 4187 1785 1308 969 644 133 34631 758 272 35776 5144 2451 --
NM_017628chr454256 1585 1447 1428 197 --13749 --
NM_017634chr82795 283 ----21511 543
NM_017637chr9128842 8427 7079 7026 6912 6823 5855 5826 2723 2329 1648 1053 18975 13388 --
NM_017813chr865290 4167 1980 220 101 85 --14158 --
NM_017848chrX94066 3611 3225 3206 3171 3089 1737 1548 1175 --1230 --
NM_017919chr975533 4992 4594 3782 3732 3652 1341 23826 1884 24716 339 14784
NM_018017chr1042386 2112 2003 578 --31080 1066 998 --
NM_018085chr1157829 7560 7505 6638 6333 6190 6158 5631 5601 5215 2791 2263 472 450 38 47897 5959 5680 5522 56020 2765 1675 1238 156 17981
NM_018373chr1496367 6262 6143 5622 4809 4637 4108 1516 1337 35384 4560 4482 45320 1360 801 349 14694
NM_018374chr744136 4023 3555 1940 14210 13446 --
NM_018440chr8127175 6950 5759 5517 5426 2633 2076 1203 900 345 183 36 28469 7849 21887 1652 --
NM_018710chr831239 1201 890 11019 --11053
NM_018947chr7104957 4362 4188 4174 3913 3378 3364 872 843 99 34574 3262 3186 24213 3403 --
NM_018970chr731092 930 458 ----12278
NM_018999chr1074386 3836 3477 1816 1199 616 596 --1277 --
NM_019087chr531708 510 86 ----1165
NM_019592chr9----1594 1668
NM_019610chr162161 1774 1757 633 290 22 12001 --11594
NM_020119chr723368 1451 --1123 12606
NM_020122chr285965 5721 5633 5540 4778 4745 4587 3723 --1971 13918
NM_020133chr6106199 6152 5887 5674 5097 4347 4169 1856 1229 681 15426 24118 598 12067
NM_020152chr212317 187 --1844 1229
NM_020381chr6----11762 11758
NM_020466chr674770 1675 1550 1287 899 389 243 --1380 --
NM_020640chr34447 262 154 97 ----11619
NM_020717chrX94915 4763 4757 4640 3628 1988 1769 1250 425 13487 1977 --
NM_020781chr762826 2637 2472 2252 1146 971 33174 2767 143 12585 --
NM_020834chr1471895 1510 1419 1360 1273 206 161 ----1335
NM_020859chr463984 3696 2656 502 318 30 ----23126 3044
NM_020899chr1772540 2409 1596 1560 869 811 249 22080 477 12455 2951 857
NM_021061chr8143383 3361 3298 3215 3149 3088 3024 2989 2902 2750 1642 844 461 182 --34345 4229 4005 1978
NM_021629chr394248 3190 1798 1773 1759 1640 756 205 196 --13270 1640
NM_021961chr1165749 5084 5067 2166 2151 1981 11530 23003 2858 11891
NM_021964chr346464 6373 5904 4077 25343 4340 --1238
NM_022048chr1595225 2447 2404 1908 1344 1117 443 423 151 12051 25238 2486 --
NM_022166chr1686047 5875 5657 4262 2357 878 543 168 ------
NM_022497chr3103124 3070 3002 1293 1284 1171 698 637 310 42 1577 21045 608 --
NM_022912chr222365 990 ----1730
NM_023016chr232665 1908 517 ----2258 81
NM_024080chr231369 779 46 --11394 1500
NM_024345chr985291 4579 4379 4301 2374 1543 1325 1109 --11623 --
NM_024646chr121336 801 12703 23317 2815 23241 315
NM_024834chr1031953 1749 633 ----21460 326
NM_024949chr444190 4135 2002 1319 13757 14204 13658
NM_024989chr266712 6342 5204 3062 714 47 --12501 --
NM_025179chr173613 3351 1599 1506 1267 1048 89 --44667 1833 1809 657 21829 968
NM_030648chr4104734 4211 3824 3491 3482 1944 1917 1606 711 383 ------
NM_030674chr1245223 4608 3638 196 14446 13718 --
NM_031268chr1674925 4100 3544 1042 866 414 84 --1313 21576 1340
NM_031427chr1495661 5522 4727 4190 3940 1484 1228 835 123 14034 54215 1606 1592 1524 300 --
NM_031468chr797886 7654 7292 7206 6286 5673 5612 1751 1140 --28045 6443 11890
NM_031483chr2022481 199 13090 1822 21060 1051
NM_031890chr2252323 1885 745 127 84 11990 22763 174 22899 1134
NM_032042chr542754 2479 2329 312 22349 631 --12677
NM_032105chr1127040 6654 6238 6149 5739 5542 5011 2261 2239 1277 1222 1003 17312 25148 2834 --
NM_032175chr521641 523 ----11812
NM_032373chr1045441 5289 3935 125 188 13974 11189
NM_032457chr452836 851 844 802 610 12904 2864 144 13387
NM_032632chr141707 ----21912 91
NM_032873chr1154389 4286 4083 3961 881 12907 1378 --
NM_032884chr13112 47 41 ----1138
NM_032932chr17106452 5926 5576 5281 4529 4391 4382 1498 588 43 --35544 4568 1653 36052 3965 3906
NM_033020chr153461 1641 1534 907 395 --11008 --
NM_033083chr383424 3232 2636 649 616 579 316 101 --12487 1334
NM_033224chr7107631 7256 7154 6800 6278 2710 2384 1977 679 370 --16339 --
NM_033425chr1143426 3130 913 204 --12744 1988
NM_033637chr1083944 3848 3772 2907 1442 1321 1241 125 33294 1145 513 33918 2813 755 13455
NM_052907chr1293707 3536 3440 3423 3149 2931 2799 1500 72 ------
NM_053016chr987530 7208 6687 6470 6183 5787 4851 914 16584 36665 4885 3068 11598
NM_080669chr17104698 4654 3688 3495 1770 1625 1359 1144 761 149 24102 343 24090 824 1305
NM_080743chr662476 2028 1829 691 533 226 --31868 1012 998 --
NM_080872chr872697 1401 782 615 445 383 34 ----12731
NM_133170chr20157749 7172 6059 5644 5498 3101 3075 1755 1231 1194 775 659 547 519 298 --23185 2161 11568
NM_133334chr4126250 5645 4080 3907 2101 1914 1849 1495 974 640 186 162 14755 14759 --
NM_138288chr1442232 1432 122 66 32095 1559 22 ----
NM_138468chr265170 4507 2229 2094 1438 153 11778 33953 2268 503 --
NM_138473chr1231915 688 486 13647 34440 4035 3667 --
NM_138578chr2051098 1030 1016 560 524 11008 11201 21085 396
NM_138713chr1696879 6807 6785 6691 2956 2805 2633 1473 325 15594 ----
NM_138714chr1696879 6807 6785 6691 2956 2805 2633 1473 325 15594 ----
NM_138731chr1473339 1542 1372 1105 810 305 47 ------
NM_138971chr1173434 3157 2959 2781 1505 420 39 197 13564 13573
NM_138971chr1173434 3157 2959 2781 1505 420 39 197 13564 13573
NM_138972chr1173434 3157 2959 2781 1505 420 39 197 13564 13573
NM_138972chr1173434 3157 2959 2781 1505 420 39 197 13564 13573
NM_138973chr1173434 3157 2959 2781 1505 420 39 197 13564 13573
NM_138973chr1173434 3157 2959 2781 1505 420 39 197 13564 13573
NM_144599chr1594927 4748 4729 4075 3951 3548 1726 1157 1074 14223 11937 1924
NM_144949chr232020 1896 215 --11872 1850
NM_145207chr434816 3337 1112 --34150 661 457 11581
NM_145307chr1034545 4036 1601 24360 1325 --13953
NM_145912chr2264262 4009 3989 1899 602 46 33319 1225 503 43331 2893 2879 596 14646
NM_147147chr662741 2627 1547 1525 1237 956 --11391 1936
NM_147150chr953532 2693 2552 2534 43 --1331 1130
NM_152253chr22114188 3584 3490 3333 3038 2874 1457 1196 776 402 85 23420 446 43145 2944 1604 356 --
NM_152529chr274407 4238 3505 3138 3059 2815 1448 13730 21275 430 --
NM_152924chr15156924 6858 6336 5614 5439 5262 5204 5054 4979 4814 4331 2165 1008 572 443 --15464 1499
NM_153365chr462658 2494 2436 2389 2207 176 ----12350
NM_153456chr1364506 4065 3975 2131 256 243 45891 5183 5136 1409 11093 11249
NM_170665chr1273708 3179 2980 1781 1642 1616 1560 13229 14546 --
NM_170686chr762826 2637 2472 2252 1146 971 33174 2767 143 12585 --
NM_170740chr642827 2477 1293 182 12468 22486 1025 23149 2284
NM_171998chrX82402 1843 1795 1020 553 368 271 209 11635 1214 --
NM_173214chr1696879 6807 6785 6691 2956 2805 2633 1473 325 15594 ----
NM_173582chr1165850 5519 5418 4692 4665 157 --35178 1657 1318 --
NM_173602chr12103586 3180 3118 3059 2825 2379 1506 1286 1170 544 --22996 1128 13723
NM_173829chr5104906 4466 3814 2162 1892 1245 1028 562 375 138 15735 14545 15426
NM_175624chr1296601 6005 5231 3092 2922 2861 2825 1857 112 15761 12900 --
NM_175625chr1296601 6005 5231 3092 2922 2861 2825 1857 112 15761 12900 --
NM_175900chr164318 172 158 54 1520 1524 1251
NM_176823chr153780 3551 2643 1009 357 23083 2902 21291 922 --
NM_178151chrX66884 6092 5226 4899 3009 1155 45361 5128 2249 1227 25308 3053 12148
NM_178152chrX66884 6092 5226 4899 3009 1155 45361 5128 2249 1227 25308 3053 12148
NM_178153chrX66884 6092 5226 4899 3009 1155 45361 5128 2249 1227 25308 3053 12148
NM_181351chr1182562 2330 2229 1876 1011 435 372 27 --32672 2129 403 --
NM_181457chr2----1450 31217 887 882
NM_181458chr2----1583 31350 1020 1015
NM_181459chr2----1349 31116 786 781
NM_181460chr2----1396 31163 833 828
NM_181504chr543684 2956 1608 1594 1132 ----
NM_181521chr16107157 5057 5022 2567 2388 1960 1898 1566 1411 516 --24942 1754 --
NM_181523chr543684 2956 1608 1594 1132 ----
NM_181524chr543684 2956 1608 1594 1132 ----
NM_181787chr882900 2749 2727 2548 1440 669 166 30 --12670 184
NM_182641chr1711708 ----1220
NM_182948chr15701 596 551 223 74 ----1641
NM_183397chr2085149 4337 3455 3297 1792 971 478 305 15027 43561 1778 1710 838 --
NM_194286chr12145954 5596 4816 4521 4284 2298 2046 1792 1498 930 899 739 478 333 16038 25771 171 11826
NM_198484chr3176401 5204 5189 5046 4611 4235 4123 3997 2454 2252 1920 1836 1788 1580 619 454 261 11564 25228 4317 --
NM_198562chr372176 1607 1544 948 760 406 363 12094 42201 731 445 169 --
NM_198581chr287105 6712 6616 6343 5763 5044 2602 402 ------
NM_198793chr364023 3799 3467 3423 1629 1030 --23478 1039 --
NM_198859chr334385 3611 391 13621 1238 24998 3186
NM_199000chr711576 --21541 177 2260 110
NM_199462chr195042 4650 4349 3758 3604 1967 1269 924 608 13348 24199 693 --
NM_201432chr1765471 5297 4875 4141 2096 393 26179 435 66401 5454 5406 5319 892 691 15315
NM_201433chr1765471 5297 4875 4141 2096 393 26179 435 66401 5454 5406 5319 892 691 15315
NM_203327chr2043941 3614 2881 707 34530 3677 1180 11082 13620
NM_203504chr431049 636 606 ----1727
NM_203505chr431049 636 606 ----1727
NM_206594chr123019 138 --1811 13172
NM_206595chr123019 138 --1811 13172
NM_206853chr684107 4076 3571 3315 2931 2867 822 453 ------
NM_206854chr6115368 5337 4832 4576 4192 4128 2083 1714 888 757 48 ------
NM_206855chr6116333 6302 5797 5541 5157 5093 1853 1722 1013 634 95 1986 ----
NM_207406chr475973 5077 4871 4798 2381 847 254 35091 4933 888 34057 2033 1779 15586
NM_207517chr1521719 458 --1340 1104