TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3668
miRNA Sequence: AAUGUAGAGAUUGAUCAAAAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr51528 ------
NM_000038chr541294 621 528 382 154 1249 --
NM_000051chr1123510 2826 ----12643
NM_000052chrX53483 3436 2575 565 257 --13417 --
NM_000084chrX56734 5654 2594 731 215 31026 994 154 --11799
NM_000091chr252772 2686 1948 1018 268 --21824 1783 --
NM_000092chr284307 4269 4105 3499 2960 938 383 322 --1709 24343 3317
NM_000108chr72581 465 11179 41868 1704 344 169 1177
NM_000109chrX102595 2373 2103 897 740 691 306 265 164 96 --32210 684 180 --
NM_000115chr135960 863 745 645 242 32377 952 156 21975 754 12164
NM_000125chr663673 3339 3049 2924 777 43 24058 90 ----
NM_000129chr61301 ----21368 1290
NM_000138chr1542551 2118 574 60 ------
NM_000141chr1031474 1288 435 ------
NM_000142chr431310 1116 611 ----11288
NM_000151chr1721925 396 ------
NM_000163chr522229 702 22122 29 1764 --
NM_000165chr621461 561 11572 ----
NM_000166chrX1634 ------
NM_000167chrX41780 1767 1702 127 1739 1384 2478 44
NM_000168chr733233 1280 1255 --1449 --
NM_000176chr563906 3167 2739 965 466 142 33588 3540 573 13606 --
NM_000210chr241756 1478 853 458 ------
NM_000212chr17172 ------
NM_000216chrX42802 2784 637 623 ----23809 1251
NM_000222chr441893 1613 684 581 --11599 --
NM_000237chr83621 473 75 --31784 1702 1332 11230
NM_000242chr1052620 2479 1928 345 255 1587 ----
NM_000245chr711682 ------
NM_000248chr342414 1018 189 21 21921 1208 22624 2080 --
NM_000252chrX21198 1033 1296 ----
NM_000253chr41868 ----197
NM_000259chr15116301 5009 4075 2161 2125 1754 1555 1459 884 709 410 1643 11854 26047 247
NM_000264chr953179 2336 831 685 172 --22486 2127 --
NM_000267chr1753327 3228 2485 1340 1222 --12928 --
NM_000276chrX52070 1487 817 556 265 --22217 1819 --
NM_000280chr112714 125 1941 ----
NM_000297chr441729 1478 1367 134 31998 1905 1665 --1812
NM_000314chr1072609 2346 1116 969 740 577 477 ------
NM_000321chr1341771 1257 553 508 --11555 --
NM_000328chrX4443 395 386 135 ------
NM_000329chr15716 376 140 93 61 ------
NM_000332chr676256 6065 5267 2553 1273 1261 623 35391 5344 2820 22202 90 14976
NM_000337chr536536 1717 1165 --15816 16224
NM_000351chrX114025 3680 3570 3301 2919 2872 1020 785 421 414 98 ------
NM_000362chr2263536 2739 2592 2387 1050 541 --1575 --
NM_000368chr911013 --33892 507 493 --
NM_000379chr241478 1327 611 470 21316 593 ----
NM_000390chrX73280 3020 2406 1149 860 815 748 11243 --1632
NM_000393chr271921 1719 1521 859 804 526 116 ------
NM_000408chr263467 3460 3359 3321 3140 1282 ------
NM_000428chr1472539 2389 2338 1942 1055 835 414 1852 ----
NM_000430chr1743704 3395 2443 1371 1911 --23761 197
NM_000435chr194977 660 411 125 --1359 --
NM_000439chr582301 2291 753 711 373 301 288 229 ------
NM_000447chr1168 ------
NM_000448chr11103086 2767 2515 2019 1153 1036 1017 608 561 537 1493 12970 33000 862 476
NM_000449chr121456 37 ----11323
NM_000452chr1351935 1737 1588 1322 57 2516 198 ----
NM_000461chr374419 3829 3470 1026 836 817 739 ----24574 4201
NM_000462chr1511164 2271 214 11257 --
NM_000484chr214833 787 226 220 1845 1207 1374
NM_000486chr1242742 2655 487 21 ----13238
NM_000489chrX63364 3129 1279 1252 1132 832 12725 13222 22846 389
NM_000492chr741498 1195 1023 507 ------
NM_000495chrX2839 785 2742 120 ----
NM_000508chr44846 770 292 90 ------
NM_000522chr73495 331 173 --31019 1012 797 --
NM_000525chr1131642 1590 1505 ------
NM_000531chrX1238 ------
NM_000536chr113553 472 123 --1639 --
NM_000544chr6_cox_hap142118 704 485 287 ------
NM_000554chr1932840 1208 1155 --23190 1248 --
NM_000555chrX107228 6506 6281 6182 5856 3124 2646 1705 1289 816 ----1363
NM_000572chr12972 23 1312 ----
NM_000575chr231078 198 136 --1811 --
NM_000596chr73549 534 184 1461 1564 --
NM_000601chr72449 434 --149 --
NM_000615chr1171866 1205 1040 910 881 864 728 --1680 --
NM_000617chr1242182 1827 333 24 ------
NM_000618chr12146610 6529 6391 6264 6107 5616 2158 1430 1286 484 458 435 246 57 11756 42297 2280 2273 1616 16195
NM_000618chr12146610 6529 6391 6264 6107 5616 2158 1430 1286 484 458 435 246 57 11756 42297 2280 2273 1616 16195
NM_000633chr1825091 1476 --35131 3909 236 14642
NM_000663chr1622782 347 ----22929 2911
NM_000681chr1021384 133 --31273 1265 1259 --
NM_000686chrX81272 1125 1042 1003 626 559 402 221 1567 ----
NM_000693chr1531774 1610 394 --1120 --
NM_000719chr1255178 1903 1702 820 192 --24672 1770 14885
NM_000724chr1041828 1336 582 87 21594 197 ----
NM_000726chr241479 1181 528 157 1904 1226 --
NM_000782chr2051137 1046 466 102 82 --1286 --
NM_000792chr12921 344 ----1976
NM_000806chr531468 1363 36 --1458 --
NM_000807chr42664 555 ----1546
NM_000809chr4149185 8150 7990 7634 6793 6774 6597 6224 5651 3030 2796 2252 1021 784 32824 706 543 78138 7377 6752 6302 6156 6090 2875 12309
NM_000813chr541571 1252 834 227 12025 13419 --
NM_000814chr1563850 3328 3233 3057 1259 600 13133 1860 --
NM_000817chr2----170 1246
NM_000824chr41645 1253 1859 --
NM_000826chr452491 2424 2394 499 440 22255 1988 ----
NM_000840chr71431 ------
NM_000844chr31762 1692 ----
NM_000859chr521388 278 --21507 211 --
NM_000860chr411692 11658 ----
NM_000866chr351903 1603 1525 1432 1374 --1315 --
NM_000868chrX82371 2140 1940 1919 969 477 160 147 141 2457 183 1122
NM_000875chr1597056 6256 5818 5635 5429 4634 1247 536 155 26821 6501 --16966
NM_000880chr83852 728 43 ------
NM_000891chr1753033 2820 2590 399 35 1601 ----
NM_000899chr1284375 3941 3350 1757 1477 423 323 214 --34072 3123 1138 --
NM_000901chr44996 931 912 675 12031 22263 568 --
NM_000902chr352328 1046 851 770 465 1523 22422 1063 --
NM_000908chr53798 722 643 --1533 --
NM_000921chr121156 ------
NM_000933chr2031090 688 426 11733 31188 657 485 --
NM_000944chr452382 418 326 188 149 176 1900 --
NM_000945chr241691 1404 1326 595 --12034 31616 359 313
NM_000950chrX43296 3184 3148 904 176 33570 3288 2722 --
NM_000965chr32817 363 ------
NM_001001132chr2131084 945 437 --11056 --
NM_001001323chr1273069 2576 2539 2309 2138 739 318 21174 266 ----
NM_001001331chr342616 2239 1988 806 12139 1627 --
NM_001001395chr1232464 150 40 --22813 2200 12311
NM_001001396chr133208 2719 261 --34271 4170 4044 --
NM_001001419chr565168 3811 1410 1050 979 86 34425 3236 649 2601 162 24174 122
NM_001001420chr565168 3811 1410 1050 979 86 34425 3236 649 2601 162 24174 122
NM_001001433chr2042191 951 720 310 1905 12973 1490
NM_001001436chr163777 638 92 --1842 --
NM_001001481chr852622 2503 2461 1300 134 13331 --23050 2240
NM_001001483chr112385 312 ------
NM_001001484chr1042281 1822 757 465 1733 1269 1587
NM_001001557chr842206 2167 2120 1383 --1498 --
NM_001001664chr273951 3640 3150 2763 754 665 484 12579 --11275
NM_001001668chr1964207 3811 2601 676 139 99 12801 11333 --
NM_001001701chr441685 884 260 138 ----12360
NM_001001890chr2132660 1170 854 --23346 963 11293
NM_001001924chr841493 845 675 52 11619 21607 1531 --
NM_001001925chr841493 845 675 52 11619 21607 1531 --
NM_001001931chr841493 845 675 52 11619 21607 1531 --
NM_001001933chr12204 147 ------
NM_001001974chr1072270 1827 1799 1578 953 885 406 --1786 --
NM_001001995chrX267 35 ----1437
NM_001002233chr842099 1959 1415 1369 1449 11421 12198
NM_001002243chr2------1171
NM_001002257chr273417 3065 2999 2616 2547 2282 892 12568 33112 1394 926 --
NM_001002258chr22714 376 --21905 1304 1309
NM_001002259chr121346 ------
NM_001002295chr101858 ------
NM_001002814chr853219 2695 2581 1415 1369 1449 11421 13433
NM_001002838chrX31401 1269 388 21251 128 ----
NM_001002860chr14134454 4339 4221 4200 4085 3007 1809 1686 1620 1418 940 712 277 24689 4463 13462 --
NM_001002876chr221388 ------
NM_001002909chr1731515 818 276 --1895 --
NM_001002914chr1711269 ------
NM_001002926chr762765 2375 480 405 287 103 ----2273 44
NM_001003407chr1064677 4061 3148 1850 1454 1077 --25099 3347 --
NM_001003408chr1064677 4061 3148 1850 1454 1077 --25099 3347 --
NM_001003652chr18198564 8327 8035 6765 6162 3286 3109 2724 2615 2150 2116 1685 1620 1448 1266 1166 1064 1036 163 --27948 6204 --
NM_001003679chr142243 2073 1432 57 31822 728 338 22159 79 --
NM_001003688chr43972 912 847 --1213 --
NM_001003712chr1254056 3672 2462 1074 329 --13345 33485 622 253
NM_001003760chr683668 3278 3073 2559 2474 1277 984 349 13602 ----
NM_001003792chr35973 952 910 860 824 ------
NM_001003793chr35973 952 910 860 824 ------
NM_001003800chr943575 3434 2656 1468 --13211 --
NM_001003945chr931896 1530 188 --11937 --
NM_001004065chr962895 803 752 562 407 262 --21581 661 --
NM_001004106chr5161 ------
NM_001004317chr674311 3316 2773 1738 1486 1306 162 13873 ----
NM_001004346chr41334 1321 199 --
NM_001004419chr1254398 4257 3884 3265 1133 --24482 4438 --
NM_001004441chr531607 643 514 ----11241
NM_001004720chr22889 867 1850 1963 --
NM_001004722chr231058 1036 57 11019 11132 --
NM_001005207chr171229 ------
NM_001005266chr151610 ------
NM_001005267chr151610 ------
NM_001005268chr151610 ------
NM_001005269chr151610 ------
NM_001005366chr123288 281 74 1694 1839 --
NM_001005367chr191349 ------
NM_001005386chr242394 2348 1682 660 1210 12289 1393
NM_001005404chr17114390 4322 3780 3632 3392 2777 1701 1444 1415 1089 536 14050 23365 1044 --
NM_001005463chr1072609 2390 2316 1829 752 528 448 ------
NM_001005473chr5135896 5501 5442 5098 4263 4209 4060 2337 1438 1410 497 447 349 25376 4298 1550 --
NM_001005609chrX33210 749 569 13777 23663 225 --
NM_001005743chr142959 522 --1314 --
NM_001005744chr142959 522 --1314 --
NM_001005745chr142959 522 --1314 --
NM_001005746chr241479 1181 528 157 1904 1226 --
NM_001005747chr241479 1181 528 157 1904 1226 --
NM_001005849chr172492 56 ------
NM_001005861chr31695 ------
NM_001006600chr542249 2241 611 571 ----11868
NM_001006612chrX1172 1309 2406 139 --
NM_001006613chrX1172 1309 2406 139 --
NM_001006614chrX1172 1309 2406 139 --
NM_001006618chr91248 ------
NM_001006665chr11275 ------
NM_001006684chrX1485 ------
NM_001006945chr12576 197 --1185 --
NM_001007024chr1754105 2924 2813 2711 1115 --1371 --
NM_001007025chr1754105 2924 2813 2711 1115 --1371 --
NM_001007067chr861107 833 384 207 129 108 ------
NM_001007068chr861107 833 384 207 129 108 ------
NM_001007069chr861107 833 384 207 129 108 ------
NM_001007070chr861107 833 384 207 129 108 ------
NM_001007075chr4--11051 21031 22 --
NM_001007097chr984037 3290 1975 1674 1534 536 491 160 1172 31683 1206 461 --
NM_001007214chr11297 21463 81 --1110
NM_001007246chr211451 31423 1368 154 31613 178 124 --
NM_001007257chr121305 1054 --11176 --
NM_001007466chr684565 4553 3735 1195 784 676 585 517 --1859 --
NM_001007527chr5190 1207 ----
NM_001007544chr1147 ------
NM_001008225chr71554 ------
NM_001008226chr1511817 --11784 1457
NM_001008239chr1831268 1100 26 --23692 2695 11488
NM_001008392chr373511 3393 3213 3138 2900 708 442 --52467 2443 2437 2431 2425 12450
NM_001008401chr1941482 1461 186 104 ------
NM_001008405chr741547 661 498 330 31848 1388 455 11510 --
NM_001008491chr232026 1672 559 ------
NM_001008492chr232026 1672 559 ------
NM_001008495chr851917 1620 738 589 240 ------
NM_001008541chr1051893 1859 675 579 349 ----11720
NM_001008541chr1051893 1859 675 579 349 ----11720
NM_001008564chr1341521 820 621 245 12048 1323 11859
NM_001008567chr91116 ------
NM_001008660chr1131531 1301 1282 ----1570
NM_001008701chr1911121 ------
NM_001008707chr1451755 1498 1444 1402 525 --1248 --
NM_001008726chr143508 404 338 11052 2428 361 --
NM_001008738chr572522 2392 1004 898 664 424 281 12549 12601 32794 826 136
NM_001008777chr171639 1154 1530 1573
NM_001008860chr15----2742 243 --
NM_001008892chr15----2742 243 --
NM_001008894chr15----2742 243 --
NM_001008895chr1321469 387 ----11091
NM_001008897chr61531 ------
NM_001008925chr463515 2968 2767 2254 781 62 --22671 371 --
NM_001009554chr484016 3931 1818 1535 879 606 593 358 11046 ----
NM_001009554chr484016 3931 1818 1535 879 606 593 358 11046 ----
NM_001009555chr421453 1394 --21141 400 --
NM_001009571chr751415 1290 1227 560 81 ------
NM_001009880chr22104699 4423 4205 4055 3594 3502 3373 1607 1067 264 ----11461
NM_001009881chr13473 199 94 ------
NM_001009882chr13473 199 94 ------
NM_001009899chr366395 5519 5064 2025 959 205 26035 5646 25075 239 14826
NM_001009959chr242545 2450 560 544 --11710 --
NM_001009960chr752573 2531 2248 225 91 12257 ----
NM_001009993chr254317 3908 2831 393 134 --24391 3752 --
NM_001010000chr1883340 2789 2780 1295 894 780 568 53 13350 12526 --
NM_001010853chr633282 2573 995 12358 --33123 2538 1099
NM_001010861chr172722 2575 2256 1014 1001 549 28 --12078 1345
NM_001010876chr6174 ------
NM_001010888chrX114033 3694 3184 3100 3090 1694 1301 1073 1057 941 101 24658 4285 2899 739 --
NM_001010895chr942030 1923 1639 1526 --11987 1831
NM_001010897chr131378 ------
NM_001010922chr133911 2619 1418 43882 3727 3430 1038 12878 11318
NM_001010932chr72449 434 --149 --
NM_001010986chrX32409 1899 774 --32440 2434 1590 11706
NM_001011513chr494147 3909 3750 3717 3489 3386 2636 1034 373 --33398 2978 1640 12673
NM_001011515chr42442 119 ------
NM_001011516chr42442 119 ------
NM_001011537chr342330 2296 1468 901 ------
NM_001011546chr203729 315 136 158 ----
NM_001011553chr74863 772 319 228 --1932 --
NM_001011666chr785756 5713 4941 4820 4765 2589 1910 1100 11062 16521 --
NM_001011708chr282858 2684 2006 1918 1862 394 376 358 11985 --12247
NM_001011713chr1431290 1251 290 ------
NM_001011722chr12484 390 ------
NM_001011722chr12484 390 ------
NM_001012267chr931939 1468 677 1662 ----
NM_001012393chr11115127 4666 3567 3537 1561 1437 636 566 555 429 61 --13664 --
NM_001012398chr161945 ------
NM_001012421chr94854 570 357 294 --190 --
NM_001012751chr1041919 1816 1674 326 ------
NM_001012755chrX104911 4705 4504 4175 4090 3691 3620 673 457 112 24227 946 13958 161
NM_001012761chr532238 2087 39 12728 1892 12339
NM_001013399chr62853 396 ------
NM_001013438chr34904 708 672 177 --2253 189 --
NM_001013439chr33750 554 23 --299 35 --
NM_001013620chr12147316 7032 6503 6256 6231 6024 5454 1849 1117 921 623 468 122 55 18351 68328 7207 5695 3184 2812 2385 --
NM_001013629chr1052122 1718 1320 470 70 11978 12140 --
NM_001013642chr12851 286 ----1881
NM_001013699chr121154 --1568 --
NM_001014286chr131345 --1103 --
NM_001014434chr14212 176 153 81 ------
NM_001014449chr161198 ------
NM_001014451chr161198 ------
NM_001014796chr1----1192 --
NM_001014796chr1----1192 --
NM_001014797chr10128116 7999 7261 6599 2989 2849 1910 1182 968 833 442 205 --22014 694 12124
NM_001015045chr472378 1002 703 601 429 335 316 1919 11773 --
NM_001015048chr1442852 2578 2205 990 1357 42752 2693 596 578 13103
NM_001015049chr1442852 2578 2205 990 1357 42752 2693 596 578 13103
NM_001015877chrX52609 2261 995 389 296 --12379 --
NM_001015881chrX1105 1972 ----
NM_001015887chr341754 1305 1188 657 --21233 539 --
NM_001017371chr221214 1050 1474 ----
NM_001017395chr333191 2716 91 --22924 123 --
NM_001017415chr14660 565 285 67 ------
NM_001017416chr14660 565 285 67 ------
NM_001017923chr1431372 1206 294 --11139 --
NM_001017926chr831519 442 195 1386 ----
NM_001017930chrX11004 ------
NM_001017963chr143889 382 40 ------
NM_001017969chr9----1641 1568
NM_001017977chr12345 72 ------
NM_001017992chr5128 ------
NM_001017995chr564396 4134 3879 3756 3179 1216 14793 ----
NM_001017999chr142226 2026 1568 648 1845 ----
NM_001017999chr142226 2026 1568 648 1845 ----
NM_001018000chr142226 2026 1568 648 1845 ----
NM_001018000chr142226 2026 1568 648 1845 ----
NM_001018001chr142226 2026 1568 648 1845 ----
NM_001018004chr151688 ------
NM_001018006chr151688 ------
NM_001018007chr151688 ------
NM_001018020chr151688 ------
NM_001018037chr931356 1020 985 ------
NM_001018064chr911732 --1332 1350
NM_001018065chr9125663 5339 4936 4488 3785 1832 1648 1284 1216 943 385 97 25333 1825 35983 5088 2153 14207
NM_001018066chr9125663 5339 4936 4488 3785 1832 1648 1284 1216 943 385 97 25333 1825 35983 5088 2153 14207
NM_001018074chr563906 3167 2739 965 466 142 33588 3540 573 13606 --
NM_001018075chr563906 3167 2739 965 466 142 33588 3540 573 13606 --
NM_001018076chr563906 3167 2739 965 466 142 33588 3540 573 13606 --
NM_001018077chr563906 3167 2739 965 466 142 33588 3540 573 13606 --
NM_001018115chr31647 ------
NM_001020658chr11658 --1315 --
NM_001020658chr11658 --1315 --
NM_001020825chr521381 214 21063 1015 11081 --
NM_001024094chr563906 3167 2739 965 466 142 33588 3540 573 13606 --
NM_001024218chr141132 ------
NM_001024372chr832033 2002 1688 1326 12017 --
NM_001024647chr12137140 7025 6791 6706 5864 4698 2835 2433 2380 2210 1897 1808 684 1988 56821 6237 1277 808 467 --
NM_001024649chr532856 2260 1826 22736 981 12140 12662
NM_001024660chr31596 ------
NM_001024666chrX1601 1510 ----
NM_001024847chr32344 251 12399 11590 32463 354 336
NM_001024934chr61184 1654 ----
NM_001024935chr61184 1654 ----
NM_001024936chr61184 1654 ----
NM_001024947chr521059 179 1931 1109 --
NM_001024948chr143063 2268 1336 699 1823 13505 --
NM_001024956chr11114875 4617 4126 4096 3896 2338 1080 996 637 509 333 12102 --14936
NM_001025076chr1095384 5257 4534 4009 2475 2141 1535 731 261 16071 1526 --
NM_001025077chr10116742 6615 5892 5367 4785 2893 2089 1619 1106 557 133 27429 1361 11884 --
NM_001025079chr363894 3816 3630 2679 1004 929 ------
NM_001025108chr274201 4119 3598 3400 1325 1249 839 --23960 1298 --
NM_001025201chr25497 491 463 81 34 ------
NM_001025252chr873192 2790 2724 760 658 360 314 ----1118
NM_001025253chr873192 2790 2724 760 658 360 314 ----1118
NM_001025266chr324214 1655 1768 54729 4280 3265 3026 1571 --
NM_001025366chr6--11555 --21692 1548
NM_001025366chr6--11555 --21692 1548
NM_001025367chr6--11555 --21692 1548
NM_001025367chr6--11555 --21692 1548
NM_001025368chr6--11555 --21692 1548
NM_001025368chr6--11555 --21692 1548
NM_001025369chr6--11571 --21708 1564
NM_001025369chr6--11571 --21708 1564
NM_001025370chr6--11555 --21692 1548
NM_001025370chr6--11555 --21692 1548
NM_001025580chrX54193 1374 1296 1262 37 11269 1961 12958
NM_001025595chr421280 199 --21631 373 --
NM_001025603chr121456 37 ----11323
NM_001025616chr431806 154 131 11437 ----
NM_001025777chr231169 1037 80 11405 ----
NM_001025780chr91275 1568 ----
NM_001029858chr63462 242 103 --12218 13007
NM_001029863chr652942 2932 1097 522 489 --12213 --
NM_001029875chr582051 1895 1055 844 808 531 366 161 --2918 542 --
NM_001029997chr192547 292 ------
NM_001030007chr1643779 3558 374 275 --33961 3318 3160 --
NM_001030055chr1484039 1605 631 355 324 248 158 118 11866 21728 434 23857 1751
NM_001030272chr113354 159 62 ------
NM_001030273chr113354 159 62 ------
NM_001031684chr231518 1044 333 11108 21327 44 --
NM_001031689chr9----1118 --
NM_001031690chr742600 2394 974 639 --22979 998 --
NM_001031692chr7143 --170 --
NM_001031695chr2265041 4967 3870 633 465 86 --11425 --
NM_001031710chr71999 ------
NM_001031711chr5----11568 --
NM_001031712chr62281 270 --1406 --
NM_001031723chr4----1454 --
NM_001031732chr433050 1462 70 --63204 2631 1395 1384 736 385 --
NM_001031804chr1663872 3477 988 793 418 328 ------
NM_001031812chr561888 1546 1520 938 156 37 11803 1503 --
NM_001032282chr821328 1177 ------
NM_001032283chr122946 772 ------
NM_001032284chr122946 772 ------
NM_001032293chr17----1153 --
NM_001032296chr1362748 2382 2142 2024 2006 580 ----1954
NM_001032380chr1041830 615 406 219 ------
NM_001032394chr632486 162 86 31987 780 236 1529 --
NM_001033045chr2104035 4006 3943 3740 3685 3360 3050 971 858 24 --1175 --
NM_001033047chr42867 697 --1681 --
NM_001033049chr2142292 2161 1969 1693 ----1473
NM_001033057chr311951 11739 --2370 281
NM_001033059chr651429 727 627 286 275 --1445 --
NM_001033081chr141609 771 556 357 11474 1376 --
NM_001033082chr141609 771 556 357 11474 1376 --
NM_001033087chr2053272 2987 2269 164 145 1791 ----
NM_001033117chr31955 --14626 2440 338
NM_001033557chr221043 308 --11238 --
NM_001033561chr173888 702 92 ------
NM_001033576chr1732531 1850 577 12314 ----
NM_001033578chr852194 1716 572 312 42 --12148 12414
NM_001033659chr17----1389 --
NM_001033756chr6--11489 --21626 1482
NM_001033756chr6--11489 --21626 1482
NM_001033925chr1011620 11628 2767 697 --
NM_001034837chr53735 119 87 ------
NM_001034838chr53735 119 87 ------
NM_001034850chr52611 340 11679 ----
NM_001035chr121219 475 ------
NM_001035260chr1021369 599 --21478 491 1435
NM_001037132chr742024 1569 1423 285 21587 403 21892 686 11742
NM_001037133chr742024 1569 1423 285 21587 403 21892 686 11742
NM_001037164chr751306 1272 718 344 74 --11253 --
NM_001037165chr788946 8453 7710 2581 2560 2327 2232 876 --28967 7670 --
NM_001037172chr331409 1276 1230 ------
NM_001037174chr221728 118 ------
NM_001037317chr172722 2575 2256 1014 1001 549 28 --12078 1345
NM_001037324chr31721 ------
NM_001037332chr521625 272 --22424 1942 --
NM_001037333chr521625 272 --22424 1942 --
NM_001037334chr1832381 2032 62 1208 ----
NM_001037533chr12211 102 ------
NM_001037535chrX51547 1440 1255 481 265 --1542 11531
NM_001037536chrX51547 1440 1255 481 265 --1542 11531
NM_001037540chrX51547 1440 1255 481 265 --1542 11531
NM_001037553chr2164467 4117 3414 3311 1367 387 --23282 1606 14788
NM_001037872chr23266 252 217 ----1550
NM_001037954chr1163406 3358 3036 2430 2169 667 --13046 12778
NM_001038493chr221206 111 --1973 --
NM_001039538chr243412 3363 1121 325 --1218 12334
NM_001039547chr3107224 7084 6684 6350 5821 5723 3037 1672 1466 1249 11359 47828 7821 6389 1662 17130
NM_001039570chr2234645 1282 382 --1253 --
NM_001039571chr2234645 1282 382 --1253 --
NM_001039580chr484800 3972 3860 1927 1491 1444 1144 1123 34673 3788 1185 21747 948 23824 1366
NM_001039585chr173884 1236 1214 1102 884 126 100 34144 611 171 --22772 793
NM_001039590chrX73976 3362 1093 403 359 313 145 33699 3592 1552 12728 --
NM_001039591chrX73976 3362 1093 403 359 313 145 33699 3592 1552 12728 --
NM_001039616chr19155 ------
NM_001039618chr1165945 5805 5216 2248 1794 828 25613 3628 15622 --
NM_001039649chr13------1213
NM_001039693chr274150 4016 2833 2605 1601 753 97 13783 34034 3835 460 --
NM_001039715chr12921 344 ----1976
NM_001039716chr12985 408 ----11040
NM_001039762chr1041759 1606 558 297 ------
NM_001039840chrX85667 5297 5061 4112 3953 2019 1062 941 25895 5308 --35967 648 607
NM_001039937chr1361588 1376 703 671 154 131 23631 679 33621 2563 687 --
NM_001040001chr621884 114 11382 1565 11774
NM_001040020chr731534 976 477 --1404 11060
NM_001040057chr721241 398 --11350 --
NM_001040101chr431108 368 290 --11577 --
NM_001040108chr1482763 2087 2005 965 909 844 509 446 1249 13285 --
NM_001040110chr731677 208 52 ----21657 345
NM_001040113chr163946 362 154 --1715 --
NM_001040142chr251939 865 393 114 42 --1516 1760
NM_001040143chr251939 865 393 114 42 --1516 1760
NM_001040152chr764478 3771 3726 3466 1527 1022 13715 35089 4298 4051 14164
NM_001040153chr133901 373 126 ------
NM_001040157chr422380 1131 12596 1352 --
NM_001040159chr441514 1281 603 46 11136 2548 32 --
NM_001040181chr321041 22 --2775 374 --
NM_001040182chr321041 22 --2775 374 --
NM_001040183chr321041 22 --2775 374 --
NM_001040199chr321041 22 --2775 374 --
NM_001040200chr321041 22 --2775 374 --
NM_001040202chr452557 2239 1694 611 177 --32482 2395 1032 --
NM_001040214chr652197 574 421 349 68 ----21605 142
NM_001040284chr1665944 3762 2109 1227 913 881 --24390 4088 1568
NM_001040402chr453102 2705 2561 908 209 ------
NM_001040429chr1352804 2271 1344 1081 86 --22387 1006 --
NM_001040441chr153971 2058 1190 1129 35 23603 1944 35500 3585 43 14930
NM_001040446chr592766 2731 2597 2393 2230 2223 2057 722 527 ------
NM_001040450chr1552890 2503 2340 421 32 1665 ----
NM_001040453chr1552890 2503 2340 421 32 1665 ----
NM_001040653chr33722 688 100 1206 1825 --
NM_001040665chr794633 4602 4360 1847 1652 1512 1018 505 489 23278 1487 23973 67 13187
NM_001040697chr113406 239 108 168 1553 --
NM_001040712chr9113533 3493 3361 3152 3045 3011 2297 1378 771 739 251 1611 ----
NM_001042355chr16135416 5258 5245 5192 4157 3575 2035 1828 1756 1298 824 560 532 --11906 43934 3886 3655 510
NM_001042357chr1021264 567 1254 11412 --
NM_001042358chr1021264 567 1254 11412 --
NM_001042360chr1021264 567 1254 11412 --
NM_001042363chr1021264 567 1254 11412 --
NM_001042389chr1021264 567 1254 11412 --
NM_001042390chr1021264 567 1254 11412 --
NM_001042392chr1021264 567 1254 11412 --
NM_001042395chr1021264 567 1254 11412 --
NM_001042404chr181986 1953 1862 1843 1451 1434 1406 1343 ----1670
NM_001042412chr16135416 5258 5245 5192 4157 3575 2035 1828 1756 1298 824 560 532 --11906 43934 3886 3655 510
NM_001042413chr953984 2960 2900 2873 1220 33910 3558 3008 14074 11335
NM_001042422chr17170 ------
NM_001042423chr17170 ------
NM_001042440chr541911 1829 1392 354 --32062 669 33 --
NM_001042441chr541911 1829 1392 354 --32062 669 33 --
NM_001042442chr541911 1829 1392 354 --32062 669 33 --
NM_001042443chr541911 1829 1392 354 --32062 669 33 --
NM_001042444chr541911 1829 1392 354 --32062 669 33 --
NM_001042445chr541911 1829 1392 354 --32062 669 33 --
NM_001042446chr541911 1829 1392 354 --32062 669 33 --
NM_001042453chrX71654 1450 1363 1249 606 326 58 --1653 11382
NM_001042481chr1442624 2505 756 331 12459 32514 2449 930 32548 1923 74
NM_001042486chr2021051 361 --11042 --
NM_001042492chr1753327 3228 2485 1340 1222 --12928 --
NM_001042494chr1593062 2877 2430 1471 1194 825 508 180 48 --13877 23817 3442
NM_001042495chr1593062 2877 2430 1471 1194 825 508 180 48 --13877 23817 3442
NM_001042496chr1593062 2877 2430 1471 1194 825 508 180 48 --13877 23817 3442
NM_001042497chr1593062 2877 2430 1471 1194 825 508 180 48 --13877 23817 3442
NM_001042510chr851850 1839 1814 818 245 ----11386
NM_001042511chr851850 1839 1814 818 245 ----11386
NM_001042533chr342525 2277 2075 612 13034 23146 668 --
NM_001042537chrX32004 853 176 22482 108 11700 --
NM_001042550chr942050 1796 671 327 --31839 618 289 --
NM_001042555chr1234454 4223 3744 13807 13528 --
NM_001042599chr2117832 7435 7141 6770 6192 5306 5045 2677 1598 496 416 --67668 2831 2618 873 731 228 15860
NM_001042603chr1265284 4330 4209 1183 256 170 14199 24405 768 --
NM_001042669chr431806 154 131 11437 ----
NM_001042681chr142516 2066 514 209 ----22525 69
NM_001042682chr142516 2066 514 209 ----22525 69
NM_001042682chr142516 2066 514 209 ----22525 69
NM_001042683chr641624 515 215 197 11792 2586 259 --
NM_001042749chrX72053 1656 1645 1342 629 573 352 --1406 --
NM_001042750chrX72053 1656 1645 1342 629 573 352 --1406 --
NM_001042751chrX72053 1656 1645 1342 629 573 352 --1406 --
NM_001042784chr4124 ------
NM_001043318chr1443673 3503 3203 303 13966 23296 3008 --
NM_001044387chr1943907 3872 485 192 ----13889
NM_001044388chr1943907 3872 485 192 ----13889
NM_001044722chr561888 1546 1520 938 156 37 11803 1503 --
NM_001044723chr561888 1546 1520 938 156 37 11803 1503 --
NM_001046chr542782 1991 697 513 12844 22815 2132 1756
NM_001048183chr111506 ----11038
NM_001071775chr1331807 93 40 --2739 197 --
NM_001079874chr141965 1340 849 102 ------
NM_001083620chr452489 2422 2392 498 439 22253 1986 ----
NM_001095chr1221775 638 --2336 189 --
NM_001099678chr386058 5154 4456 2213 1767 891 548 305 32169 444 428 66310 5817 5584 2376 644 603 15633
NM_001100108chr137880 7375 151 1944 25358 5073 --
NM_001106chr359667 8712 7065 5969 3911 1446 28752 6261 15932
NM_001117chr1832467 2288 168 ------
NM_001121chr1051477 1284 479 410 144 --11656 --
NM_001123chr10----1330 --
NM_001124chr11------1708
NM_001128chr1643779 3558 374 275 --33961 3318 3160 --
NM_001144chr161105 ----11246
NM_001149chr103403 317 202 ------
NM_001151chr4247 31 --1196 --
NM_001156chr10171 --1449 1193
NM_001160chr1232698 2145 514 --12729 --
NM_001167chrX86634 6328 5420 5396 5291 4734 2328 1449 26448 4916 11653 15143
NM_001172chr142566 118 ------
NM_001173chr1484039 1605 631 355 324 248 158 118 11866 21728 434 23857 1751
NM_001174chrX72057 1999 1932 1820 1504 205 81 ----11633
NM_001177chr125907 874 590 98 37 2807 613 ----
NM_001178chr113354 159 62 ------
NM_001186chr2171057 1046 677 588 513 354 168 --23211 2297 --
NM_001198chr682389 2260 1533 1471 492 414 243 94 ----22379 257
NM_001200chr2031169 714 178 --1452 --
NM_001204chr287438 6604 6549 6305 5771 4731 3025 2289 26881 4700 21506 1403 15710
NM_001206chr953014 2518 2127 893 157 ------
NM_001219chr762260 2064 1667 537 226 45 --12304 --
NM_001222chr1061830 1673 1445 1358 767 155 --21244 213 --
NM_001237chr421143 85 1333 ----
NM_001237chr421143 85 1333 ----
NM_001238chr192495 90 ------
NM_001241chr252429 2062 1967 560 343 12086 --1914
NM_001241chr252429 2062 1967 560 343 12086 --1914
NM_001254chr174888 225 137 76 ------
NM_001256chr1732597 2298 23 --1947 12438
NM_001257chr162144 89 ------
NM_001259chr7105794 5233 5177 4684 4563 1623 1561 1412 1271 369 14040 24524 4381 15743
NM_001278chr103817 163 131 ------
NM_001284chr52543 392 ------
NM_001304chr1763635 3179 3064 1011 923 72 --21477 569 --
NM_001310chr1253089 2120 711 200 128 12918 1519 1863
NM_001329chr1031581 420 336 1571 ----
NM_001331chr1172686 2638 2455 2315 1133 674 384 12560 ----
NM_001332chr521253 366 ------
NM_001338chr211498 11001 ----
NM_001351chr351440 478 411 252 24 --11644 --
NM_001358chr41131 ------
NM_001364chr1154549 4113 1224 748 557 ------
NM_001390chr1863254 2911 2756 2247 445 309 --33620 2381 1175 --
NM_001391chr1821175 391 ------
NM_001396chr2122204 680 ----12416
NM_001399chrX33210 749 569 13777 23663 225 --
NM_001401chr951420 1376 1136 1112 1000 1507 --11025
NM_001407chr351735 1190 1179 1157 1121 ------
NM_001412chrX23554 455 --23574 21 --
NM_001416chr17----1450 --
NM_001419chr1974823 4081 3876 3467 1492 609 261 --24649 4244 --
NM_001427chr752112 2041 1984 391 156 11556 11300 11585
NM_001429chr221975 --1800 --
NM_001430chr221560 108 ------
NM_001431chr621120 938 --1184 --
NM_001438chr143450 2635 2448 2438 12725 ----
NM_001440chr852776 2558 1962 1093 264 --1317 --
NM_001448chrX31725 1713 1340 1719 11695 --
NM_001449chrX1141 --31261 1151 268 --
NM_001452chr63685 576 473 ------
NM_001453chr621485 1268 11287 ----
NM_001455chr643302 1934 785 115 21139 577 ----
NM_001458chr71649 ------
NM_001465chr542053 2014 207 142 ------
NM_001482chr153841 815 381 ------
NM_001483chr71725 2888 28 11050 1152
NM_001491chr622529 916 1133 22581 251 --
NM_001498chr621170 987 --21271 467 1969
NM_001527chr6144774 4739 4129 3758 3739 3666 3269 1649 1290 1189 966 780 612 544 11459 34681 3364 786 --
NM_001530chr1431147 745 398 --2155 77 1421
NM_001546chr631120 557 489 1502 21457 435 1213
NM_001553chr43190 169 54 --126 --
NM_001557chr251304 1120 1011 984 284 ----1307
NM_001584chr114784 88 71 40 --11202 --
NM_001587chrX52070 1487 817 556 265 --22217 1819 --
NM_001604chr112714 125 1941 ----
NM_001609chr1053905 3348 3131 3072 1505 1711 ----
NM_001616chr273421 2998 2407 1388 454 226 169 ------
NM_001621chr732765 1858 634 42990 2513 764 195 22485 251 12660
NM_001621chr732765 1858 634 42990 2513 764 195 22485 251 12660
NM_001634chr651429 727 627 286 275 --1445 --
NM_001650chr1843582 3121 3072 159 --1951 --
NM_001655chr1151898 1741 813 780 87 ------
NM_001656chr511994 22042 499 ----
NM_001677chr131056 939 125 --2139 117 --
NM_001679chr31130 --1535 --
NM_001682chr1272783 2290 2253 2023 1852 453 32 1888 ----
NM_001683chr342616 2239 1988 806 12139 1627 --
NM_001689chr22714 376 --21905 1304 1309
NM_001690chr351940 1906 1897 394 348 ----11620
NM_001701chr931500 1383 1341 41595 1447 366 168 1234 --
NM_001704chr61445 ----1617
NM_001706chr361020 763 721 714 327 73 ------
NM_001709chr1142087 443 148 112 --2404 218 --
NM_001714chr122454 440 ------
NM_001718chr631078 437 53 ------
NM_001723chr61636 2179 84 ----
NM_001726chr11148 ------
NM_001730chr1321475 533 11173 ----
NM_001730chr1321475 533 11173 ----
NM_001731chr122926 344 --2896 298 --
NM_001740chr161532 ------
NM_001742chr761607 1484 648 582 524 514 11447 ----
NM_001744chr52478 437 ------
NM_001745chr531133 448 90 --156 --
NM_001746chr532856 2260 1826 22736 981 12140 12662
NM_001748chr11288 ------
NM_001750chr541911 1829 1392 354 --32062 669 33 --
NM_001752chr114603 596 543 136 ------
NM_001753chr711827 11638 --11748
NM_001754chr2132660 1170 854 --23346 963 11293
NM_001755chr1682192 1899 1794 1429 637 581 543 230 --12176 185
NM_001759chr1285063 4852 4694 4583 4436 3950 1255 616 --1594 --
NM_001777chr363894 3816 3630 2679 1004 929 ------
NM_001788chr74863 772 319 228 --1932 --
NM_001792chr183834 389 215 ----1967
NM_001795chr1651527 1507 1062 1035 462 ----11542
NM_001797chr161122 ------
NM_001822chr25497 491 463 81 34 ------
NM_001825chr51120 ------
NM_001839chr13724 491 309 ------
NM_001855chr94593 309 227 124 1115 1834 --
NM_001858chr6115126 4951 4851 3928 3878 3351 1640 763 722 576 222 --1529 --
NM_001859chr953902 3247 3033 2524 166 --13871 --
NM_001881chr101480 1318 ----
NM_001884chr52495 373 ----1448
NM_001896chr16--1416 ----
NM_001901chr621041 225 ----1945
NM_001903chr51902 ------
NM_001918chr1169131 8842 8538 8419 8098 7728 7217 6842 6732 6328 6153 5776 3271 2310 1729 83 38783 2810 2354 17500 12665
NM_001920chr121666 ------
NM_001938chr131846 331 32 --21304 348 --
NM_001944chr1842305 2153 1990 878 --22297 884 --
NM_001950chr161688 1710 ----
NM_001954chr62782 733 ------
NM_001957chr442327 2240 549 180 1516 11608 1213
NM_001968chr44793 361 354 97 1305 ----
NM_001969chr1463836 2906 2806 2657 744 119 --1996 --
NM_001977chr431246 245 74 --1341 --
NM_001981chr131856 1686 64 11925 --22163 1599
NM_001987chr1254323 4036 3284 3011 1055 ------
NM_001992chr561493 1372 895 777 691 283 12045 1685 --
NM_001993chr15945 899 892 763 35 --11048 --
NM_002009chr1522645 177 12183 12586 --
NM_002015chr1333138 2915 2208 32177 1163 840 21242 526 --
NM_002017chr1121339 861 ----11271
NM_002024chrX42030 1860 1421 312 1702 ----
NM_002025chrX189088 8404 8396 8373 8303 8030 7888 7637 7154 7146 6259 6088 3563 3346 2407 1916 1699 935 32339 2132 377 27622 3374 --
NM_002031chr61274 ------
NM_002033chr11113681 3308 3087 1396 1180 1074 1048 928 833 781 703 13395 --1677
NM_002035chr1853870 3628 3065 1568 846 13613 --13100
NM_002040chr2122450 222 21218 1200 --23138 425
NM_002048chr921137 481 --1844 --
NM_002051chr101858 ------
NM_002055chr1721365 328 ------
NM_002063chrX41163 1143 856 147 --11247 --
NM_002069chr731913 1582 411 --1709 1257
NM_002074chr161728 1647 1542 1532 1348 1205 ------
NM_002082chr5124 ------
NM_002092chr444752 1762 1688 1429 --14074 --
NM_002114chr61479 ------
NM_002128chr1342308 711 603 36 21717 614 1822 --
NM_002130chr51105 ------
NM_002137chr772282 2255 1795 1766 849 690 643 --11612 --
NM_002146chr1721119 394 --1963 --
NM_002158chr252557 1383 1341 1069 44 1710 --13222
NM_002160chr9----1436 --
NM_002196chr20------11049
NM_002196chr20------11049
NM_002199chr45913 858 628 409 277 ------
NM_002203chr573183 2763 2709 1628 1114 989 685 11595 21446 277 --
NM_002210chr283564 2623 1051 931 854 664 494 25 --13324 --
NM_002211chr1041126 763 387 303 ----1747
NM_002214chr7165105 4953 4894 4554 4518 4325 3987 3875 3817 2237 2204 2093 1914 1033 678 308 14728 35252 5064 4421 14841
NM_002222chr331171 1155 92 1965 ----
NM_002223chr1233092 1309 577 11060 ----
NM_002224chr61724 ------
NM_002227chr141249 934 476 318 --21336 1288 --
NM_002228chr131165 1121 308 --2961 778 --
NM_002233chr11--1163 ----
NM_002240chr21----1121 --
NM_002242chr251987 1758 1730 1673 368 1137 2186 110 --
NM_002247chr1022333 116 42068 2056 2034 2010 22301 921 11966
NM_002264chr354258 3610 1942 414 271 13651 24903 940 --
NM_002268chr32735 138 --31698 345 258 --
NM_002270chr5125276 5003 3847 3569 1881 1618 1364 1090 1016 397 97 72 54636 4047 3987 1870 1310 45643 4161 3493 1232 14570
NM_002285chr274201 4119 3598 3400 1325 1249 839 --23960 1298 --
NM_002290chr631367 1089 196 21338 445 --1387
NM_002293chr162696 2473 2257 1820 281 82 --1481 --
NM_002296chr151415 1409 597 499 21 ------
NM_002310chr596628 5913 5042 4682 4460 2598 784 125 63 22137 1739 25018 4917 --
NM_002313chr1064677 4061 3148 1850 1454 1077 --25099 3347 --
NM_002317chr5--1261 ----
NM_002332chr122749 132 ------
NM_002336chr1274393 3834 3126 1673 1590 1236 976 13646 14224 34619 3752 1297
NM_002351chrX31626 240 35 ------
NM_002356chr62554 94 ------
NM_002358chr42449 69 --1105 --
NM_002374chr243412 3363 1121 325 --1218 12334
NM_002392chr121204 141 ----
NM_002395chr62568 236 11042 ----
NM_002397chr542155 2033 1842 689 --2650 332 11711
NM_002403chr12415 322 ------
NM_002408chr143826 803 782 ------
NM_002440chr11115 ------
NM_002444chrX41828 1530 1390 411 ------
NM_002445chr831455 1414 77 ------
NM_002448chr42761 221 ------
NM_002460chr643780 3251 2758 1383 --43315 2382 955 469 --
NM_002466chr20138 ------
NM_002469chr12189 --1511 --
NM_002480chr1251508 1393 1114 1008 286 --11099 --
NM_002481chr176121 5623 2906 1561 532 165 145 --57950 6687 5381 388 155 --
NM_002486chr912046 1328 ----
NM_002487chr152645 88 ------
NM_002493chr92259 50 ------
NM_002499chr1572238 1815 1707 944 340 298 236 ------
NM_002500chr241094 949 206 67 ------
NM_002508chr131992 1645 274 --11823 --
NM_002514chr82851 267 ------
NM_002515chr1441659 639 583 214 ------
NM_002518chr24931 854 313 233 1116 --21107 942
NM_002522chr1753958 3807 3433 3041 590 --2330 316 --
NM_002524chr11775 --11034 --
NM_002526chr651625 1449 547 105 38 ----21353 337
NM_002540chr93684 591 257 ------
NM_002544chr172323 92 ------
NM_002545chr11115127 4666 3567 3537 1561 1437 636 566 555 429 61 --13664 --
NM_002556chr1142008 2002 621 597 12102 ----
NM_002570chr1531256 1029 976 ------
NM_002577chr33696 569 42 ----2528 104
NM_002581chr9115498 5468 5005 4891 4873 4593 4008 3648 1829 1708 980 14321 45674 4277 1417 311 24938 4907
NM_002590chr131520 ------
NM_002594chr203982 974 590 32253 1857 412 11645 --
NM_002595chr122435 110 2742 542 1784 --
NM_002612chr73706 439 44 --31978 1822 1555 --
NM_002613chr16105242 5236 4728 4652 3906 3747 3654 1739 1608 1324 1585 11127 --
NM_002623chr20--1488 1278 1525
NM_002628chr321233 1158 ------
NM_002641chrX52015 1924 508 386 47 11275 1127 --
NM_002645chr1182752 2612 2600 1174 909 874 337 153 --11101 12364
NM_002648chr61133 ------
NM_002655chr8155151 4599 4534 4105 3881 3863 3824 3799 3656 3605 2069 2003 1720 1030 289 --14938 14143
NM_002656chr62974 157 21100 275 ----
NM_002657chr2093890 3881 3080 1308 935 861 749 662 584 --12995 --
NM_002660chr20----1425 --
NM_002667chr641250 1090 873 27 ------
NM_002670chr361444 1007 639 627 482 55 11020 11587 --
NM_002687chr1411007 ------
NM_002699chr1199 ------
NM_002706chr2----1521 --
NM_002709chr283630 2293 1039 898 664 566 482 249 --33538 3446 3021 --
NM_002710chr123968 935 870 ------
NM_002716chr1162638 1000 901 706 642 287 13599 1524 1389
NM_002718chr382678 2574 2038 1811 1076 309 255 122 --1590 --
NM_002726chr6----2351 336 --
NM_002731chr131118 358 265 12434 31995 1055 160 --
NM_002734chr172752 690 --42020 1703 1642 848 --
NM_002736chr72867 332 --21635 123 --
NM_002737chr1746592 6390 5017 1891 11534 11288 --
NM_002745chr2244313 4191 3004 1049 --24037 343 23627 1803
NM_002748chr154912 793 326 298 --1160 --
NM_002763chr12517 401 ------
NM_002786chr112235 76 ------
NM_002821chr62833 800 1620 ----
NM_002822chr1261801 1720 1600 1329 621 503 11147 ----
NM_002828chr185702 140 74 52 30 1679 1394 --
NM_002833chr1521518 601 1438 --11623
NM_002835chr71786 1179 ----
NM_002837chr1284028 3753 3694 1817 1624 1584 804 448 11182 --24593 287
NM_002839chr9113533 3493 3361 3152 3045 3011 2297 1378 771 739 251 1611 ----
NM_002841chr33507 230 110 ------
NM_002844chr61198 --31175 354 122 1479
NM_002851chr71224 ------
NM_002863chr14156 ------
NM_002868chr1222037 831 --1479 --
NM_002873chr51395 ----1478
NM_002874chr932262 1682 398 --21527 706 --
NM_002882chr221102 ------
NM_002886chr365038 3781 3689 2065 1040 862 ------
NM_002892chr1431578 1501 669 ------
NM_002893chrX2328 43 ------
NM_002897chr22172 31 ------
NM_002898chr123677 420 236 --1174 --
NM_002902chr152527 91 ------
NM_002906chr1132368 2077 807 --11659 --
NM_002907chr121309 --1121 --
NM_002927chr11506 --3664 632 564 --
NM_002945chr172827 788 --1572 --
NM_002953chr11275 ------
NM_002956chr1251241 1221 1011 382 268 ------
NM_002958chr31695 ------
NM_002959chr144210 3422 3168 195 11372 23040 356 --
NM_002968chr161999 --1355 --
NM_002971chr341049 1030 840 188 ------
NM_002977chr263358 2688 2108 1121 636 27 12124 42184 561 534 298 23346 855
NM_003010chr172877 546 1928 ----
NM_003013chr42621 563 --1847 --
NM_003014chr741187 600 518 381 ------
NM_003017chr61225 ------
NM_003020chr15--1104 ----
NM_003024chr211804 --1366 --
NM_003026chr92855 261 11064 ----
NM_003029chr141323 1113 1074 969 ------
NM_003030chr311753 ------
NM_003036chr11284 ------
NM_003042chr322198 673 ----12059
NM_003043chr342845 1408 486 75 ----1325
NM_003051chr131963 510 438 1576 ----
NM_003068chr831018 952 940 1230 1339 --
NM_003069chrX3798 748 290 1615 ----
NM_003070chr91118 --1104 1678
NM_003071chr351953 1772 1504 793 560 ----1158
NM_003074chr332049 293 250 1386 --21558 1539
NM_003076chr1221382 427 ----1251
NM_003077chr171323 ------
NM_003079chr172862 642 ------
NM_003092chr20142 ------
NM_003094chr121208 194 --31153 1037 159 --
NM_003100chr53329 313 115 1100 ----
NM_003108chr2107297 6363 6075 5738 5593 5490 5380 2147 809 487 --24839 1710 11463
NM_003111chr221214 1050 1474 ----
NM_003112chr782902 2044 1259 1134 1026 602 416 44 --12411 23160 2614
NM_003114chr83704 164 115 2661 146 ----
NM_003131chr631516 744 77 ------
NM_003137chr651536 1461 722 562 476 --11824 11862
NM_003142chr21294 ------
NM_003144chr641764 1612 1495 168 11863 11523 --
NM_003149chr311184 ------
NM_003155chr852677 2370 2355 612 177 ----12345
NM_003161chr1751355 1215 1084 884 860 1116 12526 22313 1344
NM_003178chr311491 --41877 1474 729 504 --
NM_003184chr82802 384 --1839 --
NM_003185chr203967 381 98 --1325 --
NM_003199chr1845106 2131 1723 452 --24664 1955 --
NM_003201chr101709 --1671 --
NM_003206chr61142 ------
NM_003211chr1241754 1532 514 245 1343 11403 --
NM_003221chr684061 3610 2913 1323 1302 1256 1122 1060 --11200 24197 842
NM_003223chr162746 94 ------
NM_003234chr322325 2081 ------
NM_003242chr32344 251 12399 11590 32463 354 336
NM_003246chr1521645 519 11510 12018 --
NM_003247chr642037 1438 470 279 ----1319
NM_003253chr2151663 1645 1606 746 296 ------
NM_003255chr1751044 956 720 483 466 --32417 1988 1059 --
NM_003257chr1561352 1185 1170 1096 509 191 ------
NM_003262chr385239 4974 4895 4835 3438 884 742 227 --21009 290 --
NM_003269chr631316 1129 431 ------
NM_003274chr2142665 2302 2064 1139 22792 1928 22776 822 --
NM_003286chr201377 --1404 --
NM_003298chr3105957 5837 5719 5703 5391 4832 4302 1434 1095 770 ------
NM_003299chr12----153 --
NM_003304chr331463 1048 56 --21498 619 --
NM_003309chr661634 1605 1531 545 298 119 --1394 --
NM_003337chr551278 1064 509 393 104 1207 ----
NM_003338chr1071802 1787 1737 1219 784 602 278 --3458 332 257 --
NM_003339chr571584 1172 1022 529 478 244 28 --1621 11329
NM_003340chr42468 29 --11365 --
NM_003341chr33219 110 24 --1665 --
NM_003342chr1733266 2430 1002 22519 2501 12608 --
NM_003344chr7----11237 11727
NM_003345chr16159 ------
NM_003347chr2231505 303 139 ------
NM_003348chr1211659 ------
NM_003350chr81269 ------
NM_003368chr14660 565 285 67 ------
NM_003369chr1122248 506 12657 1946 --
NM_003373chr1031905 1784 1559 --11287 --
NM_003376chr6--11555 --21692 1548
NM_003376chr6--11555 --21692 1548
NM_003379chr61759 1777 1449 --
NM_003385chr2155 1359 --1663
NM_003387chr232438 1803 696 164 22934 562 --
NM_003392chr364075 3871 3650 3015 1499 565 12701 22664 545 --
NM_003399chrX1793 ------
NM_003400chr23754 606 32 --2883 820 --
NM_003406chr821799 41 1345 1134 --
NM_003409chr182944 330 ------
NM_003410chrX72844 2534 973 952 783 460 258 12598 1645 1910
NM_003411chrY2481 247 --41247 608 496 145 1288
NM_003413chrX81717 1419 767 547 267 233 222 116 11253 11828 11312
NM_003423chr1962550 1857 1644 1021 557 108 --291 54 --
NM_003430chr1941607 541 484 289 --11089 --
NM_003442chr111606 --1285 --
NM_003453chr13----3699 521 263 --
NM_003454chr1611377 --11436 --
NM_003457chr17----1153 --
NM_003463chr652696 2611 2503 705 478 --43121 3039 656 509 --
NM_003471chr351528 938 886 861 28 ------
NM_003473chr104985 349 284 159 --1758 --
NM_003474chr1042168 1909 1775 1629 11509 ----
NM_003478chr1173205 3138 3132 3110 3000 2047 146 23231 105 12749 --
NM_003482chr1222480 2444 ------
NM_003483chr1252903 2717 1989 382 184 12683 --11814
NM_003489chr2183299 2976 2733 2637 2220 1014 754 512 22101 384 11059 --
NM_003505chr721580 1548 --21952 1813 --
NM_003506chr83927 498 86 ------
NM_003528chr131741 1454 1382 --1712 --
NM_003557chr121408 1200 11178 11354 --
NM_003566chr1212768 --12324 1957
NM_003569chr62467 31 ----1660
NM_003576chr1362748 2382 2142 2024 2006 580 ----1954
NM_003581chr22889 867 1850 1963 --
NM_003583chr1253252 3029 2909 1565 315 --23084 1409 --
NM_003589chr1321469 387 ----11091
NM_003590chr283676 3668 3065 2896 2810 924 221 191 --33494 1626 1611 13620
NM_003591chr101128 --1396 --
NM_003592chr7----2495 156 --
NM_003597chr241959 1939 316 299 --12327 --
NM_003607chr153820 3534 3420 3238 1479 13167 ----
NM_003615chr383855 3734 3164 2604 2462 1425 1012 435 170 23936 1182 12735
NM_003617chr163358 1458 1150 1079 913 59 --11920 177
NM_003622chr1222620 357 ------
NM_003626chr113499 71 33 --11026 --
NM_003629chr153362 2492 2285 2239 45 ----184
NM_003630chr61599 2690 638 ----
NM_003632chr17------1851
NM_003646chr111569 ------
NM_003654chr113303 288 176 ------
NM_003659chr2191 --2220 161 --
NM_003663chr31927 32715 2391 1085 12829 --
NM_003672chr131799 404 325 11813 1311 --
NM_003679chr153165 2959 2794 2300 207 33241 2187 1129 32451 1330 1014 --
NM_003692chr91370 ------
NM_003701chr133405 285 167 ------
NM_003713chr111481 --11524 --
NM_003716chr31209 --1202 --
NM_003718chr72441 396 ------
NM_003722chr342710 2043 531 473 1334 ----
NM_003728chr41487 ------
NM_003743chr252247 2221 2103 1509 96 --21619 1469 --
NM_003744chr142959 522 --1314 --
NM_003749chr1322075 891 12187 12058 --
NM_003759chr464213 3434 1572 1564 1011 137 ------
NM_003763chr2042191 951 720 310 1905 12973 1490
NM_003766chr172194 105 ------
NM_003768chr141834 1653 372 362 11261 1174 --
NM_003774chr1242638 2500 2285 1295 23097 435 22783 651 --
NM_003778chr31742 ----1752
NM_003783chr1173 ----1308
NM_003794chr32774 385 1700 ----
NM_003796chr194545 414 82 66 --128 --
NM_003797chr11----2154 145 --
NM_003799chr1894084 3193 3059 1339 1289 1254 1110 1000 347 ------
NM_003800chr652355 2128 1751 539 484 --11550 --
NM_003806chr12------2275 263
NM_003816chr841396 1277 525 206 --1955 --
NM_003822chr133027 2747 2596 --11132 --
NM_003829chr921130 302 --11163 --
NM_003831chr1851695 1635 1597 372 357 1664 21500 706 --
NM_003848chr32990 338 1368 ----
NM_003858chr14----1608 --
NM_003861chr1422657 996 --21943 430 --
NM_003870chr1521766 314 ------
NM_003872chr262525 2447 2428 2359 487 63 ------
NM_003873chr1042540 2377 2285 783 ------
NM_003884chr32718 72 11150 31815 1693 1380 --
NM_003887chr271846 1698 1580 698 530 342 290 11744 1591 1157
NM_003895chr2121560 524 --12070 1516
NM_003901chr1032557 2407 898 1213 12583 1407
NM_003908chr2021355 330 --11389 --
NM_003909chr892966 2662 2312 2290 1203 1126 1095 555 494 --43037 2384 815 221 22816 79
NM_003913chr663791 3407 3151 3101 1215 630 --14092 --
NM_003916chrX21478 938 1531 11058 --
NM_003919chr7156 ------
NM_003922chr15--187 1376 --
NM_003927chr1831098 974 755 ------
NM_003930chr752560 2290 2008 1690 37 ------
NM_003931chr61184 1654 ----
NM_003934chr921286 127 --176 11295
NM_003941chr752387 408 287 222 189 1472 1822 1559
NM_003953chr132166 607 280 ----1231
NM_003955chr1721432 1239 ------
NM_003958chr673836 3748 3191 3065 2864 2785 257 --33949 2672 853 11568
NM_003961chr161211 ------
NM_003966chr5177419 7224 7186 6748 6674 5673 5104 4855 4735 3044 3018 3000 2916 2807 1750 1266 713 --47068 6740 6332 1883 --
NM_003972chr1031291 421 43 --2931 223 --
NM_003983chr1673996 2841 1470 1174 1140 887 558 ------
NM_003994chr1284375 3941 3350 1757 1477 423 323 214 --34072 3123 1138 --
NM_004006chrX102595 2373 2103 897 740 691 306 265 164 96 --32210 684 180 --
NM_004007chrX102595 2373 2103 897 740 691 306 265 164 96 --32210 684 180 --
NM_004009chrX102595 2373 2103 897 740 691 306 265 164 96 --32210 684 180 --
NM_004010chrX102595 2373 2103 897 740 691 306 265 164 96 --32210 684 180 --
NM_004011chrX102595 2373 2103 897 740 691 306 265 164 96 --32210 684 180 --
NM_004012chrX102595 2373 2103 897 740 691 306 265 164 96 --32210 684 180 --
NM_004013chrX102595 2373 2103 897 740 691 306 265 164 96 --32210 684 180 --
NM_004014chrX102595 2373 2103 897 740 691 306 265 164 96 --32210 684 180 --
NM_004015chrX102595 2373 2103 897 740 691 306 265 164 96 --32210 684 180 --
NM_004016chrX92509 2287 2017 811 654 605 220 179 78 --32124 598 94 --
NM_004017chrX102595 2373 2103 897 740 691 306 265 164 96 --32210 684 180 --
NM_004018chrX92509 2287 2017 811 654 605 220 179 78 --32124 598 94 --
NM_004020chrX102595 2373 2103 897 740 691 306 265 164 96 --32210 684 180 --
NM_004021chrX92509 2287 2017 811 654 605 220 179 78 --32124 598 94 --
NM_004022chrX92509 2287 2017 811 654 605 220 179 78 --32124 598 94 --
NM_004023chrX92509 2287 2017 811 654 605 220 179 78 --32124 598 94 --
NM_004027chr2--132 ----
NM_004028chr1843582 3121 3072 159 --1951 --
NM_004034chr10171 --1449 1193
NM_004040chr221328 1169 ----11317
NM_004050chr1422656 729 21893 337 12671 --
NM_004067chr721013 978 --11173 --
NM_004087chr341427 767 166 128 ----12048
NM_004089chrX1105 1972 ----
NM_004093chr1352515 2278 1274 526 305 13036 22301 561 --
NM_004094chr1442490 2432 803 542 --1944 1376
NM_004098chr1011194 11254 ----
NM_004100chr662240 1984 1657 1006 209 83 --11785 --
NM_004113chr341730 1594 490 137 ------
NM_004124chr143835 299 268 12359 12225 12370
NM_004134chr52633 239 ----1119
NM_004136chr1543063 2011 1222 914 32805 2534 1119 --12035
NM_004170chr961587 1575 1470 1341 545 250 1661 1141 --
NM_004171chr11149382 9011 8949 8719 8496 7632 6877 6716 6552 6082 6062 3055 2253 641 37888 7764 7185 --12424
NM_004172chr51614 --12062 11987
NM_004180chr21626 1149 ----
NM_004186chr32321 102 --196 --
NM_004187chrX--11322 --11150
NM_004202chrY3690 657 38 ------
NM_004207chr17170 ------
NM_004209chr1641175 1086 1038 341 ----1913
NM_004225chr831054 215 83 --21279 539 --
NM_004229chrX72229 1876 1783 1456 1408 895 459 --11753 --
NM_004232chr1873715 3243 2429 1404 706 571 64 --23639 3590 1477
NM_004235chr9--1549 1571 1742
NM_004241chr101319 2757 222 1793 --
NM_004267chr32519 358 ------
NM_004272chr511439 11763 21610 74 --
NM_004274chr1432621 358 133 --12563 12513
NM_004279chr75673 657 622 585 253 ------
NM_004281chr101499 --1180 --
NM_004288chr231009 771 387 ------
NM_004294chr132547 49 1720 ----
NM_004329chr1041035 911 268 119 --1949 --
NM_004330chr151929 --21179 62 --
NM_004331chr852657 2357 2347 1793 843 --1870 1119
NM_004337chr872132 1940 1475 603 486 433 338 --21972 1610 --
NM_004342chr781840 1818 1626 1533 825 585 412 156 11975 ----
NM_004354chr42855 34 --1847 --
NM_004362chr4187 1219 1610 --
NM_004380chr1642590 1933 589 496 --12422 --
NM_004384chr561888 1546 1520 938 156 37 11803 1503 --
NM_004392chr1341900 1628 522 149 12005 22549 2378 12471
NM_004397chr1153408 2904 1733 1391 852 1878 13968 --
NM_004404chr232026 1672 559 ------
NM_004424chr161150 ------
NM_004430chr832216 1806 397 11055 12333 --
NM_004432chr952258 2186 1572 1500 559 11793 2488 437 1319
NM_004433chr111354 1489 ----
NM_004434chr1451755 1498 1444 1402 525 --1248 --
NM_004438chr272384 2086 1182 1106 817 720 135 ------
NM_004440chr611657 11713 ----
NM_004454chr322194 1854 --1354 1384
NM_004458chrX22430 981 12171 ----
NM_004459chr1731386 1367 726 21814 482 21876 1848 --
NM_004464chr4123576 3546 3450 2966 2878 2714 2661 1403 1382 1343 320 52 34218 3196 303 43849 636 563 446 --
NM_004469chrX1107 ------
NM_004481chr11566 1613 22310 967 --
NM_004482chr23326 248 167 ------
NM_004492chr152165 25 ------
NM_004496chr1421202 438 ------
NM_004499chr51467 ------
NM_004500chr1421967 732 11988 12053 --
NM_004501chr133570 3279 1341 14059 3817 733 254 11174
NM_004503chr123584 299 244 ------
NM_004504chr262687 1088 917 785 128 50 --12538 1567
NM_004505chr1741810 1686 788 750 ------
NM_004506chr61290 1192 124 --
NM_004515chr11241 --172 --
NM_004519chr81218 1225 ----
NM_004520chr54531 231 165 134 ------
NM_004521chr101249 ------
NM_004523chr1021512 1149 1630 21596 1171 --
NM_004525chr271282 1150 496 464 201 177 58 ------
NM_004529chr9--1396 ----
NM_004537chr1211054 11417 175 --
NM_004563chr141163 ------
NM_004571chr2182739 2528 2133 1248 877 838 642 54 1552 12766 --
NM_004580chr1551211 714 574 384 370 11372 --11671
NM_004586chrX54484 4212 4040 3707 1981 35204 2023 887 21313 1042 --
NM_004593chr33789 241 117 --1170 --
NM_004600chr11532 ------
NM_004607chr52198 53 ------
NM_004612chr9134602 4520 4335 3957 1758 1596 1585 1526 1476 1385 1130 614 472 11868 ----
NM_004642chr12138 ------
NM_004650chrX1549 11870 ----
NM_004654chrY41258 449 352 316 ------
NM_004657chr241098 1055 501 478 ----11179
NM_004660chrY52310 2141 1507 264 73 --1510 --
NM_004666chr631330 1231 198 11187 1480 --
NM_004703chr1732148 1582 187 1668 --22327 729
NM_004709chrX1302 11364 --1374
NM_004713chr141126 --2546 255 --
NM_004719chr1252526 2344 2132 166 40 --11891 --
NM_004726chrX115635 4817 4730 3859 2299 1802 827 654 550 349 255 ------
NM_004730chr532133 2124 443 --21875 464 --
NM_004734chr1372782 2665 2323 2206 995 945 406 11268 21089 727 --
NM_004736chr12286 45 ------
NM_004737chr2231317 888 201 --11238 --
NM_004741chr1021033 136 --11547 --
NM_004742chr321812 114 1295 --1704
NM_004745chr8136298 5042 4715 4423 2453 2350 2024 1927 1596 1576 884 697 334 12590 36965 4412 1090 --
NM_004747chr1031408 1220 322 ------
NM_004748chr1574252 3458 2907 1595 1582 1249 654 ----11216
NM_004765chr16151 ------
NM_004768chr151167 352 285 276 37 --2765 157 --
NM_004772chr531075 231 141 127 31465 1149 451 --
NM_004773chr171390 ------
NM_004775chr1842135 1641 291 136 32413 2035 151 1475 11685
NM_004776chr2043285 3173 1165 85 ------
NM_004781chr131700 212 70 --1570 --
NM_004781chr131700 212 70 --1570 --
NM_004788chr1132465 1989 739 --12543 --
NM_004795chr1341853 1592 1565 344 21635 1385 --11649
NM_004796chr1411595 ----21584 725
NM_004798chr2043591 3023 2280 884 --32664 867 364 11230
NM_004808chr1063331 2870 2548 2495 473 386 ----23283 2397
NM_004814chr11396 155 1359 --
NM_004815chr124242 3590 23264 1602 44911 4273 3172 630 1568
NM_004824chr611082 11404 ----
NM_004834chr253292 3135 2876 1282 910 12954 ----
NM_004840chrX72309 2299 2123 2049 1749 642 367 ------
NM_004841chr13815 724 84 ------
NM_004842chr641756 1747 1618 574 --11297 --
NM_004850chr231103 416 99 ------
NM_004855chr151170 ------
NM_004857chr1453950 3006 1807 499 429 34627 4617 4284 33239 1436 1061 23655 1844
NM_004863chr1454827 4085 3566 3468 2109 15279 1948 11201
NM_004865chr6----1365 --
NM_004866chr5134915 4655 4043 3525 3454 3213 1858 1557 1194 859 698 217 65 --11597 --
NM_004867chrX5702 677 500 216 48 ------
NM_004871chr1754105 2924 2813 2711 1115 --1371 --
NM_004873chr1442852 2578 2205 990 1357 42752 2693 596 578 13103
NM_004874chr81508 ------
NM_004896chr1021284 514 --21393 406 1350
NM_004897chr103248 52 38 ------
NM_004898chr462884 2851 2084 1999 704 609 ----12419
NM_004904chr785756 5713 4941 4820 4765 2589 1910 1100 11062 16521 --
NM_004921chr131928 1648 103 1583 21971 1807 --
NM_004926chr1451371 730 404 357 102 ------
NM_004927chr1111474 ------
NM_004929chr841349 1292 1055 159 1109 11010 --
NM_004932chr511694 21182 458 --11123
NM_004938chr921205 365 ------
NM_004952chr1----1631 1640
NM_004956chr783177 3089 2930 1687 1362 463 319 50 --13499 13475
NM_004972chr92422 39 184 ----
NM_004973chr631668 1284 1212 ------
NM_004985chr1274076 3160 2764 1630 1315 768 605 23534 3421 23894 774 22969 1658
NM_004987chr22113 82 --1331 --
NM_004993chr1421209 1021 ------
NM_004996chr162674 43 ----11776
NM_004999chr684318 4153 3433 3375 3119 402 295 106 11513 --11038
NM_005006chr23812 735 69 ------
NM_005010chr742024 1569 1423 285 21587 403 21892 686 11742
NM_005011chr731677 208 52 ----21657 345
NM_005023chr51351 1557 ----
NM_005025chr3184 ------
NM_005028chr1072206 2093 2070 1530 1470 779 166 --2942 124 --
NM_005032chrX1936 ----11107
NM_005037chr31162 ------
NM_005050chr142992 443 11079 1758 --
NM_005056chr1275528 4574 4453 1427 500 414 132 14443 24649 1012 --
NM_005063chr1032993 2944 1244 12728 13623 --
NM_005065chr1474616 4214 3337 1798 1559 1380 1108 ------
NM_005066chr1----1831 --
NM_005079chr873192 2790 2724 760 658 360 314 ----1118
NM_005086chr1231574 738 281 1327 ----
NM_005087chr33750 554 23 --299 35 --
NM_005097chr10139 --1345 --
NM_005105chr11784 1637 2493 162 --
NM_005116chr2054309 1823 1379 885 294 14345 2102 96 --
NM_005117chr112950 74 ------
NM_005119chr131229 1222 868 ------
NM_005121chr1771412 1141 1024 969 822 718 431 ------
NM_005126chr31192 --22265 1892 12155
NM_005135chr1593062 2877 2430 1471 1194 825 508 180 48 --13877 23817 3442
NM_005141chr42364 149 ------
NM_005151chr1832381 2032 62 1208 ----
NM_005153chr16------1611
NM_005154chr152665 658 1141 ----
NM_005156chr993936 3615 2007 1693 1115 883 577 284 218 14158 11310 --
NM_005157chr931779 1773 171 --11987 --
NM_005164chr1231730 904 67 --31668 918 817 11920
NM_005168chr231496 1278 406 ------
NM_005171chr122942 835 --11240 --
NM_005180chr1071465 1261 1194 590 353 302 155 --11402 11526
NM_005188chr11117737 7222 7075 6642 5763 3286 2173 1720 1295 838 263 35960 2226 883 11923 27838 3113
NM_005190chr62853 396 ------
NM_005191chr331436 1281 516 ------
NM_005197chr1476083 5764 4881 4601 4194 1622 248 24706 4678 ----
NM_005204chr10168 --1922 --
NM_005206chr1731139 933 198 --11101 --
NM_005214chr23829 446 345 ------
NM_005224chr19--1687 --2679 671
NM_005233chr352624 2349 2313 2211 502 1801 --12399
NM_005235chr2117832 7435 7141 6770 6192 5306 5045 2677 1598 496 416 --67668 2831 2618 873 731 228 15860
NM_005238chr1153107 2992 2165 1051 840 12897 --13083
NM_005244chr201620 --1705 --
NM_005245chr41594 --1229 1661
NM_005249chr142343 36 ------
NM_005254chr1521296 227 --1563 --
NM_005259chr241499 1019 367 248 1263 21419 1185 --
NM_005261chr811022 --169 --
NM_005264chr102817 613 --1882 --
NM_005277chr441502 1431 475 207 --11704 --
NM_005281chr11269 ------
NM_005284chr6------1182
NM_005302chr71145 ------
NM_005308chr10----1364 --
NM_005318chr2211053 ------
NM_005327chr42501 244 ------
NM_005339chr463868 3337 3310 3154 984 843 23758 1653 11201 33552 1307 80
NM_005342chrX4847 734 535 399 --1170 --
NM_005348chr143889 382 40 ------
NM_005358chr1321821 69 1143 --11452
NM_005359chr1861808 1578 1555 906 354 327 15455 ----
NM_005370chr19----11278 --
NM_005376chr141126 985 845 741 ------
NM_005385chr322099 208 1436 22523 145 --
NM_005399chr163963 3626 3439 1755 984 807 1320 23378 490 --
NM_005402chr721191 225 --11534 --
NM_005406chr181619 ------
NM_005433chr1821043 66 --1101 --
NM_005436chr1073985 3704 3370 572 557 386 181 --13652 13945
NM_005443chr41410 --1444 --
NM_005455chr141734 1498 715 329 --21641 122 --
NM_005475chr1293293 2779 1267 914 903 737 704 380 217 ----22954 2279
NM_005483chr19------1134
NM_005493chr64862 809 691 143 --1127 --
NM_005497chr1775795 5440 4831 4529 4031 3990 1580 --25764 231 --
NM_005502chr973309 2637 2464 2363 2101 936 753 --12417 --
NM_005509chr52188 37 --21865 313 --
NM_005511chr93894 860 441 ------
NM_005522chr74458 451 366 95 ------
NM_005524chr31266 ------
NM_005526chr82372 289 ------
NM_005530chr152563 291 175 124 --
NM_005542chr731592 1506 251 --31734 1283 590 --
NM_005566chr112459 180 ----1500
NM_005578chr3104464 4194 4085 3349 3204 1582 1499 1204 1150 625 31536 1164 573 23541 271 --
NM_005584chr13----1623 --
NM_005587chr152918 216 3852 173 55 1766 1126
NM_005595chr11661 ------
NM_005596chr9116098 5793 5764 4802 4769 4680 4069 1574 1243 1176 361 --45160 4729 1186 817 --
NM_005599chr131338 1192 341 ------
NM_005602chr3----1907 --
NM_005604chr612166 --12436 12567
NM_005610chr11297 --1946 1108
NM_005611chr1631262 1237 1091 ------
NM_005618chr61546 ------
NM_005625chr861107 833 384 207 129 108 ------
NM_005644chr12142 100 ------
NM_005647chrX32825 1225 956 --1149 --
NM_005664chr153925 887 435 ----1134
NM_005665chr1104402 4196 3052 1492 1450 1403 633 442 298 151 --24759 304 1901
NM_005667chr22354 288 ------
NM_005668chr564449 4108 3832 3311 1151 261 23985 1305 11741 13585
NM_005685chr72121 115 ------
NM_005688chr331073 331 302 ----1309
NM_005711chr52772 377 2998 915 ----
NM_005715chr622195 1729 ----12552
NM_005717chr111238 1152 21182 275 --
NM_005722chr242394 2348 1682 660 1210 12289 1393
NM_005725chr122243 1723 12230 --12473
NM_005737chr221857 160 ----12164
NM_005738chr751306 1272 718 344 74 --11253 --
NM_005739chr1572059 1935 1631 1612 787 379 85 --12197 --
NM_005742chr2181 --1574 --
NM_005746chr731718 927 486 --22656 633 --
NM_005748chr1241168 1064 834 209 --13048 1125
NM_005749chr172697 643 1597 ----
NM_005751chr71370 ------
NM_005756chrX41297 1238 1092 65 --1445 --
NM_005759chr242916 727 717 508 --33595 1880 555 --
NM_005760chr2139 ------
NM_005765chrX4788 625 595 578 --199 --
NM_005779chr553514 1210 1014 351 185 ------
NM_005786chr1841114 846 835 801 1933 ----
NM_005788chr113808 793 302 --2292 276 --
NM_005789chr17168 ------
NM_005792chr162224 83 --1470 --
NM_005807chr13699 476 186 --1689 --
NM_005808chr373511 3393 3213 3138 2900 708 442 --52467 2443 2437 2431 2425 12450
NM_005813chr272606 2371 2167 1932 881 665 88 32296 2154 397 ----
NM_005832chr321394 1337 --31280 1038 153 --
NM_005836chr8150 ------
NM_005838chr113117 66 22 ------
NM_005839chr1--2940 749 1155 --
NM_005840chrX106984 6172 2817 2759 2372 1835 1630 1200 1106 214 --1651 12923
NM_005843chr251841 1561 1246 663 145 --31642 1626 1479 31371 1282 270
NM_005845chr1321603 359 --11618 --
NM_005853chr161417 ------
NM_005859chr551578 1478 1372 1309 552 1586 ----
NM_005863chr102441 331 --2581 475 --
NM_005880chr1631534 521 150 1400 21319 186 --
NM_005885chr511121 --137 --
NM_005896chr24208 146 138 51 --160 --
NM_005898chr1152747 2050 467 367 286 12003 23001 201 --
NM_005899chr1731350 1147 1047 ------
NM_005900chr43972 912 847 --1213 --
NM_005901chr18198564 8327 8035 6765 6162 3286 3109 2724 2615 2150 2116 1685 1620 1448 1266 1166 1064 1036 163 --27948 6204 --
NM_005902chr1573956 3498 1697 1228 1153 1139 932 ------
NM_005903chr565168 3811 1410 1050 979 86 34425 3236 649 2601 162 24174 122
NM_005907chr631493 1322 444 11336 ----
NM_005908chr41558 ------
NM_005909chr5104157 4123 4020 3909 3565 3194 3112 1427 1303 861 23388 1700 1518 1552
NM_005910chr1744112 3852 2977 740 ----14081
NM_005911chr2----11374 --
NM_005920chr163867 3803 2949 1256 374 135 --13381 13390
NM_005922chr6------162
NM_005924chr72160 74 ------
NM_005935chr485173 3768 3541 3393 1517 1077 990 772 24602 4400 ----
NM_005941chr884063 2922 2845 2573 1173 976 676 260 22756 1183 13330 --
NM_005955chr184688 4316 4160 2168 1392 925 670 602 --25026 1610 --
NM_005962chr1051893 1859 675 579 349 ----11720
NM_005962chr1051893 1859 675 579 349 ----11720
NM_005966chr251605 1537 880 646 208 ------
NM_005977chr132897 291 --1764 --
NM_005985chr20----1714 --
NM_005999chr1------1102
NM_006005chr41311 ------
NM_006007chr973244 2818 1456 1093 1085 760 237 22800 1579 73347 1570 954 782 705 315 112 --
NM_006009chr12132 ------
NM_006011chr1573932 3460 3117 2915 1268 1151 151 1159 11145 --
NM_006015chr121307 314 1273 --11202
NM_006016chr622022 553 --42323 1541 522 210 --
NM_006022chr1331032 790 373 ----2983 777
NM_006036chr252562 1778 593 400 320 21845 1786 22460 154 --
NM_006037chr264537 4294 3051 1734 557 507 --11590 --
NM_006038chr2021471 35 --12154 --
NM_006047chr2053411 3137 2908 2811 154 --12224 --
NM_006080chr772753 2289 1154 798 393 348 111 11075 11860 --
NM_006089chrX51893 1786 1581 420 305 ----11877
NM_006095chr4114318 3876 3846 3571 3486 3359 1705 1379 1303 1220 655 1935 44168 2968 1491 623 11764
NM_006106chr1133415 2774 1102 23404 2194 23025 2817 --
NM_006107chr171412 ------
NM_006113chr141965 1340 849 102 ------
NM_006114chr191473 ------
NM_006135chr121192 209 --21184 215 --
NM_006136chr7--1973 1520 --
NM_006139chr222632 761 ----12895
NM_006141chr1622358 185 ------
NM_006145chr19----1727 --
NM_006153chr31638 --1114 2408 187
NM_006154chr155967 949 916 592 196 1756 ----
NM_006155chr232026 1672 559 ------
NM_006158chr851466 1226 676 288 261 --11242 --
NM_006166chr1242406 2151 722 648 11923 21747 1665 --
NM_006167chr82647 334 --22330 1977 --
NM_006180chr911732 --1332 1350
NM_006182chr1----1192 --
NM_006183chr122140 109 --123 --
NM_006194chr142890 321 1161 11229 --
NM_006195chr9296 30 --1289 --
NM_006197chr851740 758 650 343 308 21821 38 21845 702 --
NM_006203chr5104760 4614 4100 3675 3590 3504 1570 1451 1241 972 14009 23544 554 14061
NM_006206chr432815 2381 806 ----12657
NM_006218chr31121 ------
NM_006223chrX--159 1436 --
NM_006224chr1742447 2389 745 738 ------
NM_006241chr342306 1959 575 244 --12414 --
NM_006243chr11405 1925 ----
NM_006246chr1421197 94 --11079 --
NM_006251chr532490 1287 871 22333 1295 13063 1314
NM_006256chr112069 --31077 867 586 12342
NM_006258chr1021476 1283 --1186 --
NM_006264chr43543 206 177 1472 ----
NM_006265chr821026 345 --11352 --
NM_006267chr261598 1444 1251 533 353 112 11436 1636 --
NM_006268chr1111217 ------
NM_006282chr2044133 4079 3868 561 --24320 299 --
NM_006283chr853720 1558 1468 1436 585 --2824 33 14866
NM_006298chr651272 1222 606 506 120 22104 1313 ----
NM_006306chrX34393 3976 2024 ------
NM_006312chr122952 672 ------
NM_006313chr1241667 1642 222 208 --11690 --
NM_006315chr431130 1120 179 24156 4044 13840 --
NM_006323chr44618 559 240 34 ----1538
NM_006324chr16276 40 ------
NM_006330chr851570 513 308 222 185 ------
NM_006345chr43873 186 62 ------
NM_006352chr12715 312 ----160
NM_006357chr2176 ------
NM_006359chrX32004 853 176 22482 108 11700 --
NM_006361chr1721703 1599 ------
NM_006364chr141885 --21060 104 11099
NM_006366chr631072 334 320 --11194 --
NM_006371chr385074 3868 1948 1152 1146 522 322 145 --35319 5031 1398 --
NM_006375chrX31751 1628 677 --1396 --
NM_006379chr721945 134 --11783 --
NM_006380chr1764213 4046 3786 2855 1391 943 23867 789 1560 --
NM_006386chr2231834 783 41 ------
NM_006393chr1084256 3529 2984 1801 1434 931 712 101 13709 21807 958 --
NM_006400chr12--166 ----
NM_006401chr9----1435 --
NM_006407chr32562 310 ------
NM_006413chr102585 123 ------
NM_006416chr62767 614 ------
NM_006420chr2062974 2148 721 593 141 34 ----13202
NM_006421chr81349 --132 --
NM_006439chr41435 --1579 --
NM_006451chr5189 --1995 --
NM_006457chr494147 3909 3750 3717 3489 3386 2636 1034 373 --33398 2978 1640 12673
NM_006459chr1051775 1607 760 216 87 --1351 --
NM_006467chr562233 2002 1826 1492 483 378 22149 495 1461 1158
NM_006469chr141541 1257 494 428 ------
NM_006471chr182241 83 ------
NM_006482chr1253252 3029 2909 1565 315 --23084 1409 --
NM_006489chr1441659 639 583 214 ------
NM_006496chr151965 1632 672 658 293 --11412 11372
NM_006504chr1062831 2590 645 625 552 333 --1527 --
NM_006517chrX1878 1793 169 --
NM_006520chrX3606 278 189 ------
NM_006534chr2063059 2871 2830 1047 923 863 --33314 2955 188 --
NM_006539chr161107 ------
NM_006540chr831567 550 240 --11487 --
NM_006544chr14115788 5384 4284 3994 1189 1040 542 421 271 196 40 12169 26041 4768 --
NM_006557chr931729 1533 1364 ------
NM_006561chr1095384 5257 4534 4009 2475 2141 1535 731 261 16071 1526 --
NM_006572chr1782885 2807 2590 2415 2239 2196 1249 83 1420 1113 1623
NM_006575chr1441405 1263 1184 158 ------
NM_006595chr1131470 602 270 1571 11311 --
NM_006599chr16158258 8083 7661 7384 7329 7194 6464 6075 1964 1660 1295 1250 1200 1163 397 45966 3295 2797 2388 36605 3138 861 26157 6109
NM_006603chrX72053 1656 1645 1342 629 573 352 --1406 --
NM_006614chr34917 802 725 251 ----33338 2965 1229
NM_006625chr12775 131 --11155 --
NM_006625chr12775 131 --11155 --
NM_006625chr12775 131 --11155 --
NM_006626chr912704 1216 --22713 2621
NM_006628chr1564609 4493 4378 2825 1439 869 --31588 1239 1143 --
NM_006629chr1862207 1858 1829 651 489 46 ------
NM_006642chr1134 --149 --
NM_006644chr13------167
NM_006654chr1234454 4223 3744 13807 13528 --
NM_006660chr153342 326 68 ------
NM_006670chr63649 528 510 --136 1544
NM_006675chr1252724 2646 2367 1058 226 --12433 1233
NM_006699chr142583 2516 2130 865 --22731 44 1435
NM_006705chr91457 ------
NM_006706chr5------170
NM_006713chr52745 343 --161 --
NM_006716chr731375 150 105 11273 1211 --
NM_006717chr942126 821 749 405 --33309 2400 411 --
NM_006718chr62974 157 21100 275 ----
NM_006720chr1064677 4061 3148 1850 1454 1077 --25099 3347 --
NM_006721chr10----1330 --
NM_006722chr342414 1018 189 21 21921 1208 22624 2080 --
NM_006724chr6------162
NM_006727chr53559 380 147 ------
NM_006729chrX155426 5218 5205 4865 4422 4308 4082 4056 3844 3787 1968 1840 1410 992 110 --35635 4658 1250 25441 3616
NM_006734chr631634 1591 628 11546 11247 --
NM_006735chr71316 ------
NM_006746chrX51547 1440 1255 481 265 --1542 11531
NM_006750chr1687972 7781 7551 6332 6189 5148 2404 1378 25079 2731 ----
NM_006754chr72849 291 1444 --1144
NM_006761chr172672 329 1254 1106 --
NM_006765chr83248 218 39 ------
NM_006766chr821909 223 --12163 1311
NM_006775chr632756 2208 728 ----13005
NM_006777chrX52817 2273 2066 2032 1110 11146 --1944
NM_006790chr5159 ------
NM_006800chrX1586 ------
NM_006805chr511683 11364 21579 1283 --
NM_006807chr1741339 1269 387 238 --1380 --
NM_006813chr6--1133 1777 --
NM_006822chr173624 600 552 --1177 --
NM_006826chr241202 1136 313 47 --1403 --
NM_006838chr1281928 1856 1328 582 542 448 364 353 ------
NM_006839chr21112 ------
NM_006851chr1252844 2454 1915 794 261 --12729 --
NM_006852chr1712806 --1406 12287
NM_006854chr751843 568 441 370 225 11518 11425 --
NM_006861chr121743 ------
NM_006870chr203729 315 136 158 ----
NM_006873chr273247 2957 2176 1400 1142 582 221 23175 677 11180 --
NM_006874chr411232 2374 182 ----
NM_006884chr311753 ------
NM_006885chr1694037 3619 3538 3356 3279 3117 1701 1405 247 --1186 --
NM_006888chr1443536 2595 1272 222 --32497 631 169 1118
NM_006910chr16----1149 --
NM_006914chr921340 1333 --1336 --
NM_006915chrX52367 2331 1609 706 148 ----1255
NM_006916chr241110 984 272 185 ------
NM_006918chr11114875 4617 4126 4096 3896 2338 1080 996 637 509 333 12102 --14936
NM_006920chr272074 2000 1912 1617 494 113 41 --11317 --
NM_006922chr272389 2138 1970 1930 1896 364 39 --22128 742 --
NM_006924chr1711042 --33252 863 156 --
NM_006937chr172492 56 ------
NM_006939chr144919 378 274 97 1798 1459 --
NM_006940chr123704 338 268 ----11898
NM_006943chr2032793 2641 821 ----148
NM_006948chr2141711 463 324 272 1503 2592 545 1143
NM_006951chr102296 166 1658 1109 --
NM_006963chr1041071 948 449 178 --1877 --
NM_006981chr943012 2508 2444 861 --1666 12186
NM_006988chr2121093 279 ------
NM_006996chr121915 41 --21537 1183 1510
NM_007005chr941541 1464 966 349 --1551 --
NM_007006chr1652942 2826 2540 2423 465 158 --12172
NM_007007chr1284397 4366 4285 4071 3182 1141 657 469 33971 3532 1232 34337 4043 678 1156
NM_007011chr1576628 6288 5862 5624 5346 2294 1356 1412 25333 1612 --
NM_007013chr8--1944 1732 1271
NM_007023chr231044 142 101 1951 ----
NM_007026chr171120 ------
NM_007034chr12842 171 1712 1864 --
NM_007035chr124643 302 183 167 ------
NM_007038chr21175945 5364 5295 5101 4979 4762 4363 4316 4229 4052 2257 1927 1808 1717 1647 488 458 13920 25650 4970 15755
NM_007039chr1441886 1869 1691 44 1476 11857 1646
NM_007043chr1221726 1376 ----11312
NM_007049chr62969 937 1957 1951 --
NM_007050chr2098086 8009 7601 7481 6815 5248 5192 583 157 --36336 5126 423 --
NM_007054chr533470 1046 89 13288 23671 2959 1166
NM_007064chr31596 ------
NM_007067chr1711516 --11562 --
NM_007078chr1042880 2867 2481 2079 --32412 2218 1126 --
NM_007111chr13------1810
NM_007114chr352820 2419 352 162 143 22393 2378 12178 --
NM_007124chr641871 1660 1260 755 31998 1860 372 2403 395 --
NM_007125chrY2498 55 --21371 990 --
NM_007129chr13----1745 --
NM_007157chrX42056 1958 636 409 ------
NM_007159chr321644 168 ----1480
NM_007166chr1131531 1301 1282 ----1570
NM_007172chr2242760 2724 783 617 ------
NM_007191chr121442 ------
NM_007195chr1843606 2691 824 471 --22449 78 --
NM_007197chr122742 356 1669 ----
NM_007202chr172751 99 --1243 --
NM_007203chr962895 803 752 562 407 262 --21581 661 --
NM_007207chr1--1866 ----
NM_007212chr132151 1865 1528 ----1450
NM_007217chr3----1394 --
NM_007218chr81680 ----1920
NM_007220chrX134665 4582 4307 4222 3963 3603 3099 1960 1663 1633 446 105 90 11608 --11818
NM_007222chr831519 442 195 1386 ----
NM_007236chr1531882 1793 683 2540 202 ----
NM_007242chr161198 ------
NM_007245chr16--1924 ----
NM_007249chr13198779 8750 8693 8290 8069 8030 7988 6500 5993 3691 3553 3394 3151 2189 1456 1445 1400 1128 424 --48988 5738 3248 2041 --
NM_007275chr321119 375 ----11073
NM_007276chr74994 966 825 91 ------
NM_007287chr352328 1046 851 770 465 1523 22422 1063 --
NM_007288chr352328 1046 851 770 465 1523 22422 1063 --
NM_007289chr352328 1046 851 770 465 1523 22422 1063 --
NM_007313chr931779 1773 171 --11987 --
NM_007315chr251501 1304 1047 590 442 21434 1060 --11250
NM_007332chr831128 1000 129 1372 11351 --
NM_007347chr1523233 2056 11030 1374 147
NM_007350chr1254442 4332 4296 3387 1594 ----1174
NM_007358chr121598 712 --11561 --
NM_007373chr1021527 482 11473 164 --
NM_007374chr14--1358 ----
NM_007375chr142597 537 366 199 22678 2295 42416 2404 1745 623 --
NM_012072chr2084175 3292 1313 1261 742 643 239 171 13850 33954 3246 513 --
NM_012073chr531366 90 73 --11233 --
NM_012081chr573738 3404 2391 2316 1404 1012 165 11116 1267 --
NM_012082chr8189 ------
NM_012083chr102986 860 ------
NM_012092chr261568 1263 781 687 368 328 1108 21458 636 --
NM_012095chr1043167 2959 657 467 --22143 1040 --
NM_012096chr3113401 2703 2662 2487 1433 1390 904 533 460 265 132 --33362 1489 850 11376
NM_012097chr221728 118 ------
NM_012102chr142516 2066 514 209 ----22525 69
NM_012104chr1123441 2523 ----21195 906
NM_012104chr1123441 2523 ----21195 906
NM_012120chr672849 2414 900 564 356 331 133 1612 12234 --
NM_012124chr113931 602 28 1848 ----
NM_012137chr172924 2889 2729 2265 2112 602 121 --12210 --
NM_012141chr1361588 1376 703 671 154 131 23631 679 33621 2563 687 --
NM_012153chr1152559 2486 2199 879 201 ----1587
NM_012154chr82641 237 ------
NM_012156chr2053255 2757 2455 422 266 1952 ----
NM_012157chr32944 119 ------
NM_012158chr1341247 1136 298 274 ----11495
NM_012160chr61368 ------
NM_012161chr431110 354 242 1787 ----
NM_012164chr997010 5849 5349 5022 1828 1168 974 783 82 --37468 5518 1907 --
NM_012180chr42575 77 --1714 --
NM_012193chr1134765 3677 448 14529 15367 --
NM_012199chr154236 3885 1623 1485 135 --13053 --
NM_012214chr244152 2130 955 295 25439 327 26106 552 --
NM_012215chr1021912 733 --2318 263 --
NM_012223chr241287 1106 1083 346 ------
NM_012224chr421011 32 --2491 460 --
NM_012234chr363433 3328 2736 1020 880 765 2904 477 23782 1074 --
NM_012238chr1011608 ------
NM_012242chr102808 654 --1763 --
NM_012247chr1061003 782 728 659 180 101 ------
NM_012249chr282944 2186 1165 1126 973 649 368 140 1295 1591 13151
NM_012250chr112483 275 1862 170 1243
NM_012257chr711049 --130 --
NM_012259chr62998 69 ----11437
NM_012262chr143396 2105 1746 940 --25086 1717 13574
NM_012281chr731552 971 90 22105 422 12410 --
NM_012290chr241632 1418 678 114 --11231 --
NM_012294chr753160 3004 2686 1155 31 --1898 12907
NM_012297chr432641 513 256 --12301 12259
NM_012300chr532260 318 55 ------
NM_012301chr742179 2087 1431 326 ------
NM_012302chr131105 850 373 --2506 475 --
NM_012307chr1841038 768 417 68 --1921 11070
NM_012309chr1134432 952 709 --14574 24760 3076
NM_012316chr155104 4353 4277 649 254 11776 --11180
NM_012317chrX1671 ------
NM_012319chr1821037 841 ------
NM_012328chr751216 1145 1043 942 553 ----11362
NM_012334chr554317 3596 1842 1074 207 12940 1820 --
NM_012338chr721149 1015 ------
NM_012347chr662856 2564 2554 2274 2140 1187 ------
NM_012381chr6------171
NM_012416chr921163 1040 ------
NM_012419chr6------1512
NM_012420chr1052018 1998 1947 742 389 22045 338 ----
NM_012421chr1----1125 --
NM_012429chr2211384 ------
NM_012444chr204494 440 331 202 ------
NM_012464chr472912 2656 2301 2100 1795 637 261 12331 12594 --
NM_012465chr1032861 906 215 --13385 21325 1174
NM_012471chrX41977 1758 1214 756 11448 ----
NM_012479chr732256 972 591 --2603 436 --
NM_012482chr13610 442 82 --1249 --
NM_012486chr1168 ------
NM_013229chr1232698 2145 514 --12729 --
NM_013230chrY61632 1623 1474 1460 1175 396 --1543 11157
NM_013231chr1484375 3856 3705 3648 3161 3055 503 86 21743 153 14315 --
NM_013233chr211413 1946 ----
NM_013238chr1361889 1270 1232 720 623 201 1430 1100 --
NM_013243chr152139 122 11035 --11051
NM_013246chr112787 229 ------
NM_013254chr122504 97 ------
NM_013257chr852194 1716 572 312 42 --12148 12414
NM_013261chr493477 3164 2973 2594 2351 1084 1059 1000 109 --23691 185 --
NM_013269chr1264325 4184 3811 3192 1817 1060 --24409 4365 --
NM_013281chr2031335 1112 369 1586 1226 --
NM_013282chr192303 167 --1928 --
NM_013309chr1552198 764 453 246 226 12480 ----
NM_013322chr741606 1296 278 226 --21737 621 --
NM_013341chr282858 2684 2006 1918 1862 394 376 358 11985 --12247
NM_013346chrX157 ------
NM_013357chr82634 607 --1310 --
NM_013372chr1543202 2435 2377 423 ----23378 985
NM_013374chr353022 2642 626 138 80 ----22312 310
NM_013380chr193632 610 325 ----1765
NM_013381chr1232178 1654 905 --11772 12288
NM_013390chr911462 ------
NM_013399chr1651829 1737 1695 1572 1172 ----11548
NM_013423chrX51019 961 894 466 270 ------
NM_013427chrX51019 961 894 466 270 ------
NM_013437chr83350 138 69 1955 ----
NM_013438chr951819 507 379 285 209 --1224 --
NM_013448chr143709 236 123 ------
NM_013449chr1232724 2443 165 --12538 --
NM_013450chr211280 11168 --176
NM_013952chr242386 2052 655 172 11600 --21718 1701
NM_013953chr242386 2052 655 172 11600 --21718 1701
NM_013992chr242386 2052 655 172 11600 --21718 1701
NM_013993chr62782 733 ------
NM_013994chr62782 733 ------
NM_013995chrX42401 2379 2023 215 1506 22352 2260 --
NM_014000chr1031905 1784 1559 --11287 --
NM_014007chr921239 926 ------
NM_014011chr242491 1828 576 402 12204 22538 1638 --
NM_014021chr193307 3117 2635 2596 2476 1345 725 631 602 --1418 --
NM_014028chr653003 2318 2189 762 586 12862 1652 11292
NM_014043chr331043 665 75 --11602 --
NM_014048chr16124995 4430 4375 4292 4129 4009 1611 1187 1148 352 193 83 11255 24520 4158 --
NM_014057chr911154 1155 1188 --
NM_014058chr41261 ------
NM_014071chr20148 ------
NM_014089chr1341521 820 621 245 12048 1323 11859
NM_014106chr1541960 1946 1000 91 1131 42446 2349 1176 434 --
NM_014112chr855489 3431 1972 1554 1511 --33518 2024 1624 1365
NM_014117chr162794 126 --1917 1488
NM_014141chr7115007 4980 4923 4727 4703 4471 2109 2094 1960 1897 726 --1349 --
NM_014155chr11117446 7114 6563 5257 5097 2365 2202 1654 1540 1234 260 37141 6845 1601 11150 --
NM_014178chr14164 --2515 177 --
NM_014181chr252950 2901 2526 2443 368 22056 640 1814 1420
NM_014182chr124564 303 285 96 ------
NM_014191chr126430 416 240 156 119 60 ------
NM_014220chr34821 297 255 122 ------
NM_014232chr17--1611 ----
NM_014232chr17--1611 ----
NM_014243chr481823 1646 1353 768 602 543 373 95 11370 2438 182 --
NM_014253chrX42508 2424 1587 869 ------
NM_014263chr1031511 1410 74 ----1352
NM_014267chr112822 663 ------
NM_014271chrX2207 49 --1252 --
NM_014278chr4----164 --
NM_014289chrX41415 1306 1141 976 31441 186 177 ----
NM_014294chr891300 1189 1166 1137 1087 569 492 300 54 ------
NM_014296chr321436 1306 11407 1209 --
NM_014309chr2265031 4957 3860 623 455 76 --11415 --
NM_014315chr141166 ------
NM_014317chr101266 ------
NM_014331chr4187520 7352 7322 6664 6265 6161 5296 5288 5227 5069 2799 1363 1163 1008 886 402 385 302 --47365 1196 960 483 17858
NM_014333chr1162774 2060 1797 1745 734 713 ----11718
NM_014334chr9128 ------
NM_014342chr113543 401 76 --11439 --
NM_014344chr111825 ------
NM_014352chr1131480 1129 580 ----173
NM_014368chr931567 478 359 12100 ----
NM_014372chr141715 701 619 445 ----11509
NM_014376chr521625 272 --22424 1942 --
NM_014379chr83853 659 22 1377 ----
NM_014381chr1482763 2087 2005 965 909 844 509 446 1249 13285 --
NM_014392chr431108 368 290 --11577 --
NM_014393chr832364 1515 99 11760 --21822 383
NM_014410chr182309 22 1122 ----
NM_014415chr33606 166 67 --1642 1100
NM_014418chr1451843 1809 1578 300 147 --22004 199 --
NM_014421chr4142004 1948 1934 1806 1796 1788 1684 1507 1445 1403 1352 748 501 379 21916 1494 ----
NM_014423chr5104790 1812 1514 1476 1462 1384 601 575 515 220 --25212 643 --
NM_014426chr202587 136 --1642 --
NM_014429chr32639 177 --1608 1615
NM_014445chr332439 1979 782 ----21802 333
NM_014447chr421279 199 --21630 373 --
NM_014452chr611079 ------
NM_014454chr62967 53 ------
NM_014458chr121249 1082 1365 11316 11377
NM_014469chr113702 637 261 ------
NM_014480chr191544 ------
NM_014494chr1651559 753 630 208 112 ------
NM_014500chrX179 --141 --
NM_014506chr921669 640 ----11484
NM_014548chr152479 307 --1396 --
NM_014554chr1242348 1734 1599 58 ----11757
NM_014572chr132657 222 --21614 346 --
NM_014574chr1431546 1420 93 --156 --
NM_014577chr223747 361 320 ------
NM_014584chr1411596 11483 1522 11509
NM_014585chr251213 985 902 866 374 --2976 515 11267
NM_014592chr53735 119 87 ------
NM_014606chr421185 405 1612 11284 --
NM_014607chr231398 814 107 ----11554
NM_014613chr572930 2666 2536 2434 2050 868 152 --13081 --
NM_014616chr352330 2302 1070 1039 932 23524 2356 13433 --
NM_014629chr841231 1050 1026 90 --1470 --
NM_014630chr1563724 3581 3523 3015 2803 879 --13486 --
NM_014636chr9104314 4156 3748 3303 3055 2657 1531 404 278 217 --34087 3230 1222 13242
NM_014647chr1652294 1575 1426 383 51 ------
NM_014670chr22334 79 ----11582
NM_014671chr731093 460 276 --21596 1444 --
NM_014674chr363784 3745 3678 3658 720 555 ------
NM_014675chr11467 ------
NM_014676chr11658 --1315 --
NM_014682chr842293 375 351 105 12017 ----
NM_014686chr1921952 263 --22542 574 --
NM_014690chr742600 2394 974 639 --22979 998 --
NM_014693chr31721 ------
NM_014701chr1553227 1302 829 765 669 ----13267
NM_014702chr653118 800 166 73 23 21304 407 23372 1214 12891
NM_014705chr731626 1431 44 22071 786 1602 --
NM_014707chr722205 774 --11564 3152 138 122
NM_014711chr1661928 739 529 309 263 73 11454 --1376
NM_014717chr194769 602 173 69 ------
NM_014720chr101332 ------
NM_014721chr6126878 6644 6545 5820 5686 5250 2314 2087 1893 1203 1062 1027 25467 5444 21851 1311 16757
NM_014729chr822211 1541 --1580 1858
NM_014733chr542017 1886 304 214 2600 24 32245 1712 691 --
NM_014735chrX72015 1945 1549 686 524 449 173 ------
NM_014736chr15------169
NM_014739chr683456 3347 3201 2763 463 287 262 123 1934 23569 1204 1380
NM_014747chr1125649 5237 5189 4894 3919 3814 3613 2223 1258 1068 610 110 --15789 --
NM_014748chr2145 ------
NM_014751chr882179 2155 1686 1526 644 288 223 79 ----11568
NM_014752chr1141642 1431 1211 548 --11831 --
NM_014755chr284174 3716 3444 1275 753 571 359 120 1395 31162 1144 515 --
NM_014757chr552121 956 842 468 42 1782 ----
NM_014765chr142124 1958 854 213 1274 ----
NM_014766chr7143764 3500 3298 2624 2410 1487 1220 1176 1002 767 599 526 306 179 ------
NM_014772chr1812338 ------
NM_014774chr132237 569 232 1148 ----
NM_014776chr1253170 2207 2101 597 86 13008 ----
NM_014787chr122493 1899 --12708 --
NM_014790chr54499 191 178 54 ------
NM_014802chr1211016 ------
NM_014803chr1032330 2063 1962 12241 1490 --
NM_014810chr183260 3150 3132 2828 1337 1320 1303 400 --23253 642 --
NM_014812chr181986 1953 1862 1843 1451 1434 1406 1343 ----1670
NM_014819chr582452 2153 1969 1759 1730 866 468 45 1106 ----
NM_014820chr3112097 2036 1967 1763 1620 1572 1544 789 553 385 134 --21874 1819 1359
NM_014824chr1131983 1566 1364 1460 ----
NM_014826chr153820 3534 3420 3238 1479 13167 ----
NM_014828chr1441642 769 551 499 1872 1609 --
NM_014829chr57792 635 616 438 188 70 63 --22205 1547 --
NM_014832chr1322061 64 --2642 543 --
NM_014836chr1041830 615 406 219 ------
NM_014839chr121624 432 --22221 2164 22043 733
NM_014850chr31955 --14626 2440 338
NM_014864chr143355 442 374 35 --1761 --
NM_014867chr863450 3404 1189 1124 1030 941 ------
NM_014868chr121196 ------
NM_014873chr174580 4497 4304 4011 1628 1113 617 13451 44681 4330 387 72 1650
NM_014877chr17107689 7148 7009 6878 6594 5610 5166 2210 550 81 46360 5126 2567 257 56413 2944 2516 993 376 --
NM_014883chr472378 1002 703 601 429 335 316 1919 11773 --
NM_014888chr731534 976 477 --1404 11060
NM_014893chrY112350 2221 2123 2106 1742 1690 782 753 585 459 449 --11666 11993
NM_014897chr1742783 955 755 735 ------
NM_014900chr22317 265 --1958 --
NM_014901chr542010 1558 175 117 11957 11525 --
NM_014902chr2021051 361 --11042 --
NM_014903chr1242194 1557 904 339 ----1946
NM_014904chr1043270 3010 2992 691 52730 1442 1062 722 109 22947 916 13628
NM_014905chr231916 823 456 --31492 665 102 --
NM_014906chr17144009 3941 3622 3339 3237 2921 2702 2616 1635 1583 1251 1155 885 432 --34023 2755 910 22607 2531
NM_014912chr1063482 2274 1087 889 865 157 ----33211 1345 957
NM_014917chr111009 ----1915
NM_014918chr1531635 424 104 1121 ----
NM_014920chr6103587 2972 2932 2786 2663 1489 1169 1059 856 362 13090 11242 --
NM_014921chr1911121 ------
NM_014923chr134813 462 404 32 2902 419 11670 --
NM_014924chr1433152 2530 2177 --132 12603
NM_014932chr311481 1272 11519 1443
NM_014933chr41126 ------
NM_014934chr1383993 2689 2604 2455 1478 1116 1024 948 13535 13293 23973 3547
NM_014936chr622024 464 1822 12704 --
NM_014938chr1222402 1616 ------
NM_014939chr1831228 419 59 11510 1219 --
NM_014946chr252982 966 840 589 98 22901 120 ----
NM_014947chr153168 2997 1237 463 194 --22903 711 --
NM_014950chr1441739 1668 1202 1086 --11784 --
NM_014951chr1042651 2561 2521 707 --12086 11893
NM_014953chr1323544 1547 --2708 133 14004
NM_014961chr462064 1768 1646 396 341 78 11581 --198
NM_014962chr2072499 1966 1803 1095 1015 653 77 --22354 526 12675
NM_014969chr14981 383 242 218 --1878 --
NM_014978chr1011404 ----11747
NM_014982chr14104991 4659 4274 4194 2005 1864 1755 1576 1296 569 14576 45122 3639 1981 865 --
NM_014988chr482629 2295 2047 1923 1887 1785 715 389 --22722 2015 --
NM_014989chr671840 1658 1430 1335 370 360 200 1641 ----
NM_014991chr453107 2268 2123 1312 95 1804 12584 --
NM_014999chr1241501 1463 1252 202 ----1569
NM_015000chr1273031 2867 1226 573 282 133 47 22895 995 ----
NM_015008chr333191 2716 91 --22924 123 --
NM_015009chr31337 ----1269
NM_015015chr1931739 1383 356 11353 ----
NM_015017chr131218 1189 857 ------
NM_015018chr6130 1223 ----
NM_015020chr1642609 916 793 533 11485 2414 79 12853
NM_015025chr222215 786 11732 21067 85 --
NM_015026chr1264411 3475 3258 3162 617 460 --44185 3856 1756 1630 --
NM_015032chr1352438 1999 1844 665 429 --22760 2636 --
NM_015035chr2096352 4538 2307 2240 927 846 608 588 519 --25685 337 --
NM_015040chr253290 2366 979 480 73 ----11028
NM_015042chr1521155 1125 --2618 484 1570
NM_015045chr1041813 806 197 188 --22016 569 --
NM_015054chr123499 463 414 1546 ----
NM_015057chr13123 --1106 --
NM_015061chr9----1569 --
NM_015068chr743330 2623 2578 379 12567 33941 3150 2903 13016
NM_015069chr162257 76 ------
NM_015071chr5116481 6430 6028 6021 5891 5691 5666 5459 2393 1715 444 1974 35831 5677 34 --
NM_015074chr143595 1894 1519 594 --13709 14181
NM_015075chrX32033 1801 289 ------
NM_015076chr664510 4308 3526 1544 468 219 --162 11728
NM_015087chr1332441 2220 2036 21034 361 --22342 1910
NM_015091chr144781 314 289 157 --142 1566
NM_015092chr1644048 2986 1845 1186 --33548 3350 1092 13733
NM_015093chr611736 2407 86 1704 --
NM_015097chr332143 1561 575 32201 2073 1805 21514 176 --
NM_015110chr941698 1629 875 808 12216 21787 801 11711
NM_015115chr453102 2705 2561 908 209 ------
NM_015130chr431329 1172 1015 ------
NM_015132chr72166 93 11672 --21983 1298
NM_015137chr872258 2176 2164 1926 755 416 376 21752 168 2911 734 12083
NM_015138chr1582295 2259 1047 677 393 311 175 32 ------
NM_015147chr273295 986 936 669 556 526 186 ------
NM_015149chr12645 391 --12159 1301
NM_015153chr62551 27 --1236 --
NM_015155chr1063279 3038 3025 2425 2227 732 22604 335 22527 917 --
NM_015156chr1493985 3620 3509 2909 2839 1364 530 379 211 --186 --
NM_015158chr9----2588 28 --
NM_015163chr1451938 641 526 145 136 11450 --11434
NM_015170chr841716 1593 610 340 ------
NM_015172chr131325 402 151 1211 11621 --
NM_015176chr131701 655 563 21646 577 --1299
NM_015185chrX42775 2295 1109 1067 12088 12907 --
NM_015191chr1131967 927 329 ------
NM_015192chr2062584 2265 2062 1172 704 492 ------
NM_015199chr372587 2445 2296 2074 1883 675 172 --1661 --
NM_015200chr462044 1744 1677 564 391 59 --12078 --
NM_015206chr1553287 3119 2891 684 123 --31174 1154 577 --
NM_015208chr1832925 2558 97 13737 11089 --
NM_015209chr142226 2026 1568 648 1845 ----
NM_015215chr192541 2361 2348 2312 2099 988 625 595 143 ------
NM_015231chr112298 134 --3968 658 128 --
NM_015234chr631445 320 23 --31341 1249 280 --
NM_015236chr441154 1064 948 408 1993 11175 --
NM_015239chr92523 410 --1530 --
NM_015247chr16135416 5258 5245 5192 4157 3575 2035 1828 1756 1298 824 560 532 --11906 43934 3886 3655 510
NM_015250chr921877 1736 --11513 --
NM_015251chr1652158 677 634 286 228 1297 11474 --
NM_015252chr23775 757 697 ------
NM_015263chr151240 ------
NM_015264chr22104699 4423 4205 4055 3594 3502 3373 1607 1067 264 ----11461
NM_015265chr232259 841 341 --1429 1436
NM_015268chr33641 271 127 --1670 --
NM_015269chr13473 199 94 ------
NM_015271chr474241 3955 3373 3333 1461 462 219 14208 1237 --
NM_015272chr16101988 1964 1712 1657 1590 1577 762 263 99 62 ----11437
NM_015275chr121354 21481 395 4821 798 631 317 --
NM_015277chr1831810 272 233 11667 1300 --
NM_015282chr232933 1931 1924 ------
NM_015285chr1862404 2100 1883 1826 1599 213 --32298 2202 515 --
NM_015292chr122792 754 ------
NM_015296chr1341004 857 282 128 --2865 459 --
NM_015299chr1483373 2530 1425 1040 942 877 816 784 --1845 --
NM_015310chr8128103 7139 6667 6427 5909 5776 2981 2079 1685 1588 1542 812 --28097 2146 1911
NM_015314chr741998 716 690 188 1476 ----
NM_015315chr532962 1298 342 --22509 191 --
NM_015317chr292570 2541 2443 2410 1924 1046 1005 624 396 3978 700 499 ----
NM_015321chr1943931 1738 937 807 ------
NM_015326chr142428 1146 483 466 --12021 1449
NM_015328chr742433 1169 896 559 ----32988 2980 2954
NM_015335chr1242654 2283 160 77 22646 717 ----
NM_015336chr1242234 2171 1876 132 12657 ----
NM_015344chr832030 548 229 21544 1359 11433 12020
NM_015347chr1211125 1334 --1320
NM_015349chr653028 2479 2183 447 68 ----12297
NM_015352chr2043705 2941 2480 354 ----13288
NM_015355chr173593 181 42 1580 31977 1870 574 --
NM_015358chr211936 1857 ----
NM_015359chr882970 2957 2853 2845 2189 947 783 134 ------
NM_015360chr51177 1153 ----
NM_015361chr23971 817 651 ------
NM_015365chrX54193 1374 1296 1262 37 11269 1961 12958
NM_015375chr144336 3543 647 506 --21040 597 11053
NM_015381chr2222024 815 11667 ----
NM_015382chr141229 ------
NM_015387chr23843 625 256 1588 ----
NM_015393chr492684 2678 2400 1197 1069 540 454 437 401 13130 ----
NM_015397chr931359 373 29 ------
NM_015419chrX5987 940 928 721 150 --2424 228 --
NM_015435chr82339 63 21462 433 --1994
NM_015446chr12408 347 --11174 11635
NM_015455chr533539 2585 1427 13406 --1687
NM_015458chr8105311 4960 4783 4729 4617 4597 4531 1230 614 83 --24221 647 --
NM_015472chr34435 214 85 40 ------
NM_015472chr34435 214 85 40 ------
NM_015475chr21724 1179 21000 978 --
NM_015477chr151390 ------
NM_015497chr152222 207 1428 --11134
NM_015503chr161669 ------
NM_015508chr331271 1179 582 ------
NM_015509chr121488 --1627 --
NM_015525chr61859 1809 --131
NM_015535chr264178 3576 3538 3020 1320 495 22756 1642 13033 13055
NM_015541chr33908 252 39 ------
NM_015542chr1021100 877 --11154 --
NM_015548chr64768 325 241 117 --2919 299 --
NM_015550chr743376 2896 2426 167 13087 33304 2978 144 --
NM_015554chr1562885 2754 2056 1981 984 717 --12179 --
NM_015564chr543510 1414 656 291 --1844 150
NM_015565chr2141867 1401 338 210 2569 225 1422 1681
NM_015568chr2093976 3957 3840 3524 3356 3064 3025 1398 199 13135 32817 2693 632 --
NM_015569chr151807 1504 1407 1116 595 ----11660
NM_015570chr731719 672 80 ----11347
NM_015571chr652512 2175 1775 1698 587 --1971 --
NM_015575chr21102 --13572 13242
NM_015576chr372658 2342 2012 1160 1067 878 79 1856 ----
NM_015577chr511810 ------
NM_015602chr121436 1349 1127 1681 --
NM_015630chr22778 331 1797 1367 --
NM_015635chr962202 1848 802 553 471 394 ------
NM_015642chr31315 ------
NM_015652chr102105 37 ------
NM_015702chr22128 57 ------
NM_015713chr853465 3322 2462 2442 26 23310 1000 12861 --
NM_015726chr1181 1628 ----
NM_015833chr2142292 2161 1969 1693 ----1473
NM_015834chr213903 772 304 ------
NM_015850chr821971 1578 1757 1675 --
NM_015866chr121305 1054 --11176 --
NM_015869chr31162 ------
NM_015878chr841918 1902 1502 166 21464 831 11783 32256 2143 325
NM_015885chr11------197
NM_015888chr122978 2185 1766 --1822
NM_015891chr62682 94 1661 21460 738 --
NM_015902chr84921 263 194 70 ------
NM_015904chr21195 ------
NM_015906chr144352 3821 1455 144 --12942 13940
NM_015912chr832176 773 72 --12274 --
NM_015938chr321008 806 --2375 237 --
NM_015967chr12873 249 --3793 374 90 1322
NM_015986chr172959 281 ------
NM_015990chr4--11051 21031 22 --
NM_015994chr142684 630 --1262 --
NM_016009chr154861 3990 1757 1615 860 --14845 --
NM_016018chr832538 2045 440 3828 812 783 11970 11910
NM_016023chr822116 1594 12025 11730 --
NM_016037chr131145 1128 325 ------
NM_016040chr161958 1948 1904 1814 628 255 12047 12058 1498
NM_016045chr2031512 1297 88 157 ----
NM_016053chr12--125 150 --
NM_016061chr221513 270 165 1245 --
NM_016072chr1242048 1804 111 86 12251 1736 --
NM_016073chr1511071 122 1731 --
NM_016075chr1333143 987 438 12906 12236 --
NM_016076chr162264 2075 1268 722 300 278 ------
NM_016078chr1731142 941 29 --1392 3798 401 319
NM_016083chr683852 3116 2413 1471 966 746 397 198 11525 23494 567 --
NM_016090chr112173 101 --1670 --
NM_016096chr851850 1839 1814 818 245 ----11386
NM_016097chr183855 725 708 ------
NM_016107chr531227 1078 467 --2516 79 --
NM_016120chrX31210 880 429 ------
NM_016121chr171119 1003 350 202 95 82 34 ------
NM_016132chr1542866 2706 770 30 1279 --1541
NM_016133chr231369 1031 253 --11136 1215
NM_016138chr1641729 1578 153 26 --1292 --
NM_016152chr32817 363 ------
NM_016157chrX176 ------
NM_016166chr151171 ------
NM_016195chr101648 ----1108
NM_016200chr71699 1327 1146 --
NM_016206chr3138821 8716 7697 7320 7031 6775 6092 6055 5756 3113 2866 1971 1865 27288 6636 46717 6560 6431 662 21806 1175
NM_016211chr41126 ------
NM_016217chr622937 484 155 ----
NM_016219chr91462 ------
NM_016224chr642229 1611 1532 135 ----1306
NM_016248chr1363798 2777 2477 1114 601 216 --11163 --
NM_016252chr21613 1274 ----
NM_016255chr632987 617 423 ------
NM_016257chr163498 3398 2571 2385 2165 555 22798 1067 1854 --
NM_016260chr276869 6513 5606 5522 5088 1499 595 27267 6652 46877 5955 4915 2096 12785
NM_016271chr1842158 1700 1483 62 --121 --
NM_016275chr372540 2298 1818 575 560 521 198 ------
NM_016277chr671433 1267 1203 1154 477 143 32 11112 1219 1629
NM_016287chr141518 610 216 96 --21584 691 --
NM_016289chr212033 --11706 12204
NM_016303chrX1172 1309 2406 139 --
NM_016308chr121289 101 ------
NM_016316chr23266 252 217 ----1550
NM_016319chr121293 ----1783
NM_016322chr952721 1043 775 468 218 --12284 12223
NM_016328chr72121 115 ------
NM_016374chr121549 593 --11370 --
NM_016374chr121549 593 --11370 --
NM_016376chr1793549 3054 1473 1444 937 870 812 638 469 --12889 --
NM_016377chr641756 1747 1618 574 --11297 --
NM_016395chr1551963 1865 1825 1384 410 --1562 --
NM_016396chr1553027 2466 2043 1168 265 --1486 12010
NM_016410chr92569 128 ------
NM_016424chr1721917 803 --11498 --
NM_016426chr22----1646 --
NM_016441chr262392 2346 845 787 576 153 --11515 --
NM_016451chr11130 1306 ----
NM_016454chr15----149 --
NM_016467chr251412 961 424 402 30 11150 1111 --
NM_016470chr201478 1189 ----
NM_016472chr1421129 978 ----1321
NM_016485chr682301 2195 1807 1644 1537 909 710 288 --12261 21414 323
NM_016507chr1763034 2871 2563 1129 961 276 --1106 12224
NM_016513chr6103587 2972 2932 2786 2663 1489 1169 1059 856 362 13090 11242 --
NM_016530chr15103434 3372 3294 3182 2834 2755 985 690 680 410 24144 1029 13207 --
NM_016531chr464039 3449 3340 3290 3033 2929 23727 2999 33305 2865 88 --
NM_016542chrX71654 1450 1363 1249 606 326 58 --1653 11382
NM_016578chr111467 ------
NM_016587chr74994 966 825 91 ------
NM_016603chr5--11486 11931 12164
NM_016605chr562229 2099 981 821 638 533 --12450 --
NM_016613chr442533 1753 590 459 --1481 --
NM_016620chr121260 1039 ----21025 174
NM_016621chr1163711 3343 2960 2954 1828 216 --23388 897 --
NM_016626chr1871292 1274 604 497 475 435 27 --135 --
NM_016644chr52520 111 1533 2500 40 --
NM_016651chr1411179 11059 ----
NM_016654chr1521296 227 --1563 --
NM_016824chr1051477 1284 479 410 144 --11656 --
NM_016834chr1744112 3852 2977 740 ----14081
NM_016835chr1744112 3852 2977 740 ----14081
NM_016836chr22172 31 ------
NM_016839chr22172 31 ------
NM_016841chr1744112 3852 2977 740 ----14081
NM_016936chr1641652 870 646 305 ----11560
NM_016937chrX2897 629 ------
NM_016950chr441514 1281 603 46 11136 2548 32 --
NM_016952chr1163136 2618 1620 1018 862 811 ------
NM_016954chrX131 ------
NM_017412chr841238 1080 1000 928 ------
NM_017416chrX----1151 --
NM_017420chr1473629 3377 3264 1364 653 287 181 22796 2385 1144 --
NM_017423chr462083 1401 591 192 179 161 --2448 229 11948
NM_017426chr43572 523 50 ------
NM_017437chr1451876 1603 617 260 122 ----1732
NM_017439chr7--1403 ----
NM_017440chr122599 456 --1195 --
NM_017444chr851785 1526 546 452 328 --11247 1353
NM_017447chr2174418 4236 3068 3002 1096 1073 538 --1495 --
NM_017451chr17----11112 --
NM_017459chr12415 322 ------
NM_017510chr51668 ------
NM_017545chr20----1380 --
NM_017548chr341907 1523 249 91 2463 203 1814 --
NM_017549chr721373 177 --31413 952 280 --
NM_017563chr386359 5212 5202 5020 2258 1078 785 358 15532 26389 515 --
NM_017567chr2188 ------
NM_017569chr131382 --1140 --
NM_017594chr953114 2915 2883 2661 489 --22332 350 13093
NM_017599chr1251995 1920 1343 121 44 21784 98 ----
NM_017610chr1542039 727 520 129 --11571 1357
NM_017617chr941526 1433 529 173 1284 11553 --
NM_017628chr4115167 4558 4492 2106 1841 1748 1239 1225 1082 106 53 13594 12005 11985
NM_017629chr15631 584 542 290 141 11490 21837 1613 --
NM_017633chr633912 3738 778 --11561 --
NM_017634chr861887 1804 1666 1519 1351 1245 --11449 11456
NM_017637chr9102726 2359 2315 1781 1691 1395 762 609 602 48 32884 1167 142 13699 19087
NM_017640chr62940 883 ----1785
NM_017643chr1763129 2582 2284 2182 747 41 22855 2686 22867 1240 --
NM_017644chr3105205 5116 4995 4742 2025 1973 1662 1482 612 63 --54780 4343 4122 1926 1739 1297
NM_017650chr763669 2155 1811 1161 158 150 14788 35009 4165 416 --
NM_017651chr631101 1000 274 --11036 --
NM_017657chr2------1171
NM_017658chr14144559 4340 4163 4106 3817 3374 3134 2887 1738 1585 1187 252 91 48 --24156 2870 13023
NM_017666chrX92167 2008 2001 1891 1821 903 361 289 163 ------
NM_017672chr1521383 837 11329 ----
NM_017684chr1532058 210 56 --11739 --
NM_017694chr262097 1776 1491 1471 439 29 1111 --1591
NM_017709chr163442 3280 2808 1349 429 166 --24155 642 --
NM_017714chr204799 725 340 316 ------
NM_017719chr332164 537 313 12003 1222 --
NM_017736chr1662460 2210 2120 276 109 46 --1360 12470
NM_017737chr131772 320 45 --22214 534 --
NM_017742chr1841299 350 284 95 ----1524
NM_017745chrX--199 ----
NM_017747chr51275 ----2372 321
NM_017752chrX41991 1799 1652 596 ----1381
NM_017753chr95909 844 821 799 51 ------
NM_017754chr643583 1739 1420 726 14874 23622 3609 1997
NM_017758chr1731529 1463 446 11431 --1131
NM_017761chr11990 ------
NM_017762chr1531847 1644 264 ------
NM_017768chr14981 961 788 668 --1187 --
NM_017769chr1462935 2890 2471 2328 2251 1170 1355 ----
NM_017770chr652716 2490 670 380 80 --23018 428 --
NM_017780chr82819 62 1257 ----
NM_017784chr331020 937 375 1976 ----
NM_017786chr82600 130 ------
NM_017811chr942592 2090 298 243 1418 22928 513 --
NM_017813chr895125 4842 4225 4177 4060 1510 927 413 406 --22241 291 --
NM_017824chr1042598 1829 112 23 1437 --1648
NM_017831chr1854470 4036 3298 985 249 43259 930 862 328 41374 1323 234 189 --
NM_017845chr42219 177 ------
NM_017847chr121780 238 --1183 --
NM_017848chrX43934 3574 1597 987 --13079 --
NM_017902chr1063823 3664 3584 1080 476 254 24395 626 15249 15429
NM_017913chr93390 318 301 ------
NM_017919chr975807 5765 4424 1998 1286 1127 529 22063 484 45328 5301 5174 4400 12159
NM_017926chr143595 291 220 ----1351
NM_017933chr241575 541 330 182 ----21440 601
NM_017935chr43493 248 34 --1575 --
NM_017938chrX72035 1919 1859 1795 1615 753 111 --11726 --
NM_017944chr1111056 ----11226
NM_017952chr2104573 4403 4295 4110 4036 3872 1779 1410 1233 670 ------
NM_017954chr751415 1290 1227 560 81 ------
NM_017972chr143595 291 220 ----1351
NM_017988chr121900 --2698 62 --
NM_018000chr252153 1696 1548 185 73 ----1132
NM_018003chr1572165 1673 682 615 549 471 212 1253 ----
NM_018014chr231101 981 356 ------
NM_018017chr1062431 2407 2363 1113 460 148 22590 704 --11776
NM_018027chr1052380 2372 2149 761 576 --23280 2389 13038
NM_018030chr182131 35 3861 773 341 1696 --
NM_018036chr1454014 3476 1305 667 650 13806 ----
NM_018051chr7----2134 72 --
NM_018072chr11143 ------
NM_018078chr43872 794 310 1736 197 1765
NM_018084chr221005 552 1492 1934 --
NM_018085chr187429 7211 6475 5261 1278 902 759 559 26693 645 12408 --
NM_018086chr251421 617 588 530 393 21282 63 ----
NM_018087chr11252 ------
NM_018092chr16--21627 470 21557 395 1169
NM_018098chr321179 174 ------
NM_018103chr11306 ------
NM_018105chr8----1192 21115 143
NM_018106chr7144 ------
NM_018112chr9121 1102 11040 --
NM_018120chr82609 133 11204 21516 305 --
NM_018121chr1023158 784 --1828 --
NM_018125chr12484 390 ------
NM_018126chr431385 979 279 --11305 2119 110
NM_018150chr13918 883 153 ------
NM_018155chr322332 937 12377 12969 3924 834 336
NM_018157chr1263230 2351 2242 2075 2041 276 --1954 --
NM_018159chrX31691 157 131 11427 1319 11045
NM_018164chr12174 --1115 --
NM_018171chr123639 366 196 ------
NM_018181chr1831836 762 238 1452 11776 --
NM_018184chr362114 1841 1409 574 550 375 11791 11910 --
NM_018195chr11143 --22065 487 --
NM_018202chr12842 217 1297 ----
NM_018206chr162588 237 ----1698
NM_018221chr21329 ------
NM_018222chr1161832 1797 1703 1557 651 452 --11938 --
NM_018227chr421983 247 13018 ----
NM_018243chr463900 2816 2687 1316 806 630 13116 21446 1402 12890
NM_018244chr201292 --11096 11260
NM_018247chr673020 2547 1977 1120 933 628 202 --130 --
NM_018254chr152407 1864 954 882 188 32433 1636 543 22051 967 1282
NM_018256chr21216 171 1245 --
NM_018285chr15133 ------
NM_018293chr392384 2255 2229 2094 1139 806 421 389 237 12789 ----
NM_018299chr852622 2503 2461 1300 134 13331 --23050 2240
NM_018302chr412467 --31875 660 125 12066
NM_018312chr1142160 1446 656 109 --11341 --
NM_018313chr34909 678 536 424 --1472 --
NM_018323chr471154 389 361 268 209 200 151 ------
NM_018325chr961340 614 428 366 234 181 --21521 334 --
NM_018327chr2041812 1576 668 398 ------
NM_018330chr1031674 1651 76 --11077 --
NM_018339chr92517 260 --21770 1703 11375
NM_018362chr11103766 3663 3567 2628 866 746 519 479 442 238 11379 21441 322 --
NM_018364chr152844 1413 434 157 113 23247 2923 21339 472 --
NM_018367chr1162477 2056 1909 1727 793 80 ----21830 994
NM_018371chr831227 286 160 ------
NM_018372chr12576 197 --1185 --
NM_018373chr1486494 6092 5960 5787 4623 4339 2002 454 34258 1615 439 --193
NM_018374chr7105086 4710 4531 3810 3513 3407 2004 1741 1550 112 11761 44425 4104 4044 547 11837
NM_018375chr1421899 1538 --1112 --
NM_018388chrX31127 410 281 1349 --2503 62
NM_018393chr112247 214 2471 89 ----
NM_018403chr354060 3625 3458 3074 471 11482 ----
NM_018409chr473049 2656 904 800 273 119 62 32779 758 661 --12428
NM_018416chr1262661 2574 2249 2124 739 288 ------
NM_018424chr941467 1367 513 193 21418 1313 ----
NM_018429chr562559 2401 2181 1822 845 60 22441 2158 1264 --
NM_018431chr205573 421 243 214 147 ------
NM_018433chr22189 155 ------
NM_018440chr898647 5243 3356 2946 2480 1951 1945 1571 1565 48630 8343 3327 3257 28731 8604 16732
NM_018442chr12345 72 ------
NM_018448chr12--130 1956 11109
NM_018452chr6_random22710 543 --1953 --
NM_018460chr2----159 --
NM_018466chrX3735 119 90 ------
NM_018469chr1761155 1113 1046 987 410 173 ------
NM_018471chr23178 154 59 ------
NM_018475chr4----2669 22 --
NM_018476chrX----158 --
NM_018482chr892363 2264 2040 2026 1898 604 494 269 250 --21863 791 --
NM_018489chr122249 2159 2893 850 12190 --
NM_018490chr1151848 1702 1670 1636 393 ------
NM_018509chr1731725 351 235 --21479 678 --
NM_018557chr251696 1186 628 362 227 ----11758
NM_018561chr64922 758 629 622 166 ----
NM_018566chr195047 4680 4555 3355 1155 1132 672 194 180 --13531 --
NM_018569chr461635 1607 1058 1005 998 561 --21463 575 --
NM_018571chr21433 129 ----
NM_018584chr11206 1262 1451 --
NM_018590chr1041490 1390 1206 667 ------
NM_018602chr1531627 1294 544 ----1226
NM_018638chr1264929 4893 4381 4200 979 228 34608 4169 1626 25412 3527 11446
NM_018640chr1232464 150 40 --22813 2200 12311
NM_018650chr151465 1379 620 456 314 --32012 720 369 --
NM_018667chr1672782 2140 860 630 574 262 254 ------
NM_018684chrX1932 11275 11246 --
NM_018693chr2191 ------
NM_018695chr542249 2241 611 571 ----11868
NM_018698chrX31826 1205 702 11807 21499 197 1490
NM_018703chr16----1149 --
NM_018710chr851166 958 363 274 164 --3863 387 234 --
NM_018712chr1121563 228 ------
NM_018718chr731758 246 92 --1292 --
NM_018841chr163569 2762 2481 1555 1175 765 ----13148
NM_018844chr731789 740 572 32090 1630 697 11752 1238
NM_018846chr71999 ------
NM_018898chr542143 2092 926 125 --32271 684 95 --
NM_018899chr542143 2092 926 125 --32271 684 95 --
NM_018900chr542143 2092 926 125 --32271 684 95 --
NM_018901chr542143 2092 926 125 --32271 684 95 --
NM_018902chr542143 2092 926 125 --32271 684 95 --
NM_018903chr542143 2092 926 125 --32271 684 95 --
NM_018904chr542143 2092 926 125 --32271 684 95 --
NM_018905chr542143 2092 926 125 --32271 684 95 --
NM_018906chr542143 2092 926 125 --32271 684 95 --
NM_018907chr542143 2092 926 125 --32271 684 95 --
NM_018908chr542143 2092 926 125 --32271 684 95 --
NM_018909chr542143 2092 926 125 --32271 684 95 --
NM_018910chr542143 2092 926 125 --32271 684 95 --
NM_018911chr542143 2092 926 125 --32271 684 95 --
NM_018940chr52964 131 1911 187 --
NM_018945chr623107 559 --12500 --
NM_018948chr121280 213 3286 278 33 11386 --
NM_018951chr731046 247 140 ------
NM_018970chr763132 2021 1170 1009 728 132 1319 ----
NM_018976chr1262478 2081 2002 1844 1138 396 ------
NM_018977chrX1924 ------
NM_018979chr1252464 2008 263 148 102 183 ----
NM_018993chr202561 455 11166 21208 69 --
NM_018999chr1054826 4675 1765 1408 55 23132 1371 11397 --
NM_019000chr52611 340 11679 ----
NM_019004chr782356 2317 2206 1867 1530 927 763 595 ------
NM_019022chr1843136 1142 130 88 --43157 2809 2429 2224 --
NM_019027chr462577 1972 1855 346 272 197 32467 489 396 1953 12134
NM_019028chr112385 312 ------
NM_019042chr73490 320 268 ------
NM_019045chrX2744 323 --3771 275 44 --
NM_019050chr4--2597 30 12125 --
NM_019058chr10----1749 --
NM_019063chr241874 1722 1560 39 ------
NM_019067chrX54708 3639 3126 1755 552 11165 23605 1807 23326 97
NM_019071chr7----1655 1124
NM_019080chr1341397 1267 603 456 --31251 549 192 --
NM_019084chr1042568 535 480 459 12232 --1567
NM_019087chr551641 1433 631 286 89 ------
NM_019114chr92661 447 1533 --1928
NM_019117chrX102825 2814 2732 2696 1230 976 846 729 618 521 21058 192 13202 --
NM_019555chr341840 1350 1182 35 ----1324
NM_019556chrX31148 249 184 --11006 --
NM_019590chr1051156 214 207 59 36 --1597 --
NM_019593chr2032044 331 263 1314 2636 502 --
NM_019594chr921661 1613 ------
NM_019862chr162674 43 ----11776
NM_019895chr321041 22 --2775 374 --
NM_019898chr162674 43 ----11776
NM_019899chr162674 43 ----11776
NM_019900chr162674 43 ----11776
NM_019903chr1051477 1284 479 410 144 --11656 --
NM_020039chr1221775 638 --2336 189 --
NM_020116chr451845 1377 684 72 38 1513 ----
NM_020120chr231169 1037 80 11405 ----
NM_020122chr2165602 5260 5159 4571 4306 4070 2198 2015 1795 1677 1564 1125 1117 574 372 116 ------
NM_020123chr1031429 596 380 --11058 --
NM_020130chr831023 905 896 ------
NM_020132chr2164467 4117 3414 3311 1367 387 --23282 1606 14788
NM_020141chr172401 2269 2120 2061 2015 1663 141 32219 646 287 ----
NM_020144chr751910 1685 1637 1448 447 --11377 --
NM_020148chr1862857 2189 2099 1087 910 580 22238 561 ----
NM_020150chr101820 --11437 --
NM_020159chr42241 123 --31182 387 66 --
NM_020177chr563115 3042 2747 2200 2099 150 ------
NM_020182chr2063646 3045 1126 748 389 271 --1148 --
NM_020193chr112996 237 --21346 474 1952
NM_020198chr1761478 1462 1298 1067 436 163 --21097 493 --
NM_020204chr14212 176 153 81 ------
NM_020225chr4----173 --
NM_020245chr684471 4459 3641 1101 690 582 491 423 --1765 --
NM_020336chr2042964 2478 1497 1157 --13223 --
NM_020337chr463030 2845 2101 2005 1003 121 12196 11970 1554
NM_020346chr11------11112
NM_020347chr392301 2289 1960 1708 912 880 718 572 257 --2786 306 --
NM_020378chr191583 ------
NM_020390chr3104584 4555 4289 3420 3195 3001 2983 1523 1480 722 --34786 833 397 13673
NM_020416chr462715 2419 2151 1782 1659 788 ------
NM_020424chr163656 221 24 ------
NM_020432chr712316 --2177 122 --
NM_020440chr143238 2342 699 557 --1147 12729
NM_020452chr132118 1884 1356 1406 11982 --
NM_020455chr632486 162 86 31987 780 236 1529 --
NM_020456chr1342153 803 395 32 2308 273 1710 12215
NM_020463chr231459 600 367 ------
NM_020465chr1651585 1575 1397 1377 1361 ------
NM_020466chr674683 4499 4072 3792 3315 1215 176 --24925 4544 --
NM_020473chrX52015 1924 508 386 47 11275 1127 --
NM_020474chr1861694 746 514 496 235 111 1205 --1592
NM_020526chr121550 570 11575 --11560
NM_020630chr10----1130 --
NM_020640chr3--1797 21600 784 42043 1854 1846 758
NM_020647chr841554 1482 378 60 --22122 1776 --
NM_020648chr1862820 2505 1989 1927 1797 615 1598 22780 2287 --
NM_020651chr241297 1176 359 26 11780 ----
NM_020653chr172407 31 ------
NM_020654chr321503 324 21417 1232 11220 --
NM_020666chr5--2938 27 ----
NM_020673chr20127798 7710 7422 6724 6411 5909 3030 2732 2700 1881 1498 227 --1895 --
NM_020686chr1622782 347 ----22929 2911
NM_020689chr2011277 ------
NM_020697chr81150 ------
NM_020699chr154493 4401 4245 2133 1006 14070 15234 --
NM_020708chr2042511 2073 1849 1534 ----190
NM_020711chr242545 2450 560 544 --11710 --
NM_020718chr1696266 6233 4794 4580 4086 2412 2363 1614 512 11106 12101 14417
NM_020727chr2134001 3343 780 --11190 1969
NM_020734chr1232413 844 184 12316 --1428
NM_020737chr6----199 --
NM_020739chr1574252 3458 2907 1595 1582 1249 654 ----11216
NM_020742chrX62540 2423 2192 1076 875 599 --12480 --
NM_020747chr52817 791 ------
NM_020748chr171729 138 --159
NM_020749chr841493 845 675 52 11619 21607 1531 --
NM_020752chr1082934 2624 2529 2421 2322 2104 2060 617 --12718 --
NM_020755chr641551 1280 501 266 ------
NM_020760chr281937 1722 1640 1458 1389 1375 578 503 --11673 --
NM_020766chrX43548 1807 353 103 ------
NM_020768chr532999 2286 1157 1289 33039 813 494 --
NM_020769chrX6971 954 936 839 643 84 ------
NM_020771chr641463 1270 620 467 --2506 312 --
NM_020772chr17108593 7436 6967 5257 2216 1950 1936 1279 696 33 57958 7298 5737 5370 748 28063 5728 18425
NM_020773chr432389 1659 239 12601 1413 --
NM_020774chr18105867 5716 5027 4659 4652 4302 1392 961 781 382 --24884 4562 11379
NM_020778chr1574145 3023 1243 745 423 338 290 --21405 328 --
NM_020782chr1233136 1531 1321 11868 ----
NM_020783chr1821566 682 1507 168 --
NM_020786chr1671541 1508 810 577 492 390 243 ------
NM_020791chr1751328 1277 1162 978 508 11116 ----
NM_020794chr14573 547 168 130 11270 11442 11409
NM_020796chr522665 844 --23056 2746 --
NM_020801chr531728 614 343 ------
NM_020802chr1143353 3328 769 575 ----12242
NM_020803chr441506 827 685 585 1726 1965 --
NM_020805chr1861484 556 440 365 258 182 --11782 --
NM_020806chr141132 ------
NM_020809chr1142315 2109 2080 292 11728 1409 --
NM_020810chr1472506 2412 2229 660 427 123 38 ----21066 651
NM_020819chr63787 333 323 --1966 --
NM_020821chr1532058 210 56 --11739 --
NM_020824chr101146 1252 1717 --
NM_020830chr2123198 3124 3041 3034 2964 2746 2623 2362 974 922 587 526 12903 12498 --
NM_020841chr1254056 3672 2462 1074 329 --13345 33485 622 253
NM_020843chr151138 ------
NM_020844chr8107256 6867 6113 5904 5888 5546 1355 785 566 119 25586 4896 26479 1165 --
NM_020854chr1821345 1147 11096 ----
NM_020858chr1522311 1478 --1671 --
NM_020859chr483886 3617 2929 2609 1582 1181 647 417 1861 13817 --
NM_020860chr43888 735 245 2428 188 1415 --
NM_020861chr62879 37 ------
NM_020870chr41297 ------
NM_020871chrX42435 2335 1869 136 1609 3575 403 338 --
NM_020872chr361643 1601 1497 1443 622 582 1223 21430 336 1216
NM_020886chr111136 11199 1518 --
NM_020899chr1752462 2449 2015 1945 1918 --1553 1833
NM_020917chr1952931 2858 2511 1418 1145 11538 --13145
NM_020918chr102500 375 11387 1178 --
NM_020921chr1442482 1467 1151 1004 1427 11031 13664
NM_020922chrX31401 1269 388 21251 128 ----
NM_020927chr1631749 840 120 ----12375
NM_020929chr111107 ------
NM_020935chr234039 3373 646 136 23139 682 --
NM_020940chr1032799 2657 2175 --42948 1047 964 630 1214
NM_020948chr132582 1457 691 12778 23213 1142 11373
NM_020951chr1972382 2041 1994 710 429 371 263 6865 851 790 778 757 636 1344 --
NM_020962chr1552264 1707 1700 511 226 12176 2825 578 --
NM_020964chr1844832 3073 3027 1500 11215 33199 470 46 --
NM_020975chr1021626 1616 ------
NM_020980chr1541690 1448 693 400 --11556 1151
NM_020987chr103403 317 202 ------
NM_021003chr142724 128 1760 ----
NM_021005chr1541033 891 466 190 ------
NM_021007chr251939 865 393 114 42 --1516 1760
NM_021032chr341730 1594 490 137 ------
NM_021033chr1362526 2163 1360 253 225 105 22865 2387 --13007
NM_021061chr894252 3901 3754 2850 1290 374 340 92 41 1619 11168 --
NM_021064chr631662 650 426 11630 ----
NM_021072chr531011 933 829 --22138 445 12043
NM_021083chrX43599 3390 2782 1314 ----11118
NM_021090chr2233488 3141 1969 13330 24496 4243 --
NM_021097chr222544 1940 ------
NM_021106chr91504 ------
NM_021111chr92422 181 --21194 260 --
NM_021116chr798297 7398 7385 7065 6824 5915 5642 1826 636 --1911 --
NM_021132chr1031117 533 301 ------
NM_021136chr14----1615 --
NM_021145chr72904 253 1799 ----
NM_021159chr431661 1095 248 2335 302 ----
NM_021161chr14--1111 ----
NM_021163chr752728 2338 769 703 392 23795 1460 13529 23350 281
NM_021183chrX42378 935 757 83 --11648 --
NM_021190chr131161 214 199 --11323 --
NM_021194chr11247 ------
NM_021239chr1411017 --11058 --
NM_021249chr141282 --11296 --
NM_021252chr1021422 198 11630 31470 1437 261 11393
NM_021255chr1474096 3771 3226 1447 1127 344 21 ------
NM_021619chr911218 ------
NM_021622chr1072270 1827 1799 1578 953 885 406 --1786 --
NM_021627chr32410 91 ----1971
NM_021629chr384727 4650 4612 1339 1245 943 877 121 14394 ----
NM_021637chrX41013 983 233 121 --21116 156 --
NM_021642chr121378 1255 1193 11279 --
NM_021643chr211265 ------
NM_021645chr1352212 2109 2039 1703 676 12241 ----
NM_021647chr484016 3931 1818 1535 879 606 593 358 11046 ----
NM_021648chr652551 2369 1766 245 26 --31719 697 210 --
NM_021784chr20----1644 1224
NM_021813chr685535 5508 3739 3649 2002 1789 494 395 --14116 15526
NM_021814chr611681 --11526 11608
NM_021818chr1411026 --21385 129 --
NM_021911chr541571 1252 834 227 12025 13419 --
NM_021912chr1563850 3328 3233 3057 1259 600 13133 1860 --
NM_021956chr621038 178 ------
NM_021960chr121926 708 12516 21994 751 --
NM_021961chr11137530 6338 5441 5316 4986 4802 2419 2114 2057 1794 1193 379 316 ------
NM_021964chr3126255 5665 4488 4267 4061 2637 1654 1214 828 422 193 154 12003 56613 5923 5505 4292 1519 22344 900
NM_021973chr41666 ------
NM_021998chrX21281 1063 --21235 116 1961
NM_021999chr13----161 1762
NM_022037chr2----1872 --
NM_022045chr81224 ------
NM_022048chr15106006 5658 5333 5073 2518 2156 919 636 412 284 --22290 1820 12170
NM_022051chr12723 183 --1251 --
NM_022058chr231675 1371 672 --11485 1120
NM_022062chr111347 ------
NM_022066chr171985 ------
NM_022087chr7----1555 1643
NM_022114chr154200 3649 3527 3398 1682 --14492 --
NM_022118chr13--2466 250 1566 276 24
NM_022130chr521279 118 ----1455
NM_022133chr82694 208 1302 2506 498 1134
NM_022154chr421234 301 ------
NM_022166chr1646115 4995 2290 512 --11594 --
NM_022173chr2----1872 --
NM_022336chr272292 1565 830 824 792 719 412 ------
NM_022337chr113661 532 198 ------
NM_022351chr883859 3618 3171 3163 2530 1025 234 150 22546 764 ----
NM_022444chr751887 1855 1621 676 253 --1442 --
NM_022456chr12137140 7025 6791 6706 5864 4698 2835 2433 2380 2210 1897 1808 684 1988 56821 6237 1277 808 467 --
NM_022459chr13106268 5587 4848 4343 1674 1613 1541 1494 422 38 --35104 4264 2102 --
NM_022461chr32437 339 --2279 126 --
NM_022473chr1534394 4163 3861 --1752 --
NM_022474chr1442785 819 665 197 1974 ----
NM_022475chr42271 210 1729 ----
NM_022476chr161945 ------
NM_022477chr2041714 670 485 394 21736 625 ----
NM_022482chr2052509 1861 1774 1605 119 12136 1199 --
NM_022491chr1282971 2851 2838 2182 1402 1174 1110 902 ------
NM_022495chr14------1363
NM_022550chr5--1120 ----
NM_022552chr22786 449 ----1461
NM_022566chr151550 ------
NM_022574chr721965 176 ------
NM_022716chr121123 1077 1364 1682 --
NM_022725chr1162123 1765 1735 1585 545 43 11873 ----
NM_022726chr631494 1307 430 11384 ----
NM_022733chr11887 --1403 --
NM_022735chr131531 269 260 11341 1420 11783
NM_022739chr173850 303 278 --1135 --
NM_022755chr93686 458 401 12567 ----
NM_022756chr121382 1265 --11292 --
NM_022757chr32889 54 ----1410
NM_022763chr343151 2027 916 114 12609 22205 1957 --
NM_022768chr1----1131 --
NM_022771chr123380 148 136 ------
NM_022780chr241480 1209 586 107 --1599 --
NM_022781chr9--22063 505 1950 --
NM_022782chr122322 114 --1359 --
NM_022802chr1031581 420 336 1571 ----
NM_022818chr1631591 1094 206 --11447 --
NM_022824chr551961 1783 1275 715 474 1150 21550 371 --
NM_022826chr221001 416 1110 ----
NM_022831chr11375 --1707 --
NM_022832chr452592 2524 2483 954 324 11838 22401 160 --
NM_022841chr1542173 884 547 327 --11835 --
NM_022843chr1321361 139 --1121 --
NM_022844chr163946 362 154 --1715 --
NM_022845chr1682146 1853 1748 1383 591 535 497 184 --12130 139
NM_022893chr232668 2016 565 1487 33150 839 333 --
NM_022894chr231364 1097 241 2674 200 1702 --
NM_022898chr1413457 2943 752 ----
NM_022900chr731127 1031 412 --1267 --
NM_022901chr961622 1575 1390 1277 694 219 1212 11614 --
NM_022902chr5----2429 346 --
NM_022910chr1651585 1575 1397 1377 1361 ------
NM_022912chr242584 2184 2169 465 --1698 --
NM_022918chr1121877 405 --22190 392 2438 291
NM_022965chr431310 1116 611 ----11288
NM_022970chr1031474 1288 435 ------
NM_022977chrX22430 981 12171 ----
NM_023000chr1431578 1501 669 ------
NM_023001chr1431578 1501 669 ------
NM_023012chr121727 ------
NM_023016chr242339 2154 1105 433 --12531 --
NM_023074chr1921023 104 1848 1961 --
NM_023105chr821971 1578 1757 1675 --
NM_023106chr821971 1578 1757 1675 --
NM_023110chr821971 1578 1757 1675 --
NM_023111chr821971 1578 1757 1675 --
NM_023923chr111506 ----11038
NM_023925chr121346 ------
NM_023929chr872380 2336 1969 817 319 213 32 12478 22094 1718 21990 1733
NM_023943chr32185 154 ------
NM_024007chr562833 2297 425 338 304 185 1760 ----
NM_024052chr171859 --42457 1996 923 290 --
NM_024054chr72328 89 ----1242
NM_024295chr832001 1820 248 ------
NM_024311chr171165 191 ----
NM_024339chr16172 ------
NM_024341chr1943907 3872 485 192 ----13889
NM_024416chr911154 1155 1188 --
NM_024423chr1873890 3876 3536 3288 942 766 188 --32979 2913 1097 --
NM_024490chr151567 ------
NM_024501chr22620 169 ------
NM_024511chr462949 2679 1228 1103 869 827 1255 12532 --
NM_024513chr373342 2895 2461 2327 804 409 168 ----13205
NM_024519chr162294 284 ------
NM_024524chr343091 2959 2521 214 22238 242 ----
NM_024529chr121031 361 ------
NM_024539chrX3921 819 395 ------
NM_024546chr1331248 439 88 11163 21237 1216 --
NM_024556chr112464 391 --1327 1483
NM_024557chr1131453 1308 1263 --11337 --
NM_024561chr131391 ----1168
NM_024569chr142243 1814 684 357 ----1308
NM_024581chr62182 171 1252 ----
NM_024590chr431808 1227 747 --11696 --
NM_024613chr851886 1869 513 307 194 --21840 671 --
NM_024616chr331543 1116 155 --11461 --
NM_024624chr261316 1030 515 413 407 339 ------
NM_024631chr112621 428 ----1415
NM_024646chr193861 3626 3375 3212 3199 3041 1316 1299 278 --1812 23942 3906
NM_024665chr394341 4249 3792 3641 3208 1800 1413 1351 1186 --34399 4189 1330 --
NM_024670chr103411 249 113 --11463 --
NM_024699chr84840 790 714 47 1862 1592 --
NM_024700chr121145 920 11055 1911 --
NM_024713chr1551447 1317 1039 261 62 21017 324 1660 --
NM_024721chr862371 2211 2172 1858 681 215 12402 21802 982 12716
NM_024725chr111165 --2815 101 1682
NM_024740chr11103878 3640 3626 3373 1624 1165 1082 1063 980 675 14154 24148 205 --
NM_024744chr262181 937 834 754 564 26 --1538 12662
NM_024749chr161994 1913 1778 1522 601 49 ------
NM_024761chr9105219 4442 4303 4043 4007 1975 1835 1755 1239 283 15082 24479 1950 25192 934
NM_024763chr141201 1027 903 175 172 11098 --
NM_024770chr2106481 5611 5231 4984 4562 4141 4069 1285 1244 235 36566 2329 2307 16029 --
NM_024812chr831927 1896 1582 1220 11911 --
NM_024817chr1585752 5117 4801 4130 4045 3918 1134 174 15770 44669 3761 3696 1360 15198
NM_024824chr1451731 1592 1291 681 70 ------
NM_024828chr931358 391 267 --11075 --
NM_024835chr171342 ------
NM_024837chr1551825 1684 1619 1570 1550 1331 ----
NM_024887chr131647 1639 1334 ------
NM_024899chr182265 49 ------
NM_024900chr431850 1460 339 ------
NM_024900chr431850 1460 339 ------
NM_024913chr731636 653 382 --11456 11416
NM_024921chrX31714 1456 354 --163 --
NM_024927chr171209 ------
NM_024930chr552685 2624 880 769 476 22595 1130 12630 --
NM_024941chr521382 209 ------
NM_024944chr2131018 384 102 1862 ----
NM_024947chr3189624 9072 6826 5819 3662 3654 3298 2262 2020 1884 1722 1429 1145 1047 523 221 213 153 12619 39112 8405 354 --
NM_024948chr101755 --1714 --
NM_024949chr453356 2005 1931 1877 1074 11628 ----
NM_024953chr1252698 2409 2230 318 34 ------
NM_024979chr1341576 1344 1194 412 --1506 1568
NM_024989chr2118047 8007 7693 7216 5342 2975 2696 1973 1786 558 120 47312 6999 6598 690 46605 6393 5402 2864 16483
NM_025040chr1942055 1539 492 263 11926 12011 --
NM_025054chr883858 3644 2863 1538 1150 999 860 204 ------
NM_025073chr153800 3146 1622 1253 192 43255 3089 1477 1001 1835 31851 950 344
NM_025077chr11236 ------
NM_025104chr1731492 1197 257 --198 --
NM_025134chr1672552 1739 1636 633 475 389 364 32299 1797 669 2616 451 12112
NM_025146chr332738 2183 1952 ------
NM_025151chr842099 1959 1415 1369 1449 11421 12198
NM_025152chr1462005 1994 1442 675 240 192 --11877 --
NM_025154chr721077 194 21376 1353 ----
NM_025160chr183673 3259 2991 2613 1586 603 260 158 --14248 --
NM_025181chr23723 599 233 ------
NM_025184chrX6833 766 712 308 176 160 ------
NM_025191chr133327 2979 2629 31238 1228 977 12356 22762 668
NM_025202chr231033 397 325 ------
NM_025208chr1172449 2280 2100 1975 1521 192 22 3612 521 334 ----
NM_025222chr382142 1955 1219 915 609 522 445 382 --1120 12973
NM_025235chr1061933 809 527 514 484 374 --41842 552 441 65 --
NM_025268chr141391 ------
NM_030567chr51126 ------
NM_030621chr1484186 3632 3615 3581 3537 3487 1643 873 13982 21691 727 --
NM_030627chr583231 3104 3006 2946 2930 2884 2858 2612 --1942 --
NM_030637chr143639 277 187 ------
NM_030647chr7136130 5286 4876 4815 4686 4090 1903 1877 1519 1171 716 481 145 15296 26344 1137 --
NM_030648chr475390 5076 4819 1924 594 442 58 15133 35439 3853 661 --
NM_030660chr1421209 1021 ------
NM_030664chr1042281 1822 757 465 1733 1269 1587
NM_030665chr17--1945 --1934
NM_030674chr12135856 5543 5423 5015 4566 3982 2113 1838 1481 1080 458 165 91 --25104 1595 15044
NM_030751chr1061873 1770 1697 1605 1517 503 ------
NM_030751chr1061873 1770 1697 1605 1517 503 ------
NM_030752chr61531 ------
NM_030755chr1473004 2188 1979 1078 684 569 547 --4956 845 304 140 --
NM_030759chr101519 ----1644
NM_030762chr1221910 1871 ------
NM_030775chr121606 --153 169
NM_030777chr2092487 2471 2447 2333 2317 1614 1550 1534 259 --12291 11700
NM_030780chr831325 1132 117 --1275 185
NM_030786chr141455 495 443 434 --11709 11653
NM_030791chr141556 1427 ----
NM_030801chrX1185 ------
NM_030806chr1129424 8759 7629 7038 6258 5732 2829 1230 1045 343 318 287 28416 1783 ----
NM_030809chr1232219 1950 531 --12479 --
NM_030816chr152953 2754 1483 648 308 1988 63201 2866 2273 360 354 348 --
NM_030820chr611026 1410 ----
NM_030881chr2231834 783 41 ------
NM_030885chr342369 1442 277 200 ------
NM_030918chr194741 4105 3404 1685 1588 1425 1383 1300 1134 ------
NM_030920chr141590 1540 1360 315 11794 --11840
NM_030922chr15----2742 243 --
NM_030934chr141766 1394 333 57 ------
NM_030939chr64920 897 832 242 ------
NM_030949chr621503 440 ------
NM_030953chr53486 244 33 ------
NM_030958chr82493 103 ------
NM_030962chr1121583 150 --11178 --
NM_031216chr1832218 1392 663 --11978 --
NM_031243chr772282 2255 1795 1766 849 690 643 --11612 --
NM_031266chr51467 ------
NM_031267chr72441 396 ------
NM_031268chr16105242 5236 4728 4652 3906 3747 3654 1739 1608 1324 1585 11127 --
NM_031283chr21142 ------
NM_031291chr42502 122 158 1461 --
NM_031296chr442748 2271 731 548 ------
NM_031305chr431806 154 131 11437 ----
NM_031314chr1421967 732 11988 12053 --
NM_031362chr252698 2612 1874 944 194 --11750 --
NM_031365chr252834 2748 2010 1080 330 --21886 1845 --
NM_031366chr252834 2748 2010 1080 330 --21886 1845 --
NM_031371chr121549 593 --11370 --
NM_031371chr121549 593 --11370 --
NM_031411chr542143 2092 926 125 --32271 684 95 --
NM_031418chr1152727 2513 1936 1036 505 --41962 1111 579 491 --
NM_031422chr182536 72 ------
NM_031431chr1341612 1281 353 70 ------
NM_031435chr1273047 3013 2879 2512 2464 773 198 --1511 --
NM_031442chrX32503 441 188 --63026 2608 729 277 170 60 --
NM_031445chr283331 3224 3158 2693 2114 1076 831 702 23396 3126 12977 --
NM_031452chr152535 98 --187 --
NM_031461chr862084 1996 831 258 236 154 1270 1288 11688
NM_031469chr632732 1195 914 --11267 --
NM_031475chr1--1267 ----
NM_031479chr1211137 ------
NM_031483chr2092690 2683 2270 2218 1293 685 578 345 190 1975 11260 --
NM_031844chr133570 3279 1341 14059 3817 733 254 11174
NM_031845chr243412 3363 1121 325 --1218 12334
NM_031847chr243412 3363 1121 325 --1218 12334
NM_031849chr542143 2092 926 125 --32271 684 95 --
NM_031857chr542143 2092 926 125 --32271 684 95 --
NM_031858chr1731350 1147 1047 ------
NM_031860chr542143 2092 926 125 --32271 684 95 --
NM_031862chr1731350 1147 1047 ------
NM_031889chr421849 52 1622 11359 --
NM_031892chrX1359 ------
NM_031915chr131285 --1223 --
NM_031922chr63494 401 130 --2545 505 1385
NM_031935chr11293 ----1978
NM_031954chr1232539 2347 1094 12155 ----
NM_032012chr9124884 4627 4386 3818 3268 3211 1912 1535 1096 1015 659 319 35104 1927 138 21086 1009 --
NM_032013chr2041714 670 485 394 21736 625 ----
NM_032025chr32197 110 --11648 --
NM_032042chr562700 2467 2058 1046 721 661 ----1651
NM_032047chr352424 1937 1865 1577 77 --11623 1874
NM_032105chr176254 5756 3039 1694 665 298 278 --58083 6820 5514 521 288 --
NM_032121chrX42849 2155 778 428 ------
NM_032128chr42970 751 1893 --1909
NM_032142chr182200 65 134 ----
NM_032144chr22369 56 ------
NM_032145chr631801 1317 396 2528 243 ----
NM_032156chr121346 ------
NM_032160chr1873721 3320 3309 1708 1608 1060 1043 --32859 1690 1119 23235 3119
NM_032182chr1041642 1494 351 340 --1539 --
NM_032186chr121260 1039 ----21025 174
NM_032189chr1344536 4407 3670 1767 --12013 --
NM_032199chr1023185 790 11027 11163 --
NM_032208chr253438 2612 2541 1352 1187 13343 ----
NM_032217chr4----11198 1400
NM_032221chr2031745 1670 679 ------
NM_032228chr1183088 2716 2585 2416 639 604 210 31 11129 --11122
NM_032229chr1311056 ------
NM_032246chr152315 273 --2960 222 21358 1303
NM_032250chr94854 570 357 294 --190 --
NM_032256chr125881 860 793 412 253 ------
NM_032268chr1662921 2209 1280 367 305 126 ------
NM_032288chr342330 2296 1468 901 ------
NM_032312chr21822 --1104 --
NM_032321chr273197 2760 2676 929 781 735 116 13015 12337 --
NM_032329chr244287 3724 1311 223 --13560 --
NM_032352chr143949 339 330 --11208 --
NM_032373chr10125419 5266 5237 5027 4060 2069 1899 1746 1321 1254 852 416 34434 2256 1470 23833 3600 1212
NM_032410chr811139 11233 11173 --
NM_032413chr154267 106 60 37 --1125 --
NM_032435chr1----12095 12387
NM_032439chr1031143 614 588 ------
NM_032440chr10102880 2016 1052 914 591 477 402 300 231 51 1851 --12395
NM_032445chr1551940 1665 1031 699 105 ----1569
NM_032446chr553845 3045 3035 2527 2520 --13718 --
NM_032452chr1411316 --11082 1263
NM_032456chr45613 580 435 245 122 ------
NM_032457chr433923 1554 742 13154 133 --
NM_032458chrX52939 2591 1325 719 626 --32709 2095 308 --
NM_032466chr841641 1323 225 217 --21274 560 --
NM_032468chr841641 1323 225 217 --21274 560 --
NM_032482chr1922735 329 --12742 2313 298
NM_032499chr1531688 1679 597 --11740 --
NM_032505chr332570 1853 1031 12476 12028 --
NM_032509chr831854 1808 315 11654 --11024
NM_032510chr1872416 1905 1725 536 302 214 71 ------
NM_032521chr2033226 2574 561 --33096 3075 2247 --
NM_032558chr931495 1148 181 ----127
NM_032560chr14----2937 802 --
NM_032574chr2----147 --
NM_032580chr17----1149 1164
NM_032582chr1731822 1694 1187 ------
NM_032590chr124460 453 246 55 1866 11011 --
NM_032622chr441467 375 227 65 ------
NM_032626chr162293 252 --1280 --
NM_032632chr1431784 1637 267 ------
NM_032642chr121606 --153 169
NM_032682chr352941 2913 869 455 122 ----12851
NM_032689chr1931625 1590 579 ----1451
NM_032777chr811438 ------
NM_032778chr342525 2277 2075 612 13034 23146 668 --
NM_032787chr31313 ------
NM_032793chr11286 ------
NM_032801chr1132308 2138 1013 --1747 --
NM_032810chr1021529 606 1160 ----
NM_032812chr102241 37 ------
NM_032828chr1974874 4197 3612 1464 639 580 420 ------
NM_032832chr641207 1062 115 78 --11549 --
NM_032833chr152597 1916 845 697 269 --2618 464 --
NM_032837chr1742092 794 735 698 --22047 124 --
NM_032838chr1921096 373 --1430 --
NM_032859chr1383936 3659 3564 2612 2437 1474 1458 418 13475 43924 1164 492 160 12935
NM_032873chr11114123 3837 3757 3663 3528 3041 2976 2807 1235 906 833 11579 21791 1440 --
NM_032875chr172787 691 ------
NM_032900chr1083756 3484 2727 2541 2456 1109 1027 105 ------
NM_032949chr131520 ------
NM_032961chr431155 444 259 --11164 21117 923
NM_032968chrX83746 3148 3058 3010 1073 676 608 135 --23761 1181 13137
NM_032969chrX83746 3148 3058 3010 1073 676 608 135 --23761 1181 13137
NM_032973chrY93738 3143 3053 3005 2685 1073 676 608 135 --23753 1181 13132
NM_032975chr1863254 2911 2756 2247 445 309 --33620 2381 1175 --
NM_032978chr1821175 391 ------
NM_032979chr1821175 391 ------
NM_032980chr1863254 2911 2756 2247 445 309 --33620 2381 1175 --
NM_032981chr1821175 391 ------
NM_033012chr133405 285 167 ------
NM_033014chr911154 1155 1188 --
NM_033020chr144352 3821 1455 144 --12942 13940
NM_033030chr241116 457 264 195 --11144 --
NM_033055chr121030 873 1279 1124 --
NM_033081chr2041252 1082 376 166 ------
NM_033083chr373430 3103 2519 1172 1040 611 439 --23369 1234 --
NM_033088chr11504 --1710 1647
NM_033105chr81363 1148 ----
NM_033119chr165926 887 691 280 146 1206 ----
NM_033132chr1331789 874 556 --21981 440 --
NM_033135chr1172449 2280 2100 1975 1521 192 22 3612 521 334 ----
NM_033138chr781840 1818 1626 1533 825 585 412 156 11975 ----
NM_033139chr781840 1818 1626 1533 825 585 412 156 11975 ----
NM_033140chr781840 1818 1626 1533 825 585 412 156 11975 ----
NM_033143chr4133907 3877 3781 3297 3209 3045 2992 1734 1713 1674 651 383 277 34549 3527 634 44180 967 894 777 --
NM_033157chr781840 1818 1626 1533 825 585 412 156 11975 ----
NM_033181chr683852 3116 2413 1471 966 746 397 198 11525 23494 567 --
NM_033208chr161121 ------
NM_033211chr542084 1677 1529 715 ------
NM_033222chr971267 959 545 482 393 321 195 11338 1535 --
NM_033224chr798054 7726 7302 7207 2186 1786 1706 1377 523 --38062 1490 815 --
NM_033225chr873008 2702 2046 1981 707 235 178 ------
NM_033227chr51524 1572 ----
NM_033228chr51564 1612 ----
NM_033255chr131474 ------
NM_033276chr122271 239 --1355 --
NM_033281chr5146 ------
NM_033285chr893630 1611 1583 1512 1222 656 464 91 46 --23331 1795 13041
NM_033290chrX61423 1226 1209 899 325 230 12707 ----
NM_033305chr931356 1020 985 ------
NM_033326chr1162137 1736 1633 882 495 102 ------
NM_033360chr1284197 3281 2885 1751 1436 889 726 26 23655 3542 24015 895 23090 1779
NM_033380chrX2839 785 2742 120 ----
NM_033381chrX2839 785 2742 120 ----
NM_033389chr172829 614 11067 23660 1736 --
NM_033394chr231603 431 310 ------
NM_033402chr82554 108 ------
NM_033407chr1129 ----1564
NM_033425chr1163406 3358 3036 2430 2169 667 --13046 12778
NM_033427chr72799 588 1728 ----
NM_033429chr1562578 2541 2389 2282 721 573 ----12595
NM_033430chr453433 3161 3084 50 32 1179 11255 --
NM_033437chr453433 3161 3084 50 32 1179 11255 --
NM_033450chr61302 --183 --
NM_033480chr662856 2564 2554 2274 2140 1187 ------
NM_033481chr662856 2564 2554 2274 2140 1187 ------
NM_033495chrX2320 257 ------
NM_033505chr295472 4990 4222 4189 2655 1752 1548 1158 276 16072 26365 6172 --
NM_033512chr842748 2454 2260 591 2977 55 2265 180 --
NM_033535chr431110 354 242 1787 ----
NM_033540chr311082 --1938 --
NM_033549chr53671 662 651 --1228 --
NM_033551chr532962 1298 342 --22509 191 --
NM_033644chr532260 318 55 ------
NM_033645chr532260 318 55 ------
NM_033656chr2185540 5141 4700 4544 4266 2107 425 392 34667 773 253 --34995 1318 1015
NM_044472chr11605 ------
NM_052832chr852640 2499 2369 501 372 1143 23021 927 --
NM_052834chr1862404 2100 1883 1826 1599 213 --32298 2202 515 --
NM_052840chr1511180 ----1387
NM_052854chr111447 ------
NM_052860chr51364 11003 ----
NM_052875chr11----12083 --
NM_052879chr1253433 2791 1205 479 62 11554 11395 --
NM_052880chr2211385 11437 11460 11403
NM_052885chr1254504 3961 1348 631 207 44541 1460 950 370 13868 14914
NM_052886chr811699 11765 3679 415 208 --
NM_052898chr831282 649 612 ------
NM_052900chr861706 1488 655 436 333 193 ------
NM_052903chr151538 ------
NM_052905chr261915 1774 1557 1370 490 250 ------
NM_052906chr221235 --15085 --
NM_052910chr133638 519 346 11747 11982 1374
NM_052911chr182238 208 --1259 --
NM_052913chr6125 ------
NM_052917chr2113424 3058 2769 2262 2120 1135 850 565 537 453 34 21277 1084 ----
NM_052927chr541583 1489 723 135 11607 11720 --
NM_052936chrX1845 ------
NM_052937chr882749 2562 2126 1689 1015 754 693 581 --1726 --
NM_052950chr1361941 1785 1652 888 447 258 --12212 --
NM_052954chr2162250 2043 1962 1956 1543 1502 11717 1689 1404
NM_053002chr33222 132 120 --1475 --
NM_053016chr9148048 6541 6289 6238 6041 5762 5420 5256 5249 5169 2536 2414 1836 1567 32885 2093 549 15039 36911 6089 2123
NM_053023chr1172304 2174 2141 1278 1153 901 728 22708 2547 22654 2199 --
NM_053024chr321555 1480 ------
NM_053042chr442847 2683 2073 363 12125 13059 --
NM_053056chr1122447 2066 ------
NM_053064chr1442598 2398 793 702 12977 22614 2047 12510
NM_053281chrX1139 ----123
NM_054016chr111855 ------
NM_054016chr111855 ------
NM_054016chr111855 ------
NM_054111chr64959 894 652 147 ----1134
NM_057159chr951420 1376 1136 1112 1000 1507 --11025
NM_057169chr1253170 2207 2101 597 86 13008 ----
NM_057170chr1253170 2207 2101 597 86 13008 ----
NM_057175chr451748 1038 515 376 76 ------
NM_057182chr192495 90 ------
NM_057749chr85522 483 271 220 78 ------
NM_058170chr141450 1429 202 56 11334 ----
NM_058172chr421750 1192 --2402 197 --
NM_058237chr141943 --3704 390 317 --
NM_058240chr1451719 1251 1152 1133 210 --21729 1537 --
NM_058241chr252329 1962 1867 460 243 11986 --1814
NM_058241chr252329 1962 1867 460 243 11986 --1814
NM_078476chr661777 1745 644 617 205 103 11765 11759 --
NM_078483chr583368 3132 3058 2740 1229 1188 242 21 --1827 --
NM_078629chrX1586 ------
NM_078630chrX1586 ------
NM_080546chr932325 2155 236 ------
NM_080597chr182131 35 3861 773 341 1696 --
NM_080599chr1021100 877 --11154 --
NM_080654chr1131079 356 214 1440 ----
NM_080664chr1441957 208 142 22 ------
NM_080666chr143508 404 338 11052 2428 361 --
NM_080669chr1774943 4753 4582 3658 1608 927 66 14201 ----
NM_080676chr2053272 2987 2269 164 145 1791 ----
NM_080683chr43543 206 177 1472 ----
NM_080684chr43543 206 177 1472 ----
NM_080685chr43543 206 177 1472 ----
NM_080743chr621901 339 --32531 2148 240 --
NM_080759chr1341900 1628 522 149 12005 22549 2378 12471
NM_080760chr1341900 1628 522 149 12005 22549 2378 12471
NM_080867chr14124671 4582 3760 3100 1823 1446 1181 1097 703 400 251 88 14575 14133 --
NM_080872chr8113099 3090 2944 2692 2629 2599 1533 1234 1063 988 843 22588 196 33130 3114 1280 14029
NM_080927chr342948 2342 1206 463 193 12921 --
NM_130385chr1152442 2280 2051 1189 551 ------
NM_130387chr33956 874 142 1386 ----
NM_130391chr9113533 3493 3361 3152 3045 3011 2297 1378 771 739 251 1611 ----
NM_130392chr9113533 3493 3361 3152 3045 3011 2297 1378 771 739 251 1611 ----
NM_130393chr9113533 3493 3361 3152 3045 3011 2297 1378 771 739 251 1611 ----
NM_130435chr1062831 2590 645 625 552 333 --1527 --
NM_130436chr2122204 680 ----12416
NM_130438chr2162781 2099 1257 583 480 185 ----12993
NM_130439chr1051893 1859 675 579 349 ----11720
NM_130439chr1051893 1859 675 579 349 ----11720
NM_130469chr143771 727 646 ------
NM_130768chr7----194 --
NM_130795chr91504 ------
NM_130808chr31336 ------
NM_130809chr541225 846 709 253 ------
NM_130838chr1511164 2271 214 11257 --
NM_130839chr1511164 2271 214 11257 --
NM_133170chr2098086 8009 7601 7481 6815 5248 5192 583 157 --36336 5126 423 --
NM_133171chr20164 11098 ----
NM_133264chr1763636 3316 1469 712 223 85 --1197 12774
NM_133326chr1----1333 --
NM_133338chr51395 ----1478
NM_133339chr51395 ----1478
NM_133340chr51395 ----1478
NM_133341chr51395 ----1478
NM_133342chr51395 ----1478
NM_133343chr51395 ----1478
NM_133344chr51395 ----1478
NM_133367chr631305 801 590 11019 12955 13455
NM_133370chr433050 1462 70 --63204 2631 1395 1384 736 385 --
NM_133372chr572522 2392 1004 898 664 424 281 12549 12601 32794 826 136
NM_133433chr52678 28 1861 ----
NM_133443chr1662270 2022 1945 1827 1818 297 --1201 --
NM_133473chr1961835 1818 1402 1257 597 430 ------
NM_133474chr421135 589 --11445 --
NM_133477chr452257 1269 1209 834 528 --23154 2409 --
NM_133478chr232444 1794 1636 ----1644
NM_133486chrX2439 310 1378 --191
NM_133496chr153657 3522 3482 1719 1316 --23606 3584 --
NM_133503chr121666 ------
NM_133504chr121666 ------
NM_133505chr121666 ------
NM_133506chr121666 ------
NM_133638chr531008 190 42 199 ----
NM_133642chr2231317 888 201 --11238 --
NM_133646chr285169 4895 4476 4425 3432 1524 373 109 1262 1132 14492
NM_133647chr1593062 2877 2430 1471 1194 825 508 180 48 --13877 23817 3442
NM_134266chr81401 ------
NM_134427chr91504 ------
NM_134428chr92248 32 --1298 --
NM_134447chr194545 414 82 66 --128 --
NM_138270chrX63364 3129 1279 1252 1132 832 12725 13222 22846 389
NM_138286chr1953811 3615 2703 883 760 --13821 --
NM_138288chr1442193 1546 1496 853 ------
NM_138290chr7----153 --
NM_138292chr1123510 2826 ----12643
NM_138300chr12214 201 ------
NM_138316chr10------11143
NM_138317chr14--1111 ----
NM_138318chr14--1111 ----
NM_138319chr1531256 1029 976 ------
NM_138335chr43857 642 629 --1578 1876
NM_138340chr18----2620 553 --
NM_138389chr41197 ------
NM_138415chr2221895 1723 --21617 1233 --
NM_138423chr1542193 1972 733 680 --1894 --
NM_138426chr752455 2344 1978 649 397 12071 2315 65 --
NM_138444chr1343188 1999 1672 493 --14260 13218
NM_138455chr81121 ------
NM_138459chr683559 3525 2829 2571 1464 1177 765 69 13185 11193 --
NM_138468chr255727 4261 2123 1820 711 2959 818 25619 4669 --
NM_138473chr1244723 1866 1303 299 23369 3335 1411 --
NM_138494chr752573 2531 2248 225 91 12257 ----
NM_138559chr231091 971 346 ------
NM_138576chr1413457 2943 752 ----
NM_138633chr641756 1747 1618 574 --11297 --
NM_138690chr19------179
NM_138711chr31162 ------
NM_138712chr31162 ------
NM_138713chr16158258 8083 7661 7384 7329 7194 6464 6075 1964 1660 1295 1250 1200 1163 397 45966 3295 2797 2388 36605 3138 861 26157 6109
NM_138714chr16158258 8083 7661 7384 7329 7194 6464 6075 1964 1660 1295 1250 1200 1163 397 45966 3295 2797 2388 36605 3138 861 26157 6109
NM_138771chr771268 1246 969 470 340 113 99 11311 ----
NM_138773chr53917 652 645 ------
NM_138779chr13------1225
NM_138782chr542043 1511 671 545 --21770 53 12394
NM_138811chr731144 1050 1029 --31075 321 128 --
NM_138931chr361020 763 721 714 327 73 ------
NM_138957chr22--1172 ----
NM_138959chr1146793 6632 5802 5260 4584 4164 2582 2409 1951 1447 1205 916 574 149 16538 26312 2632 15297
NM_138966chr182411 63 ------
NM_138970chr1411595 ----21584 725
NM_138971chr1123441 2523 ----21195 906
NM_138971chr1123441 2523 ----21195 906
NM_138972chr1123441 2523 ----21195 906
NM_138972chr1123441 2523 ----21195 906
NM_138973chr1123441 2523 ----21195 906
NM_138973chr1123441 2523 ----21195 906
NM_139035chrX3798 748 290 1615 ----
NM_139045chr91118 --1104 1678
NM_139048chr331116 935 32 ------
NM_139057chr1521984 199 22802 117 12104 1631
NM_139071chr1221382 427 ----1251
NM_139072chr21139 --3725 703 674 --
NM_139135chr121307 314 1273 --11202
NM_139167chr8--1350 1416 --
NM_139169chr1062297 2151 1572 1509 136 75 --11944 --
NM_139201chr122702 179 ------
NM_139207chr1231728 1611 490 22091 236 1749 --
NM_139242chr1521262 62 2618 33 31166 1072 1033 --
NM_139246chr961684 860 776 466 235 139 ----12165
NM_139266chr2128 ------
NM_139279chr232246 1208 379 ------
NM_139283chr1252125 1770 1630 1002 450 ------
NM_139312chr1031511 1410 74 ----1352
NM_139318chr142253 217 --1230 --
NM_139319chr1221331 501 ------
NM_139321chr205864 659 372 141 61 ----1849
NM_144488chr91504 ------
NM_144489chr91504 ------
NM_144570chr1642874 2377 2227 1137 --22134 719 11035
NM_144571chr466025 5116 4244 1528 547 206 26097 1710 ----
NM_144578chr14105056 4258 3461 2078 1985 1858 1815 1294 382 346 11145 ----
NM_144588chr1021530 1308 ------
NM_144595chr133901 373 126 ------
NM_144599chr1575207 4373 1641 1456 1024 350 185 ------
NM_144600chr1651539 1408 1394 141 116 ------
NM_144607chr1762618 2348 1832 382 365 312 11663 ----
NM_144609chr17----21146 122 --
NM_144643chr4----1394 --
NM_144664chr1152484 1038 840 556 369 ------
NM_144709chr21167 ----1133
NM_144710chr21378 21035 518 1107 --
NM_144721chr43808 510 374 --12616 --
NM_144728chr1--1866 ----
NM_144729chr1--1866 ----
NM_144766chr11506 --3664 632 564 --
NM_144775chr17104959 4638 4409 4294 4221 3785 3593 1776 944 216 ------
NM_144778chr1342556 2251 758 108 11768 136 --
NM_144949chr242491 1828 576 402 12204 22538 1638 --
NM_144963chr842713 2670 1846 1720 1864 1238 --
NM_144965chr91161 ------
NM_144973chr1295356 4446 4148 3925 3601 2061 1997 724 137 ------
NM_145000chr5130 --2171 164 --
NM_145036chr17----1382 --
NM_145037chr351485 588 245 232 169 --1412 --
NM_145044chr331482 430 329 --11218 --
NM_145052chrX1682 --11065 --
NM_145055chr1831268 1100 26 --23692 2695 11488
NM_145115chr71908 22332 1451 1675 --
NM_145117chr1163080 3021 2649 2589 828 54 ------
NM_145165chr1462630 1047 705 552 45 31 1539 22668 2400 1652
NM_145203chr134950 842 811 640 ------
NM_145245chr1921268 784 ------
NM_145251chr146471 453 244 175 137 111 ----1447
NM_145259chr295989 5872 5771 4994 4947 1673 1327 651 290 --22822 2074 25694 2280
NM_145268chr7193 --1223 --
NM_145276chr192703 412 --128 --
NM_145284chrX61935 1556 863 841 306 103 2429 45 22072 503 --
NM_145285chr10------1727
NM_145291chr42401 367 --1466 --
NM_145303chr61365 ------
NM_145307chr1094389 3533 3365 3338 3322 2981 1575 1332 37 --34439 3576 716 34085 3627 3567
NM_145320chr743376 2896 2426 167 13087 33304 2978 144 --
NM_145321chr743376 2896 2426 167 13087 33304 2978 144 --
NM_145322chr743376 2896 2426 167 13087 33304 2978 144 --
NM_145332chr63283 274 167 ------
NM_145333chr63283 274 167 ------
NM_145350chr1721539 1069 --1331 --
NM_145647chr81188 ------
NM_145649chr622529 916 1133 22581 251 --
NM_145655chr622529 916 1133 22581 251 --
NM_145686chr253292 3135 2876 1282 910 12954 ----
NM_145687chr253292 3135 2876 1282 910 12954 ----
NM_145690chr821799 41 1345 1134 --
NM_145714chr16--1389 ----
NM_145735chr1392656 2578 2132 1869 1011 841 798 784 222 11915 ----
NM_145753chr351573 1092 1065 1029 583 1681 ----
NM_145793chr102817 613 --1882 --
NM_145799chrX42448 657 254 25 ------
NM_145808chr762634 2584 2505 2387 1253 358 32880 1166 1128 12076 1375
NM_145859chr3----1394 --
NM_145860chr3----1394 --
NM_145891chr1671428 1165 1075 415 408 312 141 ------
NM_145892chr1671428 1165 1075 415 408 312 141 ------
NM_145893chr1681550 1287 1197 1162 537 530 434 263 ------
NM_145909chr61201 1370 --11255
NM_145911chr162412 331 ------
NM_147150chr962895 803 752 562 407 262 --21581 661 --
NM_147156chr1021249 1192 ----1252
NM_147171chr71370 ------
NM_147175chrX42150 2043 683 140 ------
NM_147185chr71370 ------
NM_147189chr831633 588 409 --31716 534 264 --
NM_147223chr252430 2404 2286 1692 279 --21802 1652 --
NM_147233chr252247 2221 2103 1509 96 --21619 1469 --
NM_148174chr841918 1902 1502 166 21464 831 11783 32256 2143 325
NM_148414chr16--1472 ----
NM_148415chr16--1412 ----
NM_148416chr16--1389 ----
NM_148894chr41431 1462 21225 1156 --
NM_148976chr112235 76 ------
NM_148977chr10------11143
NM_148978chr10------11143
NM_152227chr202587 136 --1642 --
NM_152233chr141282 --11296 --
NM_152261chr1231967 1699 1612 1394 ----
NM_152263chr156044 1473 1269 1204 208 2876 735 ----
NM_152265chr131330 1187 69 --1398 --
NM_152271chr83441 149 46 --2747 231 --
NM_152277chr521684 294 2847 780 1639 --
NM_152280chr141006 886 779 148 ----1591
NM_152282chr331409 1276 1230 ------
NM_152283chr52871 90 ------
NM_152287chr1632652 2559 320 --1804 --
NM_152291chr4135 ------
NM_152317chr122227 37 ------
NM_152330chr1442624 2505 756 331 12459 32514 2449 930 32548 1923 74
NM_152332chr1472807 2760 2496 2139 1829 864 626 --32038 516 309 --
NM_152344chr1731173 966 96 --21071 401 --
NM_152352chr1873045 2629 2547 1163 1036 494 423 12198 22827 2637 --
NM_152400chr411917 ----21989 1739
NM_152409chr553139 2910 848 753 715 12895 53505 3157 3110 585 514 --
NM_152414chr8----11123 --
NM_152422chr921410 187 --1289 --
NM_152437chr1242004 724 334 74 1493 12327 12336
NM_152440chr1241066 437 269 64 --188 --
NM_152442chr1221219 1169 ------
NM_152447chr143294 261 127 --1340 --
NM_152470chr1864048 3786 3480 1583 929 744 ------
NM_152487chr11516 ------
NM_152519chr242190 1780 676 193 --21526 104 --
NM_152520chr21902 1982 11193 1933
NM_152529chr2104035 4006 3943 3740 3685 3360 3050 971 858 24 --1175 --
NM_152538chr341754 1305 1188 657 --21233 539 --
NM_152556chr742031 782 306 123 ------
NM_152574chr9------1163
NM_152581chrX21037 436 ------
NM_152589chr12159 ------
NM_152594chr1512347 22121 542 ----
NM_152608chr141644 997 206 48 157 12248 12491
NM_152609chr11363 ------
NM_152622chr553169 914 615 459 137 --1947 --
NM_152624chr576122 2455 1603 1322 1226 919 680 11073 36539 5686 2716 --
NM_152629chr953984 2960 2900 2873 1220 33910 3558 3008 14074 11335
NM_152641chr1272706 2623 2566 800 419 350 252 22846 2509 1390 --
NM_152665chr13942 514 322 2442 366 ----
NM_152673chr3124259 4231 3999 3987 3598 3589 3365 3181 2936 1106 652 310 14380 1355 --
NM_152678chr322686 482 --1237 --
NM_152682chr421578 128 ------
NM_152685chr52408 54 --1391 --
NM_152688chr63922 238 200 ------
NM_152699chr343131 3104 1217 87 --11119 13279
NM_152716chr1121503 138 --31630 1246 241 --
NM_152721chr182620 471 1491 --2631 222
NM_152727chr161301 ------
NM_152734chr661779 1769 1437 933 917 339 24702 4601 13747 12205
NM_152739chr71230 --1805 1771
NM_152748chr7157 ----1354
NM_152753chr65758 646 615 589 510 ------
NM_152754chr763173 3074 2919 1429 718 245 12573 22824 2814 --
NM_152755chr7----1588 1418
NM_152756chr553962 1652 1216 937 457 34085 286 37 33488 3104 2912 11312
NM_152758chr862938 2569 2362 1950 818 29 11149 32919 2783 1982 11074
NM_152774chr762736 2253 2159 2089 1983 293 --2682 583 --
NM_152780chrX31244 1233 231 ------
NM_152787chrX41262 1146 1008 773 --33909 3635 2763 --
NM_152789chr721241 398 --11350 --
NM_152793chr764895 4412 1850 1296 702 417 --11253 --
NM_152836chr82694 208 1302 2506 498 1134
NM_152837chr82694 208 1302 2506 498 1134
NM_152838chr2053411 3137 2908 2811 154 --12224 --
NM_152860chr121458 ------
NM_152896chr92833 624 --1748 --
NM_152903chr1342711 2442 1764 452 --22181 296 --
NM_152924chr1576628 6288 5862 5624 5346 2294 1356 1412 25333 1612 --
NM_152989chr123704 338 268 ----11898
NM_152991chr11----2684 675 --
NM_152996chr121890 544 1228 1746 11516
NM_152999chr794633 4602 4360 1847 1652 1512 1018 505 489 23278 1487 23973 67 13187
NM_153013chr532546 1730 978 --12514 --
NM_153020chr651522 1308 440 420 348 --11458 --
NM_153029chr1673857 3723 3291 3155 2600 1243 524 --1235 1181
NM_153035chr12769 356 ------
NM_153050chr2233488 3141 1969 13330 24496 4243 --
NM_153051chr2233488 3141 1969 13330 24496 4243 --
NM_153181chr182411 63 ------
NM_153182chr342525 2277 2075 612 13034 23146 668 --
NM_153184chr351621 1233 790 673 463 --1480 --
NM_153186chr9----2588 28 --
NM_153188chr5125276 5003 3847 3569 1881 1618 1364 1090 1016 397 97 72 54636 4047 3987 1870 1310 45643 4161 3493 1232 14570
NM_153207chr1263903 3596 3181 1535 903 821 1747 --13816
NM_153235chr62679 428 11744 1543 --
NM_153240chr32151 109 1932 1909 1949
NM_153261chr1621195 479 ----11551
NM_153262chr122070 888 2755 388 23121 2399 --
NM_153271chr1511407 --11243 --
NM_153331chr31511 ------
NM_153332chr863065 3024 2401 2266 2179 1224 1223 12945 21283 954
NM_153333chrX1485 ------
NM_153343chr442309 1743 1511 150 22318 795 1491 --
NM_153347chr1142487 1783 823 416 --12350 --
NM_153354chr52295 264 ------
NM_153362chr61861 --1223 --
NM_153365chr442579 2549 2247 766 12464 12571 --
NM_153367chr1033645 2970 1501 --12603 12994
NM_153371chr1332104 1588 178 ------
NM_153453chr61768 ------
NM_153456chr1395866 5854 5685 5302 4823 4143 1789 1281 1199 --16137 --
NM_153605chr351441 1191 1075 517 424 ------
NM_153607chr562450 1185 1086 974 119 107 11975 12841 12746
NM_153610chr53604 175 124 1562 ----
NM_153616chr1522311 1478 --1671 --
NM_153617chr1522311 1478 --1671 --
NM_153618chr1522311 1478 --1671 --
NM_153619chr1553549 2716 1081 1051 347 12691 1939 --
NM_153634chr1221140 594 21327 1084 1384 --
NM_153645chr2242760 2724 783 617 ------
NM_153675chr20----1644 1224
NM_153686chr41817 --3707 175 166 --
NM_153690chr31616 ------
NM_153693chr123584 299 244 ------
NM_153712chr263374 2717 1408 1389 1324 971 --1629 13048
NM_153715chr731046 247 140 ------
NM_153759chr22786 449 ----1461
NM_153809chr92609 475 ------
NM_153810chr1084959 4517 3903 3597 1952 1391 1140 245 14472 ----
NM_153812chr1----12261 --
NM_170606chr711884 --21901 1416 --
NM_170675chr15----11054 --
NM_170676chr15----11054 --
NM_170692chr13815 724 84 ------
NM_170709chr852194 1716 572 312 42 --12148 12414
NM_170731chr1142087 443 148 112 --2404 218 --
NM_170732chr1142087 443 148 112 --2404 218 --
NM_170733chr1142087 443 148 112 --2404 218 --
NM_170734chr1142087 443 148 112 --2404 218 --
NM_170735chr1142087 443 148 112 --2404 218 --
NM_170750chrX----164 1658
NM_170751chr611082 11404 ----
NM_170752chr611082 11404 ----
NM_171998chrX22411 982 12365 11886 --
NM_172069chr242382 2319 1863 75 ------
NM_172070chr221772 1496 11795 ----
NM_172071chr157452 6433 1794 1393 227 24562 394 26052 2056 12146
NM_172097chr151236 ------
NM_172103chr662240 1984 1657 1006 209 83 --11785 --
NM_172105chr662240 1984 1657 1006 209 83 --11785 --
NM_172110chr201620 --1705 --
NM_172111chr201620 --1705 --
NM_172112chr201620 --1705 --
NM_172113chr201620 --1705 --
NM_172127chr441906 1489 221 164 --168 --
NM_172128chr441862 1445 177 120 --124 --
NM_172159chr351528 938 886 861 28 ------
NM_172160chr351528 938 886 861 28 ------
NM_172169chr1061830 1673 1445 1358 767 155 --21244 213 --
NM_172170chr1061830 1673 1445 1358 767 155 --21244 213 --
NM_172171chr1061830 1673 1445 1358 767 155 --21244 213 --
NM_172173chr1061830 1673 1445 1358 767 155 --21244 213 --
NM_172193chr145949 879 338 137 61 2390 293 11161 --
NM_172218chr83704 164 115 2661 146 ----
NM_172373chr1331214 264 221 1491 1301 --
NM_172375chr1421187 1151 --11164 --
NM_173039chr111251 ------
NM_173060chr541911 1829 1392 354 --32062 669 33 --
NM_173061chr541911 1829 1392 354 --32062 669 33 --
NM_173063chr541911 1829 1392 354 --32062 669 33 --
NM_173074chr22232 74 1131 ----
NM_173075chr441450 1252 618 218 1449 ----
NM_173082chr621361 252 11529 1323 --
NM_173083chr1--1230 ----
NM_173167chr1732531 1850 577 12314 ----
NM_173172chr221594 28 --11047 --
NM_173198chr943012 2508 2444 861 --1666 12186
NM_173200chr943012 2508 2444 861 --1666 12186
NM_173214chr16158258 8083 7661 7384 7329 7194 6464 6075 1964 1660 1295 1250 1200 1163 397 45966 3295 2797 2388 36605 3138 861 26157 6109
NM_173353chr124566 541 265 129 ------
NM_173468chr495860 5731 2400 2276 2113 855 724 657 198 35576 4444 4333 1742 25227 4935
NM_173469chr1541324 1139 389 343 --11239 1966
NM_173470chrX22519 1980 --22819 2026 --
NM_173471chr311093 --11059 --
NM_173473chr1032627 524 97 172 12409 --
NM_173475chr163525 241 109 11348 21382 1273 1485
NM_173491chr531156 534 447 1114 1323 --
NM_173508chr1--11090 11081 1789
NM_173511chr253684 3565 3267 2581 446 ------
NM_173515chr6157 ------
NM_173517chr71423 ------
NM_173519chr862020 1914 1748 1402 760 322 --11284 --
NM_173531chr1972794 2745 2686 2630 1108 834 161 --43124 1277 1078 323 --
NM_173545chr251347 638 364 138 33 31928 1407 464 ----
NM_173552chr372487 2134 1784 1550 624 190 100 11514 --1815
NM_173556chr112420 373 --1135 --
NM_173560chr61471 ------
NM_173582chr11105828 4346 4322 4205 2287 1218 1109 1009 749 503 34653 1807 63 1824 14313
NM_173595chr1295076 4784 4075 3817 3423 2088 2026 1587 1526 ------
NM_173602chr1262410 1032 553 254 141 108 --13320 --
NM_173609chr151610 ------
NM_173631chr1931324 1206 235 --11098 --
NM_173632chr1952135 1206 968 392 369 22685 996 ----
NM_173642chr1118735 8502 8338 7040 6624 6592 6067 3300 2137 649 176 --27689 7067 13660
NM_173644chr2061941 1342 802 553 526 130 --1684 11827
NM_173645chr23466 93 46 ------
NM_173648chr231035 978 779 --1100 --
NM_173654chr342192 1776 1717 876 --11608 --
NM_173667chr531955 826 380 21975 443 ----
NM_173694chrX42475 1965 1575 840 --32506 2500 1656 11772
NM_173698chrX41781 1680 743 649 --31919 1323 466 11523
NM_173808chr1183941 3891 3359 3308 3222 3004 2717 1632 1615 1572 1509 1470 1348 429 338 285 185 112 --11231 24442 1290
NM_173812chr1241476 1253 1189 1113 1235 ----
NM_173822chr231906 417 187 ------
NM_173824chr3196 1199 ----
NM_173825chr332130 1186 806 1731 1951 23031 2532
NM_173826chr33612 585 468 11745 11459 195
NM_173827chr423192 2833 32935 1347 634 ----
NM_173829chr564622 4036 2471 786 731 588 23982 79 11604 --
NM_173833chr851232 1225 239 135 51 11666 21275 449 11589
NM_174890chr103756 631 213 --1161 --
NM_174900chr411215 ------
NM_174907chr3196 ----135
NM_174909chr53787 243 237 ------
NM_174916chr153767 344 130 --22264 925 --
NM_174921chr451165 475 238 198 109 --1354 --
NM_175061chr711490 1467 11582 --
NM_175607chr341327 1103 464 206 ----1254
NM_175610chr1561352 1185 1170 1096 509 191 ------
NM_175612chr341327 1103 464 206 ----1254
NM_175623chr12137140 7025 6791 6706 5864 4698 2835 2433 2380 2210 1897 1808 684 1988 56821 6237 1277 808 467 --
NM_175624chr12137235 7120 6886 6801 5959 4793 2930 2528 2475 2305 1992 1903 779 11083 56916 6332 1372 903 562 --
NM_175625chr12137235 7120 6886 6801 5959 4793 2930 2528 2475 2305 1992 1903 779 11083 56916 6332 1372 903 562 --
NM_175629chr22786 449 ----1461
NM_175736chr12127601 7553 7426 6879 5980 5158 5108 2787 2399 983 633 617 16280 16728 --
NM_175748chr1421839 429 12129 ----
NM_175767chr551674 1546 1317 596 60 11881 ----
NM_175854chr1321041 957 --22144 770 --
NM_175866chr131406 999 380 ------
NM_175876chr152324 1994 1831 590 89 1271 ----
NM_175884chr731241 1002 91 ------
NM_175895chr121193 1818 ----
NM_175907chr1832334 499 233 1708 42673 1851 1044 469 --
NM_175921chr5114191 4107 3899 3751 3591 2739 1689 1600 1177 916 283 1113 13886 11728
NM_176814chr741424 1292 291 227 --21387 547 11231
NM_176815chr332630 1858 150 12472 164 --
NM_176816chr581980 1754 1535 1237 533 512 469 80 --2461 151 --
NM_176823chr163766 3422 2708 1338 257 99 --13021 --
NM_176863chr17168 ------
NM_177401chr191464 ------
NM_177414chr111481 --11524 --
NM_177424chr12519 429 ----1760
NM_177438chr1484186 3632 3615 3581 3537 3487 1643 873 13982 21691 727 --
NM_177535chrX1185 ------
NM_177556chrX176 ------
NM_177952chr142724 128 1760 ----
NM_177966chr331374 1277 198 --21843 1628 --
NM_177968chr24816 660 489 238 --21507 803 --
NM_177969chr2----1521 --
NM_177974chr1542193 1972 733 680 --1894 --
NM_177985chr221728 118 ------
NM_177995chr921410 187 --1289 --
NM_177996chr2053255 2757 2455 422 266 1952 ----
NM_178010chr123704 338 268 ----11898
NM_178011chr1063076 1168 949 394 374 181 1647 12075 23177 2954
NM_178033chr12532 52 ----1187
NM_178120chr211028 ------
NM_178126chr1761732 1657 1545 1467 507 428 --11791 --
NM_178135chr421232 342 1242 ----
NM_178151chrX107228 6506 6281 6182 5856 3124 2646 1705 1289 816 ----1363
NM_178152chrX107228 6506 6281 6182 5856 3124 2646 1705 1289 816 ----1363
NM_178153chrX107228 6506 6281 6182 5856 3124 2646 1705 1289 816 ----1363
NM_178270chrX1845 ------
NM_178313chr261608 615 381 366 255 240 --11630 --
NM_178314chr121585 ------
NM_178423chr721065 457 ------
NM_178425chr721065 457 ------
NM_178426chr122114 1965 ------
NM_178496chr31140 ----187
NM_178509chr17124131 3692 3459 3225 3167 3117 1543 1529 896 853 533 28 --13499 12953
NM_178554chr363497 3426 3114 2442 2384 276 --2544 102 --
NM_178565chr811641 1564 11602 --
NM_178566chr91416 --1188 --
NM_178584chr21378 21035 518 1107 --
NM_178585chr453107 2268 2123 1312 95 1804 12584 --
NM_178812chr84651 569 320 294 --11577 1476
NM_178819chr81250 ------
NM_180989chr131138 --12153 12038
NM_180991chr542489 2327 108 27 --1371 --
NM_181054chr1421293 891 --2301 223 1802
NM_181077chr1531443 902 461 ------
NM_181332chrX62540 2423 2192 1076 875 599 --12480 --
NM_181351chr1171866 1205 1040 910 881 864 728 --1680 --
NM_181354chr831581 649 359 11410 ----
NM_181358chr1114200 4005 3834 3111 2724 1663 883 352 279 182 123 --13766 24232 1254
NM_181361chr321394 1337 --31280 1038 153 --
NM_181443chr2072499 1966 1803 1095 1015 653 77 --22354 526 12675
NM_181457chr21342 1147 1919 11037
NM_181458chr21475 1280 11052 11170
NM_181459chr21241 146 1818 1936
NM_181460chr21288 193 1865 1983
NM_181489chr396422 5693 5350 5127 4864 4320 1334 775 252 24445 648 12150 16084
NM_181504chr533629 1350 1016 13747 ----
NM_181523chr533629 1350 1016 13747 ----
NM_181524chr533629 1350 1016 13747 ----
NM_181645chr115698 594 491 166 72 --2533 187 --
NM_181659chr2063059 2871 2830 1047 923 863 --33314 2955 188 --
NM_181659chr2063059 2871 2830 1047 923 863 --33314 2955 188 --
NM_181661chr81105 ------
NM_181670chr1241442 1408 1146 168 --1562 --
NM_181672chrX31613 561 160 ----11830
NM_181673chrX31613 561 160 ----11830
NM_181701chr931798 551 157 ------
NM_181702chr811022 --169 --
NM_181705chr585714 5493 5350 761 464 380 338 50 11151 21242 1186 --
NM_181712chr141897 1714 453 387 --22003 376 --
NM_181723chr872317 2309 2187 2132 2100 2010 250 3887 555 298 11474 --
NM_181726chr4156 --1162 --
NM_181782chr632287 2105 2096 --21823 1788 21781 693
NM_181787chr881558 1367 1301 1042 654 462 244 210 --13623 23589 949
NM_181836chr562372 2051 2034 796 780 455 12141 1372 --
NM_181837chr6------171
NM_181838chr571584 1172 1022 529 478 244 28 --1621 11329
NM_181861chr1232698 2145 514 --12729 --
NM_181868chr1232698 2145 514 --12729 --
NM_181869chr1242783 2230 599 72 --12814 --
NM_181876chr462715 2419 2151 1782 1659 788 ------
NM_181886chr42468 29 --11365 --
NM_181887chr42468 29 --11365 --
NM_181888chr42468 29 --11365 --
NM_181889chr42468 29 --11365 --
NM_181890chr42468 29 --11365 --
NM_181891chr42468 29 --11365 --
NM_181892chr42515 76 --11412 --
NM_181893chr42468 29 --11365 --
NM_181897chr382678 2574 2038 1811 1076 309 255 122 --1590 --
NM_182314chrX31751 1628 677 --1396 --
NM_182485chr452616 2564 919 669 185 2608 326 ----
NM_182503chr6115480 5184 4381 4234 4155 3588 1430 1376 1298 1227 111 13529 ----
NM_182551chr273417 3065 2999 2616 2547 2282 892 12568 33112 1394 926 --
NM_182569chr17--1156 ----
NM_182641chr1731386 1367 726 21814 482 21876 1848 --
NM_182645chr61768 ------
NM_182646chr452616 2564 919 669 185 2608 326 ----
NM_182648chr143709 236 123 ------
NM_182666chr33219 110 24 --1665 --
NM_182678chr2176 ------
NM_182691chr71379 1372 11300 --
NM_182692chr71379 1372 11300 --
NM_182697chr7----11237 11727
NM_182715chr72849 291 1444 --1144
NM_182734chr2052831 2512 2309 951 739 ------
NM_182763chr121915 697 12505 21983 740 --
NM_182764chr20164 11098 ----
NM_182765chr1062095 2049 660 620 483 406 1560 31850 936 743 12145
NM_182767chr1211388 11776 41808 1794 724 183 --
NM_182789chr5189 --1995 --
NM_182797chr2031110 708 446 11753 31208 677 505 --
NM_182811chr20----1425 --
NM_182830chr1472305 2003 1960 1804 1410 758 704 ------
NM_182848chr1351439 574 506 221 199 21330 158 1245 --
NM_182898chr785756 5713 4941 4820 4765 2589 1910 1100 11062 16521 --
NM_182899chr785756 5713 4941 4820 4765 2589 1910 1100 11062 16521 --
NM_182907chr682389 2260 1533 1471 492 414 243 94 ----22379 257
NM_182936chr1451719 1251 1152 1133 210 --21729 1537 --
NM_182944chr14------1296
NM_182948chr131118 358 265 12434 31995 1055 160 --
NM_182964chr1163080 3021 2649 2589 828 54 ------
NM_182970chr2043835 3678 3162 2743 ------
NM_182972chr152811 2598 2227 845 739 22612 755 21896 161 12699
NM_182975chr121128 210 ----1819
NM_182976chr1----134 --
NM_183002chr1451719 1251 1152 1133 210 --21729 1537 --
NM_183004chr1463836 2906 2806 2657 744 119 --1996 --
NM_183006chr2021051 361 --11042 --
NM_183043chr132897 291 --1764 --
NM_183044chr132897 291 --1764 --
NM_183050chr672415 2169 2157 1858 1814 1711 504 --42306 1650 510 193 --
NM_183078chr673742 3654 3097 2971 2770 2691 163 --33855 2578 759 11474
NM_183227chr671433 1267 1203 1154 477 143 32 11112 1219 1629
NM_183234chr1551211 714 574 384 370 11372 --11671
NM_183235chr1551211 714 574 384 370 11372 --11671
NM_183236chr1551211 714 574 384 370 11372 --11671
NM_183323chr5189 --1995 --
NM_183353chrX31210 880 429 ------
NM_183376chr1541702 1648 965 838 --12275 --
NM_183380chr64768 325 241 117 --2919 299 --
NM_183393chr31209 --1202 --
NM_183394chr31209 --1202 --
NM_183416chr131783 699 626 --1104 --
NM_183419chr82339 63 21462 433 --1994
NM_183422chr1331032 790 373 ----2983 777
NM_194071chr734165 1965 213 --34983 1582 47 --
NM_194247chr284426 3817 3741 3493 1175 1004 950 315 12808 32802 840 413 --
NM_194259chr16159 ------
NM_194260chr16159 ------
NM_194261chr16159 ------
NM_194278chr1443673 3503 3203 303 13966 23296 3008 --
NM_194282chr452706 932 914 662 411 1427 22323 2260 --
NM_194283chr594206 4049 3761 3435 3175 917 303 107 96 --24199 688 --
NM_194285chr1173306 2652 2428 2291 2214 2085 1363 ------
NM_194291chr872831 2740 2536 1161 737 656 376 11142 ----
NM_194301chr1441115 1047 399 250 --1416 --
NM_194314chr195371 4498 2212 2096 1833 1815 1592 1420 505 24965 1980 44239 4188 3896 1070 --
NM_194317chr262604 2440 2306 1905 969 64 --21033 272 22427 1852
NM_194318chr1321572 394 --22462 2331 --
NM_194328chr9--22063 505 1950 --
NM_194329chr9--22063 505 1950 --
NM_194330chr9--22063 505 1950 --
NM_194332chr9--22063 505 1950 --
NM_194356chr1242259 2070 925 173 --12309 --
NM_194442chr151415 1409 597 499 21 ------
NM_194449chr181998 --1217 1924
NM_194463chrX3921 819 395 ------
NM_197941chr542969 2538 721 652 12625 1927 --
NM_197955chr154267 106 60 37 --1125 --
NM_197968chr13----3699 521 263 --
NM_197970chr241116 457 264 195 --11144 --
NM_198057chrX1105 1972 ----
NM_198081chr642283 1117 1027 380 ------
NM_198087chr1611377 --11436