TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-367-5p
miRNA Sequence: ACUGUUGCUAAUAUGCAACUCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000068chr193980 636 294 --12187 184 181 178 175 172 169 166 163 160 157 154 --
NM_000089chr71172 ------
NM_000093chr942481 2220 782 756 ------
NM_000103chr1531124 499 76 ----11057
NM_000109chrX32557 2087 383 11766 ----
NM_000138chr1562395 2278 2156 2074 1856 829 11919 ----
NM_000145chr22215 190 ------
NM_000168chr733329 1052 40 131 ----
NM_000176chr521061 829 ----1175
NM_000202chrX42921 1468 1424 1187 11409 1161 --
NM_000210chr232142 1784 877 31489 650 552 11563 2797 681
NM_000216chrX31544 1152 358 23799 302 ----
NM_000217chr1273776 3479 1474 1435 1389 925 484 11223 23378 2087 25002 3491
NM_000231chr131603 ------
NM_000232chr443096 2149 1235 1184 11196 ----
NM_000245chr742255 2027 1752 849 11998 125 --
NM_000248chr352976 2873 2776 2555 130 ------
NM_000259chr15115877 5660 5072 4451 4046 2379 2334 1778 519 312 210 15404 15076 --
NM_000314chr1062866 2793 2212 1163 804 743 --33129 2602 86 1430
NM_000329chr11685 ------
NM_000332chr667206 6053 5604 2782 223 145 34668 4602 2799 12669 1953
NM_000337chr565436 1273 1244 768 401 32 --25359 4501 --
NM_000368chr943841 1553 576 327 23467 1624 33301 3258 559 1983
NM_000390chrX53036 2900 2324 2207 1104 --199 12613
NM_000393chr242123 1740 1614 226 11671 --11814
NM_000408chr243157 2622 736 57 --12321 --
NM_000461chr374669 4040 3634 3289 1827 1318 508 31260 930 415 13227 --
NM_000484chr2121014 144 ------
NM_000486chr1252985 2192 2074 1141 555 --22879 1185 --
NM_000489chrX42930 2922 590 276 178 ----
NM_000533chrX31631 771 128 11402 ----
NM_000544chr6_cox_hap143374 3172 579 565 --22101 589 --
NM_000555chrX117769 7641 7491 7129 6482 6074 2395 1192 867 241 82 35848 5400 1165 ----
NM_000599chr244246 1372 1179 579 21661 190 1903 11641
NM_000610chr1142310 2032 1995 866 32277 489 75 ----
NM_000621chr1311270 ----11444
NM_000684chr1011320 ------
NM_000719chr1255054 4643 2554 2281 1412 1935 --16186
NM_000726chr22234 219 1482 ----
NM_000793chr1464560 4435 3861 1950 1877 144 44493 4363 4327 83 14439 --
NM_000806chr511489 21651 759 ----
NM_000811chr51163 ------
NM_000813chr554854 3665 2185 775 326 24179 4101 ----
NM_000814chr1543758 3331 3243 1076 22775 894 ----
NM_000824chr43229 162 100 ------
NM_000827chr582423 2406 2190 1604 942 879 250 138 ------
NM_000831chr176147 5721 2128 2034 1799 1527 161 34852 1365 850 24690 1378 --
NM_000833chr1641043 423 297 82 11317 1531 --
NM_000840chr71341 ----1444
NM_000844chr31843 ------
NM_000860chr4----11104 --
NM_000861chr33590 492 24 42664 1877 188 171 ----
NM_000868chrX52185 1730 1659 439 323 ----12493
NM_000875chr15157014 6080 5581 5331 4935 4844 4622 2785 2693 2364 2081 1788 1070 801 697 16028 25249 4263 21894 274
NM_000877chr242907 2829 520 169 23072 2304 1947 23009 490
NM_000899chr1243469 3168 555 455 --148 --
NM_000912chr873579 3545 2942 1266 1144 433 201 1445 1955 --
NM_000945chr22605 220 1412 ----
NM_000958chr51191 1343 11159 159
NM_000990chr1153684 3516 2606 1568 311 ------
NM_000991chr1973324 3186 2869 2329 840 604 22 1438 --13190
NM_001001331chr342625 1090 109 99 1891 ----
NM_001001389chr1142310 2032 1995 866 32277 489 75 ----
NM_001001390chr1142310 2032 1995 866 32277 489 75 ----
NM_001001391chr1142310 2032 1995 866 32277 489 75 ----
NM_001001392chr1152356 2078 2041 912 48 32323 535 121 ----
NM_001001396chr144255 4205 3343 394 ------
NM_001001481chr863058 2995 2648 656 545 314 --1372 --
NM_001001665chr272910 2821 2251 1169 668 514 411 ------
NM_001001683chr172410 395 ------
NM_001001711chr112729 103 ------
NM_001001928chr2297543 5921 5672 3227 2710 2658 2034 486 75 46438 3027 2996 662 46089 2664 2288 2285 --
NM_001002033chr171571 ------
NM_001002860chr1434671 3267 919 11381 23776 1095 --
NM_001002926chr732781 2658 2465 22813 51 ----
NM_001003407chr1065065 1457 325 272 173 116 14682 ----
NM_001003408chr1065065 1457 325 272 173 116 14682 ----
NM_001003652chr18128660 8273 6884 6533 5960 5259 2901 1843 1451 892 291 41 45504 1915 1205 1080 --16270
NM_001003674chr1886975 6799 4379 2038 1202 1153 1060 982 35092 4873 2825 45669 5499 5248 1667 15567
NM_001003675chr1886975 6799 4379 2038 1202 1153 1060 982 35092 4873 2825 45669 5499 5248 1667 15567
NM_001003688chr42220 179 ------
NM_001003712chr1223014 994 ----12634
NM_001003792chr3--1367 --21100 396
NM_001003793chr3--1367 --21100 396
NM_001003800chr972814 2419 2278 843 453 151 59 12562 162 21076 275
NM_001003894chrY2198 43 ------
NM_001004065chr983854 3581 917 816 628 492 455 140 12784 12412 --
NM_001004317chr663884 3620 3071 1761 1168 1069 --23205 899 --
NM_001004329chr1231442 552 48 1977 1242 --
NM_001004330chr1241760 513 180 74 ----11212
NM_001004342chr174938 4858 3802 2374 2219 1687 1469 46123 5776 4280 4104 14226 --
NM_001004419chr1253800 840 806 530 168 --11487 13513
NM_001005366chr122809 191 ------
NM_001005386chr23837 591 380 ----11595
NM_001005404chr1743485 2790 1672 1295 23702 2825 21298 674 11706
NM_001005407chr161698 ------
NM_001005463chr1052273 1977 755 112 26 ----12145
NM_001005474chr33271 254 30 ------
NM_001005743chr1421023 349 1515 --1284
NM_001005744chr1421023 349 1515 --1284
NM_001005745chr1421023 349 1515 --1284
NM_001005746chr22234 219 1482 ----
NM_001005747chr22234 219 1482 ----
NM_001006600chr562336 1713 1519 980 935 645 --1333 12272
NM_001006945chr12562 523 ------
NM_001007023chr1464560 4435 3861 1950 1877 144 44493 4363 4327 83 14439 --
NM_001007075chr411112 ------
NM_001007094chr1063436 3217 2745 2725 1071 1002 23652 3610 12977 11649
NM_001007097chr9124840 3715 3609 3518 3450 3191 1744 1392 1115 774 467 233 --1778 --
NM_001007102chr63509 205 115 ------
NM_001007565chr31400 ------
NM_001007794chr12139 53 ------
NM_001008225chr71665 ------
NM_001008239chr1831239 951 671 ------
NM_001008392chr343131 3078 2316 593 1741 --12484
NM_001008738chr532952 2714 230 --1347 --
NM_001008756chr352383 2140 1999 1873 844 ----11908
NM_001008895chr1311161 ------
NM_001009552chr82225 105 --183 --
NM_001009555chr441610 1597 1353 280 21745 183 11761 --
NM_001009899chr366474 6196 6027 4629 4181 4142 22567 1089 36228 5920 4885 --
NM_001009909chr1143912 859 228 179 ----13740
NM_001009955chr11180 ------
NM_001009955chr11180 ------
NM_001009959chr242206 1803 878 472 22017 1857 11668 1729
NM_001009993chr264535 3866 3535 3291 2762 147 11358 23614 3611 13790
NM_001010853chr632761 2231 2040 ----12214
NM_001010898chr153738 3191 3107 3019 1293 ------
NM_001010984chr142413 2282 1622 358 21878 1017 12558 22347 686
NM_001010986chrX32403 296 62 11789 12266 --
NM_001011537chr31599 --11552 1276
NM_001011666chr776410 5965 5276 5213 2323 1774 1270 15761 35018 2329 1409 15005
NM_001011708chr222224 86 ----22411 1820
NM_001011713chr1451613 1510 1281 1229 554 ------
NM_001011885chr1541293 503 147 38 21113 166 ----
NM_001012393chr1174259 4095 4044 1928 1404 1122 28 21183 1044 ----
NM_001012398chr1631003 903 148 ------
NM_001012420chr1562500 2393 1976 1786 787 373 21878 1823 11797 --
NM_001012423chr1542500 2393 1976 1786 32205 1878 1823 21797 787 --
NM_001012751chr1051951 1830 1426 1237 340 21202 68 ----
NM_001012761chr512599 ----12074
NM_001012969chr151304 ------
NM_001013415chr441603 1509 463 413 ----1138
NM_001013438chr34975 387 203 28 --1134 --
NM_001013439chr33821 233 49 ------
NM_001013839chr1782543 2213 2040 2015 1968 1710 1698 1607 --41749 1746 1743 332 --
NM_001014380chr1344949 4472 1930 1242 13632 25635 5428 --
NM_001014443chr11243 ------
NM_001014797chr10148160 7783 6699 6583 5669 5578 5525 5429 5152 2979 2567 2007 1343 1293 47466 5254 2048 1989 12830 --
NM_001014812chr151321 ------
NM_001015877chrX42723 2297 415 266 12944 1732 --
NM_001015892chr5122 ------
NM_001017424chr12680 327 ------
NM_001017425chr12680 327 ------
NM_001017440chr797359 7192 7093 5587 5091 1904 415 326 241 38041 1242 82 27219 1710 28257 4999
NM_001017926chr811690 ------
NM_001017977chr11254 ------
NM_001018009chr321140 271 --1339 --
NM_001018065chr964621 4022 2295 1177 1082 286 12224 ----
NM_001018066chr964621 4022 2295 1177 1082 286 12224 ----
NM_001018067chr184408 4284 3343 1978 1899 1803 1137 183 ------
NM_001018068chr184408 4284 3343 1978 1899 1803 1137 183 ------
NM_001018069chr184408 4284 3343 1978 1899 1803 1137 183 ------
NM_001018074chr521061 829 ----1175
NM_001018075chr521061 829 ----1175
NM_001018076chr521061 829 ----1175
NM_001018077chr521061 829 ----1175
NM_001018090chr1521829 229 --12659 --
NM_001018091chr1521939 339 --12769 --
NM_001018102chr1521829 229 --12659 --
NM_001020658chr121509 1470 ------
NM_001020658chr121509 1470 ------
NM_001023567chr1551817 1807 1636 1542 373 22251 1844 1790 12263
NM_001024094chr521061 829 ----1175
NM_001024372chr841914 1622 1390 251 165 --151
NM_001024647chr1297175 7060 5985 5394 2816 2383 2374 2315 1324 46988 5478 5444 4766 35746 1870 1327 --
NM_001024948chr153185 2816 2271 69 46 ------
NM_001024956chr1121148 1041 14369 --1259
NM_001025076chr1075710 5655 5482 4117 2478 2351 408 1453 15040 --
NM_001025077chr1077068 7013 6840 5475 5034 1766 75 11811 16398 --
NM_001025079chr364092 2979 1038 1011 889 449 14024 2652 271 --
NM_001025108chr243648 2598 961 433 1782 11204 --
NM_001025233chr1231865 641 438 --11009 22110 536
NM_001029858chr621104 742 22430 1163 ----
NM_001029860chr81276 ------
NM_001029875chr562687 2210 1133 1049 767 608 ------
NM_001030007chr1653493 3469 2960 1143 377 13522 ----
NM_001031679chr1273566 3258 3023 2891 1431 1318 1151 --11337 --
NM_001031695chr2244973 4112 3620 63 34364 4099 395 23966 469 --
NM_001031716chr23858 805 408 ------
NM_001031740chr121505 503 1460 2652 103 11674
NM_001031743chr62164 47 ------
NM_001031812chr552185 2137 1751 1490 609 1433 ----
NM_001032280chr641498 1134 643 358 1296 ----
NM_001032293chr171469 ------
NM_001032394chr672741 2117 1960 1946 1801 1791 352 11740 ----
NM_001032395chr672608 1984 1827 1813 1668 1658 219 --11075 --
NM_001033045chr243688 3023 2692 1286 188 --34343 3319 611
NM_001033047chr432329 1758 551 12339 1788 --
NM_001033578chr852340 1611 897 855 347 12103 1592 --
NM_001033925chr1042118 1766 867 846 1475 ----
NM_001034841chr1675127 4920 4826 4721 3393 1446 235 15349 ----
NM_001035267chr121258 ------
NM_001037126chr7138 ------
NM_001037132chr72664 255 21753 266 --12099
NM_001037133chr72664 255 21753 266 --12099
NM_001039199chr2054580 4563 4487 4158 594 1716 14685 21519 666
NM_001039538chr242985 2939 2240 987 12502 1199 --
NM_001039547chr387343 5431 2595 2320 1533 1279 1103 201 15046 14869 12314
NM_001039574chr11808 --1848 --
NM_001039577chr143023 1655 1451 483 11380 13298 11809
NM_001039585chr153878 3801 1057 316 59 11693 ----
NM_001039590chrX62789 712 648 570 467 428 13986 ----
NM_001039591chrX62789 712 648 570 467 428 13986 ----
NM_001039618chr1153855 1515 948 839 351 ----25354 4348
NM_001039693chr254006 3408 3208 2889 736 13477 ----
NM_001039716chr14881 704 277 99 21129 821 ----
NM_001039762chr1052225 2023 1841 1570 694 32238 168 157 ----
NM_001039802chr11103 ----1340
NM_001039840chrX75642 5526 4381 3702 1255 777 615 14928 ----
NM_001040152chr721777 896 14418 --11360
NM_001040158chr5------1456
NM_001040159chr421360 1037 21060 487 ----
NM_001040202chr4141 --11650 --
NM_001040402chr453054 2818 2606 1053 606 --22020 1172 --
NM_001040409chr23900 349 75 166 ----
NM_001040429chr1333402 3252 2824 --12289 --
NM_001040441chr135102 1891 1037 --15453 --
NM_001040445chr295273 4941 4101 4093 3897 2267 2176 756 495 24713 3468 ----
NM_001040665chr764715 4492 4441 3393 3336 739 1343 ----
NM_001040712chr933374 1243 857 13288 11416 --
NM_001042355chr1654776 3619 2102 1076 737 13461 21020 564 --
NM_001042412chr1654776 3619 2102 1076 737 13461 21020 564 --
NM_001042413chr92829 600 23060 575 12650 13359
NM_001042425chr641498 1134 643 358 1296 ----
NM_001042440chr541927 1460 591 308 ----2719 91
NM_001042441chr541927 1460 591 308 ----2719 91
NM_001042442chr541927 1460 591 308 ----2719 91
NM_001042443chr541927 1460 591 308 ----2719 91
NM_001042444chr541927 1460 591 308 ----2719 91
NM_001042445chr541927 1460 591 308 ----2719 91
NM_001042446chr541927 1460 591 308 ----2719 91
NM_001042453chrX31623 1457 114 ----1625
NM_001042481chr1431769 590 337 1460 12529 22335 715
NM_001042494chr15103547 3390 3354 3189 2471 2445 1527 1326 891 690 13658 23798 3780 --
NM_001042495chr15103547 3390 3354 3189 2471 2445 1527 1326 891 690 13658 23798 3780 --
NM_001042496chr15103547 3390 3354 3189 2471 2445 1527 1326 891 690 13658 23798 3780 --
NM_001042497chr15103547 3390 3354 3189 2471 2445 1527 1326 891 690 13658 23798 3780 --
NM_001042529chr17------1287
NM_001042530chr17------1287
NM_001042531chr17------1287
NM_001042532chr17------1287
NM_001042533chr331243 519 472 13157 22313 1179 --
NM_001042555chr1284799 4524 4207 4119 3887 449 379 215 23174 1711 11026 --
NM_001042599chr247451 1825 1147 544 --26263 1252 12780
NM_001042603chr1284734 4060 3251 1254 957 386 322 217 11033 21770 510 --
NM_001043318chr1463405 2571 1399 878 450 419 --1914 12529
NM_001044385chr253630 3374 2730 1301 1125 ------
NM_001044722chr552185 2137 1751 1490 609 1433 ----
NM_001044723chr552185 2137 1751 1490 609 1433 ----
NM_001046chr543022 2752 2019 273 1884 ----
NM_001048183chr13963 561 553 ----12503
NM_001096chr171666 ------
NM_001100108chr188375 8270 7779 7352 5343 3234 2549 2121 1433 21737 352 --
NM_001105518chr12959 866 151 ----
NM_001106chr3129742 8758 8283 7901 7676 3665 2436 2001 1878 780 704 245 38819 7107 555 16700 --
NM_001113490chrX53438 2991 2871 273 120 --31219 1155 454 --
NM_001117chr1842130 1690 717 73 11560 --11695
NM_001128chr1653493 3469 2960 1143 377 13522 ----
NM_001146chr841708 920 114 34 ------
NM_001149chr1051153 892 407 287 73 1519 ----
NM_001167chrX56503 6045 4278 2677 151 14675 25124 4439 --
NM_001177chr121129 1375 ----
NM_001186chr2173131 2779 2462 1049 833 339 318 ----11029
NM_001204chr286992 6558 6234 5835 5673 1389 562 122 --1516 13088
NM_001206chr932992 2315 1135 21009 953 ----
NM_001256chr1752650 2166 1856 497 176 ------
NM_001259chr756171 5863 4220 1281 537 11172 21774 1758 24652 3984
NM_001275chr142350 306 ------
NM_001304chr1753551 3331 3094 541 402 ----1221
NM_001316chr201488 ------
NM_001331chr1152664 2458 2299 544 407 ------
NM_001364chr1151723 1570 1247 963 812 3820 306 30 14234 --
NM_001420chr1952649 2320 1998 1963 855 12982 22634 2538 23134 42
NM_001422chr111287 1882 --165
NM_001438chr173666 3124 1457 923 768 699 132 22598 110 11117 --
NM_001448chrX31487 395 236 ------
NM_001453chr631700 1405 502 ------
NM_001463chr23715 267 23 ------
NM_001498chr611218 ------
NM_001508chr21682 ------
NM_001527chr664872 4842 4830 3892 1874 1221 14854 --1520
NM_001543chr544367 4270 774 117 33825 3088 224 24160 4093 --
NM_001564chr4196 ------
NM_001616chr233273 671 178 23434 2435 12992 --
NM_001621chr732639 897 878 ----12232
NM_001621chr732639 897 878 ----12232
NM_001627chr322026 963 12036 22330 1580 --
NM_001649chrX72480 2123 1728 1558 474 371 141 32459 819 522 11561 --
NM_001656chr552065 1633 1425 1302 448 1544 ----
NM_001664chr31214 ----1417
NM_001679chr31739 --159 --
NM_001681chr123736 622 68 ------
NM_001683chr342625 1090 109 99 1891 ----
NM_001684chr143972 3922 3060 111 ------
NM_001688chr12317 275 --1624 1891
NM_001693chr84825 297 157 136 1175 11130 --
NM_001701chr931074 545 464 --1394 1330
NM_001704chr61468 ------
NM_001718chr611155 ------
NM_001723chr63779 724 107 ------
NM_001743chr21205 ------
NM_001748chr14905 456 349 310 ------
NM_001750chr541927 1460 591 308 ----2719 91
NM_001759chr1233663 1461 324 ------
NM_001777chr364092 2979 1038 1011 889 449 14024 2652 271 --
NM_001791chr11103 ----1340
NM_001830chrX34066 3982 3958 32831 1454 106 ----
NM_001854chr131263 1061 493 132 ----
NM_001858chr675167 4666 3118 1792 1108 560 33 23782 3448 14406 --
NM_001882chr54497 461 395 374 ------
NM_001904chr32814 272 ------
NM_001918chr188517 8032 7947 7700 3505 1890 1575 1289 18336 --1557
NM_001938chr131931 1734 511 ------
NM_001945chr51418 ----21171 976
NM_001951chr8293 46 ------
NM_001968chr43781 596 328 ------
NM_001969chr1463825 3533 584 446 72 27 ------
NM_001987chr1264237 3363 1659 1027 766 33 --11662 11088
NM_001999chr521529 343 1523 ----
NM_002006chr444540 3704 2246 572 14199 1575 12175
NM_002009chr1541049 813 484 34 11736 2711 276 --
NM_002017chr1141278 1204 1129 58 --11194 --
NM_002024chrX41745 1678 1464 169 11705 ----
NM_002025chrX118311 7916 6351 5910 2410 2345 1928 1685 923 539 363 27061 3542 ----
NM_002126chr1734035 3278 729 13522 ----
NM_002137chr722365 2120 ----167
NM_002140chr94879 396 364 267 ----1271
NM_002158chr262760 1306 1150 1124 456 22 ----13105
NM_002167chr11444 ------
NM_002190chr631177 845 155 11149 ----
NM_002207chr32267 252 ------
NM_002210chr233183 3086 3079 --11145 --
NM_002211chr1021113 80 11024 2980 322 --
NM_002214chr775660 5320 4988 4546 2183 1967 461 15649 ----
NM_002228chr131250 1125 30 ----1375
NM_002239chr21235 --1169 --
NM_002268chr331803 1652 33 ----21852 718
NM_002270chr545303 4484 1904 1884 25510 4186 ----
NM_002285chr243648 2598 961 433 1782 11204 --
NM_002290chr611038 21223 565 --1989
NM_002293chr162731 2503 1807 1699 426 24 2766 370 ----
NM_002313chr1065065 1457 325 272 173 116 14682 ----
NM_002336chr1255059 4497 1242 560 418 1198 ----
NM_002356chr652522 2117 1778 790 226 1990 ----
NM_002372chr53636 258 66 ------
NM_002374chr242985 2939 2240 987 12502 1199 --
NM_002376chr14186 ------
NM_002382chr143239 165 24 11125 --1907
NM_002395chr641353 1177 539 119 ----1529
NM_002397chr521656 406 2298 221 ----
NM_002399chr1531175 482 324 ----1468
NM_002470chr171103 ------
NM_002481chr1127970 7593 7361 6115 6108 5466 4831 3113 3087 1153 841 468 12697 17024 --
NM_002500chr231305 1157 326 ------
NM_002508chr121455 44 11289 ----
NM_002515chr141513 ------
NM_002520chr5----158 --
NM_002545chr1174259 4095 4044 1928 1404 1122 28 21183 1044 ----
NM_002568chr8------1373
NM_002572chr111263 ------
NM_002581chr945404 4821 3463 1929 21765 85 14234 --
NM_002627chr10155 ------
NM_002655chr874761 4094 3551 1402 1241 1186 346 ----1393
NM_002662chr362199 1953 799 632 530 303 --1665 --
NM_002670chr361417 1286 1273 1062 657 180 --1596 --
NM_002709chr243417 2311 1244 885 ------
NM_002711chr72754 338 ------
NM_002717chr8----1633 --
NM_002718chr322017 1086 --2288 148 12182
NM_002731chr152708 2341 736 581 174 ------
NM_002736chr73615 577 165 --12081 --
NM_002737chr1785317 5230 4583 1894 1737 1679 1182 605 --45982 2648 2534 2531 15076
NM_002740chr332580 986 431 --2838 537 --
NM_002745chr2254494 3404 758 709 555 11494 13163 --
NM_002760chrY85487 4801 4621 4388 2389 2180 1928 1017 24521 1193 191 --
NM_002791chr14156 ------
NM_002806chr141126 ------
NM_002837chr12104554 4447 4425 3896 3794 3700 3600 3497 1285 1065 1479 --24487 163
NM_002839chr933374 1243 857 13288 11416 --
NM_002843chr1152941 2373 957 781 649 --12193 --
NM_002868chr1221533 168 --195 12436
NM_002886chr354988 3762 1173 449 230 ------
NM_002904chr61161 ------
NM_002912chr61705 ------
NM_002938chr441743 1391 651 622 ------
NM_002941chr311127 ------
NM_002942chr321084 552 ------
NM_002959chr153590 1606 1337 711 632 ----1746
NM_002968chr162748 291 11071 --11120
NM_002973chr123148 136 128 ------
NM_002998chr831895 1380 759 --1631 --
NM_003010chr1742320 1582 979 112 ----1517
NM_003016chr171503 ------
NM_003034chr1297531 7158 6753 5849 2009 1738 1526 1325 708 --16851 --
NM_003042chr322017 1424 ------
NM_003043chr343064 2854 1727 1031 --43220 2946 2943 1397 1395
NM_003045chr1344416 3581 1831 487 --23142 32 192
NM_003048chr252759 2405 2154 898 858 --176 21893 129
NM_003068chr81824 ------
NM_003070chr91197 ------
NM_003071chr321635 193 ------
NM_003099chr1565948 4353 2056 1433 1392 233 --14366 --
NM_003105chr11196 ------
NM_003108chr276260 6100 2829 1608 1432 506 390 25114 931 ----
NM_003112chr743239 3140 3049 538 11006 --12095
NM_003137chr621944 1769 2446 24 --11837
NM_003139chr111914 ------
NM_003144chr62625 187 ----1537
NM_003155chr852195 1895 1820 999 186 --41907 1904 1901 1898 11887
NM_003161chr1783538 2512 2215 1333 1307 1163 742 243 1975 12286 --
NM_003178chr372268 2071 1795 1554 1433 805 247 ------
NM_003185chr20------1169
NM_003187chr5122 ------
NM_003189chr142868 1078 460 376 ----11246
NM_003193chr11184 ------
NM_003199chr18104869 4564 4290 3493 1899 1422 981 536 420 55 15393 ----
NM_003220chr641498 1134 643 358 1296 ----
NM_003221chr621441 190 1184 12991 --
NM_003244chr181317 ------
NM_003248chr51121 ------
NM_003253chr2121753 1192 21470 342 ----
NM_003262chr394912 4898 3516 3427 1829 1661 888 554 546 1647 ----
NM_003272chr11151 ----1562
NM_003298chr385382 5004 4004 2256 1948 1842 454 151 13792 --2221 32
NM_003319chr22991 679 ------
NM_003341chr31222 2429 115 ----
NM_003342chr1762924 2324 2051 835 732 143 ------
NM_003367chr191536 ------
NM_003385chr22844 760 --1832 --
NM_003392chr363755 3172 2828 944 522 192 13227 23458 688 --
NM_003403chr143847 308 259 ----1837
NM_003411chrY31273 349 209 1567 --11197
NM_003421chr1063436 3217 2745 2725 1071 1002 23652 3610 12977 11649
NM_003439chr773574 3020 2960 2576 700 646 146 198 ----
NM_003441chr41283 ------
NM_003442chr113765 231 22 ----156
NM_003457chr171469 ------
NM_003458chr363569 3498 3347 2874 1282 198 --32795 1076 1066 13146
NM_003468chr294159 4083 3671 3427 3238 3121 1290 710 292 --1977 --
NM_003478chr1172500 2322 2129 2041 1194 757 498 12278 ----
NM_003483chr1262918 1895 822 728 448 32 1908 135 --
NM_003487chr171268 ------
NM_003489chr2143250 1353 1207 1001 1829 --12822
NM_003498chr1642703 2429 2088 1770 11837 22582 2092 --
NM_003566chr1243149 482 428 106 ------
NM_003574chr1845589 4489 4092 3889 23526 602 ----
NM_003583chr1253665 2740 2375 1487 948 12752 ----
NM_003589chr1311161 ------
NM_003590chr274019 3985 3760 3462 1106 1032 417 ------
NM_003597chr22738 290 ----12255
NM_003607chr194387 3936 3756 3661 3426 1268 869 263 182 13035 43610 875 872 117 13017
NM_003615chr344025 3178 1099 461 1560 1738 1258
NM_003617chr134353 3413 91 14332 --11346
NM_003618chr22932 56 ------
NM_003621chr112526 47 --1445 --
NM_003630chr61766 1190 182 --
NM_003651chr121121 ------
NM_003663chr331236 410 399 12243 ----
NM_003679chr163306 2502 1298 1210 1149 338 --1350 11139
NM_003690chr22494 418 ------
NM_003714chr532186 1246 899 --33059 2518 404 --
NM_003716chr31216 ------
NM_003718chr74367 143 105 69 --1560 --
NM_003722chr352740 2508 2190 2046 1044 ------
NM_003744chr1421023 349 1515 --1284
NM_003749chr1342439 2198 2051 1710 1819 ----
NM_003758chr1541469 1104 414 308 --1278 --
NM_003758chr1541469 1104 414 308 --1278 --
NM_003759chr442817 1530 472 307 --21614 924 --
NM_003783chr141010 983 488 245 ------
NM_003800chr61194 ------
NM_003831chr1861782 668 320 232 55 35 ------
NM_003861chr1452752 849 753 610 165 1799 --11126
NM_003873chr1061719 1703 1617 924 702 578 1155 --12075
NM_003884chr321797 1755 ------
NM_003888chr1551750 1684 1560 1548 1427 1683 ----
NM_003899chr1382025 1907 1009 812 609 521 493 264 ------
NM_003922chr151152 ------
NM_003930chr732052 702 305 --11915 2967 625
NM_003934chr92396 249 ----2363 65
NM_003939chr1053888 3348 1001 770 85 13450 1844 --
NM_003941chr752274 2174 1682 548 150 12016 ----
NM_003948chr432261 275 62 ----12563
NM_003968chr31561 --187 --
NM_003983chr1673879 3868 2907 1792 1585 1363 704 24075 3578 22814 569 --
NM_003994chr1243469 3168 555 455 --148 --
NM_004006chrX32557 2087 383 11766 ----
NM_004007chrX32557 2087 383 11766 ----
NM_004009chrX32557 2087 383 11766 ----
NM_004010chrX32557 2087 383 11766 ----
NM_004011chrX32557 2087 383 11766 ----
NM_004012chrX32557 2087 383 11766 ----
NM_004013chrX32557 2087 383 11766 ----
NM_004014chrX32557 2087 383 11766 ----
NM_004015chrX32557 2087 383 11766 ----
NM_004016chrX32471 2001 297 11680 ----
NM_004017chrX32557 2087 383 11766 ----
NM_004018chrX32471 2001 297 11680 ----
NM_004020chrX32557 2087 383 11766 ----
NM_004021chrX32471 2001 297 11680 ----
NM_004022chrX32471 2001 297 11680 ----
NM_004023chrX32471 2001 297 11680 ----
NM_004040chr241102 1043 913 434 ------
NM_004061chr5----1507 --
NM_004067chr711182 ------
NM_004074chr111202 ------
NM_004093chr1363101 2065 1062 872 612 529 --12107 --
NM_004094chr1411003 2547 140 13021 --
NM_004096chr1071707 517 105 98 76 67 31 --11860 --
NM_004099chr921610 1561 --21915 494 --
NM_004113chr331924 1750 405 11315 ----
NM_004114chrX------133
NM_004119chr133736 622 49 ------
NM_004136chr1563106 2815 2749 2495 2069 721 --13185 187
NM_004156chr82225 105 --183 --
NM_004161chr221425 568 1104 ----
NM_004162chr341109 1098 1083 205 ------
NM_004170chr91548 ------
NM_004171chr1189566 7962 7663 7230 5880 3867 3031 1278 37757 6771 2552 16177 --
NM_004215chr82587 60 ------
NM_004225chr821244 531 ------
NM_004227chr762814 2725 1042 891 586 346 2368 45 22170 758 --
NM_004229chrX1504 ------
NM_004232chr1873628 3406 3212 2936 2496 987 574 22503 387 --13372
NM_004235chr91681 ------
NM_004242chr61331 ------
NM_004272chr531894 1830 1714 ------
NM_004282chr61178 ------
NM_004296chr1443758 3263 2815 1483 --23658 2965 --
NM_004326chr12862 194 --1103 --
NM_004331chr852475 2039 1775 561 375 3694 285 228 12042 --
NM_004338chr1886975 6799 4379 2038 1202 1153 1060 982 35092 4873 2825 45669 5499 5248 1667 15567
NM_004342chr731925 502 460 2849 313 ----
NM_004361chr18----143 --
NM_004371chr131313 373 74 ----11153
NM_004384chr552185 2137 1751 1490 609 1433 ----
NM_004392chr1321651 724 ------
NM_004393chr342209 1633 432 227 ------
NM_004397chr1153493 3139 1138 520 373 13881 11395 --
NM_004414chr2141327 1290 1106 452 ------
NM_004415chr62678 243 ------
NM_004419chr1051011 952 328 315 86 ------
NM_004438chr242935 1301 1195 1095 13106 ----
NM_004440chr641323 754 502 114 21544 789 ----
NM_004442chr111084 ------
NM_004447chr1231133 341 333 ------
NM_004449chr21--1504 --1377
NM_004451chr112602 486 ------
NM_004454chr331996 1658 301 ------
NM_004456chr71212 ------
NM_004458chrX42468 945 830 501 ------
NM_004459chr1731959 703 138 1173 --11986
NM_004466chr13193 ------
NM_004500chr141487 --11593 --
NM_004501chr163759 3750 3440 2863 1046 371 1298 ----
NM_004504chr243025 2939 2617 178 ----1458
NM_004586chrX34398 3626 590 14127 2993 62 --
NM_004593chr32368 56 ------
NM_004598chr563052 2952 2035 1024 830 566 22307 883 ----
NM_004622chr231903 736 644 1605 ----
NM_004654chrY3544 456 207 ------
NM_004671chr181330 ------
NM_004685chr1332066 1169 113 ------
NM_004687chr1721873 1725 ----1340
NM_004703chr1742461 2388 337 240 12503 2422 61 --
NM_004712chr17129 ------
NM_004717chr721460 1060 1172 ----
NM_004721chr32269 147 ------
NM_004726chrX85132 4669 4042 3569 1826 1527 1427 117 25035 1456 15492 14641
NM_004739chr111640 ------
NM_004744chr463810 2580 1555 258 236 104 13512 ----
NM_004745chr866565 4667 4371 4339 2603 691 25685 5629 --14754
NM_004748chr1564173 4023 3110 1478 569 349 11495 --23653 3545
NM_004756chr1911463 --21380 181 21287 1237
NM_004760chr72595 193 ------
NM_004770chr81199 ------
NM_004772chr51407 --11525 --
NM_004775chr1821796 121 ----11675
NM_004796chr1422438 923 ------
NM_004798chr2032804 557 390 32862 1115 1081 12775 1667
NM_004808chr1053207 2719 2140 1077 552 ----23167 427
NM_004815chr134829 1451 780 11828 11729 --
NM_004834chr241094 889 479 472 ------
NM_004840chrX22033 239 11784 1371 11640
NM_004842chr641606 1342 1220 588 1171 ----
NM_004844chr321140 271 --1339 --
NM_004845chrX52557 1021 948 896 756 2453 114 1918 --
NM_004849chr611562 ------
NM_004850chr241451 1388 1378 672 1348 1193 --
NM_004857chr1454538 4463 4171 3528 83 44418 3955 1038 555 24541 512 1896
NM_004874chr81105 ------
NM_004883chr51223 ------
NM_004893chr5------1456
NM_004898chr462830 2470 2351 846 194 95 --12261 11841
NM_004904chr776410 5965 5276 5213 2323 1774 1270 15761 35018 2329 1409 15005
NM_004906chr6----1215 --
NM_004921chr13858 726 715 2693 452 --1206
NM_004922chr103735 314 80 ------
NM_004949chr182509 491 12129 ----
NM_004956chr713636 --1223 --
NM_004965chr21----1593 --
NM_004967chr42427 82 ------
NM_004973chr621264 1080 ------
NM_004992chrX158132 8030 7806 6839 6222 5749 5345 5217 3367 3130 2702 2129 1665 1476 766 13355 26248 1727 1372
NM_004992chrX158132 8030 7806 6839 6222 5749 5345 5217 3367 3130 2702 2129 1665 1476 766 13355 26248 1727 1372
NM_004993chr1431284 273 266 ------
NM_004999chr674089 3565 3315 3073 1741 1097 851 --13338 13001
NM_005006chr21703 --1998 --
NM_005010chr72664 255 21753 266 --12099
NM_005036chr2297543 5921 5672 3227 2710 2658 2034 486 75 46438 3027 2996 662 46089 2664 2288 2285 --
NM_005045chr72912 775 2805 288 ----
NM_005050chr142774 391 ----1396
NM_005056chr1284978 4304 3495 1498 1201 630 566 461 11277 22014 754 --
NM_005087chr33821 233 49 ------
NM_005095chr131593 627 282 --1383 --
NM_005112chr4----1194 --
NM_005116chr2074248 4075 3254 1737 1422 1249 65 --13687 --
NM_005123chr121355 --1376 --
NM_005135chr15103547 3390 3354 3189 2471 2445 1527 1326 891 690 13658 23798 3780 --
NM_005156chr955015 3975 3606 2090 1080 14989 25150 5128 --
NM_005184chr1961559 1059 1013 638 501 137 ------
NM_005188chr1187766 7204 6940 6233 2890 2037 1352 1214 16565 --16223
NM_005197chr14126205 5739 5556 5330 5166 4629 4061 1768 1625 1325 949 80 25852 1231 12031 --
NM_005198chr221194 ------
NM_005207chr2253730 3655 2710 2366 431 12271 ----
NM_005230chr121514 ------
NM_005233chr342484 1915 1794 447 --1418 --
NM_005235chr247451 1825 1147 544 --26263 1252 12780
NM_005239chr2151950 1581 600 499 185 1513 1189 --
NM_005243chr221299 ------
NM_005254chr151156 ----11057
NM_005274chr11102 ------
NM_005312chr962244 2044 1780 997 578 221 1357 42231 2047 685 682 1342
NM_005339chr453586 3032 2815 1624 1543 23948 581 ----
NM_005359chr1856539 5514 5107 4722 4156 12019 25331 1413 --
NM_005370chr1931022 356 229 --21238 440 --
NM_005375chr64813 206 133 121 1317 ----
NM_005381chr21159 ------
NM_005384chr9------151
NM_005385chr352609 2349 1749 1022 284 ------
NM_005402chr711644 --11476 --
NM_005406chr1821251 1182 ------
NM_005436chr1073777 3549 1614 1223 1200 844 284 43886 3016 1543 547 22643 287 --
NM_005443chr42179 44 ------
NM_005455chr131333 1276 1229 1544 ----
NM_005461chr2021729 427 ----11857
NM_005475chr1262958 2788 2342 1004 907 27 --12538 --
NM_005502chr94815 676 669 352 13162 ----
NM_005504chr1265787 2420 2004 1782 1118 1011 35061 4825 4067 11225 16563
NM_005520chr54642 211 200 25 --1311 --
NM_005562chr111195 11228 11589 11355
NM_005573chr51530 ------
NM_005584chr131271 ------
NM_005591chr1142622 2500 2221 145 --11094 --
NM_005595chr12295 210 ------
NM_005596chr9126162 6130 5373 5004 4856 4567 2252 1850 1747 346 253 135 1870 1824 --
NM_005602chr331321 1023 1015 11331 1823 --
NM_005603chr1821928 163 ----1711
NM_005604chr61760 ------
NM_005639chr1241692 1536 1457 223 --1635 --
NM_005664chr1531088 736 257 --1984 --
NM_005665chr164890 4128 3982 1134 376 253 13081 13632 --
NM_005668chr563135 2940 1677 1517 334 272 21665 407 ----
NM_005721chr23893 229 115 --1874 --
NM_005722chr23837 591 380 ----11595
NM_005724chr15----1323 --
NM_005739chr1542265 2118 1722 164 ------
NM_005748chr1223399 2757 12881 22211 450 --
NM_005749chr171652 ------
NM_005756chrX21464 110 ------
NM_005759chr244231 3162 1775 263 23922 2943 ----
NM_005776chr141860 ------
NM_005779chr573482 3302 2851 1323 994 737 550 --1312 12243
NM_005789chr1711440 ------
NM_005801chr173728 256 158 --2703 221 --
NM_005802chr91602 ------
NM_005808chr343131 3078 2316 593 1741 --12484
NM_005813chr251718 861 442 283 239 --1702 --
NM_005822chr631818 1560 307 1690 ----
NM_005832chr321397 133 11133 ----
NM_005836chr8162 ------
NM_005839chr11632 ------
NM_005840chrX97106 5615 5088 4975 4781 2437 1368 307 49 36351 5927 1270 21666 807 --
NM_005845chr134610 504 198 93 11364 --11374
NM_005868chr722212 1581 11540 --1361
NM_005898chr1151236 1167 780 704 632 ------
NM_005900chr42220 179 ------
NM_005901chr18128660 8273 6884 6533 5960 5259 2901 1843 1451 892 291 41 45504 1915 1205 1080 --16270
NM_005909chr574247 3865 3441 1099 867 206 192 --12985 --
NM_005920chr133252 3236 2821 1437 21323 866 --
NM_005935chr475019 4554 4315 1343 848 318 156 ------
NM_005955chr1115523 5019 4924 4515 4220 4140 3731 1544 1385 1226 737 25311 2219 ----
NM_005966chr242413 594 212 172 11803 --2919 691
NM_005977chr132920 724 2341 104 ----
NM_005999chr111340 ------
NM_006007chr974217 4047 3975 1690 802 647 325 14372 14099 --
NM_006011chr1544308 3538 2757 1545 187 23750 3055 1544
NM_006016chr631456 507 188 1599 --12041
NM_006060chr7104108 4077 4018 3942 3803 3513 3328 920 512 82 13862 23987 2837 11637
NM_006070chr31400 ------
NM_006080chr722526 72 32562 2241 207 ----
NM_006089chrX21933 238 1329 21312 142 --
NM_006090chr12139 53 ------
NM_006094chr8----12162 2968 493
NM_006095chr474021 3590 3435 2888 1337 969 186 ------
NM_006139chr232360 2079 664 --12053 11080
NM_006141chr1632432 809 313 11797 --12465
NM_006153chr31466 ------
NM_006178chr1741620 1513 378 147 ------
NM_006186chr22894 387 --11008 --
NM_006197chr822232 771 ----11479
NM_006202chr1921214 264 ------
NM_006206chr442333 2032 1933 704 1316 --1337
NM_006251chr552693 2254 1255 458 31 22807 2276 1467 12590
NM_006252chr1137534 7083 6858 5083 3029 2340 874 834 731 538 339 227 92 1573 26564 594 --
NM_006256chr132662 283 87 21826 654 1634 --
NM_006265chr841015 454 275 253 11088 ----
NM_006267chr2------1279
NM_006282chr2044616 3847 3691 323 23728 1320 ----
NM_006283chr834053 3423 835 44703 3783 1748 26 23985 165 14006
NM_006287chr231877 938 21 12631 12289 --
NM_006298chr663370 2292 2239 1340 1007 615 12531 13165 --
NM_006300chr1942383 1590 1553 632 ------
NM_006306chrX55564 5396 5388 1336 192 --35591 5573 5422 25797 5482
NM_006315chr453758 3594 736 594 278 --12819 13206
NM_006380chr1753950 3653 3248 701 252 --14098 --
NM_006393chr1034313 797 177 --24461 1513 22858 1069
NM_006401chr9----1327 --
NM_006416chr61792 ------
NM_006451chr51246 ------
NM_006460chr172383 59 ------
NM_006482chr1253665 2740 2375 1487 948 12752 ----
NM_006489chr141513 ------
NM_006497chr171836 ------
NM_006517chrX62225 1948 1873 1665 1586 564 ------
NM_006520chrX51402 531 365 155 109 ------
NM_006534chr2063251 2902 2423 875 747 181 --1678 --
NM_006538chr234141 3261 1092 31078 963 186 1947 11426
NM_006541chr101194 ------
NM_006544chr1495458 4787 4664 4180 2245 1918 892 145 64 26086 3968 ----
NM_006546chr17116100 5864 5324 4617 4259 1594 1568 1294 844 608 40 26165 5590 15871 --
NM_006547chr73836 695 681 2302 66 ----
NM_006557chr921749 214 11369 ----
NM_006561chr1075710 5655 5482 4117 2478 2351 408 1453 15040 --
NM_006572chr1743514 2901 803 559 11117 --1833
NM_006575chr1421468 292 --11252 --
NM_006577chr221219 1107 ------
NM_006595chr1121596 534 --11927 1215
NM_006599chr1665788 2722 2139 976 539 220 16782 15691 --
NM_006614chr353363 2514 1112 971 21 ----12440
NM_006621chr162029 2006 1896 1758 1680 313 ------
NM_006624chr1042112 763 542 198 1308 ----
NM_006625chr1----1258 --
NM_006625chr1----1258 --
NM_006625chr1----1258 --
NM_006626chr961774 923 537 294 153 71 1867 1979 --
NM_006628chr1593810 3049 2869 605 561 540 283 211 179 ----14517
NM_006636chr23900 349 75 166 ----
NM_006646chr1333054 710 702 ----1971
NM_006654chr1284799 4524 4207 4119 3887 449 379 215 23174 1711 11026 --
NM_006667chrX----2939 54 --
NM_006713chr51823 --1306 --
NM_006717chr952854 2186 1189 960 539 22821 129 ----
NM_006720chr1065065 1457 325 272 173 116 14682 ----
NM_006722chr352976 2873 2776 2555 130 ------
NM_006726chr41872 ----11091
NM_006729chrX64682 3806 3484 2171 1766 1536 24717 1653 11673 11004
NM_006772chr6----156 --
NM_006775chr642267 2034 674 255 ----12121
NM_006805chr531540 1271 52 --21455 1326 --
NM_006822chr171253 ------
NM_006826chr221039 992 --1982 --
NM_006827chr1472885 2519 2377 677 361 225 87 145 ----
NM_006837chr8158 ------
NM_006838chr1231905 1878 96 ----11490
NM_006861chr1241836 1644 750 500 3834 767 676 --1368
NM_006873chr243154 2392 1096 1033 ------
NM_006885chr1634071 3003 2723 ------
NM_006888chr1412933 ------
NM_006902chr172859 2283 1029 504 148 86 56 12543 ----
NM_006914chr931198 1067 99 ------
NM_006918chr1121148 1041 14369 --1259
NM_006920chr241297 1288 498 72 --11279 --
NM_006924chr1724345 1163 ------
NM_006930chr54719 470 220 27 11792 1801 --
NM_006931chr121710 ------
NM_006999chr521812 504 --11515 1367
NM_007005chr941447 598 505 246 1982 ----
NM_007007chr1264802 4131 3729 3693 498 72 23860 401 21012 555 --
NM_007011chr1585641 4856 2340 2102 847 757 118 29 ----14904
NM_007030chr554905 4598 4279 1079 418 33570 3455 1617 1341 --
NM_007036chr51250 ------
NM_007038chr2195955 5261 5079 4647 3885 3779 1227 201 118 35699 5369 2441 ----
NM_007050chr20128064 7320 6954 5851 5616 5483 5415 2262 2196 1667 1176 674 35953 5199 2751 14981 --
NM_007078chr1031158 291 56 --12786 --
NM_007114chr342300 2022 1293 183 ------
NM_007115chr22497 118 ------
NM_007124chr611920 ----11542
NM_007172chr2233320 3115 2306 ------
NM_007176chr1421691 627 ----11240
NM_007191chr121632 ------
NM_007203chr983854 3581 917 816 628 492 455 140 12784 12412 --
NM_007207chr11677 ------
NM_007214chr63490 429 409 --11363 --
NM_007222chr811690 ------
NM_007235chr121176 ------
NM_007249chr13128976 7594 7541 7156 6845 2977 1751 1572 1389 1009 487 62 --23437 1991 26451 2947
NM_007347chr1542987 2674 752 528 --12023 --
NM_007350chr1224384 4249 13019 11665 --
NM_007375chr162574 2493 2477 2137 2063 136 --12480 --
NM_012069chrX62511 2413 1737 1068 779 311 --1322 --
NM_012090chr111189 ------
NM_012095chr1063523 2751 2595 2585 1265 1217 1350 23281 286 13259
NM_012096chr323690 70 ----1499
NM_012104chr1153648 2723 2351 1126 918 12661 ----
NM_012104chr1153648 2723 2351 1126 918 12661 ----
NM_012120chr632648 1945 48 11901 --12462
NM_012156chr2073263 2426 1231 958 532 244 90 --11293 12361
NM_012158chr1341581 1539 1430 1194 ------
NM_012198chr21162 ------
NM_012199chr164675 4631 4624 4590 4318 274 --64646 4643 4640 4637 4634 3664 --
NM_012207chr102884 35 1837 --1143
NM_012214chr296035 5938 5624 4820 4657 4203 2238 1760 1518 ------
NM_012238chr101438 ------
NM_012249chr243090 1049 705 188 33468 2633 1034 --1988
NM_012252chr765166 5042 4771 4755 1688 305 11506 --1144
NM_012257chr72906 850 ------
NM_012259chr641315 965 559 292 1100 2505 25 --
NM_012262chr135120 4612 4236 15023 ----
NM_012288chr664944 4885 2207 930 870 601 33887 2095 2056 25313 805 --
NM_012294chr754004 3976 3877 967 34 12847 ----
NM_012297chr432644 1811 179 1447 2527 517 --
NM_012308chr1141804 495 370 25 12246 --22272 1657
NM_012309chr1164426 4187 3829 3270 1221 1213 11892 24100 1976 --
NM_012329chr1731647 567 347 ------
NM_012330chr1031415 1137 514 ----1159
NM_012339chr102582 558 ------
NM_012347chr642513 2306 2143 741 --21063 573 --
NM_012399chr2231634 1614 1315 ------
NM_012425chr1062334 2281 2184 1874 1820 1021 ----12449
NM_012475chr11243 ------
NM_012479chr732409 1722 620 ------
NM_013231chr1453878 3499 3219 1364 974 2841 720 14043 --
NM_013255chr7117142 6466 6378 6072 6034 5953 1736 1595 817 776 731 23130 372 ----
NM_013257chr852340 1611 897 855 347 12103 1592 --
NM_013261chr463288 3251 2662 2506 2456 1332 --1430 13316
NM_013262chr621203 308 ----1393
NM_013269chr1253727 767 733 457 95 --11414 13440
NM_013281chr2021181 570 ------
NM_013309chr1542336 1840 1773 61 1472 ----
NM_013322chr751667 1610 1574 1155 1086 11321 1430 --
NM_013341chr222224 86 ----22411 1820
NM_013367chr4186 ------
NM_013374chr342591 2020 884 62 ------
NM_013386chr11131 ------
NM_013411chr172523 2500 2439 1910 813 149 28 12658 ----
NM_013437chr8143 ------
NM_013438chr9----1529 --
NM_013444chrX1883 ------
NM_013448chr142673 83 ------
NM_013449chr1232793 1937 383 --1389 --
NM_013450chr2----1282 --
NM_013943chr162594 2341 1238 891 655 61 ------
NM_013981chr51223 ------
NM_013982chr51223 ------
NM_013983chr51223 ------
NM_013986chr221299 ------
NM_013989chr1464560 4435 3861 1950 1877 144 44493 4363 4327 83 14439 --
NM_014011chr23358 244 184 11718 ----
NM_014021chr133212 2803 663 ----23278 208
NM_014028chr643315 3090 2109 721 2250 181 --12336
NM_014039chr1121075 198 187 ----
NM_014048chr1694833 4617 4505 4113 3779 3447 1692 1617 319 24442 493 --14898
NM_014106chr1542425 2314 2155 402 --12908 --
NM_014112chr8125473 5246 5047 4782 4260 3670 1975 1722 1570 604 597 58 15258 ----
NM_014141chr784768 4525 3751 3649 1954 786 765 616 14370 25245 333 11799
NM_014154chr321513 25 11242 ----
NM_014155chr1166716 6495 4800 4584 1668 917 1576 16033 22469 2370
NM_014160chr351427 947 511 373 259 --11340 --
NM_014217chr12680 327 ------
NM_014240chr322855 2737 ----33974 3935 708
NM_014245chr331033 401 328 ------
NM_014253chrX----1407 --
NM_014264chr42466 424 ------
NM_014294chr81410 ------
NM_014309chr2244963 4102 3610 53 34354 4089 385 23956 459 --
NM_014319chr1231409 169 40 ----11475
NM_014344chr111219 ------
NM_014352chr1111435 --1308 --
NM_014372chr131802 1498 290 ------
NM_014396chr742198 2005 1617 58 11737 ----
NM_014409chr121007 899 --135 --
NM_014421chr441951 1406 529 443 1506 ----
NM_014423chr545294 4836 2193 223 14878 12257 --
NM_014449chr122186 49 ------
NM_014548chr1511399 ------
NM_014554chr1272086 2044 2000 1886 1868 774 106 ------
NM_014571chr141216 683 654 313 21196 628 2737 316 32515 1908 658
NM_014572chr1351551 707 429 199 76 ------
NM_014574chr1431575 623 25 ------
NM_014577chr22------1800
NM_014606chr411557 ------
NM_014607chr242004 1780 1679 25 --11498 --
NM_014613chr551941 653 413 223 67 11053 --12969
NM_014615chr1673452 3039 2794 2423 550 331 310 --12265 --
NM_014616chr353365 2629 2290 1248 641 ------
NM_014636chr943856 3098 2682 220 44147 3522 3294 1185 ----
NM_014665chr873103 2992 2761 2719 1302 872 630 23607 2819 33475 3466 3463 11265
NM_014674chr333857 2472 131 2774 273 11379 --
NM_014675chr12499 187 ------
NM_014676chr121509 1470 ------
NM_014677chr831227 530 81 ----1302
NM_014682chr862303 1645 694 404 120 37 ----125
NM_014699chr162358 254 ------
NM_014730chr12105091 3821 3584 3502 1577 1524 1033 968 946 364 --13505 11038
NM_014730chr12105091 3821 3584 3502 1577 1524 1033 968 946 364 --13505 11038
NM_014733chr51892 ------
NM_014739chr644221 1673 794 586 126 ----
NM_014743chr433051 2858 2034 ----12145
NM_014747chr175808 5667 3909 2311 1206 1155 613 35267 5109 4725 11553 --
NM_014751chr872162 2042 1701 1402 1357 547 533 11819 ----
NM_014755chr274159 3702 3123 2866 2801 2640 124 ------
NM_014761chr16178 ------
NM_014767chr1033368 2556 858 33318 1204 42 41119 752 59 56 12914
NM_014787chr132086 988 98 ------
NM_014790chr51373 ------
NM_014806chr9----1361 --
NM_014810chr173548 3286 3063 2675 1277 585 561 --21222 1216 --
NM_014826chr194387 3936 3756 3661 3426 1268 869 263 182 13035 43610 875 872 117 13017
NM_014827chr12626 69 ------
NM_014829chr522358 1518 12015 ----
NM_014830chr1261432 1098 896 518 487 362 23058 376 3899 187 40 --
NM_014838chr221905 22412 564 12357 21977 420
NM_014840chr1213267 1100 --12564
NM_014841chr631386 1005 144 ------
NM_014848chr1532784 2225 566 ------
NM_014862chr1584150 3902 3530 3120 1181 767 366 359 12922 13178 --
NM_014868chr121905 ------
NM_014873chr163041 1887 1866 537 514 491 --14063 --
NM_014877chr1757751 6331 5136 1312 494 14817 15556 --
NM_014893chrY52272 2041 1834 1580 332 2266 153 ----
NM_014897chr1712796 22974 141 --13274
NM_014899chr523166 661 ----12922
NM_014903chr1252259 2167 1927 915 854 ----1142
NM_014906chr1793815 3737 3292 3172 3148 2990 2979 2501 636 21516 1384 ----
NM_014912chr1063486 3125 2956 2859 2192 895 22292 1076 1684 --
NM_014918chr151338 ------
NM_014920chr663395 3331 3107 1321 1173 253 22916 2739 1404 1902
NM_014923chr1332305 1726 294 --21547 336 --
NM_014932chr3----11358 11599
NM_014934chr1363767 3349 611 188 115 36 11542 ----
NM_014936chr642679 1746 250 222 1410 --12590
NM_014938chr1212586 --1188 11699
NM_014950chr1441089 707 555 199 148 ----
NM_014988chr442610 2337 700 340 --12815 --
NM_014991chr443234 2041 475 234 22453 2324 13263 13052
NM_014997chr732639 908 672 --2556 422 --
NM_015000chr1251975 1206 397 376 333 --13007 --
NM_015009chr31208 ------
NM_015026chr12104147 3741 3272 3262 3099 2994 1852 751 444 198 ------
NM_015032chr1362561 2336 2178 1973 1851 188 --22667 985 --
NM_015039chr144293 3882 3092 23 --6783 780 777 774 771 768 --
NM_015040chr233111 2590 2270 ----11333
NM_015052chr731201 537 233 ------
NM_015057chr131629 ------
NM_015064chr1273220 2556 2522 1194 810 755 637 1303 --11293
NM_015068chr71629 13270 --21393 212
NM_015071chr585324 5085 4953 4724 2413 920 448 308 21460 220 --15092
NM_015076chr641477 854 436 53 13854 13391 13745
NM_015090chr196115 5568 5406 4272 4007 2054 1808 1411 106 35544 3812 879 15494 --
NM_015092chr1654482 4392 4028 476 281 1920 1494 31776 587 285
NM_015093chr61586 --21156 1150 11851
NM_015094chr2253548 3342 2837 1267 654 14213 3713 81 78 --
NM_015097chr341676 1608 1535 378 --11497 1156
NM_015115chr453054 2818 2606 1053 606 --22020 1172 --
NM_015124chr2232445 1823 113 ------
NM_015125chr191552 ------
NM_015132chr731924 390 226 11561 ----
NM_015137chr832608 1043 725 ------
NM_015138chr1542636 2372 1926 1870 12086 2372 366 --
NM_015144chr1653650 3539 2748 2437 752 2934 612 1888 1638
NM_015170chr812348 ------
NM_015172chr121532 1239 1358 --11246
NM_015173chr421813 25 ------
NM_015176chr121738 82 ----1206
NM_015185chrX52787 2506 2255 1124 856 --22878 1844 --
NM_015187chr44922 756 741 47 ----1746
NM_015192chr2032351 682 251 ------
NM_015199chr34739 529 392 317 ----1330
NM_015200chr442619 2168 738 378 1196 ----
NM_015205chr13115256 5066 4576 4350 4155 2003 1641 1077 1071 254 69 13447 ----
NM_015206chr1563607 3592 1117 409 230 82 1567 31531 474 72 --
NM_015208chr1832999 1337 293 23122 3037 12939 14067
NM_015215chr142192 425 176 82 ------
NM_015219chr1782543 2213 2040 2015 1968 1710 1698 1607 --41749 1746 1743 332 --
NM_015231chr11------1668
NM_015236chr441406 1343 1022 399 ------
NM_015247chr1654776 3619 2102 1076 737 13461 21020 564 --
NM_015265chr231908 1743 27 ------
NM_015271chr443853 1431 1218 143 13268 ----
NM_015275chr121659 --21882 1569 --
NM_015277chr1841626 1156 726 339 170 ----
NM_015278chr623057 736 ----22393 438
NM_015285chr181594 --12054 1312
NM_015288chr533585 2543 1459 ----13706
NM_015296chr133977 937 329 1273 ----
NM_015310chr868311 7192 6823 3135 3113 766 --26581 791 --
NM_015349chr673090 2612 2031 1972 1144 758 178 ------
NM_015375chr154893 4802 4209 3128 194 --1361 54378 3659 1996 1470 953
NM_015415chr12210 165 ------
NM_015435chr81464 ------
NM_015436chr42872 835 22654 2065 23169 1350 --
NM_015455chr563628 3518 3341 2653 2602 369 23839 275 --2598 169
NM_015457chr111914 ------
NM_015458chr885094 4847 4363 3612 1871 1542 697 448 --23603 624 12053
NM_015460chr352044 1316 259 68 52 11574 31831 1828 1825 --
NM_015461chr18----1576 --
NM_015481chr121392 ----1791
NM_015526chr1921354 97 3332 277 158 --1445
NM_015530chr22770 387 ------
NM_015532chr1521829 229 --12659 --
NM_015535chr223103 226 13604 --13318
NM_015548chr61827 ------
NM_015549chr141623 ------
NM_015550chr743156 2601 918 740 --11185 --
NM_015554chr1542743 2062 1860 435 --12002 --
NM_015564chr533499 2808 1316 12329 11101 13544
NM_015568chr2074092 3997 3884 2782 2678 1054 65 ----11061
NM_015569chr133725 3383 52 23348 1356 1663 --
NM_015570chr71487 --11202 --
NM_015571chr632246 1976 1659 --2518 504 --
NM_015575chr242716 506 273 105 22691 455 ----
NM_015578chr1941935 1822 1812 1668 --1748 --
NM_015601chr102927 864 --1377 --
NM_015622chr71110 ------
NM_015630chr24876 823 98 74 ------
NM_015640chr184408 4284 3343 1978 1899 1803 1137 183 ------
NM_015660chr71317 ------
NM_015678chr1321543 65 --1130 --
NM_015878chr83545 262 113 ------
NM_015879chr1868542 7667 6475 5595 1577 1413 36062 2833 2484 17584 16636
NM_015904chr2138 --1779 --
NM_015912chr842161 1866 591 104 1475 1440 --
NM_015990chr411112 ------
NM_016009chr144275 3701 650 310 2827 533 --14184
NM_016018chr842558 2169 470 131 11793 ----
NM_016023chr851976 1435 1429 420 134 ------
NM_016025chr161374 --1323 --
NM_016040chr1102775 2359 1817 916 851 589 346 328 52 24 --1201 --
NM_016072chr1252206 2086 1648 677 147 ----22297 1924
NM_016083chr683735 3715 1499 1488 1440 1009 844 22 ------
NM_016106chr14176 ------
NM_016185chr171571 ------
NM_016206chr387729 7314 6640 5627 2574 2488 2108 32 38926 6037 3261 21463 88 28518 2752
NM_016218chr521263 113 ------
NM_016230chr61381 ------
NM_016231chr1711522 ------
NM_016235chr16----186 --
NM_016242chr42174 34 ------
NM_016257chr173419 3026 2773 2710 2518 2373 1000 ------
NM_016260chr266249 5571 5433 2789 1003 902 21329 982 ----
NM_016298chr352040 1142 766 679 671 12625 ----
NM_016315chr231689 1501 1403 21607 1193 ----
NM_016322chr942454 2187 2048 1957 1642 ----
NM_016351chr71628 ------
NM_016353chr832112 1719 255 21528 901 ----
NM_016357chr122788 317 ------
NM_016374chr131311 524 197 ------
NM_016374chr131311 524 197 ------
NM_016376chr1754044 3841 585 295 49 --11503 1116
NM_016377chr641606 1342 1220 588 1171 ----
NM_016395chr1541773 1569 609 141 ------
NM_016422chr1132964 2467 2116 --1286 12839
NM_016441chr232172 1987 370 ------
NM_016470chr201124 ------
NM_016513chr663395 3331 3107 1321 1173 253 22916 2739 1404 1902
NM_016522chr1151278 545 78 71 60 11355 ----
NM_016531chr464121 3985 3739 2920 2713 807 --11554 --
NM_016542chrX31623 1457 114 ----1625
NM_016570chr12176 ------
NM_016577chr334251 3461 895 --34283 3279 670 23407 1634
NM_016578chr11----1546 --
NM_016599chr431372 1241 102 11170 ----
NM_016603chr542056 1987 1432 635 ------
NM_016607chrX21699 29 1448 ----
NM_016621chr1174328 3714 3653 3610 2830 1054 930 --23354 311 --
NM_016628chr10------1268
NM_016654chr151156 ----11057
NM_016929chr644479 3961 1120 360 13382 13629 --
NM_016950chr421360 1037 21060 487 ----
NM_017415chr594543 4154 4003 3537 2876 2836 837 245 64 11405 14506 14243
NM_017420chr1421475 1069 11037 --13660
NM_017447chr2164351 3771 3565 1714 570 396 21199 313 --12774
NM_017449chr111084 ------
NM_017491chr4----1194 --
NM_017519chr6------1498
NM_017548chr332183 226 59 11469 --12020
NM_017563chr366268 6036 5952 1600 949 241 --15285 --
NM_017577chr32369 147 --11402 --
NM_017592chr1962806 2496 2015 147 127 85 12003 11818 1138
NM_017628chr483462 1930 1853 1531 1076 890 668 251 23899 978 23296 685 --
NM_017633chr663771 3368 1161 705 608 469 2740 617 ----
NM_017637chr9139106 8929 8647 7243 6737 6396 5894 5843 5710 3069 2817 1501 1449 26003 2219 27270 1455 17247
NM_017644chr344397 998 904 833 24069 1329 1989 13530
NM_017645chr922426 99 ------
NM_017650chr796083 5850 4727 4707 4403 1799 1614 833 475 14453 --21570 163
NM_017658chr1464398 4099 3084 2828 791 543 --14383 --
NM_017673chr12959 866 151 ----
NM_017719chr352582 1981 1824 1778 442 1790 ----
NM_017730chr31651 ------
NM_017737chr141894 1525 335 244 ------
NM_017738chr91105 ----1430
NM_017740chr1681875 1248 665 435 413 128 91 73 1202 ----
NM_017742chr1831980 489 205 11469 1476 11429
NM_017749chr111300 ------
NM_017754chr635005 4880 692 1510 152 14526
NM_017768chr1167 ------
NM_017769chr1423018 2989 ------
NM_017780chr81108 ------
NM_017801chr342393 735 663 283 ------
NM_017813chr843892 1738 583 498 ------
NM_017831chr1854110 3616 3452 1096 873 ----23801 801
NM_017847chr152295 2037 1975 700 244 1354 ----
NM_017864chr81177 ------
NM_017913chr91474 ------
NM_017919chr955842 4534 4380 3982 2123 14752 14742 --
NM_017922chr141126 ------
NM_017923chr42770 592 2760 527 1337 --
NM_017926chr143619 210 141 --2625 622 1861
NM_017938chrX51891 1498 704 638 194 1297 ----
NM_017953chr131216 1037 407 ----150
NM_017972chr143619 210 141 --2625 622 1861
NM_018015chrX11183 ------
NM_018018chr124713 569 308 104 2630 481 ----
NM_018024chr81495 ------
NM_018036chr1494079 3460 3112 3083 1550 1541 1476 955 65 11197 --12758
NM_018043chr1131145 1041 263 ------
NM_018070chr11180 ------
NM_018084chr263193 3125 1277 700 146 89 ------
NM_018085chr1107203 6368 6078 5754 2959 2738 2668 2532 1852 868 23177 2558 15745 16362
NM_018086chr211846 --1504 --
NM_018099chr12185 ------
NM_018116chr12639 37 ------
NM_018121chr1032364 1962 1094 --22955 2592 --
NM_018126chr421587 1352 ------
NM_018151chr2--1801 2637 634 1280
NM_018155chr332274 2210 419 12792 12336 --
NM_018181chr1841791 1562 112 90 --1334 --
NM_018182chr1732098 1575 28 ------
NM_018195chr1141881 820 411 306 ------
NM_018211chr132084 329 168 --1139 11946
NM_018225chr985328 5224 4791 4517 4161 3305 1826 535 25016 845 ----
NM_018243chr473989 3392 1128 825 760 368 269 --13343 --
NM_018293chr342942 2930 2291 1950 --3739 574 261 --
NM_018297chr3131 ------
NM_018299chr863058 2995 2648 656 545 314 --1372 --
NM_018315chr441603 1509 463 413 ----1138
NM_018317chr43312 218 24 ------
NM_018327chr2021877 280 --11281 --
NM_018334chr71343 ------
NM_018351chr1254673 3863 1676 1448 352 --13024 --
NM_018364chr132905 1494 253 1301 ----
NM_018367chr1162424 2282 2230 2203 302 294 1111 ----
NM_018372chr12562 523 ------
NM_018373chr1486246 4819 2316 2263 1642 914 812 315 --14146 --
NM_018374chr745237 5138 3932 3578 14901 13839 --
NM_018403chr353986 3757 3551 3312 648 33694 372 197 33009 1193 633 --
NM_018427chr1621248 294 ----1338
NM_018429chr552851 2134 2057 961 670 --1702 --
NM_018439chr182764 712 --1262 --
NM_018442chr11254 ------
NM_018448chr123813 450 242 --11277 --
NM_018466chrX1664 ----1727
NM_018475chr42687 170 ------
NM_018490chr1131297 620 273 11818 ----
NM_018557chr2168 21403 559 1688 --
NM_018569chr421593 1185 ------
NM_018571chr23596 503 416 ------
NM_018584chr11393 --150 --
NM_018593chr61756 ------
NM_018638chr1215689 24658 1748 21951 1661 14107
NM_018650chr12775 128 --11569 --
NM_018695chr562336 1713 1519 980 935 645 --1333 12272
NM_018698chrX41819 1737 1594 744 ------
NM_018700chr551653 1565 1328 674 469 ------
NM_018723chr16169 ------
NM_018834chr52758 382 ----1223
NM_018896chr171265 ------
NM_018898chr541882 1750 703 162 1720 ----
NM_018899chr541882 1750 703 162 1720 ----
NM_018900chr541882 1750 703 162 1720 ----
NM_018901chr541882 1750 703 162 1720 ----
NM_018902chr541882 1750 703 162 1720 ----
NM_018903chr541882 1750 703 162 1720 ----
NM_018904chr541882 1750 703 162 1720 ----
NM_018905chr541882 1750 703 162 1720 ----
NM_018906chr541882 1750 703 162 1720 ----
NM_018907chr541882 1750 703 162 1720 ----
NM_018908chr541882 1750 703 162 1720 ----
NM_018909chr541882 1750 703 162 1720 ----
NM_018910chr541882 1750 703 162 1720 ----
NM_018911chr541882 1750 703 162 1720 ----
NM_018945chr663301 3140 2745 2736 421 342 --183 13034
NM_018958chr1543936 442 436 241 12764 1522 --
NM_018970chr762264 2082 2063 757 125 105 --32575 2356 145 --
NM_018999chr1044622 4400 3879 1537 ------
NM_019035chr472094 2031 1840 1593 1448 841 526 --11394 --
NM_019049chr12518 119 ------
NM_019072chr554294 3497 2926 1111 176 ------
NM_019084chr1032032 759 188 1283 ----
NM_019091chr21256 ------
NM_019590chr1031047 87 53 ------
NM_019593chr2023221 116 ------
NM_019596chr2162912 2599 1889 729 246 49 12428 1948 --
NM_019857chrX1603 ------
NM_019858chr122186 49 ------
NM_020122chr265578 4955 3996 2422 1626 1243 25638 869 14064 14344
NM_020123chr1031229 549 150 ------
NM_020126chr191608 ------
NM_020127chr12467 249 ------
NM_020130chr831316 935 83 176 ----
NM_020144chr742141 1585 1462 565 --1441 11533
NM_020159chr41285 ------
NM_020177chr51223 23022 2130 43124 1149 582 46 12239
NM_020180chr182863 188 ------
NM_020182chr2053626 3233 2717 392 97 ------
NM_020194chr23581 218 36 1671 1563 --
NM_020341chr2041919 1484 436 320 1147 ----
NM_020342chr222586 900 --22123 1967 --
NM_020346chr1141720 1321 1303 436 ------
NM_020354chr101991 ------
NM_020390chr364936 3878 3791 3771 3019 1361 1276 13872 11809
NM_020403chr1341803 1459 1144 159 2295 79 --11206
NM_020432chr732043 598 554 11580 12084 --
NM_020440chr143049 2536 2504 217 23105 2201 12061 --
NM_020443chr1116817 6645 6567 5667 5536 5453 4875 4866 2661 2245 1652 135 26210 356 --
NM_020455chr672741 2117 1960 1946 1801 1791 352 11740 ----
NM_020456chr1332203 1961 256 ----11507
NM_020466chr664662 4520 3815 3271 3224 205 24077 1644 14880 --
NM_020546chr573023 2922 2874 2166 1082 534 301 21027 263 21935 970 --
NM_020644chr1121003 795 ------
NM_020647chr83780 550 408 ----11990
NM_020654chr31540 --21047 281 --
NM_020673chr2055295 2476 322 164 56 24857 2354 16564 1606
NM_020676chr34848 793 739 661 --1595 --
NM_020699chr145338 1131 1087 251 25274 1611 11990 14661
NM_020708chr2052523 2193 2184 2081 281 ----1582
NM_020711chr242206 1803 878 472 22017 1857 11668 1729
NM_020715chr1421844 94 ----12219
NM_020717chrX85044 3836 3786 1772 1148 621 363 215 --23123 1651 14944
NM_020718chr1666604 6013 4318 1350 549 211 ------
NM_020732chr6------1498
NM_020739chr1564173 4023 3110 1478 569 349 11495 --23653 3545
NM_020742chrX52740 2342 2109 1900 49 ------
NM_020744chr2174 ------
NM_020748chr172868 68 ----1397
NM_020752chr1092937 2909 2686 2667 2315 1780 1033 222 168 ------
NM_020760chr241300 589 375 233 21573 472 ----
NM_020766chrX54172 3633 3255 727 172 --44218 1241 1234 179 --
NM_020768chr593046 2642 2514 2439 2012 1257 625 539 121 12031 ----
NM_020772chr1786970 2826 2627 2475 2091 1384 373 36 ----198
NM_020774chr18106235 5285 4786 4704 4000 2504 766 709 535 399 ------
NM_020778chr15104943 4662 3712 1770 1280 1271 1189 904 370 33 24706 1927 23634 3124 2374 37
NM_020781chr793200 2383 2258 1965 1177 1045 964 333 43 12662 ----
NM_020786chr1642060 1439 524 129 ------
NM_020796chr552853 2577 1146 251 35 --1199 1611
NM_020801chr542486 1705 802 172 ----1686
NM_020810chr1462301 1391 1220 903 827 806 --11304 --
NM_020818chr142413 44 ------
NM_020819chr61194 ------
NM_020830chr253084 2584 1236 925 38 --22404 1320 --
NM_020841chr1223014 994 ----12634
NM_020844chr856883 6089 4882 921 764 37578 5779 5734 17299 1245
NM_020858chr1552121 1472 297 175 144 ------
NM_020859chr463894 2809 2638 420 310 298 ------
NM_020860chr421058 297 ------
NM_020866chr131384 ------
NM_020873chr33839 680 642 ----1650
NM_020917chr1953575 3303 2962 753 643 13002 12489 13951
NM_020921chr1453423 2486 2351 1338 105 ------
NM_020935chr2104108 2996 1827 1710 1264 944 869 388 110 25 --13589 --
NM_020940chr1052510 1852 931 795 299 --1733 --
NM_020951chr1922274 267 ------
NM_020987chr1051153 892 407 287 73 1519 ----
NM_021032chr331924 1750 405 11315 ----
NM_021033chr1383501 3429 3167 2732 972 511 496 166 ------
NM_021038chr353049 2111 1159 1008 103 1840 ----
NM_021045chr1072572 2327 1948 1895 1615 1032 338 ------
NM_021072chr511711 ------
NM_021076chr224562 358 162 74 ------
NM_021098chr161698 ------
NM_021104chr121258 ------
NM_021111chr911363 ------
NM_021120chrX42697 2558 1237 463 23154 1162 --1476
NM_021136chr14----154 --
NM_021183chrX42313 2150 1018 779 22514 2268 ----
NM_021191chr1242246 1613 987 116 --12429 --
NM_021202chr2042764 2651 2219 1174 12981 --13041
NM_021204chr42889 655 1691 ----
NM_021240chr91141 ------
NM_021255chr1453729 3538 3202 197 34 1477 --1164
NM_021620chr61659 --1183 --
NM_021629chr344589 4000 3659 1100 ----23443 1977
NM_021633chr131406 495 379 ----1198
NM_021644chr102884 35 1837 --1143
NM_021722chr71587 ------
NM_021723chr71628 ------
NM_021783chrX61979 1558 744 642 566 76 --182 --
NM_021809chr2041878 1775 812 137 1828 --1457
NM_021911chr554854 3665 2185 775 326 24179 4101 ----
NM_021912chr1543758 3331 3243 1076 22775 894 ----
NM_021914chr1452362 835 720 481 271 ------
NM_021935chr321020 125 ------
NM_021945chr652736 2633 2606 1212 401 33597 816 755 1717 --
NM_021951chr91154 1861 140 --
NM_021954chr1363654 3546 3207 3089 2550 272 182 1336 12365
NM_021961chr1146742 6660 5487 841 11643 ----
NM_021964chr376118 6099 5518 4651 2512 1039 401 --15281 --
NM_021977chr652405 1497 1016 1007 662 --1622 --
NM_022003chr1131118 822 527 11288 2944 100 11045
NM_022041chr1642415 2273 2105 386 ------
NM_022048chr15105776 5138 4306 3983 2435 1448 1380 1013 922 547 15577 ----
NM_022079chr102927 864 --1377 --
NM_022080chr2052831 2706 2508 2151 2108 12064 ----
NM_022143chr71540 ----136
NM_022160chr92372 152 ------
NM_022166chr16136236 5759 4203 2471 2234 1189 1178 1002 944 691 152 40 29 35570 4060 2144 --22208 340
NM_022351chr853105 2600 2388 1521 662 33086 2554 2492 ----
NM_022373chr73806 226 61 2905 213 ----
NM_022374chr21426 ------
NM_022451chr10----1840 --
NM_022456chr1297175 7060 5985 5394 2816 2383 2374 2315 1324 46988 5478 5444 4766 35746 1870 1327 --
NM_022459chr1385851 4715 2129 1584 1366 1198 1131 643 12277 22357 1863 --
NM_022469chr182804 2542 2289 1071 925 900 287 118 ----12067
NM_022476chr1631003 903 148 ------
NM_022483chr531544 772 214 11263 ----
NM_022552chr251116 401 388 375 30 ------
NM_022648chr284206 4008 3876 3028 2982 1004 843 131 11325 1728 11437
NM_022716chr142703 2127 873 348 12387 ----
NM_022726chr621627 1184 ------
NM_022737chr19----11317 --
NM_022763chr3----31050 740 473 --
NM_022776chr341360 540 222 158 ----1324
NM_022781chr93899 876 786 --12379 --
NM_022828chr52620 247 --11186 --
NM_022841chr1542507 2189 1930 1731 ----183
NM_022842chr36804 757 647 354 303 113 23225 1012 ----
NM_022893chr22325 281 1680 ----
NM_022913chr52284 253 ------
NM_022918chr111275 ----11485
NM_022977chrX42468 945 830 501 ------
NM_023009chr11728 ------
NM_023010chrX----1842 --
NM_023071chr1211079 ------
NM_023923chr13963 561 553 ----12503
NM_023927chr541368 507 467 186 ------
NM_023928chr1211063 ------
NM_023929chr822734 1016 ------
NM_024007chr541268 1109 1090 1022 22669 2090 ----
NM_024052chr1772717 2479 1972 989 950 762 617 ------
NM_024345chr9125331 5030 4582 4422 3798 1520 1208 940 765 592 216 201 12168 --11802
NM_024411chr202260 215 1389 71067 284 281 278 275 272 269 --
NM_024512chr342653 2306 2277 1047 ----13021
NM_024524chr321051 181 12602 ----
NM_024548chr331748 1248 699 ------
NM_024556chr111108 ------
NM_024582chr441105 1073 741 249 11142 ----
NM_024613chr841709 1410 439 293 ------
NM_024631chr11------1451
NM_024664chr11454 ------
NM_024665chr353856 3784 3756 1498 980 1369 2822 454 --
NM_024689chrX31332 1224 1145 11362 1190 11456
NM_024692chr211408 ------
NM_024697chr3130 ------
NM_024721chr852223 2189 966 456 157 --32121 2075 970 --
NM_024740chr1133629 1455 86 1770 --13940
NM_024744chr232129 558 355 1866 --1721
NM_024745chr162779 716 --1366 1953
NM_024749chr152316 896 643 383 327 21411 411 ----
NM_024751chr411647 11897 1136 --
NM_024761chr9105296 5026 4399 3507 3468 1983 1864 1838 476 461 25011 113 11154 --
NM_024770chr296676 6586 6467 6165 6155 6000 4439 2671 1259 --15013 --
NM_024792chr171193 ------
NM_024828chr92631 216 1513 ----
NM_024852chr11198 ------
NM_024854chr1221433 430 ------
NM_024887chr151972 1744 819 813 246 ----1761
NM_024915chr832074 1933 610 12664 11798 12798
NM_024930chr542552 305 196 169 ------
NM_024947chr379513 9414 7600 6471 3638 2252 30 18150 --12166
NM_024953chr1241086 473 250 71 ----3575 332 39
NM_024989chr275276 2635 2129 1142 1083 958 335 ----12497
NM_024993chr221368 1273 --21003 503 --
NM_025047chr3----2416 383 --
NM_025054chr833293 3241 1643 11101 --11305
NM_025099chr1711077 1515 1185 11282
NM_025133chr22172 37 1345 ----
NM_025134chr1622447 407 11005 11731 --
NM_025146chr322499 856 --31870 383 380 --
NM_025160chr174080 3832 3214 2985 1121 660 389 --11418 --
NM_025191chr173390 3379 2800 970 776 255 237 11151 12907 --
NM_025208chr1122417 2066 11512 --1805
NM_025222chr342686 2512 2113 46 --22176 756 1207
NM_025233chr17------1287
NM_025239chr91150 1410 --1389
NM_030579chr1633603 540 364 22924 1191 1733 --
NM_030594chr1521052 408 ----11391
NM_030621chr1433790 383 138 22948 151 23974 3971 --
NM_030627chr573402 1593 1164 609 533 404 278 21011 327 ----
NM_030647chr796035 5582 4739 3991 2049 1042 1010 363 174 34051 1509 343 24094 504 --
NM_030648chr4115033 3642 3500 1699 1287 1193 1183 888 629 201 130 11015 --24471 503
NM_030650chr234267 3303 1477 23442 1015 13714 --
NM_030660chr1431284 273 266 ------
NM_030670chr1282154 2022 1752 915 548 451 233 98 22302 461 1625 --
NM_030671chr1282154 2022 1752 915 548 451 233 98 22302 461 1625 --
NM_030674chr1245120 4621 3924 947 15236 14674 --
NM_030751chr1041535 1284 308 268 ----1277
NM_030751chr1041535 1284 308 268 ----1277
NM_030755chr1433102 2195 243 --11951 --
NM_030773chr2061785 1349 1171 366 99 72 ------
NM_030806chr1169257 9204 8962 8004 6660 6433 6057 3345 2885 2420 2161 1748 1721 1409 667 277 22262 1209 13120 27375 5862
NM_030816chr142344 1246 621 500 11034 13140 --
NM_030885chr352303 1939 731 421 31 ------
NM_030918chr195444 5083 4829 4641 4245 3936 3918 1574 1116 34237 1012 799 23728 2141 --
NM_030920chr12567 395 ----146
NM_030934chr111831 ------
NM_030938chr172435 243 11035 --1258
NM_030963chr61548 ------
NM_030979chr13------1398
NM_031213chr19132 ----1152
NM_031226chr1531124 499 76 ----11057
NM_031243chr722365 2120 ----167
NM_031262chr94822 339 307 210 ----1214
NM_031263chr94879 396 364 267 ----1271
NM_031267chr74367 143 105 69 --1560 --
NM_031283chr21129 ------
NM_031291chr41125 ------
NM_031296chr422343 2098 ------
NM_031309chr842278 2030 1983 41 --4462 255 181 114 --
NM_031314chr141487 --11593 --
NM_031371chr131311 524 197 ------
NM_031371chr131311 524 197 ------
NM_031411chr541882 1750 703 162 1720 ----
NM_031419chr33271 254 30 ------
NM_031427chr1431065 495 459 23819 53 11131 11785
NM_031435chr1221200 111 ------
NM_031442chrX52671 2051 795 774 363 11045 ----
NM_031461chr831726 75 47 ------
NM_031468chr797359 7192 7093 5587 5091 1904 415 326 241 38041 1242 82 27219 1710 28257 4999
NM_031483chr2073414 3005 2898 1321 1296 833 378 ------
NM_031844chr163759 3750 3440 2863 1046 371 1298 ----
NM_031845chr242985 2939 2240 987 12502 1199 --
NM_031847chr242985 2939 2240 987 12502 1199 --
NM_031849chr541882 1750 703 162 1720 ----
NM_031857chr541882 1750 703 162 1720 ----
NM_031860chr541882 1750 703 162 1720 ----
NM_031953chr41486 ----1182
NM_031954chr1262915 2731 1114 483 327 124 --12819 --
NM_032012chr943617 3424 1514 808 24965 874 24681 733 14008
NM_032116chr1344949 4472 1930 1242 13632 25635 5428 --
NM_032119chr5------1311
NM_032139chr193824 165 49 ------
NM_032144chr231579 1331 177 --1331 --
NM_032160chr1844293 4181 3383 2973 24105 4089 ----
NM_032189chr13105058 4868 4378 4152 3957 1805 1443 879 873 56 13249 ----
NM_032199chr1063830 3664 3544 1497 1064 849 42610 1084 473 42 ----
NM_032208chr252466 2327 1190 766 284 1812 --1709
NM_032228chr1173568 2436 2274 1424 1386 693 148 ------
NM_032236chr121057 1041 ------
NM_032281chr1952649 2320 1998 1963 855 12982 22634 2538 23134 42
NM_032288chr31599 --11552 1276
NM_032321chr252628 1014 645 458 179 1768 --11178
NM_032373chr1065560 5429 5376 4814 1724 577 25436 60 ----
NM_032435chr141677 1580 1563 466 21594 334 --11766
NM_032438chr63509 205 115 ------
NM_032439chr1041466 1233 511 425 ------
NM_032440chr1042894 2047 1999 947 11977 --12511
NM_032445chr1572549 2283 2238 1980 1869 1841 547 --21706 681 --
NM_032446chr533887 3468 812 23094 2341 ----
NM_032457chr432933 1512 1328 ------
NM_032458chrX43053 2627 745 596 23274 2128 11062 --
NM_032466chr851718 1662 1377 355 323 1490 ----
NM_032468chr851718 1662 1377 355 323 1490 ----
NM_032505chr342105 2076 402 389 ------
NM_032576chrY------1147
NM_032632chr1421692 332 11401 1211 --
NM_032663chr1242067 1859 775 437 11515 11431 --
NM_032664chr831564 1498 365 ------
NM_032682chr353335 2688 2368 1108 1056 1373 1980 1324
NM_032689chr1931483 1094 358 11179 ----
NM_032717chr431007 669 188 ------
NM_032778chr331243 519 472 13157 22313 1179 --
NM_032784chr62282 266 ------
NM_032813chr132787 162 ------
NM_032837chr1762156 1816 1543 787 144 136 --1544 --
NM_032858chr1----137 --
NM_032859chr1333989 2812 484 --13687 --
NM_032873chr1131452 964 943 ------
NM_032968chrX63908 1648 999 724 313 155 13898 1878 --
NM_032969chrX63908 1648 999 724 313 155 13898 1878 --
NM_032973chrY73900 2836 1642 999 724 313 155 13890 1878 --
NM_033027chr3----183 --
NM_033044chr111189 ------
NM_033055chr11862 ------
NM_033083chr373456 3215 3052 2498 1043 1001 357 1241 ----
NM_033121chr1231577 1150 116 --2401 110 --
NM_033132chr1332327 733 335 22298 566 ----
NM_033133chr1733421 3326 985 --43195 2432 1132 747 --
NM_033135chr1122417 2066 11512 --1805
NM_033138chr731925 502 460 2849 313 ----
NM_033139chr731925 502 460 2849 313 ----
NM_033140chr731925 502 460 2849 313 ----
NM_033143chr484652 4366 3333 1793 1413 1185 624 58 --14471 --
NM_033157chr731925 502 460 2849 313 ----
NM_033181chr683735 3715 1499 1488 1440 1009 844 22 ------
NM_033224chr768088 6247 5991 2304 380 135 68032 6031 5885 5595 5481 3016 46161 2718 2090 1074 15336
NM_033227chr52595 163 ------
NM_033228chr52635 203 ------
NM_033394chr211106 --21120 367 --
NM_033426chr1462309 2069 1845 1146 381 359 ------
NM_033429chr15112843 2614 2606 2529 2042 958 837 687 532 512 147 1597 ----
NM_033480chr642513 2306 2143 741 --21063 573 --
NM_033481chr642513 2306 2143 741 --21063 573 --
NM_033495chrX2878 189 ------
NM_033631chr143012 2431 1152 315 --43746 2543 2527 938 12970
NM_033632chr441603 1509 463 413 ----1138
NM_033637chr1053888 3348 1001 770 85 13450 1844 --
NM_033642chrX------133
NM_033646chr18----143 --
NM_033656chr2174336 4285 3843 3731 2228 329 185 --15263 --
NM_044472chr11163 ------
NM_052832chr843009 1217 1025 715 ------
NM_052834chr181594 --12054 1312
NM_052873chr141146 ------
NM_052885chr1213998 ----2773 342
NM_052905chr211836 --1221 --
NM_052906chr2265093 3433 3199 1650 865 567 24292 1913 43871 3785 3782 1483 --
NM_052907chr1274296 4095 3975 3841 2704 1127 233 23822 3318 178 11046
NM_052927chr531776 215 129 21438 536 21669 484 --
NM_052936chrX3789 122 106 1363 --1794
NM_052937chr83519 506 142 --1253 --
NM_053016chr967322 6676 2742 1725 1413 82 17108 17973 16852
NM_053023chr1152491 1075 960 861 708 1296 32482 248 245 --
NM_053024chr32517 506 --11060 --
NM_054016chr11303 ----1748
NM_054016chr11303 ----1748
NM_054016chr11303 ----1748
NM_058170chr111014 ------
NM_080388chr11408 --8436 433 430 427 424 421 418 412 1440
NM_080629chr131263 1061 493 132 ----
NM_080630chr131263 1061 493 132 ----
NM_080632chrX----1842 --
NM_080655chr9------187
NM_080669chr1784774 3391 3345 3037 1848 1379 350 89 1701 ----
NM_080670chr56904 817 368 271 103 93 ------
NM_080743chr631879 1023 718 ------
NM_080759chr1321651 724 ------
NM_080760chr1321651 724 ------
NM_080821chr2012154 --12129 --
NM_080867chr1434628 1256 572 14327 --13527
NM_100264chr10------1268
NM_100486chr10------1268
NM_130391chr933374 1243 857 13288 11416 --
NM_130392chr933374 1243 857 13288 11416 --
NM_130393chr933374 1243 857 13288 11416 --
NM_130434chr1531124 233 113 169 ----
NM_130438chr2183421 2816 2337 2300 2229 2163 1352 1250 22520 71 199 1557
NM_130469chr141753 ------
NM_133170chr20128064 7320 6954 5851 5616 5483 5415 2262 2196 1667 1176 674 35953 5199 2751 14981 --
NM_133265chrX53438 2991 2871 273 120 --31219 1155 454 --
NM_133329chr221550 393 ----11221
NM_133372chr532952 2714 230 --1347 --
NM_133378chr22991 679 ------
NM_133432chr22991 679 ------
NM_133433chr52843 589 ----1186
NM_133437chr22991 679 ------
NM_133445chr952586 2562 1241 969 404 --42573 2570 161 158 23282 701
NM_133478chr232498 2016 821 11985 1510 1989
NM_133493chr654113 798 411 142 27 14641 ----
NM_133510chr141259 ----1136
NM_133631chr311127 ------
NM_133646chr275599 4225 3732 1818 1677 1509 454 24879 885 ----
NM_133647chr15103547 3390 3354 3189 2471 2445 1527 1326 891 690 13658 23798 3780 --
NM_138270chrX42930 2922 590 276 178 ----
NM_138288chr1432240 2152 569 ------
NM_138426chr741929 1657 473 170 --12117 11933
NM_138444chr1344166 3282 1942 1599 24888 1169 1801 11630
NM_138448chr2121 135 ----
NM_138459chr633685 3585 1219 --12893 --
NM_138473chr1254853 3514 3123 1785 819 --13852 1823
NM_138569chr61270 ------
NM_138609chr5------1456
NM_138610chr5------1456
NM_138621chr234141 3261 1092 31078 963 186 1947 11426
NM_138633chr641606 1342 1220 588 1171 ----
NM_138638chr1452362 835 720 481 271 ------
NM_138713chr1665788 2722 2139 976 539 220 16782 15691 --
NM_138714chr1665788 2722 2139 976 539 220 16782 15691 --
NM_138730chr61356 ------
NM_138771chr721365 92 21043 419 ----
NM_138782chr531785 1712 1668 21692 655 ----
NM_138811chr721107 215 159 ----
NM_138959chr176103 6003 5393 4859 2117 1450 824 26218 4410 1876 16683
NM_138966chr182600 577 ------
NM_138970chr1422438 923 ------
NM_138971chr1153648 2723 2351 1126 918 12661 ----
NM_138971chr1153648 2723 2351 1126 918 12661 ----
NM_138972chr1153648 2723 2351 1126 918 12661 ----
NM_138972chr1153648 2723 2351 1126 918 12661 ----
NM_138973chr1153648 2723 2351 1126 918 12661 ----
NM_138973chr1153648 2723 2351 1126 918 12661 ----
NM_139045chr91197 ------
NM_139072chr2----1598 --
NM_139215chr171268 ------
NM_139242chr1511536 --1479 --
NM_139244chr61396 ------
NM_139246chr941941 1803 1550 894 1344 11670 1811
NM_139279chr2113260 3075 2985 2574 1366 1263 891 796 659 386 104 --12605 13302
NM_144571chr477023 5783 2239 1521 614 306 260 46743 5877 4976 498 11341 --
NM_144578chr1475108 4441 4265 4047 1184 859 560 14529 14463 --
NM_144590chr1072745 2612 2146 2019 1950 1194 357 ------
NM_144599chr15124648 4335 4276 3977 3833 2024 1742 1466 1385 1000 642 204 --1120 --
NM_144664chr1132112 305 298 11630 2341 245 --
NM_144709chr21153 ------
NM_144723chr5----1638 --
NM_144728chr11677 ------
NM_144729chr11677 ------
NM_144778chr1372649 2625 2584 2047 860 531 399 22303 91 ----
NM_144949chr23358 244 184 11718 ----
NM_144967chrX21016 893 ------
NM_144973chr1285028 4253 4199 3475 3379 1371 1222 1183 21387 1065 --11881
NM_144974chr132853 213 ------
NM_145010chr1062325 1498 895 456 188 55 ------
NM_145049chr52791 173 ------
NM_145055chr1831239 951 671 ------
NM_145056chr193868 593 141 ------
NM_145112chr143239 165 24 11125 --1907
NM_145113chr145511 437 296 177 151 11397 21008 997 11179
NM_145117chr1123046 2687 ------
NM_145251chr142297 152 ----1180
NM_145259chr2136927 6684 6613 5992 5560 5368 2679 2627 2122 1554 1526 225 138 --1616 --
NM_145320chr743156 2601 918 740 --11185 --
NM_145321chr743156 2601 918 740 --11185 --
NM_145322chr743156 2601 918 740 --11185 --
NM_145686chr241094 889 479 472 ------
NM_145687chr241094 889 479 472 ------
NM_145716chr11180 ------
NM_145808chr722828 299 --11910 --
NM_145891chr1631621 1492 69 --11498 --
NM_145892chr1631621 1492 69 --11498 --
NM_145893chr1631743 1614 191 --11620 --
NM_147150chr993854 3581 2414 917 816 628 492 455 140 12784 ----
NM_147190chr12154 --2682 591 --
NM_148174chr83545 262 113 ------
NM_148955chr1565948 4353 2056 1433 1392 233 --14366 --
NM_152253chr2283740 3599 2992 1215 1094 698 267 175 11441 14079 --
NM_152263chr156107 4566 3702 1674 1357 34598 4420 1276 --11222
NM_152272chr8------1980
NM_152275chr252375 1907 534 259 244 21674 1653 ----
NM_152277chr531851 1617 705 1744 ----
NM_152287chr1672620 2581 2205 1735 989 462 284 ----1690
NM_152330chr1431769 590 337 1460 12529 22335 715
NM_152332chr1452819 2790 2513 927 215 ------
NM_152381chr221409 147 11395 3684 285 30 --
NM_152388chr253630 3374 2730 1301 1125 ------
NM_152400chr491825 1796 1617 1340 653 342 317 287 176 21712 1692 ----
NM_152409chr562642 2626 2275 968 465 221 13225 ----
NM_152414chr8----11152 --
NM_152446chr143985 977 607 192 ----
NM_152467chr17136 ------
NM_152524chr21194 ------
NM_152529chr243688 3023 2692 1286 188 --34343 3319 611
NM_152536chr321204 28 --1443 --
NM_152556chr731695 1636 1597 ------
NM_152581chrX31486 354 126 ----160
NM_152594chr1532245 832 85 11928 11878 --
NM_152622chr532825 2295 34 22528 203 ----
NM_152625chr51329 ------
NM_152629chr92829 600 23060 575 12650 13359
NM_152666chr11787 ------
NM_152695chrX32137 2041 1898 --168 --
NM_152699chr363533 2808 1488 1094 1048 681 23616 3076 13299 13337
NM_152707chr1031009 853 693 ----1409
NM_152724chr1062334 2281 2184 1874 1820 1021 ----12449
NM_152745chr72866 395 ------
NM_152756chr574156 3189 3080 3065 1422 543 93 --11047 --
NM_152758chr842731 2530 2143 341 ----22040 624
NM_152785chr352383 2140 1999 1873 844 ----11908
NM_152787chrX53798 3528 2737 1475 481 ------
NM_152826chr1565948 4353 2056 1433 1392 233 --14366 --
NM_152835chr1260 50 21931 1850 1775 --
NM_152890chr121107 352 ------
NM_152903chr1322604 327 ----11825
NM_152924chr1585641 4856 2340 2102 847 757 118 29 ----14904
NM_152998chr71212 ------
NM_152999chr764715 4492 4441 3393 3336 739 1343 ----
NM_153020chr631479 403 94 1277 1672 --
NM_153181chr182600 577 ------
NM_153182chr331243 519 472 13157 22313 1179 --
NM_153184chr321931 1759 --1410 --
NM_153188chr545303 4484 1904 1884 25510 4186 ----
NM_153223chr541351 1286 1166 984 11256 ----
NM_153235chr651713 1492 342 241 56 ----12062
NM_153260chr1511344 11243 --31180 333 240
NM_153261chr1641505 1412 134 113 ------
NM_153262chr13365 241 38 11163 11966 12132
NM_153616chr1552121 1472 297 175 144 ------
NM_153617chr1552121 1472 297 175 144 ------
NM_153618chr1552121 1472 297 175 144 ------
NM_153619chr1563359 2710 2414 2270 1413 1382 22391 207 ----
NM_153634chr1241562 1456 495 117 1270 1475 1196
NM_153645chr2233320 3115 2306 ------
NM_153687chr1221306 1165 ------
NM_153689chr23742 584 378 --1157 --
NM_153759chr251116 401 388 375 30 ------
NM_153810chr1053474 3254 1724 1309 315 --14807 --
NM_170606chr7----11362 --
NM_170665chr12124571 4457 3903 3826 3544 3268 3109 2809 1620 1498 1271 1253 2901 318 12820 2770 346
NM_170674chr1531175 482 324 ----1468
NM_170675chr152851 158 ----1144
NM_170676chr152851 158 ----1144
NM_170677chr1531175 482 324 ----1468
NM_170686chr793200 2383 2258 1965 1177 1045 964 333 43 12662 ----
NM_170695chr181317 ------
NM_170696chr1551750 1684 1560 1548 1427 1683 ----
NM_170697chr1551750 1684 1560 1548 1427 1683 ----
NM_170706chr144293 3882 3092 23 --6783 780 777 774 771 768 --
NM_170709chr852340 1611 897 855 347 12103 1592 --
NM_170723chrY2198 43 ------
NM_170750chrX2860 716 ------
NM_171998chrX42395 2280 954 525 12196 ----
NM_172071chr155331 2162 2150 970 550 ----17173
NM_172315chr1531175 482 324 ----1468
NM_172316chr1531175 482 324 ----1468
NM_172344chr221550 393 ----11221
NM_173054chr72912 775 2805 288 ----
NM_173060chr541927 1460 591 308 ----2719 91
NM_173061chr541927 1460 591 308 ----2719 91
NM_173063chr541927 1460 591 308 ----2719 91
NM_173171chr22894 387 --11008 --
NM_173172chr221202 272 --11316 --
NM_173173chr22894 387 --11008 --
NM_173207chr181317 ------
NM_173208chr181317 ------
NM_173209chr181317 ------
NM_173210chr181317 ------
NM_173211chr181317 ------
NM_173214chr1665788 2722 2139 976 539 220 16782 15691 --
NM_173354chr213856 111 45 --12061 --
NM_173468chr454746 4199 2224 1742 490 15421 32009 1754 1292 12405
NM_173470chrX52866 2484 2128 471 397 12098 1670 --
NM_173473chr1082610 2532 2447 2318 973 599 155 33 ----12247
NM_173519chr841974 1819 750 466 11466 11787 --
NM_173576chr1021996 1512 --11626 --
NM_173642chr199018 8129 7516 6060 5999 3271 3191 2671 1699 17539 ----
NM_173672chr622370 826 1747 --1622
NM_173694chrX32469 362 128 11855 12332 --
NM_173797chr521353 48 ----1841
NM_173807chr1------124
NM_173808chr194147 4129 3681 3066 1642 958 844 383 103 24017 3540 --14029
NM_173812chr1221259 1012 21313 101 1484 --
NM_173822chr221854 159 11703 ----
NM_173825chr342497 2103 942 657 --12218 --
NM_173826chr341570 1253 472 82 ----31145 693 304
NM_173829chr554765 4424 1909 155 94 --15113 13843
NM_173851chr863864 2579 1162 928 596 288 --1266 --
NM_173854chr122302 457 11900 ----
NM_174886chr181317 ------
NM_174887chr171377 ------
NM_174911chr852792 2631 1541 616 597 --12807 22418 582
NM_174916chr1562279 2072 1539 1532 466 39 ------
NM_174921chr42892 112 ----11183
NM_175061chr731877 1396 40 ----12116
NM_175607chr32368 43 --11155 --
NM_175612chr32368 43 --11155 --
NM_175623chr1297175 7060 5985 5394 2816 2383 2374 2315 1324 46988 5478 5444 4766 35746 1870 1327 --
NM_175624chr1297270 7155 6080 5489 2911 2478 2469 2410 1419 47083 5573 5539 4861 35841 1965 1422 --
NM_175625chr1297270 7155 6080 5489 2911 2478 2469 2410 1419 47083 5573 5539 4861 35841 1965 1422 --
NM_175629chr251116 401 388 375 30 ------
NM_175736chr12107778 7536 6872 6484 6226 6013 2467 2383 2159 1315 36140 5554 2609 27351 7311 15061
NM_175767chr551716 709 413 342 131 11481 11366 11551
NM_175859chrX1603 ------
NM_175861chr1235231 1354 82 24986 2133 33761 3736 1784 --
NM_175863chr6------1498
NM_176863chr1711440 ------
NM_177422chr11198 ------
NM_177438chr1433790 383 138 22948 151 23974 3971 --
NM_177452chr14128 21754 350 12184 --
NM_177947chrX21699 29 1448 ----
NM_177948chrX21699 29 1448 ----
NM_177990chr2041919 1484 436 320 1147 ----
NM_177996chr2073263 2426 1231 958 532 244 90 --11293 12361
NM_178011chr1042904 2896 2889 696 ----1891
NM_178037chr1273220 2556 2522 1194 810 755 637 1303 --11293
NM_178038chr1273220 2556 2522 1194 810 755 637 1303 --11293
NM_178140chr542679 1786 1113 672 --1167 --
NM_178151chrX117769 7641 7491 7129 6482 6074 2395 1192 867 241 82 35848 5400 1165 ----
NM_178152chrX117769 7641 7491 7129 6482 6074 2395 1192 867 241 82 35848 5400 1165 ----
NM_178153chrX117769 7641 7491 7129 6482 6074 2395 1192 867 241 82 35848 5400 1165 ----
NM_178161chr10----1220 --
NM_178270chrX3789 122 106 1363 --1794
NM_178313chr252074 484 346 319 187 ------
NM_178424chr51432 ------
NM_178426chr142255 2248 2089 274 --21456 45 --
NM_178554chr363415 3399 1263 1029 483 464 ----11294
NM_178565chr831197 609 125 ------
NM_178585chr443234 2041 475 234 22453 2324 13263 13052
NM_178587chr141105 ------
NM_178812chr841424 1360 281 69 2299 190 ----
NM_178815chr1041015 676 236 122 22728 884 182 --
NM_181077chr1572323 1991 1815 1805 1634 1540 373 22244 1842 1790 --
NM_181332chrX52740 2342 2109 1900 49 ------
NM_181354chr881639 1559 1151 446 256 229 91 81 ------
NM_181361chr321397 133 11133 ----
NM_181457chr23542 116 100 ------
NM_181458chr24249 233 167 129 ------
NM_181460chr23488 62 46 ------
NM_181481chr1886975 6799 4379 2038 1202 1153 1060 982 35092 4873 2825 45669 5499 5248 1667 15567
NM_181482chr1886975 6799 4379 2038 1202 1153 1060 982 35092 4873 2825 45669 5499 5248 1667 15567
NM_181483chr1886975 6799 4379 2038 1202 1153 1060 982 35092 4873 2825 45669 5499 5248 1667 15567
NM_181504chr533407 2994 511 22803 1073 --22596 656
NM_181521chr1657105 2561 1572 1391 310 14395 14725 --
NM_181523chr533407 2994 511 22803 1073 --22596 656
NM_181524chr533407 2994 511 22803 1073 --22596 656
NM_181571chr105363 300 286 226 29 ------
NM_181655chr172794 51 1279 ----
NM_181656chr1731003 647 260 --3139 136 25 --
NM_181659chr2063251 2902 2423 875 747 181 --1678 --
NM_181659chr2063251 2902 2423 875 747 181 --1678 --
NM_181723chr821908 60 1665 1773 --
NM_181836chr542657 2544 2117 90 --22191 692 --
NM_181872chr91250 ------
NM_181897chr322017 1086 --2288 148 12182
NM_182485chr442944 691 309 142 12439 ----
NM_182487chr974422 4148 3440 3091 3010 1117 58 1275 3803 800 34 --
NM_182492chr221301 ------
NM_182501chr242900 2691 2413 1099 1549 32044 1289 871 --
NM_182526chr1472742 2609 2382 2293 520 428 88 --1314 1208
NM_182641chr1731959 703 138 1173 --11986
NM_182643chr8----12162 2968 493
NM_182646chr442944 691 309 142 12439 ----
NM_182648chr142673 83 ------
NM_182666chr31222 2429 115 ----
NM_182691chr751395 1361 1214 1029 82 ------
NM_182692chr751395 1361 1214 1029 82 ------
NM_182718chr105363 300 286 226 29 ------
NM_182719chr105363 300 286 226 29 ------
NM_182724chr105363 300 286 226 29 ------
NM_182725chr105363 300 286 226 29 ------
NM_182758chr1553737 3654 606 284 182 11230 ----
NM_182763chr131735 1095 218 ------
NM_182767chr1241988 1932 1416 135 --1561 --
NM_182769chr105363 300 286 226 29 ------
NM_182770chr105363 300 286 226 29 ------
NM_182771chr105363 300 286 226 29 ------
NM_182772chr105363 300 286 226 29 ------
NM_182789chr51246 ------
NM_182835chr14176 ------
NM_182850chr105363 300 286 226 29 ------
NM_182898chr776410 5965 5276 5213 2323 1774 1270 15761 35018 2329 1409 15005
NM_182899chr776410 5965 5276 5213 2323 1774 1270 15761 35018 2329 1409 15005
NM_182918chr21--1504 --1377
NM_182920chr3156 ------
NM_182948chr152708 2341 736 581 174 ------
NM_182964chr1123046 2687 ------
NM_182970chr2063944 3657 1146 718 644 202 12841 34208 3853 3071 --
NM_182975chr111063 ------
NM_182976chr11507 ------
NM_183004chr1463825 3533 584 446 72 27 ------
NM_183043chr132920 724 2341 104 ----
NM_183044chr132920 724 2341 104 ----
NM_183060chr105363 300 286 226 29 ------
NM_183078chr653387 2695 2623 1526 460 --13883 1554
NM_183323chr51246 ------
NM_183376chr1552563 2496 2068 757 415 ----1130
NM_183380chr61827 ------
NM_183393chr31216 ------
NM_183394chr31216 ------
NM_183419chr81464 ------
NM_194247chr244557 3486 3230 1590 13070 24004 3837 21754 1241
NM_194250chr21441 ------
NM_194278chr1463405 2571 1399 878 450 419 --1914 12529
NM_194285chr113851 671 464 ----11264
NM_194286chr1256131 4883 4099 1684 1116 1719 31728 1462 1456 --
NM_194291chr832689 2408 231 12836 191 --
NM_194298chr1041660 1636 1419 49 162 ----
NM_194328chr93899 876 786 --12379 --
NM_194329chr93899 876 786 --12379 --
NM_194330chr93899 876 786 --12379 --
NM_194332chr93899 876 786 --12379 --
NM_194434chr1845589 4489 4092 3889 23526 602 ----
NM_197941chr563012 2825 2567 2382 489 301 --12425 --
NM_198066chr1422871 2818 12117 ----
NM_198097chr71110 ------
NM_198120chr82587 60 ------
NM_198158chr352976 2873 2776 2555 130 ------
NM_198159chr352976 2873 2776 2555 130 ------
NM_198177chr352976 2873 2776 2555 130 ------
NM_198178chr352976 2873 2776 2555 130 ------
NM_198195chr31561 --187 --
NM_198267chr71616 ------
NM_198270chrX43393 2584 894 760 11205 ----
NM_198273chr52865 460 1559 12445 11101
NM_198281chr462627 2557 2152 1368 1065 983 22766 2577 ----
NM_198376chr171265 ------
NM_198377chr171265 ------
NM_198378chr171265 ------
NM_198379chr171265 ------
NM_198380chr171265 ------
NM_198381chr111287 1882 --165
NM_198382chr171265 ------
NM_198383chr171265 ------
NM_198384chr171265 ------
NM_198385chr171265 ------
NM_198386chr171265 ------
NM_198387chr171265 ------
NM_198388chr171265 ------
NM_198391chr2021181 570 ------
NM_198396chr171265 ------
NM_198402chr31326 ------
NM_198467chr71129 ------
NM_198503chr111738 ----11886
NM_198507chr51146 ------
NM_198513chr831713 1409 387 ----11629
NM_198560chr333756 2947 2685 ------
NM_198569chr672608 1984 1827 1813 1668 1658 219 --11075 --
NM_198581chr297172 5814 5212 2208 1268 974 778 551 364 12449 --11034
NM_198597chr103735 314 80 ------
NM_198679chr962244 2044 1780 997 578 221 1357 42231 2047 685 682 1342
NM_198715chr144965 1057 204 41 26107 2381 15482 14107
NM_198793chr364088 2975 1034 1007 885 445 14020 2648 267 --
NM_198794chr1421468 292 --11252 --
NM_198830chr171666 ------
NM_198844chr171920 ------
NM_198859chr344685 3592 2049 161 14332 25050 3424 --
NM_198880chr31651 ------
NM_198900chr12107778 7536 6872 6484 6226 6013 2467 2383 2159 1315 36140 5554 2609 27351 7311 15061
NM_198902chr15----1323 --
NM_198904chr522029 1376 1417 ----
NM_198935chr2042877 2834 2538 925 22478 381 ----
NM_198947chr114786 665 147 83 1916 ----
NM_198968chr1363767 3349 611 188 115 36 11542 ----
NM_199000chr761976 753 452 63 43 23 2407 181 ----
NM_199003chr82321 146 ----11535
NM_199039chr411112 ------
NM_199044chr152945 1976 475 190 141 --12809 --
NM_199072chr722466 514 22484 857 --1694
NM_199169chr2053626 3233 2717 392 97 ------
NM_199170chr2053626 3233 2717 392 97 ------
NM_199171chr2053626 3233 2717 392 97 ------
NM_199185chr5----158 --
NM_199189chr52758 382 ----1223
NM_199320chr462960 2417 1093 865 632 534 11084 21993 515 --
NM_199320chr462960 2417 1093 865 632 534 11084 21993 515 --
NM_199321chr171920 ------
NM_199324chr433018 2957 1139 129 12716 --
NM_199421chr1434628 1256 572 14327 --13527
NM_199461chr1023347 950 --23526 827 22500 1363
NM_199462chr154893 4802 4209 3128 194 --1361 54378 3659 1996 1470 953
NM_199478chrX31631 771 128 11402 ----
NM_199511chr31840 ------
NM_199512chr31840 ------
NM_201263chr131576 844 617 191 --21761 805
NM_201280chr651432 1065 609 365 103 ------
NM_201413chr2121014 144 ------
NM_201414chr2121014 144 ------
NM_201628chr173388 2286 2273 2262 2059 1202 778 --12063 --
NM_203301chr1421365 1332 ----21420 497
NM_203327chr2074248 4075 3254 1737 1422 1249 65 --13687 --
NM_203341chr1--1387 --1326
NM_203350chr131228 1171 1124 1439 ----
NM_203406chr552504 2068 1985 830 467 11920 ----
NM_203417chr2141327 1290 1106 452 ------
NM_203418chr2141327 1290 1106 452 ------
NM_203446chr2162694 2490 2472 2398 896 174 --12097 1824
NM_203451chr13--12110 133 12347
NM_203487chr1341803 1459 1144 159 2295 79 --11206
NM_203504chr432644 1811 179 1447 2527 517 --
NM_203505chr432644 1811 179 1447 2527 517 --
NM_205861chr151972 1744 819 813 246 ----1761
NM_206594chr173666 3124 1457 923 768 699 132 22598 110 11117 --
NM_206595chr173666 3124 1457 923 768 699 132 22598 110 11117 --
NM_206852chr14----154 --
NM_206853chr674152 3206 3108 888 566 532 67 --13481 12548
NM_206854chr695413 4467 4369 3320 2149 1827 1793 1328 30 --14742 13809
NM_206855chr676378 5432 5334 4285 2293 995 495 --15707 14774
NM_206857chr14----154 --
NM_206866chr2173131 2779 2462 1049 833 339 318 ----11029
NM_206876chr243417 2311 1244 885 ------
NM_206907chr552693 2254 1255 458 31 22807 2276 1467 12590
NM_206909chr868311 7192 6823 3135 3113 766 --26581 791 --
NM_207009chr102703 248 191 ----
NM_207012chr1063523 2751 2595 2585 1265 1217 1350 23281 286 13259
NM_207111chr752486 1898 1866 265 26 --32093 1902 595 1599
NM_207116chr752486 1898 1866 265 26 --32093 1902 595 1599
NM_207291chr191536 ------
NM_207292chr353049 2111 1159 1008 103 1840 ----
NM_207293chr353049 2111 1159 1008 103 1840 ----
NM_207294chr353049 2111 1159 1008 103 1840 ----
NM_207295chr353049 2111 1159 1008 103 1840 ----
NM_207296chr353049 2111 1159 1008 103 1840 ----
NM_207297chr353074 2136 1184 1033 128 1865 ----
NM_207304chr1372536 2512 2471 1934 747 418 286 12190 ----
NM_207361chr1375153 4546 3843 2091 1697 1664 218 34105 417 324 11292 --
NM_207366chr722266 1443 22302 1787 11475 --
NM_207406chr465150 4482 4403 3953 1998 558 24599 186 12212 --
NM_207445chr1542016 1422 760 193 --1645 --
NM_207481chr24592 438 401 69 11292 ----
NM_207517chr1541766 1728 1421 421 ------
NM_213651chr11131 ------
NM_213654chr321513 25 11242 ----