TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3672
miRNA Sequence: AUGAGACUCAUGUAAAACAUCUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr531332 1035 942 ------
NM_000038chr531578 1280 177 3807 301 69 ----
NM_000052chrX42526 1383 1029 799 11222 1820 12993
NM_000084chrX86450 5399 4937 4297 4222 2681 2203 1993 34321 2323 1323 35199 1595 878 --
NM_000088chr1711253 ------
NM_000089chr7----2692 180 --
NM_000097chr351196 486 340 269 107 ------
NM_000104chr222689 399 --2863 442 --
NM_000108chr741320 1207 493 196 1699 ----
NM_000109chrX1225 --12241 --
NM_000110chr141150 318 275 166 ------
NM_000111chr7--1120 ----
NM_000112chr5125549 5257 4371 3834 1961 1770 1587 1569 1268 884 516 211 11986 24355 581 --
NM_000125chr634014 3146 770 ------
NM_000163chr511699 21723 261 32262 2133 1531 --
NM_000165chr621483 1352 ------
NM_000168chr723002 2309 1135 22410 2029 --
NM_000176chr513377 --33129 3118 1543 12439
NM_000194chrX1490 ------
NM_000202chrX53850 3252 2610 1265 183 23710 561 13114 --
NM_000208chr1944509 3623 3463 1032 21163 258 13242 --
NM_000210chr232336 2242 890 2664 646 21798 762 --
NM_000217chr1245198 4319 4050 2119 1738 ----
NM_000220chr113985 347 34 --2794 313 --
NM_000230chr752107 1028 710 591 575 22806 2418 ----
NM_000237chr821833 424 2730 104 --1170
NM_000242chr1012507 12632 32205 820 446 --
NM_000245chr711876 2716 429 --1864
NM_000259chr1544564 4034 689 439 14488 15081 15666
NM_000264chr943066 2669 2550 1172 ----1334
NM_000286chr172870 64 ------
NM_000297chr452008 1822 1313 288 109 --1350 --
NM_000302chr11708 ------
NM_000314chr1022805 2566 12321 13294 --
NM_000321chr1311817 ----11480
NM_000328chrX294 81 ------
NM_000330chrX4608 450 398 297 1508 1323 --
NM_000332chr687180 6614 6125 4579 2142 1741 1162 425 16568 15219 11307
NM_000334chr1721935 1916 21420 463 132 1395
NM_000337chr546516 4314 2630 224 --12382 15421
NM_000346chr1721909 1324 ------
NM_000368chr963454 3314 1812 1521 1009 652 171 ----
NM_000379chr231404 1262 24 ------
NM_000390chrX63109 2701 2456 2299 318 50 --21082 964 --
NM_000393chr2--41859 1401 608 139 11901 --
NM_000408chr232705 1124 1096 12728 1727 1643
NM_000430chr1723000 1018 1705 ----
NM_000448chr114998 933 841 42 ----23229 871
NM_000452chr1321962 142 ------
NM_000458chr172742 192 --1905 --
NM_000459chr91241 ------
NM_000462chr1531299 1284 537 ------
NM_000480chr1151628 1491 1422 1388 607 ------
NM_000486chr1222307 2229 --22695 1059 --
NM_000489chrX52693 2352 1149 1125 628 --13399 13286
NM_000492chr7--11148 ----
NM_000500chr6137 ------
NM_000503chr841555 1466 447 134 --170 --
NM_000533chrX51625 1497 473 160 143 ------
NM_000536chr111540 ------
NM_000555chrX127019 5865 5574 5538 5114 5031 4932 2500 2187 1395 922 338 --12176 --
NM_000565chr131531 792 452 31555 1473 195 ----
NM_000574chr12423 55 ------
NM_000575chr22452 22 1929 ----
NM_000586chr41183 ------
NM_000609chr1052923 2638 2228 2206 654 12981 ----
NM_000610chr1152293 1122 795 721 99 --12079 --
NM_000615chr1122614 2441 --1408 --
NM_000618chr1276399 5783 5318 4435 1984 1276 742 15510 ----
NM_000618chr1276399 5783 5318 4435 1984 1276 742 15510 ----
NM_000663chr1612158 12009 12812 --
NM_000668chr441361 421 407 33 11064 ----
NM_000700chr9182 ------
NM_000719chr1265703 5647 1990 1162 747 62 140 26486 1595 --
NM_000724chr1051520 1279 490 76 43 11709 --1653
NM_000756chr81416 ------
NM_000782chr201229 1814 ----
NM_000801chr201981 --1288 21088 830
NM_000806chr551769 1626 1569 431 114 2409 98 ----
NM_000809chr499157 8112 7840 7812 7786 7409 6789 6469 3322 39134 6246 5896 ----
NM_000813chr535326 3405 979 24237 3783 15575 --
NM_000814chr1553981 3224 2796 1433 910 ------
NM_000816chr5--1212 145 --
NM_000831chr1116159 6071 5050 4712 4302 2472 1461 1200 1154 724 313 ------
NM_000840chr71408 ------
NM_000868chrX32571 1714 549 182 ----
NM_000875chr1597022 5655 5114 4324 2390 2205 1157 756 293 15355 --12483
NM_000891chr1743683 3629 2858 1450 1143 ----
NM_000899chr1243785 419 315 270 13105 --13323
NM_000901chr451001 694 334 119 36 ------
NM_000917chr102910 138 ----170
NM_000919chr53571 517 178 ------
NM_000944chr421853 805 11728 --1547
NM_000945chr221398 1383 ------
NM_000950chrX23063 1426 2980 329 11306 --
NM_000963chr132437 2027 1782 ------
NM_000965chr331285 1132 319 ------
NM_000966chr121144 ------
NM_001001132chr2131029 937 926 ------
NM_001001323chr1252603 2285 2145 1257 1050 13185 ----
NM_001001342chr1061225 1038 955 557 55 28 --11380 --
NM_001001389chr1152293 1122 795 721 99 --12079 --
NM_001001390chr1152293 1122 795 721 99 --12079 --
NM_001001391chr1152293 1122 795 721 99 --12079 --
NM_001001392chr1152339 1168 841 767 145 --12125 --
NM_001001395chr1242446 1985 1871 982 ------
NM_001001396chr154086 3536 1562 1521 997 --12859 13412
NM_001001481chr821217 71 --13358 --
NM_001001483chr11--1324 ----
NM_001001521chr2141 ------
NM_001001549chr742138 1812 1072 999 1461 ----
NM_001001550chr742138 1812 1072 999 1461 ----
NM_001001555chr742138 1812 1072 999 1461 ----
NM_001001664chr211233 22696 930 13929 1350
NM_001001668chr1943808 3142 1378 1122 1840 ----
NM_001001669chr542519 2494 2193 899 11912 1317 --
NM_001001790chr92385 52 ------
NM_001001974chr1042137 1537 653 45 ----11512
NM_001001994chrX------1363
NM_001001995chrX1203 1128 ----
NM_001001996chrX------1363
NM_001002033chr17196 --1785 --
NM_001002243chr23691 365 22 ------
NM_001002258chr242022 1911 776 653 --1576 --
NM_001002295chr101245 1812 --1782
NM_001002814chr823280 3067 22536 1329 ----
NM_001002838chrX3609 511 73 --1482 --
NM_001002843chr1521227 260 --121 --
NM_001002860chr1443636 3036 1877 108 23182 1111 11276 --
NM_001002906chrY2543 159 ------
NM_001002909chr1731536 1486 549 ------
NM_001003407chr1073932 3824 3792 3544 3280 1773 1180 ------
NM_001003408chr1073932 3824 3792 3544 3280 1773 1180 ------
NM_001003652chr1898170 6286 5971 3163 2594 1791 875 249 126 --13134 --
NM_001003678chr11--1112 ----
NM_001003679chr11647 ------
NM_001003681chr2221780 419 1604 ----
NM_001003698chr641763 1411 1234 626 1760 --1712
NM_001003699chr641763 1411 1234 626 1760 --1712
NM_001003712chr1253550 3423 1316 794 318 ------
NM_001003760chr622772 2512 1784 22579 2372 --
NM_001003790chr82303 181 ------
NM_001003791chr82303 181 ------
NM_001003792chr321131 957 1783 ----
NM_001003793chr321131 957 1783 ----
NM_001004065chr931558 1172 436 ------
NM_001004317chr684474 4384 3869 3361 3286 2829 1686 1630 23923 3812 12919 13671
NM_001004342chr185091 5053 4675 3813 1903 1817 880 526 --25331 4943 16082
NM_001005353chr141072 884 865 352 1234 ----
NM_001005353chr141072 884 865 352 1234 ----
NM_001005366chr121148 ------
NM_001005375chrY31508 1201 1174 --2623 111 --
NM_001005415chr19--1427 ----
NM_001005416chr19--1427 ----
NM_001005417chr1----1157 --
NM_001005463chr1031908 1008 296 12498 ----
NM_001005473chr585670 4222 1664 1406 627 562 275 99 1458 44050 4016 1395 1353 --
NM_001005527chr331179 887 284 ------
NM_001005739chr21553 ------
NM_001005910chr33647 593 496 1226 ----
NM_001005911chr33647 593 496 1226 ----
NM_001006600chr5----11992 12461
NM_001006610chr16----147 --
NM_001006617chr931145 948 550 ------
NM_001006619chr931145 948 550 ------
NM_001006620chr931145 948 550 ------
NM_001006621chr931145 948 550 ------
NM_001007024chr1783896 3265 3172 2672 474 457 337 175 --1644 --
NM_001007025chr1783896 3265 3172 2672 474 457 337 175 --1644 --
NM_001007027chr111210 ------
NM_001007097chr974199 3941 3929 3511 1930 1790 1240 1682 24875 3775 --
NM_001007099chr1----1265 --
NM_001007100chr1----1265 --
NM_001007257chr11399 ------
NM_001007466chr674110 3679 3288 3257 3238 2035 1912 --21597 880 --
NM_001007527chr52675 55 1502 ----
NM_001007559chr1831643 1537 137 41835 1579 538 284 1810 --
NM_001007794chr11511 ------
NM_001008239chr1872812 2660 2602 2350 928 556 340 12556 ----
NM_001008388chr41929 160 1989 --
NM_001008392chr342734 2698 482 471 ------
NM_001008408chr776437 6353 5168 2425 645 437 98 24724 618 22003 1190 --
NM_001008495chr81435 --11445 --
NM_001008529chr1721256 441 ----1871
NM_001008530chr143332 186 88 ----1482
NM_001008540chr22484 180 ------
NM_001008541chr1041971 1897 1816 91 ------
NM_001008541chr1041971 1897 1816 91 ------
NM_001008566chr22----1459 --
NM_001008738chr552819 2294 980 702 354 12685 21829 305 --
NM_001008744chr1461377 1354 1029 403 305 194 --196 --
NM_001008895chr1341220 1104 907 552 ------
NM_001008925chr453113 2565 1121 567 345 --22434 96 --
NM_001009880chr2253905 3585 3316 1636 1140 33963 3173 3086 ----
NM_001009894chr1221220 574 ----21569 140
NM_001009899chr375861 4977 4585 2168 1522 1165 843 ------
NM_001009909chr1153573 3556 2633 2573 1063 12597 ----
NM_001009955chr1----1173 --
NM_001009955chr1----1173 --
NM_001009958chr71636 ------
NM_001009959chr222235 1605 ------
NM_001009993chr263914 3685 2877 1058 787 167 1193 1436 --
NM_001010854chr141212 ------
NM_001010861chr142737 2551 2021 303 1839 ----
NM_001010867chr1116280 6271 6053 5926 5739 2007 1906 892 839 478 453 24644 2197 15167 --
NM_001010888chrX94588 4149 4078 3781 1676 1296 1260 605 155 1629 --14442
NM_001010895chr931523 1481 397 11415 1667 --
NM_001010917chr101791 ------
NM_001010971chr11356 --158 --
NM_001010984chr151938 1752 223 185 86 11767 11685 11775
NM_001011537chr342384 2179 1671 841 --21557 626 --
NM_001011538chr4--11085 --1659
NM_001011666chr744882 1820 1536 297 45190 4190 2018 1557 22045 1358 --
NM_001011708chr21576 2725 618 12637 --
NM_001011713chr143536 372 127 ------
NM_001011720chr821469 41 ------
NM_001011724chr131209 ------
NM_001011725chr131209 ------
NM_001012267chr921527 1485 21779 764 1513 --
NM_001012393chr1153648 3524 1702 1595 1490 --24332 348 --
NM_001012398chr162360 203 ------
NM_001012410chr32361 127 ------
NM_001012420chr1552634 2312 2290 687 176 --11928 --
NM_001012423chr1552634 2312 2290 687 176 --11928 --
NM_001012751chr1041650 576 567 332 2552 78 ----
NM_001012755chrX94759 3361 2037 1438 1374 1207 1165 770 211 21992 1399 1223 --
NM_001012968chrX42134 761 507 431 --1154 --
NM_001013031chr1023321 957 --11048 --
NM_001013406chr721217 404 ------
NM_001013438chr33913 248 151 ------
NM_001013615chr161187 1009 973 241 160 56 1442 ----
NM_001013620chr1277058 6806 6508 6243 5257 3018 993 25968 3042 27692 2850 --
NM_001013642chr131157 1059 905 ------
NM_001013659chr1951480 1388 621 599 235 31065 641 259 ----
NM_001013699chr121459 ------
NM_001014286chr132223 66 ------
NM_001014342chr111724 ----1126
NM_001014797chr1098220 7180 7152 2478 2255 1540 1496 1458 1420 --47272 6034 1642 1066 --
NM_001014972chr2192 ------
NM_001015877chrX53074 2605 899 873 220 ------
NM_001017368chr1772212 1116 961 674 480 441 390 12600 1328 22846 900
NM_001017371chr221020 457 ------
NM_001017423chr102159 57 --1655 --
NM_001017923chr1411408 --1114 --
NM_001017926chr82617 509 ------
NM_001017962chr102910 138 ----170
NM_001017963chr142684 595 --1209 --
NM_001017969chr91549 1237 ----
NM_001017995chr544043 3848 369 157 24857 4217 13753 --
NM_001017999chr11792 ----11870
NM_001017999chr11792 ----11870
NM_001018000chr11792 ----11870
NM_001018000chr11792 ----11870
NM_001018001chr11792 ----11870
NM_001018009chr3--11200 1128 --
NM_001018038chr92452 81 ----153
NM_001018054chr111064 ------
NM_001018064chr921546 519 ------
NM_001018074chr513377 --33129 3118 1543 12439
NM_001018075chr513377 --33129 3118 1543 12439
NM_001018076chr513377 --33129 3118 1543 12439
NM_001018077chr513377 --33129 3118 1543 12439
NM_001018108chr1521937 884 11999 ----
NM_001018111chr763903 3090 1615 1561 1444 753 ------
NM_001020658chr11586 ----11230
NM_001020658chr11586 ----11230
NM_001023567chr1532460 690 176 --11949 --
NM_001023587chr31315 11075 ----
NM_001024094chr513377 --33129 3118 1543 12439
NM_001024226chr11204 ------
NM_001024227chr11204 ------
NM_001024228chr11204 ------
NM_001024460chr611122 ----1379
NM_001024649chr532509 2456 319 ------
NM_001024660chr33501 450 25 ------
NM_001024808chr1232851 1148 270 21800 116 ----
NM_001024847chr352125 1927 1555 1539 547 ----12423
NM_001024948chr132483 739 457 --11012 1602
NM_001025072chr372964 2636 2434 2374 2207 423 291 12398 --12597
NM_001025073chr372964 2636 2434 2374 2207 423 291 12398 --12597
NM_001025076chr10116182 6053 5234 5213 4910 4655 4024 2209 1873 813 501 2746 100 24756 112 1826
NM_001025077chr10117540 7411 6592 6571 6268 6013 5382 2171 1859 1235 978 45026 2104 1458 72 36114 5046 1470 12184
NM_001025108chr272916 2602 2562 1361 1307 240 36 33024 2941 940 ----
NM_001025266chr364617 3907 1605 861 662 165 11798 23740 3000 33391 3384 1422
NM_001025356chr1242717 1149 844 387 --2571 147 1110
NM_001025366chr6--11534 ----
NM_001025366chr6--11534 ----
NM_001025367chr6--11534 ----
NM_001025367chr6--11534 ----
NM_001025368chr6--11534 ----
NM_001025368chr6--11534 ----
NM_001025369chr6--11550 ----
NM_001025369chr6--11550 ----
NM_001025370chr6--11534 ----
NM_001025370chr6--11534 ----
NM_001025389chr1151628 1491 1422 1388 607 ------
NM_001025390chr1151628 1491 1422 1388 607 ------
NM_001025579chr171314 ------
NM_001025580chrX63902 3539 3203 1385 293 113 11097 ----
NM_001025595chr41195 ------
NM_001029858chr642821 2776 1062 503 13079 22337 1219 --
NM_001029863chr623230 818 12241 22058 682 --
NM_001029875chr572651 2547 2269 1012 956 550 414 ------
NM_001029884chr652606 2015 1856 1760 238 12039 ----
NM_001030007chr1662743 2446 1504 1304 1253 806 12506 13922 1977
NM_001030055chr1464721 4125 3976 3690 90 63 24383 3703 --13666
NM_001031679chr1272984 2824 2572 2492 2310 1375 552 12832 ----
NM_001031695chr2285188 4870 4521 4501 1891 1256 495 486 ------
NM_001031711chr541748 1432 619 307 ------
NM_001031716chr22958 179 ------
NM_001031723chr4165 ------
NM_001031732chr443637 3066 1075 550 23676 3650 12865 --
NM_001031804chr1644416 4121 1718 912 22884 938 --13581
NM_001031812chr542176 1755 1427 153 21786 1483 ----
NM_001032282chr84504 263 200 39 1382 ----
NM_001032288chr203462 370 57 ----1535
NM_001032293chr171235 ------
NM_001032296chr1342138 836 185 158 --12068 --
NM_001032363chr141893 1652 807 266 2466 206 ----
NM_001032363chr141893 1652 807 266 2466 206 ----
NM_001033045chr233851 2961 2929 22779 1494 13746 --
NM_001033117chr364298 4050 3652 3555 3390 3128 --11843 --
NM_001033506chr111325 ----1443
NM_001033576chr17122739 2560 2251 2114 2005 972 816 596 483 233 190 158 ----2732 117
NM_001033756chr6--11468 ----
NM_001033756chr6--11468 ----
NM_001034025chr12152 --1805 --
NM_001034850chr521651 671 ------
NM_001034852chr141170 ------
NM_001035260chr1051322 1155 1112 644 210 --11535 --
NM_001037132chr722253 513 --11455 --
NM_001037133chr722253 513 --11455 --
NM_001037163chr73959 699 47 ------
NM_001037172chr31507 ----11166
NM_001037317chr142737 2551 2021 303 1839 ----
NM_001037332chr512358 --2401 290 --
NM_001037333chr512358 --2401 290 --
NM_001037334chr1852251 1891 1874 783 106 ----1686
NM_001037339chr141772 1681 538 309 --11662 --
NM_001037340chr141772 1681 538 309 --11662 --
NM_001037341chr141772 1681 538 309 --11662 --
NM_001037341chr141772 1681 538 309 --11662 --
NM_001037553chr2164179 3988 3277 3184 411 177 ----14398
NM_001037582chr421417 398 11087 2268 230 --
NM_001037954chr1142416 2355 866 96 1656 ----
NM_001038493chr221564 560 ------
NM_001038640chr151757 ------
NM_001039372chr7--1470 1624 --
NM_001039538chr222712 1029 12688 1736 12882
NM_001039573chr171485 1389 ----
NM_001039590chrX63667 3572 2939 2849 1203 139 --1472 --
NM_001039591chrX63667 3572 2939 2849 1203 139 --1472 --
NM_001039618chr1144303 3963 852 213 45127 4862 2158 1117 --15638
NM_001039690chr1672132 1870 1637 1463 488 446 328 1787 ----
NM_001039693chr263986 3892 3716 3656 1469 548 43695 3663 3226 3075 ----
NM_001039711chr121143 301 ------
NM_001039712chr121143 301 ------
NM_001039762chr1042078 1893 1863 446 ----124
NM_001039802chr131279 909 474 21374 252 ----
NM_001039937chr1323676 3121 --11110 --
NM_001040101chr4----11219 --
NM_001040108chr1442042 528 473 150 --13045 --
NM_001040110chr721384 88 --11562 --
NM_001040142chr262073 1921 1898 1650 685 627 ------
NM_001040143chr262073 1921 1898 1650 685 627 ------
NM_001040144chr1672132 1870 1637 1463 488 446 328 1787 ----
NM_001040146chr1672132 1870 1637 1463 488 446 328 1787 ----
NM_001040152chr744211 3794 802 333 ------
NM_001040153chr131726 ------
NM_001040157chr442729 2395 2133 710 2901 633 21815 1077 --
NM_001040202chr41423 ------
NM_001040214chr621964 672 --11557 --
NM_001040284chr16105843 5463 5390 5383 5321 4732 2330 1631 1009 942 11368 ----
NM_001040402chr453250 2807 2779 1031 398 13195 ----
NM_001040439chr161233 11486 ----
NM_001040440chr5----1147 --
NM_001040441chr144098 2051 1994 492 44190 1911 1057 399 12163 --
NM_001040446chr551798 1765 841 757 400 ------
NM_001040450chr1531000 745 409 --21783 199 --
NM_001040453chr1531000 745 409 --21783 199 --
NM_001040455chr1121045 1034 ------
NM_001040665chr764424 3604 3563 1957 1449 1423 --1697 --
NM_001041chr3----155 --
NM_001042368chr9----1119 --
NM_001042370chr11226 ------
NM_001042403chr122877 401 1256 ----
NM_001042406chr62999 248 ------
NM_001042413chr943692 2708 2569 1592 22881 496 ----
NM_001042424chr421136 840 ------
NM_001042453chrX2501 26 --1219 --
NM_001042478chr1157 ------
NM_001042481chr1442081 1917 862 792 ------
NM_001042494chr1563628 3156 2531 2388 1330 234 12732 13290 --
NM_001042495chr1563628 3156 2531 2388 1330 234 12732 13290 --
NM_001042496chr1563628 3156 2531 2388 1330 234 12732 13290 --
NM_001042497chr1563628 3156 2531 2388 1330 234 12732 13290 --
NM_001042510chr832178 1455 49 --11529 --
NM_001042511chr832178 1455 49 --11529 --
NM_001042517chr13--1894 ----
NM_001042533chr353015 2805 1143 204 92 ------
NM_001042537chrX31732 818 272 ------
NM_001042555chr1254029 1927 1449 1380 876 --1720 --
NM_001042599chr285158 3094 2546 2113 1686 548 532 466 --35993 5199 3029 --
NM_001042603chr1275068 4523 2059 1805 1781 1474 750 --14940 11272
NM_001042604chr364179 4133 3873 1744 1499 72 23020 754 23910 1340 12954
NM_001042632chr2032414 2305 1710 ----1625
NM_001042633chr2032414 2305 1710 ----1625
NM_001042681chr131809 1785 811 ------
NM_001042682chr131809 1785 811 ------
NM_001042682chr131809 1785 811 ------
NM_001042728chr121144 ------
NM_001042762chr72245 41 ------
NM_001043318chr1463761 3354 2917 1505 1012 789 --12632 --
NM_001044722chr542176 1755 1427 153 21786 1483 ----
NM_001044723chr542176 1755 1427 153 21786 1483 ----
NM_001046chr531861 997 426 ----11081
NM_001048183chr153769 3578 3531 2961 482 32807 1448 982 1168 --
NM_001077628chr11171 ------
NM_001079874chr131888 1742 1618 1509 11725 1149
NM_001083621chr164523 3368 3282 1642 1407 679 --24477 132 14316
NM_001092chr1752381 2189 2012 472 450 12472 --11654
NM_001095chr1241837 1618 517 145 11959 ----
NM_001099678chr395698 5425 4674 2244 2126 2111 1846 1166 147 13931 31657 1274 221 --
NM_001100108chr197310 7076 6740 6547 5237 5192 3266 2536 791 15688 36556 5098 157 --
NM_001106chr362060 1701 851 476 392 356 11292 18979 --
NM_001113490chrX73228 2875 2755 2490 1464 939 578 11067 1499 1948
NM_001117chr1832394 2021 557 ----12154
NM_001122679chr531332 1035 942 ------
NM_001128chr1662743 2446 1504 1304 1253 806 12506 13922 1977
NM_001146chr842253 1824 1572 185 ----11718
NM_001148chr41231 11458 ----
NM_001152chrX193 ------
NM_001160chr1241064 764 600 548 32517 2387 788 ----
NM_001167chrX96049 5694 5672 5454 2047 1879 1435 1165 1108 35821 4298 1119 25535 1378 --
NM_001173chr1464721 4125 3976 3690 90 63 24383 3703 --13666
NM_001174chrX150 ------
NM_001177chr1222217 1555 ------
NM_001186chr2143177 2750 725 534 12455 23194 1204 --
NM_001187chr211446 150 126 --
NM_001192chr161197 ------
NM_001201chr453631 3371 2595 1364 1246 1110 12831 --
NM_001204chr286924 6916 6654 6439 5298 4737 2028 351 1288 1224 15338
NM_001206chr921982 1186 --12260 --
NM_001212chr17----130 --
NM_001219chr731456 486 58 ------
NM_001233chr71609 11552 ----
NM_001241chr21274 21488 521 ----
NM_001241chr21274 21488 521 ----
NM_001248chr31349 ------
NM_001254chr1751009 839 385 178 59 11040 11091 --
NM_001256chr1792944 2779 2751 2339 2187 2079 1995 360 78 ------
NM_001257chr1631306 1002 36 11490 ----
NM_001259chr796386 5912 5409 5173 4975 4623 3915 732 575 1236 36013 2177 1243 14031
NM_001271chr1552270 1234 1196 816 717 ------
NM_001275chr141269 ------
NM_001284chr5------197
NM_001293chr112462 91 ------
NM_001304chr1743686 1319 1140 1128 ------
NM_001310chr1221057 976 ------
NM_001315chr611500 ------
NM_001316chr20------1471
NM_001329chr10----1648 --
NM_001343chr52424 266 ------
NM_001346chr352417 2337 1862 1757 357 21051 184 ----
NM_001351chr341482 1170 1143 524 ------
NM_001356chrX32492 658 579 22336 2097 ----
NM_001364chr1154225 3448 3272 3022 1821 ------
NM_001386chr872469 2190 2011 855 655 470 311 11970 12396 --
NM_001400chr111035 ----1396
NM_001401chr91412 11499 ----
NM_001402chr641982 1724 794 56 21404 73 ----
NM_001408chr11410 ------
NM_001419chr1954718 1826 771 337 207 11705 1688 --
NM_001423chr1231938 1805 764 ------
NM_001424chr162731 491 --1596 1256
NM_001431chr6------174
NM_001432chr453268 1407 1294 585 571 33244 2523 981 ----
NM_001438chr142998 850 554 181 13162 13340 13010
NM_001448chrX31518 1153 1143 ------
NM_001449chrX11293 ------
NM_001453chr621668 324 ------
NM_001498chr6----11064 --
NM_001514chr11464 ------
NM_001546chr6----11146 --
NM_001552chr171121 ------
NM_001553chr4179 ------
NM_001608chr21268 ------
NM_001614chr171477 ------
NM_001614chr171477 ------
NM_001616chr223135 2365 ----13295
NM_001621chr722827 538 --12509 --
NM_001621chr722827 538 --12509 --
NM_001650chr1831373 308 115 --12792 1584
NM_001655chr1161871 1550 1355 545 458 166 --1380 --
NM_001658chr11204 ------
NM_001663chr142476 413 32267 2075 1003 11966 --
NM_001668chr121653 1518 ------
NM_001681chr121762 ------
NM_001682chr1252317 1999 1859 971 764 12899 ----
NM_001684chr153803 3253 1279 1238 714 --12576 13129
NM_001689chr242022 1911 776 653 --1576 --
NM_001690chr352291 1650 1032 812 161 1836 22447 2314 --
NM_001695chr853066 1277 767 277 192 33091 1129 474 ----
NM_001699chr1951549 1173 605 359 328 21309 312 1439 --
NM_001707chr72781 291 1849 ----
NM_001709chr1172626 2606 2595 2432 2197 2179 878 ------
NM_001716chr11--11574 ----
NM_001717chr1541476 982 554 82 11075 ----
NM_001723chr61206 ------
NM_001731chr122771 267 1637 ----
NM_001746chr532509 2456 319 ------
NM_001759chr12115216 4958 4801 3339 2071 1756 1643 1603 840 685 48 ------
NM_001761chr1651759 1487 710 282 141 ----11451
NM_001781chr122692 88 --1832 --
NM_001791chr131279 909 474 21374 252 ----
NM_001797chr161612 ------
NM_001801chr51213 --1488 --
NM_001826chr11391 ------
NM_001829chr42903 655 ----1770
NM_001830chrX53595 2453 1354 989 618 ----1215
NM_001833chr9--1279 ----
NM_001845chr1311205 1424 ----
NM_001854chr111541 ----21393 1067
NM_001858chr644153 3361 1248 802 --24398 393 --
NM_001865chr61136 --136 --
NM_001880chr2174 ------
NM_001881chr101367 ------
NM_001884chr51524 --1478 --
NM_001885chr11142 ------
NM_001895chr2021058 937 ------
NM_001904chr33869 692 426 ------
NM_001923chr112649 447 --1219 --
NM_001938chr111204 --1144 --
NM_001942chr1841962 746 432 239 ----11461
NM_001946chr123756 749 51 ------
NM_001949chr61756 ----12294
NM_001951chr81474 ------
NM_001964chr5----1761 --
NM_001968chr41204 --1146 --
NM_001969chr1433673 2526 1115 11067 23119 2966 --
NM_001977chr42495 332 21660 1236 ----
NM_001981chr122041 738 --1339 22216 843
NM_001987chr1274179 3306 1513 1353 1221 1213 711 --21269 1151 --
NM_002006chr463595 2071 1720 1705 800 617 34639 2192 1674 --12292
NM_002009chr1542811 1910 1057 1003 ------
NM_002010chr13155 --1482 --
NM_002015chr1363374 2966 1346 1319 1175 1029 ------
NM_002017chr112338 233 ------
NM_002024chrX32021 1499 410 ----22213 1769
NM_002025chrX119062 8867 8532 7932 7608 7516 6222 3433 3314 2260 373 --32551 2314 1922 --
NM_002028chr141942 167 ----
NM_002033chr1154073 3171 3163 2715 2547 --23208 1106 11559
NM_002040chr2131024 472 31 12017 ----
NM_002051chr101245 1812 --1782
NM_002056chr23827 577 345 1656 ----
NM_002069chr751596 1500 1472 1407 76 ------
NM_002076chr1252792 1132 219 107 83 --22625 1237 --
NM_002092chr4125018 4629 4553 4343 3813 3784 3658 3313 1349 877 481 363 13486 24059 154 34246 779 703
NM_002114chr63514 436 384 ------
NM_002126chr1793981 3800 3706 2701 2683 2575 1616 642 311 ------
NM_002130chr531736 1365 170 --11321 --
NM_002136chr121209 ------
NM_002137chr741952 1809 1681 257 --22336 346 1829
NM_002141chr7125 ------
NM_002156chr21148 ------
NM_002158chr21567 33144 486 283 11375 --
NM_002180chr111824 ------
NM_002184chr5----1144 --
NM_002187chr51323 1892 ----
NM_002188chr51785 ------
NM_002193chr221836 1678 ------
NM_002203chr533899 2790 2608 --24088 3770 --
NM_002211chr1021071 350 --11001 --
NM_002214chr765340 4425 3684 1747 513 203 25499 1672 11188 --
NM_002226chr142234 91 ------
NM_002228chr11995 ------
NM_002232chr11888 ------
NM_002241chr143039 2613 617 34 12868 ----
NM_002242chr212030 11274 11866 1393
NM_002264chr344228 1554 956 782 ----13665
NM_002268chr3----11186 --
NM_002271chr133626 416 171 12371 ----
NM_002285chr272916 2602 2562 1361 1307 240 36 33024 2941 940 ----
NM_002293chr14980 891 642 356 --22347 385 --
NM_002294chrX1145 2400 357 ----
NM_002296chr111486 11139 11235 1283
NM_002306chr14161 1152 ----
NM_002310chr576436 5945 4573 4182 2613 1060 628 --14207 --
NM_002313chr1073932 3824 3792 3544 3280 1773 1180 ------
NM_002336chr1244228 1927 1811 670 14849 14267 14079
NM_002351chrX11729 --158 --
NM_002356chr61568 --1644 --
NM_002374chr222712 1029 12688 1736 12882
NM_002384chr182950 153 ------
NM_002399chr1511210 ----1907
NM_002408chr142187 28 ------
NM_002419chr11199 --1480 --
NM_002467chr81109 168 ----
NM_002469chr121506 ------
NM_002480chr1251016 526 438 230 150 ------
NM_002486chr931870 703 57 32133 1930 610 ----
NM_002487chr151303 ------
NM_002499chr154551 506 394 45 --1779 --
NM_002508chr141806 1677 1567 193 --11785 --
NM_002515chr141176 --1434 11395
NM_002518chr21123 ------
NM_002519chr1131055 970 385 ------
NM_002522chr1733659 3509 1583 --11560 --
NM_002526chr621686 379 ------
NM_002544chr171230 ----1119
NM_002545chr1153648 3524 1702 1595 1490 --24332 348 --
NM_002577chr343710 2702 404 392 --32680 2513 534 --
NM_002581chr954869 4694 4290 1024 180 ------
NM_002590chr13169 ------
NM_002594chr2042313 2270 2104 68 2929 394 ----
NM_002600chr141772 1681 538 309 --11662 --
NM_002612chr71742 1584 1340 --
NM_002635chr12--1340 1146 --
NM_002641chrX11803 11973 11506 --
NM_002655chr844495 833 738 502 13898 ----
NM_002657chr2031080 840 356 ------
NM_002690chr8------144
NM_002710chr12--11103 ----
NM_002715chr541203 1078 1002 242 --11300 --
NM_002720chr161212 ------
NM_002731chr142884 728 520 335 --12353 12698
NM_002734chr1712101 12274 11870 --
NM_002738chr161134 ------
NM_002740chr342828 2522 2355 1827 1858 ----
NM_002745chr2224587 963 --13968 --
NM_002748chr1521179 1164 ----1965
NM_002822chr121539 1316 --11646
NM_002828chr181990 ------
NM_002835chr72745 477 ------
NM_002837chr1273567 3236 3072 911 897 890 195 --11668 11703
NM_002840chr12622 144 ------
NM_002844chr61310 ------
NM_002850chr191807 ------
NM_002851chr72676 621 ------
NM_002858chr121177 418 --1426 --
NM_002860chr102159 57 --1655 --
NM_002868chr1272132 2070 1675 872 803 742 562 ------
NM_002874chr94410 403 369 293 1992 ----
NM_002886chr3114788 4208 4173 4157 3861 3420 3310 3238 1613 1513 1137 14187 1330 --
NM_002891chr152173 75 ------
NM_002897chr22638 583 ------
NM_002902chr151238 ----1105
NM_002906chr112529 323 ------
NM_002924chr1--1168 1441 --
NM_002942chr31514 ------
NM_002955chr641763 1411 1234 626 1760 --1712
NM_002956chr1221361 164 ------
NM_002959chr143297 1758 1430 952 11403 14283 --
NM_002970chrX1316 ------
NM_002973chr121231 --1425 --
NM_002979chr1----1265 --
NM_002994chr471952 1937 575 421 66 40 32 11435 ----
NM_002996chr1622007 1874 ------
NM_003016chr173672 368 295 ------
NM_003017chr621041 424 ----1554
NM_003022chrX21263 42 --11140 --
NM_003028chr993837 3398 2511 2412 1532 983 748 726 243 1375 13664 --
NM_003031chr16----147 --
NM_003034chr1267577 7329 1379 909 420 86 22380 1641 27877 1341 18095
NM_003042chr352238 1800 1699 1535 853 --11595 --
NM_003045chr13104863 4852 4795 4564 3839 3072 1965 1885 1526 915 --14277 --
NM_003048chr232747 1941 1858 --12689 --
NM_003069chrX1497 ------
NM_003072chr19----194 --
NM_003074chr341880 854 362 287 --11491 --
NM_003099chr1585776 5749 5293 4235 2558 1511 802 206 24711 588 34982 1115 823 --
NM_003108chr287021 6601 6343 6183 2451 1612 1417 941 1294 15227 15307
NM_003111chr221020 457 ------
NM_003112chr753068 2730 2100 2068 1281 --1907 --
NM_003131chr611892 ------
NM_003136chr14--1373 ----
NM_003137chr62896 107 1430 ----
NM_003140chrY------190
NM_003144chr652206 1394 546 292 257 ------
NM_003146chr11175 1167 ----
NM_003150chr1731824 1786 1466 22097 875 ----
NM_003155chr81522 2702 415 ----
NM_003161chr1732588 2581 2428 12895 195 --
NM_003182chr72434 351 ----1473
NM_003182chr72434 351 ----1473
NM_003185chr201320 ------
NM_003188chr61191 ------
NM_003199chr1854604 929 793 702 156 --12038 --
NM_003204chr1711212 1659 1358 --
NM_003216chr22122604 2334 2313 1310 1245 867 574 480 348 254 197 143 ------
NM_003217chr1211915 ----12005
NM_003242chr352125 1927 1555 1539 547 ----12423
NM_003253chr212586 395 1537 ----
NM_003257chr15--1367 ----
NM_003262chr3104602 4329 4095 1967 1532 1331 1194 1173 414 240 15145 14434 11805
NM_003270chrX1809 --1934 --
NM_003275chr91425 1337 --1313
NM_003286chr201313 --1889 1111
NM_003292chr11711 1481 ----
NM_003298chr3106105 5708 5358 5339 5087 2295 2109 1401 1194 755 26191 3864 --12057
NM_003300chr14--1477 ----
NM_003304chr321357 1272 ------
NM_003319chr22307 55 ------
NM_003330chr1221620 588 ----1263
NM_003336chrX1389 ------
NM_003337chr551234 1192 685 549 477 --21498 503 1616
NM_003338chr102550 91 11751 ----
NM_003339chr531402 1311 482 ------
NM_003344chr711431 ------
NM_003348chr1221594 1207 --186 --
NM_003349chr203462 370 57 ----1535
NM_003350chr8--127 --1711
NM_003369chr1132253 499 368 ------
NM_003372chrX------1158
NM_003376chr6--11534 ----
NM_003376chr6--11534 ----
NM_003392chr364225 3929 3304 1587 1415 620 ----13638
NM_003403chr14--1224 ----
NM_003405chr221524 --1155 --
NM_003409chr1821067 197 ------
NM_003410chrX22811 540 --174 --
NM_003411chrY3383 182 68 ------
NM_003412chr371103 1083 961 870 715 607 301 12333 12343 11075
NM_003413chrX12007 ----1417
NM_003418chr31770 ------
NM_003457chr171235 ------
NM_003458chr333711 3173 662 1818 22885 1344 --
NM_003462chr13558 254 108 ------
NM_003463chr622398 2050 --22971 580 --
NM_003467chr22484 180 ------
NM_003468chr222775 672 23132 385 --14184
NM_003478chr1173273 3174 3069 2796 2736 2368 1003 ------
NM_003480chr1231980 1898 521 --1754 --
NM_003482chr1212485 12007 ----
NM_003483chr1222125 1084 12017 --12219
NM_003487chr171189 ------
NM_003488chr17126 ----1282
NM_003498chr1652192 1998 1105 790 499 12682 12232 --
NM_003557chr121532 1375 ------
NM_003558chr92476 64 ------
NM_003559chr1773852 3637 3060 2786 2635 2403 817 --12608 --
NM_003566chr1252711 2646 2457 1069 881 12998 ----
NM_003567chr1140 ------
NM_003574chr1864177 3677 3606 2074 1987 322 25611 5112 21735 1003 --
NM_003576chr1342138 836 185 158 --12068 --
NM_003589chr1341220 1104 907 552 ------
NM_003590chr251414 1287 1261 1167 159 11010 34092 668 484 --
NM_003595chr22----1459 --
NM_003597chr242233 1679 836 800 --1199 --
NM_003601chr4----1153 --
NM_003607chr144228 3654 3201 1584 --1363 --
NM_003615chr363968 2887 2779 853 514 488 22668 839 ----
NM_003620chr1731017 268 244 1756 ----
NM_003622chr1272495 2437 2265 992 831 483 38 12461 ----
NM_003659chr21913 ----21044 967
NM_003663chr333043 2481 705 13459 ----
NM_003670chr321264 361 ------
NM_003705chr2--1194 1206 --
NM_003716chr31381 1748 ----
NM_003749chr1321592 76 11562 ----
NM_003758chr1511585 1458 ----
NM_003758chr1511585 1458 ----
NM_003760chr1----161 --
NM_003768chr131741 1552 242 --11316 --
NM_003774chr1222210 247 13184 13166 12924
NM_003780chr1----1157 --
NM_003783chr11277 --1942 --
NM_003787chr183101 89 44 ------
NM_003791chr161103 ------
NM_003794chr31339 1325 ----
NM_003821chr82129 31 ------
NM_003822chr152839 913 894 698 617 --22176 2009 --
NM_003825chr1521535 1095 ------
NM_003829chr91136 ------
NM_003870chr151201 --1296 --
NM_003873chr1021856 220 12427 ----
NM_003885chr1732558 1025 123 12217 11799 --
NM_003902chr11690 ------
NM_003913chr663089 2842 2688 1277 491 184 13565 --12965
NM_003916chrX31426 1214 259 --1985 --
NM_003932chr2211848 11483 ----
NM_003934chr931332 1153 197 --1382 --
NM_003939chr1073608 3524 2673 1005 960 402 115 --12614 --
NM_003941chr732244 532 438 --1792 --
NM_003948chr421972 1874 21002 182 12594 --
NM_003953chr11869 12718 2988 414 --
NM_003956chr10--1337 ----
NM_003958chr662949 2823 1313 1091 721 113 11115 1537 --
NM_003966chr5117819 7607 2186 2128 2048 1993 1873 1345 1145 640 326 15558 26723 2913 --
NM_003971chr17----199 --
NM_003972chr101144 --21106 485 --
NM_003983chr1633625 2872 1597 --21263 695 --
NM_003986chr11--2344 328 ----
NM_003993chr12315 217 ------
NM_003994chr1243785 419 315 270 13105 --13323
NM_003996chr6232 25 ------
NM_004006chrX1225 --12241 --
NM_004007chrX1225 --12241 --
NM_004009chrX1225 --12241 --
NM_004010chrX1225 --12241 --
NM_004011chrX1225 --12241 --
NM_004012chrX1225 --12241 --
NM_004013chrX1225 --12241 --
NM_004014chrX1225 --12241 --
NM_004015chrX1225 --12241 --
NM_004016chrX1139 --12155 --
NM_004017chrX1225 --12241 --
NM_004018chrX1139 --12155 --
NM_004020chrX1225 --12241 --
NM_004021chrX1139 --12155 --
NM_004022chrX1139 --12155 --
NM_004023chrX1139 --12155 --
NM_004028chr1831373 308 115 --12792 1584
NM_004040chr21873 ------
NM_004056chr81311 ------
NM_004067chr721290 152 --1315 --
NM_004077chr1241133 994 932 70 ------
NM_004080chr761480 1373 1332 1284 176 89 ------
NM_004081chrY31508 1201 1174 --2623 111 --
NM_004085chrX----1750 1558
NM_004087chr351602 1507 685 495 77 1648 ----
NM_004093chr1342743 2402 500 169 13247 13189 --
NM_004094chr1432800 2148 501 22272 2001 1994 --
NM_004096chr1022033 121 --12162 12079
NM_004098chr1011134 ------
NM_004100chr642369 2257 867 201 1100 --1992
NM_004107chr191154 ------
NM_004113chr311718 ------
NM_004114chrX2925 905 ------
NM_004117chr63742 530 279 --11748 --
NM_004119chr13------1486
NM_004124chr1443551 3509 3436 1162 13120 1649 --
NM_004128chr131161 ------
NM_004133chr822703 2155 --1290 --
NM_004162chr34915 238 124 31 1199 ----
NM_004171chr11147736 7452 7217 7145 6189 3701 2134 2054 1962 1177 1164 700 532 426 22158 583 36874 3427 2636 --
NM_004229chrX21538 787 11800 22258 2097 11436
NM_004232chr1831547 234 205 13734 --23340 1285
NM_004235chr91670 ------
NM_004236chr15--1571 ----
NM_004261chr11102 ----1746
NM_004270chr5----186 175
NM_004272chr531885 1650 789 ------
NM_004279chr751882 889 689 518 171 ------
NM_004282chr63544 484 120 ------
NM_004290chr5------11362
NM_004291chr5--1143 ----
NM_004301chr3147 ------
NM_004302chr1241944 979 773 748 ------
NM_004311chr1023008 636 1255 12346 --
NM_004316chr1221165 952 ------
NM_004330chr1521160 400 --11100 --
NM_004331chr841757 1014 767 477 ------
NM_004354chr4170 2602 42 ----
NM_004370chr62781 377 ------
NM_004384chr542176 1755 1427 153 21786 1483 ----
NM_004385chr51488 ------
NM_004392chr1311908 12608 ----
NM_004397chr1131254 595 583 ------
NM_004412chr10115695 5208 4933 4525 4360 3970 3745 2380 1513 950 161 13994 44492 4132 3807 1797 --
NM_004415chr6----1506 --
NM_004418chr2----1125 --
NM_004427chr12973 776 ------
NM_004429chrX31396 1093 120 --1916 --
NM_004432chr931669 886 286 ------
NM_004437chr121325 140 --23627 444 --
NM_004441chr33811 522 494 11177 ----
NM_004442chr11354 ------
NM_004447chr1241173 450 374 250 ------
NM_004449chr21--1306 1176 1277
NM_004459chr1721559 1507 --1370 --
NM_004469chrX3493 462 351 ------
NM_004480chr141746 ------
NM_004482chr22655 173 1181 ----
NM_004487chr351239 951 511 434 90 1353 ----
NM_004491chr1933964 3590 1174 14313 ----
NM_004496chr1431140 1081 917 ------
NM_004500chr1421558 1500 --1216 1559
NM_004501chr143891 3457 3007 534 12823 ----
NM_004504chr22114 82 --13003 --
NM_004505chr1721308 1280 --1179 11604
NM_004520chr51225 ------
NM_004529chr9----11025 --
NM_004535chr2021500 283 ------
NM_004549chr1131382 1216 192 11406 2285 28 --
NM_004559chr11279 1395 ----
NM_004566chr1032413 2209 1801 --11688 --
NM_004571chr2142780 2723 1268 541 ------
NM_004575chr431481 1196 188 ------
NM_004578chr12839 230 --1355 --
NM_004583chr17------1214
NM_004586chrX55150 4052 3325 1329 684 33873 2191 1762 --15478
NM_004588chr1154038 4021 3708 3463 2791 13625 --1768
NM_004593chr31269 ------
NM_004600chr11226 ------
NM_004602chr20----1590 --
NM_004612chr984644 4447 1788 1581 1314 698 440 374 1293 ----
NM_004622chr242247 335 270 210 --12435 --
NM_004631chr111064 ------
NM_004654chrY3978 460 47 ------
NM_004660chrY12079 12022 ----
NM_004663chr1541277 1202 1017 135 ------
NM_004673chr1----21092 164 --
NM_004677chrY2543 159 ------
NM_004687chr1711341 1583 ----
NM_004705chr112664 260 ------
NM_004719chr1222008 720 11050 12254 --
NM_004726chrX45383 3585 2153 292 24875 4320 15575 12046
NM_004730chr541898 1601 1564 537 21664 1589 --1627
NM_004736chr141853 1837 1761 1409 --1814 --
NM_004744chr453324 2732 2661 1217 404 ------
NM_004745chr875906 4857 4456 2409 2303 1347 552 --31407 869 757 15612
NM_004748chr15142 ------
NM_004768chr111152 ----11087
NM_004772chr511385 ------
NM_004774chr1722460 212 22577 2405 ----
NM_004775chr1822204 1490 ----12142
NM_004776chr2061147 878 503 310 299 114 ------
NM_004795chr1371806 1720 1256 1231 1203 684 476 ------
NM_004796chr1422263 2174 ------
NM_004798chr2033162 2562 561 ------
NM_004815chr194467 4353 4207 4012 3635 3430 3377 1071 829 ----1332
NM_004834chr273221 2804 2740 2492 2067 1344 39 12419 ----
NM_004842chr641515 533 470 99 --1237 --
NM_004844chr3--11200 1128 --
NM_004845chrX23857 3156 23180 1102 1901 --
NM_004850chr241455 1444 701 357 ------
NM_004857chr1423303 1673 34770 3177 2986 34688 3733 1506 1609
NM_004859chr1712683 --12957 22312 222
NM_004862chr1631624 1241 97 --11031 1371
NM_004866chr574928 3950 1343 480 397 179 159 14422 11766 --
NM_004867chrX----1224 --
NM_004871chr1783896 3265 3172 2672 474 457 337 175 --1644 --
NM_004872chr1175 ------
NM_004887chr511124 ------
NM_004896chr1051237 1070 1027 559 125 --11450 --
NM_004902chr203860 561 330 1594 ----
NM_004904chr744882 1820 1536 297 45190 4190 2018 1557 22045 1358 --
NM_004905chr12676 157 ------
NM_004906chr6----1516 --
NM_004911chr72492 143 ------
NM_004912chr721217 404 ------
NM_004929chr81331 --21173 528 11066
NM_004939chr2----1145 150
NM_004956chr732887 1551 459 ----24167 1487
NM_004964chr11520 ------
NM_004966chr10------1957
NM_004967chr41404 ------
NM_004969chr103458 89 48 ------
NM_004973chr621400 1221 ------
NM_004976chr11124579 4237 3657 3409 3205 2053 2005 1551 1309 733 313 209 ------
NM_004979chrX11169 --1138 --
NM_004982chr124653 647 204 26 ------
NM_004985chr1254152 2749 1735 908 849 --11040 --
NM_004992chrX66060 6000 3416 2301 992 144 18488 22419 2134 --
NM_004992chrX66060 6000 3416 2301 992 144 18488 22419 2134 --
NM_004993chr1411269 --11337 --
NM_004999chr664280 3735 1393 986 887 548 1770 ----
NM_005010chr722253 513 --11455 --
NM_005011chr721384 88 --11562 --
NM_005012chr11144 --1134 --
NM_005016chr122119 69 ------
NM_005017chr31258 ------
NM_005028chr1032360 1751 1504 --11598 --
NM_005032chrX11027 1763 ----
NM_005056chr1275312 4767 2049 2025 1718 994 81 --15184 11516
NM_005068chr621297 1176 21012 542 ----
NM_005088chrX--1767 --1216
NM_005099chr121110 965 1989 ----
NM_005104chr61520 2725 632 ----
NM_005105chr131640 488 293 --32172 1515 514 1508
NM_005112chr41743 ------
NM_005113chr141188 ------
NM_005116chr2084122 4065 3161 3060 2870 2863 1319 178 --13580 --
NM_005119chr1--11300 ----
NM_005135chr1563628 3156 2531 2388 1330 234 12732 13290 --
NM_005151chr1852251 1891 1874 783 106 ----1686
NM_005155chr61644 ------
NM_005156chr974317 3953 3640 3484 1718 1398 676 --34823 4227 1370 24087 890
NM_005180chr1011415 ------
NM_005188chr11108353 7487 5470 5042 2649 2137 2057 999 582 108 --27276 2823 12301
NM_005194chr20--1554 ----
NM_005197chr1436177 1442 45 13952 25616 4869 --
NM_005202chr11194 ------
NM_005204chr101277 1197 1902 --
NM_005206chr17------21463 294
NM_005207chr2283506 2264 1492 1411 765 653 600 51 1789 ----
NM_005219chr52622 380 ------
NM_005233chr3--21989 616 ----
NM_005235chr285158 3094 2546 2113 1686 548 532 466 --35993 5199 3029 --
NM_005238chr1142345 1175 932 636 1620 --13123
NM_005245chr42768 591 ------
NM_005249chr142590 128 1819 ----
NM_005278chrX------1363
NM_005311chr742138 1812 1072 999 1461 ----
NM_005324chr1741453 856 590 459 ----31608 1431 437
NM_005327chr41723 ------
NM_005329chr1631789 850 107 ------
NM_005338chr743457 1078 710 442 12800 43282 2684 662 452 --
NM_005342chrX32837 2539 136 ------
NM_005348chr142684 595 --1209 --
NM_005359chr1854642 4300 2105 896 311 1589 14571 --
NM_005378chr21300 ------
NM_005388chr931610 1470 335 11704 ----
NM_005392chr911667 --11625 --
NM_005397chr763903 3090 1615 1561 1444 753 ------
NM_005399chr154099 3335 771 701 119 11023 171 --
NM_005400chr243108 3077 2580 208 --1967 --
NM_005406chr1821580 638 11398 ----
NM_005409chr41195 ----1759
NM_005418chr113557 464 286 ------
NM_005425chr16137 ------
NM_005433chr181457 12519 ----
NM_005436chr1054102 4076 3261 1561 1154 1787 ----
NM_005437chr1021372 1039 ------
NM_005442chr31438 --1528 --
NM_005475chr1222962 184 1645 ----
NM_005487chr2221780 419 1604 ----
NM_005497chr17115436 4158 4054 2456 2113 1811 1637 1420 1272 1259 566 34912 1836 1336 13780 --
NM_005499chr19----1588 --
NM_005502chr911238 --23155 2520 --
NM_005504chr1266659 6618 5816 5802 2331 192 25927 4667 36241 5178 1230 14927
NM_005520chr51204 --1567 --
NM_005522chr731098 943 100 --11133 --
NM_005530chr1521476 310 ------
NM_005537chr13--1896 21132 254 --
NM_005542chr731705 691 192 ------
NM_005562chr131517 1093 168 ------
NM_005578chr355037 5028 1361 303 95 --11128 --
NM_005584chr13--1633 ----
NM_005587chr151757 ------
NM_005595chr11324 ------
NM_005596chr975703 5516 5426 4462 4144 2498 2373 25732 1829 14416 --
NM_005600chr1----1200 --
NM_005604chr632462 1896 1840 --11788 --
NM_005606chr143332 186 88 ----1482
NM_005610chr11876 ------
NM_005626chr12435 38 ----1413
NM_005637chr1831643 1537 137 41835 1579 538 284 1810 --
NM_005638chrX41763 1516 167 106 --1324 --
NM_005639chr1221905 1492 ----11438
NM_005647chrX43064 2527 2504 1198 23435 895 12860 --
NM_005650chr2221312 547 ------
NM_005651chr42295 36 ------
NM_005655chr84504 263 200 39 1382 ----
NM_005665chr154861 4541 3249 689 82 1713 1157 --
NM_005668chr52684 89 24417 875 ----
NM_005688chr351105 1046 499 146 23 ------
NM_005711chr511090 ----1338
NM_005717chr131275 388 217 ------
NM_005721chr21813 ------
NM_005725chr152401 1916 1559 666 387 ------
NM_005730chr1223059 292 --12471 1705
NM_005734chr111640 ------
NM_005746chr721865 423 1985 1407 --
NM_005754chr53826 365 192 ----1966
NM_005779chr553109 2777 868 767 316 --32577 2541 61 --
NM_005789chr1742163 2084 1537 752 ------
NM_005796chr16--1363 ----
NM_005801chr172269 187 ------
NM_005808chr342734 2698 482 471 ------
NM_005822chr652107 1621 846 439 339 --32068 1493 795 --
NM_005826chr14409 251 160 89 ------
NM_005828chr1775029 4110 1676 1098 884 550 385 13234 ----
NM_005839chr11884 ------
NM_005840chrX57031 5873 5841 1827 210 17320 25707 2555 --
NM_005843chr22510 250 11695 ----
NM_005853chr161381 1189 ----
NM_005859chr521473 180 ------
NM_005870chr13--1182 ----
NM_005871chr101249 ------
NM_005875chr31276 ------
NM_005876chr21741 ------
NM_005880chr1631060 324 81 ----1271
NM_005888chr12--1340 1146 --
NM_005898chr1121072 784 --32363 2099 1096 12470
NM_005901chr1898170 6286 5971 3163 2594 1791 875 249 126 --13134 --
NM_005906chr621675 615 11661 ----
NM_005909chr574202 4146 3290 2678 1462 1300 315 ----1601
NM_005920chr122889 530 1495 --12546
NM_005923chr61567 ------
NM_005935chr463230 1897 1763 1578 1031 81 ----1357
NM_005941chr841310 751 574 337 --11046 13353
NM_005955chr164854 4169 3970 2095 1376 1250 12059 ----
NM_005962chr1041971 1897 1816 91 ------
NM_005962chr1041971 1897 1816 91 ------
NM_005964chr172448 229 1122 ----
NM_005966chr252325 2068 2042 1920 949 1754 21858 1548 --
NM_005969chr112956 918 ------
NM_005977chr13----1359 --
NM_005989chr7--11358 --1528
NM_005990chr542716 2148 1810 643 --12372 --
NM_006016chr651689 1520 1468 1444 229 ------
NM_006022chr132903 732 ------
NM_006024chr72368 171 ------
NM_006036chr232535 2411 2325 --153 --
NM_006037chr263855 3653 3385 777 642 447 1175 ----
NM_006038chr202861 56 1802 ----
NM_006047chr2023535 1145 1104 12461 13088
NM_006048chr11299 11020 ----
NM_006080chr722078 716 41982 1835 1132 1104 --22535 2253
NM_006085chr131321 848 296 --1338 --
NM_006090chr11511 ------
NM_006095chr444094 2752 816 226 1903 1837 --
NM_006106chr1122667 2419 --22887 2458 11268
NM_006108chr1182055 2038 1889 843 602 490 478 133 ------
NM_006113chr131888 1742 1618 1509 11725 1149
NM_006135chr12461 324 ------
NM_006136chr711129 1295 ----
NM_006139chr2----42794 2737 1810 215 --
NM_006141chr16----1373 --
NM_006145chr192789 381 ------
NM_006152chr12----143 --
NM_006154chr152207 103 12581 ----
NM_006157chr111129 ------
NM_006164chr2----1187 --
NM_006166chr1252542 2048 1659 915 315 12312 ----
NM_006180chr921546 519 ------
NM_006194chr145928 331 74 46 37 1274 ----
NM_006195chr931395 300 120 11087 --11422
NM_006196chr21110 ------
NM_006203chr551958 1093 900 874 502 11007 ----
NM_006210chr191344 ----1182
NM_006224chr1741909 1629 617 341 12516 ----
NM_006235chr1121960 1507 21638 1531 11342 --
NM_006243chr1----1233 --
NM_006246chr141115 ------
NM_006251chr542243 687 557 247 1711 --1928
NM_006252chr157604 6540 5341 2980 1537 27312 5138 36775 5224 4628 24650 701
NM_006253chr1211071 ----11275
NM_006256chr11567 --1220 --
NM_006258chr1011171 --1544 --
NM_006265chr851448 1309 1034 409 115 11139 ----
NM_006266chr9----1119 --
NM_006267chr231867 1753 1419 1677 ----
NM_006281chr83821 431 282 ------
NM_006281chr83821 431 282 ------
NM_006283chr884974 3972 3010 1448 966 931 691 240 21722 1428 ----
NM_006286chr3--125 ----
NM_006287chr232208 634 56 12047 1418 --
NM_006306chrX55872 4802 4452 2296 906 --31497 1132 499 --
NM_006313chr121213 --1107 --
NM_006317chr51779 1146 ----
NM_006322chr133249 169 132 ------
NM_006323chr41212 --1508 --
NM_006325chr12----1240 --
NM_006330chr82181 77 ------
NM_006335chr11421 ------
NM_006352chr141793 773 611 87 1418 11937 1814
NM_006359chrX31732 818 272 ------
NM_006375chrX1644 --11690 11283
NM_006379chr721873 21 ------
NM_006413chr1041317 504 309 294 21341 529 11171 --
NM_006420chr2032860 2531 159 12948 181 --
NM_006431chr12136 ------
NM_006459chr101658 --21464 201 11853
NM_006460chr17----1391 --
NM_006472chr131288 308 89 ------
NM_006489chr141176 --1434 11395
NM_006504chr1052777 2676 921 548 503 ----12807
NM_006526chr201493 21373 593 11496 --
NM_006534chr2023227 2528 ----13302
NM_006538chr244075 2835 134 76 23058 2893 ----
NM_006540chr81630 188 ----
NM_006544chr1465860 5189 1269 1243 965 53 --15051 --
NM_006546chr17106636 6215 5900 5370 4638 2413 2139 1835 1785 801 16666 25810 972 --
NM_006549chr1242832 2774 1098 869 1500 22734 1900 --
NM_006551chr11--178 ----
NM_006552chr11128 180 ----
NM_006557chr91105 11170 11539 --
NM_006559chr11395 11032 --1345
NM_006561chr10116182 6053 5234 5213 4910 4655 4024 2209 1873 813 501 2746 100 24756 112 1826
NM_006572chr1752992 2933 2491 2207 224 --12371 --
NM_006575chr1431440 371 265 11202 ----
NM_006595chr1111338 ------
NM_006599chr16116997 6703 5290 2375 2353 1945 1529 1428 1068 998 247 --37905 5097 829 --
NM_006606chr2032855 1992 553 22016 456 --1129
NM_006614chr31386 --2545 479 43206 2611 1118 631
NM_006618chr121150 576 ------
NM_006620chr61749 158 --23268 948
NM_006621chr1------1294
NM_006624chr1021433 393 ------
NM_006626chr951725 659 321 200 54 --1225 --
NM_006628chr1544217 3627 3190 530 23651 2997 13463 14344
NM_006629chr18----2941 674 --
NM_006640chr1711814 11922 ----
NM_006646chr136913 786 536 425 366 57 --22417 1959 --
NM_006654chr1254029 1927 1449 1380 876 --1720 --
NM_006662chr163386 243 86 ------
NM_006670chr62264 157 ------
NM_006675chr1253326 2873 2805 2657 2540 ----1675
NM_006706chr52579 139 ------
NM_006708chr62989 916 1381 ----
NM_006717chr962743 2171 2163 1198 996 495 13048 ----
NM_006720chr1073932 3824 3792 3544 3280 1773 1180 ------
NM_006729chrX54829 4570 4272 3971 1847 --13515 --
NM_006734chr61499 ------
NM_006744chr102182 52 --122 --
NM_006750chr1667863 6581 5410 3150 2648 1648 15424 47882 7510 7434 1987 --
NM_006754chr711004 ------
NM_006756chr811471 1213 21004 168 --
NM_006759chr2141 ------
NM_006766chr822036 1841 ----1790
NM_006775chr632083 1193 136 --22693 2324 --
NM_006777chrX72279 2253 1015 690 576 270 53 --11896 --
NM_006791chr151531 ------
NM_006803chr82751 28 11873 12116 --
NM_006807chr1721097 127 41357 222 167 45 11053 --
NM_006815chr12177 ------
NM_006851chr1242759 2504 909 246 --1966 --
NM_006852chr1762757 2248 1993 1036 821 704 12034 ----
NM_006854chr772010 1639 1630 1619 1568 1464 360 11487 1648 --
NM_006861chr1242096 1695 1448 756 1623 183 --
NM_006873chr223088 2315 ----11258
NM_006874chr431138 784 163 11078 ----
NM_006877chr61331 ------
NM_006885chr1614047 13080 ----
NM_006887chr22686 488 --1233 --
NM_006888chr1452981 2267 1352 1248 855 13165 12170 12203
NM_006892chr20--11372 ----
NM_006892chr20--11372 ----
NM_006895chr232008 1656 186 11477 1653 --
NM_006901chr15169 ------
NM_006916chr221168 406 1300 ----
NM_006920chr21465 ----1285
NM_006922chr22703 658 --31739 731 565 --
NM_006924chr1754404 3836 3684 1236 1219 --33663 2701 982 --
NM_006939chr14------11205
NM_006947chr421420 408 2545 133 1298 --
NM_006948chr2162198 2121 1900 658 156 86 ------
NM_006981chr932910 639 630 32708 1202 429 ----
NM_006993chr10------163
NM_006997chr10--1439 ----
NM_007005chr931451 1081 961 11420 ----
NM_007006chr1652968 2598 1416 1392 727 ------
NM_007007chr1233913 485 42 13758 13601 14521
NM_007008chr21307 --1107 --
NM_007010chr17----21478 85 1170
NM_007011chr15126226 5887 5878 5857 2535 1622 894 837 301 146 74 68 21834 1424 1264 --
NM_007033chr131965 879 506 ------
NM_007050chr20127756 6562 6160 6069 5902 5747 3179 2490 2005 1312 934 173 12057 11698 --
NM_007054chr583627 3024 2860 2838 893 696 627 587 --12667 13889
NM_007064chr33501 450 25 ------
NM_007096chr9--1279 ----
NM_007106chr1342723 2538 1852 34 --1779 --
NM_007111chr131862 ------
NM_007114chr322514 2383 ------
NM_007125chrY21220 78 ------
NM_007129chr133987 335 217 ------
NM_007145chr1921223 949 ------
NM_007146chr1722558 1004 11880 ----
NM_007157chrX62984 2525 2007 1955 970 825 ------
NM_007170chr1------1643
NM_007175chr853549 3530 3513 2434 1106 32329 981 804 ----
NM_007192chr142953 266 1334 ----
NM_007195chr1842986 2807 2436 1394 32643 1382 1047 11192 --
NM_007202chr171539 --1593 1218
NM_007203chr931558 1172 436 ------
NM_007204chr12201 127 --1262 --
NM_007212chr14749 427 313 237 12018 ----
NM_007214chr6--1950 ----
NM_007222chr82617 509 ------
NM_007235chr12--1458 ----
NM_007238chr2074285 4152 1354 1293 790 642 312 11916 --11318
NM_007249chr13109246 8980 8796 8270 7532 7296 6330 1731 1351 733 23315 2058 27186 723 --
NM_007271chr6101837 1803 1702 1639 1455 1276 1213 734 534 124 --1473 --
NM_007276chr72777 56 ------
NM_007315chr21242 --11489 --
NM_007347chr1512030 12445 22252 363 --
NM_007350chr1293550 3303 1836 1505 1267 1261 874 668 99 ------
NM_007363chrX41017 340 234 21 --1372 --
NM_007375chr122359 2347 ------
NM_012062chr121207 --1251 1352
NM_012073chr541577 1555 1177 60 --21423 149 11205
NM_012081chr543175 2303 2285 1350 --22589 110 --
NM_012093chr11974 174 11162 --
NM_012095chr1063551 3391 3348 3268 992 340 ------
NM_012096chr363595 3111 2943 1322 918 45 1546 ----
NM_012102chr131809 1785 811 ------
NM_012104chr1133357 2987 1211 --1351 --
NM_012104chr1133357 2987 1211 --1351 --
NM_012118chr42364 309 --174 1295
NM_012137chr162904 2715 986 861 852 584 12916 ----
NM_012141chr1323676 3121 --11110 --
NM_012164chr9107092 6080 6058 5997 5688 4713 4635 2760 2231 1417 16575 ----
NM_012175chr112650 122 ------
NM_012189chr18----1182 --
NM_012193chr1144118 3592 1959 981 24142 1436 13778 --
NM_012197chr921069 538 --11545 --
NM_012199chr174433 3336 2890 1761 1203 1169 304 11180 11022 --
NM_012207chr102729 27 ----1374
NM_012214chr2106046 5776 4923 4627 4563 4298 2561 2187 1206 526 11537 ----
NM_012215chr104448 287 237 34 11681 1407 --
NM_012218chr1963098 2828 2353 1937 546 406 ------
NM_012219chr333227 3135 2940 --12161 23144 501
NM_012229chr1031365 483 131 11389 1343 --
NM_012234chr343481 3096 2885 996 13589 22356 634 13035
NM_012238chr1021650 1260 11491 --1338
NM_012242chr102830 107 ------
NM_012249chr21254 ------
NM_012252chr785278 4211 4189 1364 695 418 373 74 13493 ----
NM_012259chr641431 1391 498 260 --1912 --
NM_012262chr124438 480 23881 1558 21436 186 14899
NM_012266chr91258 ------
NM_012281chr731779 1509 513 ------
NM_012286chrX3519 120 62 ------
NM_012288chr634796 4233 3558 22086 108 14449 11044
NM_012294chr753022 1484 1413 1194 662 13435 ----
NM_012297chr492591 2567 2253 1917 1874 1616 1606 923 23 ------
NM_012300chr5239 24 1275 --11860
NM_012301chr731766 646 63 ------
NM_012302chr111158 ------
NM_012304chr552438 2340 2322 906 232 --12126 --
NM_012309chr1194585 4191 4066 3814 3251 1980 1339 847 208 11210 ----
NM_012316chr114167 45623 5204 1209 767 ----
NM_012319chr182341 274 --146 --
NM_012322chr71106 ------
NM_012325chr2041650 1324 534 153 ------
NM_012328chr721006 215 ------
NM_012334chr594610 3000 1807 1782 1669 958 636 567 214 21693 1090 34071 3767 1503 1720
NM_012338chr72994 77 --1164 --
NM_012339chr102625 589 ------
NM_012399chr2221964 448 ------
NM_012405chr162839 2663 2485 2477 806 761 12863 1942 --
NM_012408chr201653 --1774 --
NM_012416chr921078 782 1226 ----
NM_012421chr1------1453
NM_012464chr451012 798 494 419 158 --1710 --
NM_012479chr772703 2326 717 552 509 427 48 ------
NM_013229chr1241064 764 600 548 32517 2387 788 ----
NM_013231chr1433406 2707 1240 --24413 455 --
NM_013236chr223432 290 42 --1814 --
NM_013243chr1541161 321 37 25 11061 1477 --
NM_013244chr12126 ------
NM_013255chr798183 7110 7016 6803 6440 6402 5799 2084 962 38619 8517 615 26136 1741 --
NM_013261chr442599 861 843 276 13796 ----
NM_013262chr64472 379 354 286 ------
NM_013281chr2021399 1309 ----1170
NM_013313chr2242538 2262 855 831 32373 800 639 22841 873 --
NM_013316chr71941 ----1283
NM_013322chr741459 1292 566 167 11309 11114 --
NM_013323chr171274 ------
NM_013341chr21576 2725 618 12637 --
NM_013354chr82961 365 ------
NM_013357chr8----1755 --
NM_013372chr1542870 2238 765 209 --23330 3304 --
NM_013374chr322708 2595 --1548 --
NM_013377chr123579 473 51 ------
NM_013381chr1231494 967 178 ------
NM_013399chr1671792 1770 1491 1353 1219 1157 289 11537 11207 --
NM_013410chr141072 884 865 352 1234 ----
NM_013444chrX3739 314 272 ------
NM_013448chr141728 ------
NM_013449chr1232428 1099 762 ------
NM_013451chr102528 151 ------
NM_013996chr72434 351 ----1473
NM_013996chr72434 351 ----1473
NM_013997chr72434 351 ----1473
NM_013997chr72434 351 ----1473
NM_013998chr72434 351 ----1473
NM_013998chr72434 351 ----1473
NM_014011chr242423 1852 786 739 12473 ----
NM_014016chr34588 502 179 60 --1390 --
NM_014021chr142977 2742 1118 278 1345 33244 542 46 --
NM_014023chr1062595 1982 945 663 653 603 1773 22849 24 --
NM_014043chr311485 1514 ----
NM_014071chr201145 ------
NM_014106chr1552762 2243 1046 108 30 1786 1597 --
NM_014112chr865099 4401 1924 546 526 72 --13830 --
NM_014117chr1622446 948 22517 2105 ----
NM_014141chr764025 3844 3564 1686 1487 290 24049 3302 24996 756 --
NM_014153chr162543 162 ------
NM_014155chr1195849 5093 4878 2081 1931 1442 1029 153 112 27189 2404 ----
NM_014157chr1643405 2561 900 862 33029 2585 2451 11012 --
NM_014178chr14----2557 470 --
NM_014181chr2--1576 1122 --
NM_014240chr321155 358 13952 23454 858 --
NM_014243chr432022 1916 795 ------
NM_014250chr2221780 419 1604 ----
NM_014253chrX11717 --2847 356 --
NM_014267chr112783 604 ------
NM_014268chr1831281 1269 899 ------
NM_014280chr11798 ------
NM_014285chr9--1757 1238 --
NM_014294chr81129 --21401 967 --
NM_014299chr192719 647 ------
NM_014300chr15------1438
NM_014305chr131281 --1170 --
NM_014309chr2285178 4860 4511 4491 1881 1246 485 476 ------
NM_014319chr1241639 1586 1374 611 ----1138
NM_014323chr221280 1941 ----
NM_014325chr1231500 907 706 ------
NM_014331chr4117319 7242 6989 5813 5239 2387 2071 1849 825 609 239 --15018 16182
NM_014332chrX1313 ------
NM_014333chr1132653 2365 2331 1641 2510 273 --
NM_014342chr1131317 1194 1021 11393 --1311
NM_014350chr51960 ------
NM_014361chr11--1381 ----
NM_014368chr922130 1499 ------
NM_014369chr21116 ------
NM_014372chr131976 1957 112 11436 ----
NM_014376chr512358 --2401 290 --
NM_014381chr1442042 528 473 150 --13045 --
NM_014383chr192270 21 ------
NM_014392chr4----11219 --
NM_014393chr82653 396 11616 ----
NM_014394chr1041197 1100 450 294 11050 ----
NM_014409chr1------11178
NM_014415chr3----1328 --
NM_014421chr451521 1434 1340 1300 557 ----11691
NM_014423chr544293 2234 2149 810 --14441 11768
NM_014431chr1011594 ------
NM_014445chr341907 1568 726 401 ------
NM_014447chr41195 ------
NM_014454chr63864 751 133 ------
NM_014456chr101687 31710 539 473 123 --
NM_014470chr12--1782 ----
NM_014488chr112458 191 ------
NM_014491chr7----1399 --
NM_014494chr161420 ----11712
NM_014497chr2192 ------
NM_014498chr31311 ------
NM_014515chr124992 657 323 55 ------
NM_014517chr33753 110 79 11745 ----
NM_014521chr211761 ------
NM_014554chr1232009 763 352 --11812 --
NM_014572chr13--1525 ----
NM_014574chr1421358 597 ------
NM_014583chr3------1206
NM_014584chr1431516 589 299 --11322 190
NM_014587chr1611459 ------
NM_014612chr92425 342 ------
NM_014629chr841221 1158 1041 846 ------
NM_014636chr984280 4199 4082 3255 1517 1501 1459 1106 12694 --11559
NM_014653chr1231595 538 144 ------
NM_014655chr132330 1931 1667 --1806 --
NM_014670chr24624 238 176 60 ----1424
NM_014674chr373573 2505 1234 1168 781 326 96 1757 ----
NM_014676chr11586 ----11230
NM_014677chr8----1293 --
NM_014701chr153955 713 219 13424 1855 --
NM_014702chr643332 3146 2945 128 ------
NM_014705chr71779 ------
NM_014707chr782284 2089 1887 1639 633 444 344 167 --12045 --
NM_014710chrX--1328 ----
NM_014721chr687161 6823 6591 6076 2649 2569 2143 569 24602 1902 ----
NM_014733chr51468 ----11642
NM_014735chrX32074 538 430 1159 ----
NM_014739chr633285 756 143 33865 3500 3249 ----
NM_014746chr284344 3968 3674 3622 3305 3137 925 374 --11529 --
NM_014751chr851456 858 294 241 39 ------
NM_014755chr211674 13729 14264 --
NM_014761chr1631129 851 104 ------
NM_014764chr1241024 525 504 409 ------
NM_014786chr1131216 1150 894 ------
NM_014787chr132535 2152 1751 12507 22638 774 --
NM_014790chr51512 ------
NM_014810chr153025 2944 1116 763 432 --12371 --
NM_014820chr32188 142 ------
NM_014822chr42637 226 ------
NM_014826chr144228 3654 3201 1584 --1363 --
NM_014827chr151727 1610 1503 1365 1135 --157 --
NM_014828chr1432470 2230 126 --1939 --
NM_014829chr5--1517 1489 --
NM_014830chr1253713 1570 1447 1298 925 ----13593
NM_014840chr1263401 2768 2247 2232 2081 125 ------
NM_014841chr6--1364 --183
NM_014848chr1522462 241 ----12666
NM_014850chr364298 4050 3652 3555 3390 3128 --11843 --
NM_014860chr232656 1686 568 1275 22630 1635 --
NM_014864chr143939 1576 1376 935 24381 3049 21203 181 1270
NM_014870chr164523 3368 3282 1642 1407 679 --24477 132 14316
NM_014872chr922209 2094 1443 ----
NM_014877chr17117715 7365 6119 6097 5543 5340 4960 4928 3000 2665 1760 --47351 5930 5419 4770 --
NM_014897chr1762655 2488 2309 2100 806 483 12679 --1262
NM_014899chr522777 992 1171 ----
NM_014903chr1242316 2070 819 127 151 ----
NM_014904chr1053784 3700 3091 1053 102 1706 12842 --
NM_014906chr1711356 1234 2702 194 22898 1258
NM_014917chr11851 ------
NM_014918chr1521601 487 --1606 --
NM_014920chr623595 1108 --21441 1229 11179
NM_014924chr1422680 642 --12358 --
NM_014925chr121284 ------
NM_014932chr311277 11878 11972 1785
NM_014946chr22749 572 33034 2031 445 1116 --
NM_014947chr121105 938 --12334 --
NM_014951chr1032387 2304 282 ------
NM_014974chr1011519 11375 ----
NM_014982chr1464385 4207 4185 1505 1242 1011 --14191 --
NM_014988chr432075 1751 882 ------
NM_014989chr661955 1634 1331 1274 665 606 12017 1698 --
NM_014990chr141363 --1515 --
NM_014992chr14165 ------
NM_014999chr1241481 1456 623 427 21033 451 1260 --
NM_015000chr1222989 2855 --12212 --
NM_015017chr141126 414 248 217 ----1438
NM_015020chr1673442 2865 1504 300 218 170 132 --1519 13805
NM_015025chr22907 522 ------
NM_015026chr1254117 3959 1421 1212 64 ------
NM_015027chr162669 41 11391 --11573
NM_015032chr1342365 1969 512 204 11813 ----
NM_015035chr2065762 4705 4688 4517 4064 612 35545 1889 1808 ----
NM_015039chr184044 3521 3461 1642 1574 1335 562 203 14373 --23558 888
NM_015044chr1631973 474 82 --12827 --
NM_015045chr10----12223 --
NM_015046chr94707 628 584 256 ------
NM_015049chr232596 2453 2095 12424 1568 --
NM_015051chr942847 2182 1367 874 12791 ----
NM_015052chr721295 859 1253 ----
NM_015055chr1132632 2173 948 11812 ----
NM_015057chr131181 ------
NM_015059chr1583870 3212 3044 2747 1499 757 266 244 1996 --11422
NM_015060chr7--1208 ----
NM_015068chr723063 2646 ------
NM_015069chr161583 ------
NM_015070chr132566 141 1384 ----
NM_015073chr1942123 2017 355 209 12106 ----
NM_015076chr652984 2929 1796 1786 198 1803 23301 566 2822 507
NM_015084chr531061 956 29 --1401 --
NM_015092chr1644476 3526 1013 878 1757 14314 14705
NM_015115chr453250 2807 2779 1031 398 13195 ----
NM_015132chr71101 2201 113 ----
NM_015133chr161233 11486 ----
NM_015138chr1542618 686 539 386 1524 ----
NM_015144chr1632667 2584 1365 --23676 684 --
NM_015149chr11767 22096 1731 1423 --
NM_015155chr1043304 2894 2640 2521 ----1681
NM_015156chr1463528 3151 904 454 392 351 --1244 --
NM_015172chr111614 ----11023
NM_015176chr131751 1349 337 ----11158
NM_015185chrX32284 940 502 1284 ----
NM_015191chr1151963 1095 871 836 590 --1970 --
NM_015197chr1443288 2366 1362 1206 ----22783 120
NM_015200chr41763 12598 ----
NM_015208chr1861360 840 720 629 413 195 --12784 --
NM_015209chr11792 ----11870
NM_015213chr11----1618 --
NM_015215chr122531 1010 ------
NM_015225chr963132 2958 2818 2379 954 436 1417 21036 735 --
NM_015239chr9--1138 ----
NM_015251chr1621510 250 11958 ----
NM_015264chr2253905 3585 3316 1636 1140 33963 3173 3086 ----
NM_015267chr1242031 1678 805 671 11566 ----
NM_015268chr31102 ------
NM_015271chr444080 4051 3093 3067 ------
NM_015272chr161586 ------
NM_015282chr2142964 2677 2669 2202 2169 2162 2004 1949 1224 973 821 650 529 204 ------
NM_015285chr1821819 1692 ------
NM_015288chr543072 1062 938 81 13491 21195 875 --
NM_015296chr132996 32 1353 ----
NM_015308chr112852 275 1671 --162
NM_015310chr897567 7012 5969 5866 5457 1878 1530 1188 150 17211 26975 5076 15783
NM_015317chr252368 2299 2222 2189 1770 11070 ----
NM_015321chr19104321 4289 3946 3714 3366 2995 1586 1250 1113 928 --1901 --
NM_015326chr1102676 2582 1890 1153 1135 812 605 559 522 438 --1325 1955
NM_015331chr11108 --1658 --
NM_015336chr121137 11037 ----
NM_015347chr1232086 2024 188 1147 12361 11191
NM_015354chr9--1336 ----
NM_015359chr831084 691 197 12406 ----
NM_015365chrX63902 3539 3203 1385 293 113 11097 ----
NM_015375chr194838 4564 3378 3365 1760 1544 1131 638 238 24904 970 ----
NM_015382chr14------1616
NM_015387chr251989 1758 1517 445 349 --11592 --
NM_015393chr433153 3092 1151 13349 --11188
NM_015397chr9150 11731 ----
NM_015412chr372964 2636 2434 2374 2207 423 291 12398 --12597
NM_015429chr3128 ------
NM_015435chr821324 106 1301 181 --
NM_015436chr452932 2384 940 386 164 --12253 --
NM_015446chr12335 167 --1543 2645 371
NM_015455chr563455 3199 2725 2539 1251 558 23769 1582 13166 12854
NM_015457chr111704 ------
NM_015458chr895214 3421 3338 3263 1560 1141 970 287 186 21833 788 15054 --
NM_015464chr71826 2704 143 ----
NM_015465chr52296 202 1723 ----
NM_015475chr2----153 --
NM_015483chr72381 322 --1173 --
NM_015485chr11100 ------
NM_015497chr152309 67 ------
NM_015525chr611031 --177 --
NM_015534chr11763 1314 ----
NM_015542chr1011144 --1408 --
NM_015550chr753334 3178 2605 1189 1129 ------
NM_015553chr664060 3958 3658 3603 3506 1486 14235 13374 --
NM_015567chr1321323 1194 193 11286 --
NM_015569chr164347 4089 3902 1825 1425 1256 14292 1719 --
NM_015576chr332460 2332 941 12596 --12519
NM_015578chr1931945 1510 70 ------
NM_015602chr141704 368 194 100 --11110 --
NM_015630chr211095 ------
NM_015642chr32222 102 ------
NM_015670chr17--1135 ----
NM_015676chr14176 ------
NM_015680chr22545 41 1671 1683 --
NM_015695chr651885 1849 1658 612 523 --11898 --
NM_015713chr832741 2733 2560 ----22250 1444
NM_015844chr182950 153 ------
NM_015846chr182950 153 ------
NM_015847chr182950 153 ------
NM_015866chr11399 ------
NM_015872chr1----11284 --
NM_015879chr1887850 6469 6383 5384 2306 1476 329 92 35196 3134 2561 17309 --
NM_015885chr111349 --1186 --
NM_015886chr875532 5359 4867 4692 3951 3741 1717 23710 1973 1683 --
NM_015892chr105639 577 455 232 85 ------
NM_015902chr81343 ----1722
NM_015906chr174652 4504 3307 3088 972 880 564 1817 --1221
NM_015926chr31301 ------
NM_015975chrX11475 11467 31408 304 222 --
NM_016009chr143853 3808 1933 238 23635 429 --13279
NM_016019chr71191 ------
NM_016025chr1631809 1260 21 ------
NM_016038chr72266 63 ------
NM_016057chr122828 813 ------
NM_016072chr1232422 813 801 --1696 11557
NM_016078chr1711082 1382 --11001
NM_016081chr442053 2011 1954 1844 ------
NM_016083chr653487 2918 1200 1013 865 13618 --1248
NM_016096chr832178 1455 49 --11529 --
NM_016097chr181965 --1183 --
NM_016120chrX21075 410 ------
NM_016121chr141133 786 432 383 1291 ----
NM_016129chr4----159 --
NM_016131chr242351 2268 1671 692 ------
NM_016132chr152677 303 --21342 1016 23202 1065
NM_016152chr331285 1132 319 ------
NM_016185chr17196 --1785 --
NM_016201chr331447 735 561 ------
NM_016206chr3138150 7949 7601 7413 7206 7116 6835 6650 6293 3173 2007 1207 290 12769 --11187
NM_016216chr33343 245 223 --156 --
NM_016224chr641899 1498 361 328 --1344 --
NM_016230chr62372 120 ------
NM_016235chr161317 11507 ----
NM_016248chr1343902 2509 1127 622 --1507 12656
NM_016255chr622284 658 33358 2473 2155 ----
NM_016258chr11739 ------
NM_016260chr267235 6972 6125 5579 4737 1141 21134 452 --26267 6056
NM_016261chr171769 1290 ----
NM_016262chr6--163 ----
NM_016271chr1852032 2022 1782 690 227 --12327 --
NM_016272chr2222768 184 12125 ----
NM_016275chr332093 1070 172 ----1766
NM_016281chr121277 ------
NM_016282chr941672 1364 1102 332 11776 ----
NM_016306chr3------1258
NM_016315chr231524 1510 1463 ------
NM_016322chr932658 545 342 ------
NM_016338chr52968 278 ------
NM_016357chr122879 507 11140 11227 11054
NM_016358chr5172 ------
NM_016374chr111402 11447 ----
NM_016374chr111402 11447 ----
NM_016376chr1793979 3562 2750 1302 1192 704 514 367 219 --24383 4091 --
NM_016377chr641515 533 470 99 --1237 --
NM_016396chr1531180 1070 216 --1673 --
NM_016418chr2253222 2387 2376 1362 289 13045 --13187
NM_016422chr1122794 470 --1787 --
NM_016441chr232102 1908 567 127 ----
NM_016448chr141787 585 339 270 ------
NM_016451chr111227 ------
NM_016472chr143478 179 167 ------
NM_016496chr19--1427 ----
NM_016507chr1742808 2429 833 749 --1344 --
NM_016513chr623595 1108 --21441 1229 11179
NM_016516chr21553 ------
NM_016525chr94919 855 294 144 ------
NM_016529chr1321044 300 ------
NM_016530chr1553154 2854 2547 1207 1172 ------
NM_016531chr433993 2784 826 1784 --12965
NM_016542chrX2501 26 --1219 --
NM_016577chr374263 3899 3283 1808 1333 1245 1175 --13390 --
NM_016578chr112654 145 ------
NM_016587chr72777 56 ------
NM_016599chr431162 506 306 11437 2395 295 --
NM_016603chr521972 1781 ------
NM_016607chrX11477 ------
NM_016608chrX1371 ------
NM_016612chr8----1661 --
NM_016621chr1174495 4150 3442 1498 1170 712 390 ------
NM_016631chr212727 74 ----1647
NM_016823chr17------21333 164
NM_016831chr1--12315 2699 652 --
NM_016836chr22638 583 ------
NM_016839chr22638 583 ------
NM_016936chr1642085 1579 570 59 12217 11663 --
NM_016946chr173299 3133 2761 2413 2285 2210 1020 23496 2309 21058 82 --
NM_016952chr1143984 1530 632 465 ------
NM_017420chr1443665 3103 1519 523 2547 532 11118 --
NM_017431chr22700 603 ------
NM_017447chr2153800 3472 2722 173 43 14302 --1977
NM_017449chr11354 ------
NM_017452chr20----1590 --
NM_017453chr20----1590 --
NM_017454chr20----1590 --
NM_017491chr41743 ------
NM_017510chr51675 --1628 --
NM_017519chr621016 861 ------
NM_017522chr111064 ------
NM_017544chrX2619 100 ----2663 369
NM_017548chr321637 1444 ----1223
NM_017553chr1551079 494 474 372 176 ----1267
NM_017563chr386206 4650 3986 1542 1161 1085 596 100 15972 35506 4478 2172 --
NM_017569chr133260 103 42 ------
NM_017582chr1--1192 11405 --
NM_017599chr1221867 1748 --12014 2538 462
NM_017610chr1511542 ------
NM_017613chr211370 ------
NM_017633chr642821 2565 422 373 22446 1118 ----
NM_017635chr1121638 1440 --1498 --
NM_017637chr979098 7940 7573 6226 3468 3014 1009 ----12458
NM_017643chr1732382 2164 1972 ------
NM_017644chr345046 1270 1148 609 24454 1007 14670 --
NM_017650chr744336 4040 3823 1254 --34322 2104 1423 15919
NM_017657chr23691 365 22 ------
NM_017658chr1431581 1012 768 --12905 11465
NM_017661chr1521227 260 --121 --
NM_017676chr521894 439 ----11545
NM_017681chrX3866 859 849 ----1680
NM_017699chr3151 ------
NM_017714chr202594 28 ------
NM_017719chr322288 2075 31931 757 586 ----
NM_017738chr92364 134 ------
NM_017741chr421801 1089 12344 --1450
NM_017742chr1841358 1320 547 190 ------
NM_017747chr51433 1282 ----
NM_017753chr9----1871 --
NM_017754chr644248 3164 1549 330 ----24627 1298
NM_017769chr1412636 --12999 --
NM_017778chr8285 45 --11369 --
NM_017786chr83485 464 88 ----1547
NM_017789chr2------1281
NM_017798chr2011147 1789 ----
NM_017799chr143564 261 246 --21473 503 --
NM_017801chr352619 2105 2090 1697 1613 --11911 --
NM_017813chr865550 5426 4997 3857 816 786 22159 196 11966 --
NM_017830chr4193 ----133
NM_017831chr1863581 1851 1774 1462 858 634 --24340 3702 --
NM_017848chrX31810 1613 1504 11168 14578 1243
NM_017849chr263195 2678 2470 2232 908 282 --12300 --
NM_017864chr81193 ------
NM_017902chr10125640 4885 4757 4500 4471 4350 4174 3948 2087 1603 1115 756 11302 14273 --
NM_017913chr92457 356 ------
NM_017922chr142584 445 ------
NM_017925chr911698 1687 --11407
NM_017933chr2--176 11657 --
NM_017938chrX--12193 ----
NM_017943chr14------1778
NM_017944chr1152966 2587 2344 721 577 11084 ----
NM_017958chr223079 2483 11026 12335 --
NM_017964chr25995 900 836 373 118 ------
NM_017987chr1031894 725 553 ------
NM_017988chr12--1940 --140
NM_017994chr721913 385 11882 22496 715 --
NM_018011chr13------1664
NM_018023chr321956 260 21976 1653 ----
NM_018030chr18----1181 147
NM_018036chr1444342 4114 3175 1442 13198 13544 13877
NM_018046chr531827 633 562 --11749 --
NM_018047chr53871 843 96 ------
NM_018050chr122154 61 --180 --
NM_018061chr121273 609 ------
NM_018070chr1----1173 --
NM_018078chr41237 129 11041 --
NM_018084chr222883 58 12709 ----
NM_018086chr211530 ------
NM_018098chr331094 921 481 1960 ----
NM_018119chr161277 ------
NM_018121chr101858 1550 1235 --
NM_018126chr411296 1333 11532 11096
NM_018128chr1741056 983 154 24 --1513 --
NM_018144chr101103 ------
NM_018155chr332251 1125 307 ------
NM_018171chr122326 227 ------
NM_018182chr174664 514 257 59 --188 181
NM_018184chr332097 871 437 1238 ----
NM_018189chr341704 1361 497 334 1521 ----
NM_018200chr1542619 1653 559 536 ------
NM_018202chr13680 302 89 ------
NM_018211chr12374 113 ------
NM_018221chr22407 171 ------
NM_018223chr122400 120 ----1365
NM_018227chr432215 903 401 ----12149
NM_018244chr201149 ------
NM_018247chr642415 2144 2076 134 ------
NM_018248chr43295 67 29 ------
NM_018254chr121839 407 ------
NM_018257chr2022058 1632 ----12264
NM_018266chr321091 705 ------
NM_018286chr171822 ----2928 380
NM_018287chr10----1842 1498
NM_018290chr42967 143 --11116 --
NM_018293chr332949 1880 274 22172 2021 --12398
NM_018299chr821217 71 --13358 --
NM_018302chr412102 --1187 2850 714
NM_018313chr31505 --22621 249 --
NM_018319chr1461377 1354 1029 403 305 194 --196 --
NM_018323chr41114 11900 11169 --
NM_018327chr2041636 710 655 205 ------
NM_018351chr1264136 4062 3920 3359 3101 373 --13948 --
NM_018362chr1123363 3189 23072 1245 32883 1464 473 --
NM_018364chr132816 864 527 --23186 1069 13983
NM_018369chr51518 --1670 --
NM_018374chr744866 4000 1618 807 11862 --14488
NM_018375chr1441878 1583 94 86 ------
NM_018388chrX31421 1271 79 ------
NM_018403chr333572 1502 176 ------
NM_018416chr1242598 2288 2242 276 --22135 454 --
NM_018429chr552834 2693 2044 785 98 ------
NM_018439chr1852261 734 629 468 198 ------
NM_018440chr8128218 7703 7643 6754 5991 2317 2138 2024 971 654 289 160 25333 1871 12848 13205
NM_018444chr842299 1863 1470 349 11566 11842 --
NM_018464chr10------1371
NM_018471chr21570 ------
NM_018490chr1131896 1548 432 ----11249
NM_018534chr2190 ------
NM_018566chr144802 1492 545 517 15148 21221 685 --
NM_018584chr11967 --1291 --
NM_018593chr6155 ------
NM_018638chr1265381 4887 4353 3461 996 336 --45246 5092 1016 989 --
NM_018640chr1242446 1985 1871 982 ------
NM_018650chr12897 728 ------
NM_018657chr3------1736
NM_018689chr1552403 2375 2254 1896 123 12729 ----
NM_018695chr5----11992 12461
NM_018704chr11704 2759 232 ----
NM_018710chr821171 136 1121 1372 --
NM_018712chr111397 11243 ----
NM_018713chr13741 230 209 ------
NM_018718chr752267 451 345 261 230 ------
NM_018719chr721118 907 ------
NM_018834chr5------1335
NM_018836chr1157 ------
NM_018840chr202455 389 ------
NM_018841chr133706 535 143 12611 23889 1181 --
NM_018844chr722019 169 1671 ----
NM_018898chr52895 253 ------
NM_018899chr52895 253 ------
NM_018900chr52895 253 ------
NM_018901chr52895 253 ------
NM_018902chr52895 253 ------
NM_018903chr52895 253 ------
NM_018904chr52895 253 ------
NM_018905chr52895 253 ------
NM_018906chr52895 253 ------
NM_018907chr52895 253 ------
NM_018908chr52895 253 ------
NM_018909chr52895 253 ------
NM_018910chr52895 253 ------
NM_018911chr52895 253 ------
NM_018937chr53310 153 32 ------
NM_018947chr764598 4425 3928 1069 390 43 34409 1972 1352 34947 3918 1417 --
NM_018955chr17----193 --
NM_018968chr21135 ------
NM_018970chr742089 1154 241 137 22615 1934 11272 --
NM_018976chr1232468 2293 2232 12867 2227 92 --
NM_018999chr1094924 4788 4332 3568 1929 1869 390 327 305 --23862 3652 13276
NM_019000chr521651 671 ------
NM_019001chr364179 4133 3873 1744 1499 72 23020 754 23910 1340 12954
NM_019006chr152727 500 ------
NM_019027chr4--12382 12091 --
NM_019028chr11--1324 ----
NM_019036chr62999 248 ------
NM_019045chrX4959 734 270 39 ------
NM_019063chr242284 2242 247 153 --1142 22081 1412
NM_019084chr1032376 578 406 12291 ----
NM_019087chr541143 671 641 55 11079 ----
NM_019091chr21368 ------
NM_019094chr1232825 1013 901 23710 1451 139 13276
NM_019114chr932462 477 118 ----1797
NM_019116chr1663752 3117 2445 2425 1303 704 13385 --1381
NM_019117chrX32960 2497 1253 ------
NM_019558chr2--1104 ----
NM_019590chr1011429 1305 ----
NM_019593chr2042307 1076 610 199 --12931 --
NM_019605chr12615 517 --1587 --
NM_019617chr2------1133
NM_020039chr1241837 1618 517 145 11959 ----
NM_020119chr763453 1531 1231 613 447 117 1471 ----
NM_020122chr265784 4428 2320 1408 1370 1216 13772 --11755
NM_020130chr821134 901 1988 ----
NM_020132chr2164179 3988 3277 3184 411 177 ----14398
NM_020143chr21862 ----1874
NM_020144chr731803 1558 379 ------
NM_020148chr1853083 2420 2398 2243 1177 1977 22186 773 --
NM_020151chr251314 715 424 323 46 --1587 --
NM_020159chr441498 1441 1208 431 ------
NM_020177chr563259 2477 2329 397 363 54 11225 ----
NM_020178chr171323 11065 2307 292 --
NM_020182chr2043206 2908 2499 279 ------
NM_020194chr2--133 1568 --
NM_020198chr171105 1198 11504 --
NM_020205chr13743 358 272 1925 ----
NM_020226chr41570 ------
NM_020235chr3----1361 --
NM_020244chr12143 ------
NM_020245chr674016 3585 3194 3163 3144 1941 1818 --21503 786 --
NM_020309chr192806 29 1260 --2440 202
NM_020336chr2053761 3511 2991 885 658 ------
NM_020338chr1023553 1470 ------
NM_020341chr2031400 716 668 1171 ----
NM_020342chr21295 --1120 22177 2170
NM_020347chr342338 2008 1462 610 --2230 52 --
NM_020353chr331547 1463 458 3575 448 182 ----
NM_020357chr33661 230 55 1521 1217 --
NM_020372chr14--1305 1100 --
NM_020373chr121217 --1456 --
NM_020390chr334820 1861 1113 --23512 945 --
NM_020403chr13----1324 --
NM_020418chr31182 ------
NM_020420chrY31508 1201 1174 --2623 111 --
NM_020432chr721691 190 --198 --
NM_020440chr152788 2738 2574 1039 874 ------
NM_020443chr196430 6352 6215 5847 5601 5325 2758 2314 399 37015 6144 298 15761 --
NM_020448chr153720 3331 3058 2650 1359 13590 185 --
NM_020449chrX2492 208 --1702 --
NM_020453chr431489 1392 689 ------
NM_020456chr1341823 1579 905 591 21847 1524 11657 --
NM_020463chr221315 35 ------
NM_020466chr674562 4149 1629 655 573 201 34 24838 3991 188 --
NM_020473chrX11803 11973 11506 --
NM_020474chr1841890 1633 358 251 ------
NM_020532chr21307 --1107 --
NM_020640chr311909 --1289 --
NM_020644chr114741 725 220 78 ------
NM_020645chr112457 444 --1258 --
NM_020647chr812227 --1566 --
NM_020651chr221234 206 ------
NM_020653chr17--143 ----
NM_020661chr1231716 1437 78 ----11857
NM_020666chr51729 ----1760
NM_020673chr20127177 6341 6159 5229 2893 2602 2149 2062 1251 990 106 99 36183 5863 5253 35990 5065 957 17514
NM_020686chr1612158 12009 12812 --
NM_020698chr1263082 3006 2686 342 329 204 1703 ----
NM_020699chr155315 5197 4950 4384 1666 --14149 --
NM_020702chr941698 1155 427 39 ----11322
NM_020708chr2032149 2021 261 ------
NM_020711chr222235 1605 ------
NM_020715chr1472162 1672 855 645 510 175 136 1534 ----
NM_020717chrX63184 1661 1452 815 710 76 14961 1480 --
NM_020718chr1685855 5604 5335 2445 2167 1341 1134 535 ----14303
NM_020724chr481976 853 806 799 784 339 179 159 --1317 --
NM_020726chr5----1255 --
NM_020732chr621016 861 ------
NM_020734chr1233132 2381 759 ------
NM_020737chr62113 82 ------
NM_020739chr15142 ------
NM_020742chrX22165 99 ----11837
NM_020750chr631525 1268 426 ------
NM_020752chr1052374 2174 1953 539 521 2924 816 12387 --
NM_020760chr2----11474 184
NM_020766chrX34339 4327 1635 34510 1583 169 ----
NM_020772chr1788700 8276 7055 5671 2349 1990 1502 1270 27558 6980 48239 6777 2604 1872 18383
NM_020774chr1895389 5371 4573 4414 4163 1967 1521 1104 109 --15224 33973 1620 672
NM_020776chr1832044 1065 114 12485 2567 431 --
NM_020791chr171405 ----11412
NM_020794chr11276 11455 --11173
NM_020801chr52247 89 11819 ----
NM_020819chr611017 152 ----
NM_020824chr101118 ------
NM_020825chr1643618 2585 1181 1120 23400 3100 ----
NM_020839chr31177 2378 310 ----
NM_020841chr1253550 3423 1316 794 318 ------
NM_020858chr1532196 1655 863 ------
NM_020866chr13----1343 --
NM_020870chr432035 1670 1651 22235 1679 ----
NM_020871chrX52164 1886 1837 764 465 --22106 34 2616 304
NM_020872chr331733 1687 1182 ------
NM_020886chr1121005 199 --1839 --
NM_020888chr132051 1981 239 --1346 --
NM_020899chr1742344 548 527 213 11801 12290 --
NM_020917chr1953550 596 498 461 72 11478 ----
NM_020921chr1432593 994 118 22615 2474 23688 707 --
NM_020922chrX3609 511 73 --1482 --
NM_020935chr243841 2992 246 190 --23985 492 --
NM_020940chr1042442 2383 2073 987 ------
NM_020948chr153326 2549 2483 441 143 ----1123
NM_020951chr1932159 921 239 11542 21822 435 11846
NM_020967chr2011097 11176 ----
NM_020974chr111530 ------
NM_020975chr1011271 --41672 1410 1297 230 --
NM_020977chr41231 11458 ----
NM_020983chr1211718 ------
NM_020988chr1621110 202 ------
NM_020993chr1232851 1148 270 21800 116 ----
NM_021005chr1531128 367 276 ------
NM_021007chr262073 1921 1898 1650 685 627 ------
NM_021009chr12--122 ----
NM_021012chr1742738 2460 803 401 ------
NM_021032chr311718 ------
NM_021033chr1323171 210 13293 ----
NM_021045chr1012065 ----147
NM_021079chr1742739 2049 1258 210 22577 2453 ----
NM_021111chr911128 ------
NM_021116chr778932 6756 6660 5576 3288 1906 980 --28136 1035 --
NM_021120chrX1186 --12660 11972
NM_021137chr1752204 2096 1924 1604 95 12003 ----
NM_021140chrX1424 --11020 --
NM_021141chr26810 670 400 367 295 258 ------
NM_021145chr72399 339 11185 ----
NM_021148chr7----1859 --
NM_021183chrX1334 ------
NM_021190chr1------21253 1062
NM_021202chr2052755 2264 1120 575 403 11209 ----
NM_021229chr1221116 135 ------
NM_021238chr1261954 1791 1542 597 498 269 1293 12115 --
NM_021622chr1042137 1537 653 45 ----11512
NM_021633chr121094 438 11412 11193 --
NM_021637chrX21096 1024 1849 1526 --
NM_021643chr21119 ------
NM_021644chr102729 27 ----1374
NM_021648chr652611 2344 924 82 34 1228 ----
NM_021722chr7----1107 --
NM_021794chr12313 280 ------
NM_021809chr2042018 1645 1573 671 ------
NM_021813chr665137 5046 4146 1854 266 128 --24575 4197 --
NM_021814chr611483 1472 ----
NM_021911chr535326 3405 979 24237 3783 15575 --
NM_021912chr1553981 3224 2796 1433 910 ------
NM_021913chr1951549 1173 605 359 328 21309 312 1439 --
NM_021942chr43186 179 63 ----1767
NM_021949chrX72692 2670 2122 1882 1769 310 74 ------
NM_021960chr132646 2605 1893 --22027 223 --
NM_021961chr1186913 6525 5388 2907 2705 1560 888 308 22581 1760 26564 6223 --
NM_021962chr1752381 2189 2012 472 450 12472 --11654
NM_021963chrX1248 1112 ----
NM_021964chr335717 1659 735 21667 1362 25784 4713 14391
NM_021988chr203462 370 57 ----1535
NM_021998chrX177 21299 88 ----
NM_022037chr221033 233 1250 ----
NM_022041chr1661069 1054 1023 988 775 535 12715 ----
NM_022048chr15106338 6185 5865 5517 5293 5080 4735 4524 1918 1710 ----14756
NM_022049chr12613 386 --11854 --
NM_022058chr221470 233 --1478 --
NM_022060chr1451235 1033 1024 542 118 ------
NM_022062chr1121566 460 --21416 446 --
NM_022063chr101152 --11689 --
NM_022080chr203519 210 51 12348 ----
NM_022085chr631548 1514 191 ------
NM_022104chr201234 ------
NM_022114chr133980 1675 1057 --2762 194 --
NM_022116chr72245 41 ------
NM_022121chr611083 --1173 --
NM_022130chr531262 974 342 ------
NM_022133chr821167 706 ------
NM_022137chr141170 ------
NM_022173chr221033 233 1250 ----
NM_022340chr383571 3277 3254 2943 2421 1217 1113 388 11053 11404 --
NM_022351chr833244 3159 1170 --12848 --
NM_022442chr203462 370 57 ----1535
NM_022459chr1365863 5723 5711 1972 511 74 --35147 5135 4063 --
NM_022462chr1953544 2810 1076 909 198 11100 --13184
NM_022465chr1232425 2024 1100 ------
NM_022474chr1442443 1890 870 356 1757 ----
NM_022475chr41470 ------
NM_022476chr162360 203 ------
NM_022484chr71451 ------
NM_022552chr231191 1178 930 ------
NM_022652chr123756 749 51 ------
NM_022728chr71114 1129 ----
NM_022730chr2----11010 --
NM_022739chr1731000 951 369 ----173
NM_022753chr122698 930 --1981 12736
NM_022756chr131406 1031 192 ----1944
NM_022771chr122949 346 ----1960
NM_022776chr32390 383 ------
NM_022781chr943064 1278 964 170 --11075 --
NM_022802chr10----1648 --
NM_022841chr1572641 2634 2581 2122 2075 814 434 161 2869 308 --
NM_022842chr343349 2907 2255 778 23236 2945 23358 33 --
NM_022875chr5--3416 406 361 ----
NM_022877chr5--3416 406 361 ----
NM_022894chr221652 385 --21708 1156 --
NM_022898chr1464394 3942 3929 3469 1630 670 14825 ----
NM_022912chr231111 627 302 12328 --13089
NM_022918chr1131582 582 37 ------
NM_023012chr121526 ------
NM_023015chr1--1770 1681 --
NM_023016chr222551 1081 21950 42 ----
NM_023018chr141583 529 381 94 ------
NM_023071chr1221130 311 ----1973
NM_023076chr1622048 1064 1221 ----
NM_023923chr153769 3578 3531 2961 482 32807 1448 982 1168 --
NM_023929chr862724 2562 1763 1727 1094 564 --1575 --
NM_024007chr51803 1649 ----
NM_024061chr71636 ------
NM_024071chr141461 ------
NM_024117chr931145 948 550 ------
NM_024295chr851760 1421 814 137 117 --1177 --
NM_024321chr19------1111
NM_024337chr51292 ------
NM_024345chr9105841 5807 5506 5140 4212 2051 1483 1223 610 586 11819 ----
NM_024408chr153178 2449 1262 1097 573 11173 2612 171 11129
NM_024423chr1833717 3461 448 11086 ----
NM_024430chr1831324 1220 401 11516 ----
NM_024491chr32579 518 ------
NM_024511chr443527 2282 865 509 22306 533 22640 343 --
NM_024523chr721119 128 ------
NM_024524chr332215 992 65 ----12740
NM_024539chrX2215 65 ------
NM_024551chr1232580 1962 1679 --1982 --
NM_024551chr1232580 1962 1679 --1982 --
NM_024567chr82270 103 ------
NM_024569chr11946 12795 21065 491 --
NM_024582chr4--1364 ----
NM_024595chr11305 ------
NM_024598chr1631240 1043 546 ----11333
NM_024612chr17--1928 ----
NM_024645chr821415 633 ------
NM_024646chr143543 605 203 159 23301 3011 23753 2559 12719
NM_024665chr364140 4025 3711 1826 826 529 ------
NM_024713chr1521513 1420 11185 178 --
NM_024721chr8--2366 272 12504 12538
NM_024722chr171584 ------
NM_024744chr232166 1690 50 12126 ----
NM_024757chr941110 907 320 292 ------
NM_024761chr954310 3804 3492 1621 495 14600 24131 3910 --
NM_024913chr731783 690 371 11402 ----
NM_024920chr421289 65 ------
NM_024927chr171200 ------
NM_024947chr348244 6666 6236 583 38473 3573 2397 58079 3646 3510 2681 1637 17517
NM_024949chr494909 4660 3837 3682 3650 3634 3328 825 785 11423 11937 --
NM_024953chr1211966 22688 811 ----
NM_024963chr7125856 5751 5292 4896 4581 4542 4082 2188 1872 1815 1607 27 14871 ----
NM_024989chr2148131 7450 7119 6658 5956 5935 5872 5613 5385 2721 2370 1792 1589 442 12394 22205 350 --
NM_025054chr843717 2992 2756 1059 ----1294
NM_025114chr12124 ------
NM_025126chr121502 ------
NM_025133chr21852 --1986 --
NM_025134chr1662396 1735 1724 838 554 184 22507 2178 12417 11870
NM_025135chr181370 1499 ----
NM_025146chr312116 ------
NM_025147chr2--11121 ----
NM_025154chr721335 523 ------
NM_025160chr163434 2977 1550 1442 1287 755 14328 23945 2635 --
NM_025179chr164216 4202 4153 3088 3055 166 --24280 62 --
NM_025181chr22781 87 --1226 --
NM_025191chr142934 1002 558 534 ----11324
NM_025208chr1121946 1927 --1138 --
NM_025222chr352566 1166 957 605 463 12532 --13050
NM_030579chr1652642 2558 1339 1047 959 13278 12759 --
NM_030582chr211132 ------
NM_030621chr1473559 1594 1504 1323 1104 691 641 ------
NM_030625chr1031038 939 249 11066 1969 --
NM_030627chr521445 1305 ------
NM_030629chr162602 126 ----11614
NM_030647chr776116 5895 4267 4233 2496 1298 251 35737 4798 4785 25587 5036 1550
NM_030648chr455345 5196 4720 1755 644 13727 ----
NM_030660chr1411269 --11337 --
NM_030670chr121498 11714 32130 467 54 1208
NM_030671chr121498 11714 32130 467 54 1208
NM_030674chr12125031 4485 3978 3865 2232 1689 1566 1272 1204 1166 1056 307 11336 ----
NM_030755chr1422769 390 42615 1032 764 446 22694 2465 --
NM_030756chr102256 45 ------
NM_030762chr121626 11615 ----
NM_030763chrX2836 159 --1346 --
NM_030780chr83690 519 148 1427 1262 --
NM_030808chr171228 ------
NM_030810chr631548 1514 191 ------
NM_030817chr1273611 3411 2706 2338 1288 396 214 --22382 1159 --
NM_030820chr61947 --1695 --
NM_030885chr332019 1991 1978 1728 ----
NM_030918chr174260 4209 2076 2020 1851 1516 263 12045 14568 --
NM_030925chr1341310 555 328 36 ------
NM_030933chr1------185
NM_030938chr171439 11031 ----
NM_030939chr611168 ------
NM_030953chr5----21399 1384 --
NM_030962chr113422 242 175 ------
NM_030963chr61534 --1588 --
NM_031157chr121209 ------
NM_031216chr1831608 1388 657 1883 --12122
NM_031243chr741952 1809 1681 257 --22336 346 1829
NM_031314chr1421558 1500 --1216 1559
NM_031371chr111402 11447 ----
NM_031371chr111402 11447 ----
NM_031411chr52895 253 ------
NM_031427chr1455949 4404 1415 1038 105 35976 4412 3746 25127 250 --
NM_031442chrX43008 1975 1257 1027 12969 23153 2231 --
NM_031459chr111687 ------
NM_031461chr821969 292 ------
NM_031472chr11167 ------
NM_031476chr1652777 2244 1065 923 240 12268 22078 446 1912
NM_031483chr2052811 2609 1206 658 255 --1308 --
NM_031492chr112193 109 ------
NM_031844chr143891 3457 3007 534 12823 ----
NM_031845chr222712 1029 12688 1736 12882
NM_031847chr222712 1029 12688 1736 12882
NM_031849chr52895 253 ------
NM_031857chr52895 253 ------
NM_031860chr52895 253 ------
NM_031922chr61422 ------
NM_031942chr261008 878 276 204 109 57 ----1500
NM_031989chr122119 69 ------
NM_032042chr522788 729 ------
NM_032047chr332429 566 500 ------
NM_032050chr221280 1941 ----
NM_032052chr221306 11326 ----
NM_032139chr194799 444 317 117 ------
NM_032147chr122877 401 1256 ----
NM_032160chr1854231 3803 1285 673 243 23827 1301 13637 --
NM_032199chr1053834 3689 3036 2441 207 12716 ----
NM_032208chr273271 3110 3019 743 623 296 60 ------
NM_032211chr101324 ----1879
NM_032221chr2041267 305 170 41 --11386 --
NM_032239chr45989 284 262 170 121 --11143 --
NM_032272chr81493 ------
NM_032283chr121555 110 ------
NM_032288chr342384 2179 1671 841 --21557 626 --
NM_032291chr131745 1372 1241 --11329 1795
NM_032295chr72566 70 ------
NM_032312chr21732 ------
NM_032329chr294249 4200 3757 3652 3289 2947 2819 1392 1343 ------
NM_032352chr1421480 307 ------
NM_032354chr1731049 889 859 ------
NM_032373chr1044370 4161 1270 1229 1232 --11003
NM_032377chr191614 ------
NM_032379chr111343 1687 ----
NM_032408chr73796 489 414 ------
NM_032410chr81171 --1898 --
NM_032412chr5--1358 ----
NM_032435chr13492 440 79 2958 532 11685 --
NM_032436chr135870 678 171 126 118 ------
NM_032439chr1011676 1532 --11560
NM_032457chr443041 1180 734 317 --23265 1092 12843
NM_032458chrX53404 2935 1229 1203 550 ------
NM_032491chr1231308 1194 371 ------
NM_032494chr22571 543 ------
NM_032499chr1521513 164 ------
NM_032509chr822045 452 --11687 21824 547
NM_032558chr91552 --11094 --
NM_032562chr102388 67 ------
NM_032582chr1711327 --1191 11627
NM_032590chr123769 320 128 ------
NM_032594chr141803 1357 ----
NM_032632chr1451945 1820 1769 1539 466 ------
NM_032704chr12198 ------
NM_032765chr5------1864
NM_032778chr353015 2805 1143 204 92 ------
NM_032802chr152228 95 ------
NM_032810chr1011357 2574 285 11418 --
NM_032826chr764448 4354 3387 3348 1750 301 24051 1187 ----
NM_032833chr122406 2312 ----11952
NM_032842chr751246 573 409 387 315 ------
NM_032858chr11135 ------
NM_032859chr1341371 905 839 276 --11139 --
NM_032870chr6------1128
NM_032876chr1441993 1968 1602 352 --1517 --
NM_032900chr1023941 3118 ------
NM_032924chr71460 ----142
NM_032943chr111343 1687 ----
NM_032949chr13169 ------
NM_032961chr411275 ------
NM_032966chr11--11574 ----
NM_032968chrX42830 1710 1493 522 ------
NM_032969chrX42830 1710 1493 522 ------
NM_032973chrY42825 1704 1493 522 ------
NM_032998chr121143 301 ------
NM_033008chr31182 ------
NM_033009chr31182 ------
NM_033010chr31182 ------
NM_033020chr174652 4504 3307 3088 972 880 564 1817 --1221
NM_033055chr1143 21108 109 ----
NM_033081chr2051495 970 474 383 309 --1453 --
NM_033082chr121174 ------
NM_033083chr383298 3290 3283 2735 1009 653 401 151 ------
NM_033102chr161291 1246 459 241 203 98 1942 ----
NM_033102chr161291 1246 459 241 203 98 1942 ----
NM_033105chr8147 1485 ----
NM_033121chr12--11596 1689 --
NM_033135chr1121946 1927 --1138 --
NM_033136chr531200 221 171 ------
NM_033137chr531200 221 171 ------
NM_033143chr454627 3358 2849 379 320 22873 468 14117 --
NM_033181chr653487 2918 1200 1013 865 13618 --1248
NM_033196chr1921460 137 ----11561
NM_033211chr521340 750 1678 ----
NM_033224chr746787 6614 5541 262 26811 5353 36506 5912 5476 66320 5563 2883 2291 1150 775
NM_033225chr822499 2056 ------
NM_033226chr162603 61 1560 ----
NM_033285chr853975 3531 3365 2740 704 --13667 --
NM_033290chrX--11434 ----
NM_033300chr111064 ------
NM_033326chr1132272 308 286 1119 2628 295 2922 607
NM_033360chr1254273 2870 1856 1029 970 --11161 --
NM_033389chr1764741 3971 3878 3487 3220 1205 ------
NM_033407chr1--1544 ----
NM_033421chr2041758 1649 469 425 1749 1726 --
NM_033425chr1142416 2355 866 96 1656 ----
NM_033430chr453910 2920 2768 1444 64 23766 1342 ----
NM_033437chr453910 2920 2768 1444 64 23766 1342 ----
NM_033512chr832901 2577 2484 --12287 12708
NM_033540chr321122 153 ------
NM_033637chr1073608 3524 2673 1005 960 402 115 --12614 --
NM_033642chrX2925 905 ------
NM_033644chr5239 24 1275 --11860
NM_033645chr5239 24 1275 --11860
NM_033656chr2155695 2216 1506 376 85 ------
NM_052818chr1352177 1942 225 122 43 ------
NM_052834chr1821819 1692 ------
NM_052847chr1932999 1005 71 1355 1838 --
NM_052874chr161503 ------
NM_052886chr832077 498 264 --136 --
NM_052900chr821412 651 --11195 --
NM_052904chr641469 965 906 107 1306 ----
NM_052918chr1033520 2273 1156 --11247 --
NM_052927chr532255 1749 1514 1165 ----
NM_052953chr31114 ------
NM_052962chr621632 1146 ------
NM_052966chr133613 1139 24 13004 11435 --
NM_053023chr113890 733 588 ------
NM_053024chr31588 ----172
NM_053025chr3125 --11422 11469
NM_053026chr3125 --11422 11469
NM_053027chr3125 --11422 11469
NM_053028chr3125 --11422 11469
NM_053031chr3125 --11422 11469
NM_053032chr3125 --11422 11469
NM_053042chr41913 11235 ----
NM_053043chr776437 6353 5168 2425 645 437 98 24724 618 22003 1190 --
NM_053064chr1432504 2377 2297 13001 ----
NM_054035chr17----1629 --
NM_057159chr91412 11499 ----
NM_057175chr462504 2342 2084 1843 1071 200 ----1695
NM_057178chr1772212 1116 961 674 480 441 390 12600 1328 22846 900
NM_057749chr821274 1239 ------
NM_058170chr1--21183 140 11489 --
NM_058172chr41567 ------
NM_058240chr14------1176
NM_058241chr21174 1421 ----
NM_058241chr21174 1421 ----
NM_078487chr943143 1263 492 30 ------
NM_080546chr931966 1762 830 1280 ----
NM_080552chr201131 1457 ----
NM_080597chr18----1181 147
NM_080599chr1011144 --1408 --
NM_080617chr201187 ------
NM_080629chr111541 ----21393 1067
NM_080630chr111541 ----21393 1067
NM_080645chr62781 377 ------
NM_080654chr113279 74 22 ------
NM_080664chr1461895 1888 1520 490 322 128 1514 ----
NM_080671chr252144 1615 1424 844 81 11736 ----
NM_080759chr1311908 12608 ----
NM_080760chr1311908 12608 ----
NM_080764chr2253021 2390 1267 956 321 1515 12536 --
NM_080832chrX31216 533 25 ------
NM_080867chr1444694 3754 3329 1700 13778 23587 1840 11707
NM_080927chr332711 2556 645 --1746 11062
NM_130434chr151872 ------
NM_130435chr1052777 2676 921 548 503 ----12807
NM_130439chr1041971 1897 1816 91 ------
NM_130439chr1041971 1897 1816 91 ------
NM_130440chr12622 144 ------
NM_130445chr211132 ------
NM_130798chr1521535 1095 ------
NM_130838chr1531299 1284 537 ------
NM_130839chr1531299 1284 537 ------
NM_133170chr20127756 6562 6160 6069 5902 5747 3179 2490 2005 1312 934 173 12057 11698 --
NM_133171chr201164 ------
NM_133265chrX73228 2875 2755 2490 1464 939 578 11067 1499 1948
NM_133330chr421136 840 ------
NM_133331chr421136 840 ------
NM_133334chr435232 5092 717 1726 13894 --
NM_133335chr421136 840 ------
NM_133367chr633324 3153 2316 ----13294
NM_133370chr443637 3066 1075 550 23676 3650 12865 --
NM_133372chr552819 2294 980 702 354 12685 21829 305 --
NM_133378chr22307 55 ------
NM_133432chr22307 55 ------
NM_133437chr22307 55 ------
NM_133445chr943786 2673 378 189 ------
NM_133459chr1821989 701 1319 ----
NM_133468chr742514 2213 1734 693 11642 ----
NM_133478chr222200 248 1265 ----
NM_133496chr174109 4089 3904 3094 3014 868 395 --22966 703 14292
NM_133638chr51969 --11291 --
NM_133647chr1563628 3156 2531 2388 1330 234 12732 13290 --
NM_138270chrX52693 2352 1149 1125 628 --13399 13286
NM_138285chr21524 ------
NM_138286chr1933242 3227 2700 11324 ----
NM_138288chr1422035 1419 31592 1443 282 12227 11889
NM_138316chr1031353 1110 430 1450 ----
NM_138348chr586308 5952 5436 5415 4794 2372 182 83 24350 329 11555 --
NM_138357chr1041373 737 487 237 1220 ----
NM_138423chr1531852 627 440 ------
NM_138426chr722513 1576 1802 ----
NM_138459chr643636 3176 315 144 ------
NM_138468chr275156 4956 4881 4778 2022 1937 1062 23997 1636 ----
NM_138473chr12105041 4569 4323 4216 4191 1456 1288 973 728 262 ----15154
NM_138576chr1464394 3942 3929 3469 1630 670 14825 ----
NM_138621chr244075 2835 134 76 23058 2893 ----
NM_138633chr641515 533 470 99 --1237 --
NM_138694chr643187 2311 1371 186 --13357 --
NM_138713chr16116997 6703 5290 2375 2353 1945 1529 1428 1068 998 247 --37905 5097 829 --
NM_138714chr16116997 6703 5290 2375 2353 1945 1529 1428 1068 998 247 --37905 5097 829 --
NM_138717chr61644 ------
NM_138731chr1473301 2889 2606 1593 762 632 498 1801 --14107
NM_138766chr53571 517 178 ------
NM_138771chr721520 1408 ------
NM_138775chr112676 526 ----1138
NM_138782chr522065 1502 --1338 --
NM_138821chr53571 517 178 ------
NM_138822chr53571 517 178 ------
NM_138959chr176263 5407 5355 4394 2398 2182 402 ------
NM_138962chr17170 ------
NM_138970chr1422263 2174 ------
NM_138971chr1133357 2987 1211 --1351 --
NM_138971chr1133357 2987 1211 --1351 --
NM_138972chr1133357 2987 1211 --1351 --
NM_138972chr1133357 2987 1211 --1351 --
NM_138973chr1133357 2987 1211 --1351 --
NM_138973chr1133357 2987 1211 --1351 --
NM_139012chr611500 ------
NM_139015chr1261369 1237 1139 435 400 347 --1455 --
NM_139035chrX1497 ------
NM_139072chr21328 ------
NM_139126chr62772 230 --1246 --
NM_139136chr122690 320 ----1375
NM_139157chr113557 464 286 ------
NM_139164chr5--1950 31415 1332 577 --
NM_139168chr511929 11590 ----
NM_139169chr101302 12286 1368 21897 143
NM_139215chr171189 ------
NM_139244chr61744 ------
NM_139276chr1731824 1786 1466 22097 875 ----
NM_139283chr1252160 1952 1859 473 122 --12334 --
NM_139321chr2022899 2872 1340 --1683
NM_144567chr111746 1963 1772 12599
NM_144571chr486459 6353 5913 5390 4561 1538 1149 351 15559 1963 21646 1457
NM_144578chr1434918 1150 86 13850 ----
NM_144586chr2179 11138 ----
NM_144590chr1072911 2481 2360 1066 421 259 233 22778 376 ----
NM_144595chr131726 ------
NM_144599chr1554561 4313 4211 3927 3486 11581 --11886
NM_144600chr162412 112 129 1246 --
NM_144604chr162126 79 --1494 --
NM_144632chr241670 349 247 71 --11900 12365
NM_144642chr371376 1354 484 468 429 309 130 179 ----
NM_144643chr41373 ------
NM_144664chr1121917 325 11626 ----
NM_144668chr121140 ------
NM_144720chr4149 ------
NM_144723chr53859 728 713 ------
NM_144778chr1362075 882 741 504 322 301 --21842 1069 --
NM_144949chr242423 1852 786 739 12473 ----
NM_144963chr81731 22572 611 ----
NM_144997chr1731050 422 84 11074 1882 --
NM_145005chr93821 735 216 ------
NM_145013chr1132606 2266 625 1203 ----
NM_145049chr54894 730 677 389 ------
NM_145055chr1872812 2660 2602 2350 928 556 340 12556 ----
NM_145117chr1132514 898 474 --22784 2040 13302
NM_145159chr142234 91 ------
NM_145176chr683574 3194 2894 2737 2322 1140 1074 413 ------
NM_145206chr1032751 2618 2552 ------
NM_145207chr4105266 5061 4828 4345 3911 3361 1935 1912 1329 889 1913 44548 3553 1148 723 1197
NM_145244chr451183 699 312 137 119 ------
NM_145259chr256791 6333 5042 4863 571 --12580 --
NM_145280chr24328 292 88 52 ------
NM_145284chrX22471 1799 1911 --1436
NM_145307chr1054231 2919 1666 1174 227 1412 --13499
NM_145320chr753334 3178 2605 1189 1129 ------
NM_145321chr753334 3178 2605 1189 1129 ------
NM_145322chr753334 3178 2605 1189 1129 ------
NM_145331chr61191 ------
NM_145341chr101687 31710 539 473 123 --
NM_145686chr273221 2804 2740 2492 2067 1344 39 12419 ----
NM_145687chr273221 2804 2740 2492 2067 1344 39 12419 ----
NM_145716chr1----1173 --
NM_145725chr14--1477 ----
NM_145726chr14--1477 ----
NM_145756chr1831305 464 439 1410 ----
NM_145808chr722557 2266 ------
NM_145810chr261008 878 276 204 109 57 ----1500
NM_145858chr211413 ----1456
NM_145891chr1611333 --11742 --
NM_145892chr1611333 --11742 --
NM_145913chr122726 664 2816 39 ----
NM_147150chr931558 1172 436 ------
NM_147175chrX21748 1624 ------
NM_148571chr172583 318 --1474 --
NM_148894chr4----1919 --
NM_148898chr7----1399 --
NM_148899chr7----1399 --
NM_148955chr1585776 5749 5293 4235 2558 1511 802 206 24711 588 34982 1115 823 --
NM_148977chr1031353 1110 430 1450 ----
NM_148978chr1031353 1110 430 1450 ----
NM_152244chr171274 ------
NM_152261chr1242290 2134 434 280 1999 2894 425 --
NM_152263chr135585 2328 1350 35983 5753 4287 ----
NM_152265chr111292 ------
NM_152267chr222268 131 ------
NM_152271chr831136 976 93 ------
NM_152275chr22301 94 ------
NM_152280chr163000 2463 2236 1355 418 250 22994 442 ----
NM_152282chr31507 ----11166
NM_152283chr5122 --1714 --
NM_152284chr81619 --2635 609 --
NM_152288chr1611090 ------
NM_152289chr1931274 608 412 ----11609
NM_152300chr17----21478 85 1170
NM_152309chr1031996 363 50 1842 ----
NM_152330chr1442081 1917 862 792 ------
NM_152332chr1442094 1807 1124 372 --12654 --
NM_152375chr142583 1969 742 339 12266 1177 --
NM_152380chr131488 555 51 ------
NM_152399chr4155 ------
NM_152400chr41228 1103 3739 694 413 --
NM_152409chr563536 3099 2309 1374 277 270 11175 --12868
NM_152418chr831822 478 175 ------
NM_152422chr911577 31763 578 460 11462 --
NM_152424chrX73936 3857 3210 3098 3080 1174 707 13993 ----
NM_152437chr1232304 2083 1651 1914 ----
NM_152440chr1231025 450 179 127 1245 --
NM_152447chr141147 178 ----
NM_152455chr1542433 964 909 57 1641 22744 743 --
NM_152463chr173152 135 123 ----1499
NM_152470chr1883679 2815 2664 1400 1335 808 525 396 ------
NM_152475chr1942643 1840 783 44 31993 1679 133 32188 1803 160 12336
NM_152527chr22844 28 1433 11469 --
NM_152529chr233851 2961 2929 22779 1494 13746 --
NM_152549chr5----1147 --
NM_152556chr712098 12421 1190 1942
NM_152594chr1532363 944 154 --21890 1500 --
NM_152605chr1911312 ------
NM_152609chr12952 443 --1793 1305
NM_152622chr523077 74 21363 697 13383 13154
NM_152624chr5127045 6697 5932 5565 5553 5342 5302 5098 2907 2314 1917 1719 17285 1797 46578 6056 5464 4698
NM_152629chr943692 2708 2569 1592 22881 496 ----
NM_152630chrX21296 61 11229 ----
NM_152638chr1231225 979 803 ------
NM_152641chr1242891 1940 1881 262 11982 22418 459 182
NM_152660chr1------1756
NM_152665chr121238 1022 ----11149
NM_152678chr352026 694 588 507 488 21708 1054 ----
NM_152680chr432216 854 777 ----12179
NM_152699chr352897 2708 2451 1240 199 1361 21447 532 --
NM_152705chr13--1277 ----
NM_152709chr101300 ------
NM_152716chr1141619 1033 552 116 ------
NM_152745chr73885 843 426 ----11192
NM_152756chr554053 3885 3474 3352 3005 --23333 244 --
NM_152758chr8--33063 2300 1965 ----
NM_152780chrX3797 512 223 --11205 --
NM_152787chrX53783 3221 1527 1394 1258 13101 12419 --
NM_152793chr784320 4211 3787 3522 3369 1691 1424 953 21466 666 14727 14862
NM_152826chr1585776 5749 5293 4235 2558 1511 802 206 24711 588 34982 1115 823 --
NM_152835chr132444 2130 2002 22482 185 --12955
NM_152836chr821167 706 ------
NM_152837chr821167 706 ------
NM_152838chr2023535 1145 1104 12461 13088
NM_152857chr61184 ----1341
NM_152858chr61184 ----1341
NM_152888chr811008 1810 ----
NM_152890chr131127 1097 420 ------
NM_152924chr15126226 5887 5878 5857 2535 1622 894 837 301 146 74 68 21834 1424 1264 --
NM_152999chr764424 3604 3563 1957 1449 1423 --1697 --
NM_153000chr182647 181 ------
NM_153020chr6----11365 --
NM_153182chr353015 2805 1143 204 92 ------
NM_153183chrX3843 363 298 ------
NM_153207chr1243170 2903 2810 1345 --22924 51 --
NM_153256chr1021237 467 1483 41519 1293 654 364 --
NM_153261chr161204 ----11535
NM_153262chr141127 726 502 154 --12115 --
NM_153353chr3246 38 ------
NM_153362chr61905 --1237 --
NM_153371chr133660 202 70 1684 1495 --
NM_153426chr41557 ------
NM_153427chr41557 ------
NM_153464chr19------1334
NM_153490chr171256 ------
NM_153499chr1242930 2872 1196 967 1598 22832 1998 --
NM_153500chr1242930 2872 1196 967 1598 22832 1998 --
NM_153607chr522288 2089 12324 12535 --
NM_153616chr1532196 1655 863 ------
NM_153617chr1532196 1655 863 ------
NM_153618chr1532196 1655 863 ------
NM_153620chr751489 1334 1135 491 259 --11524 --
NM_153634chr1231545 367 113 1584 ----
NM_153685chr121351 ----11217
NM_153686chr411911 --22381 804 --
NM_153712chr242993 2596 1092 1067 13822 ----
NM_153748chr122690 320 ----1375
NM_153756chr131479 521 298 --11225 --
NM_153759chr231191 1178 930 ------
NM_153764chr113985 347 34 --2794 313 --
NM_153765chr113985 347 34 --2794 313 --
NM_153766chr113985 347 34 --2794 313 --
NM_153767chr113985 347 34 --2794 313 --
NM_153810chr1064900 4212 3807 1189 525 406 ------
NM_153812chr141673 1618 707 446 ------
NM_153815chr152173 75 ------
NM_153828chr21307 --1107 --
NM_170601chr11------169
NM_170606chr721214 316 --1338 --
NM_170665chr1264597 3524 3373 1060 488 120 11773 11246 --
NM_170672chr231691 1463 1342 --1682 --
NM_170674chr1511210 ----1907
NM_170675chr151886 ------
NM_170676chr151886 ------
NM_170677chr1511210 ----1907
NM_170679chr531337 209 187 ------
NM_170706chr184044 3521 3461 1642 1574 1335 562 203 14373 --23558 888
NM_170721chr1731086 450 113 ------
NM_170731chr1172626 2606 2595 2432 2197 2179 878 ------
NM_170732chr1172626 2606 2595 2432 2197 2179 878 ------
NM_170733chr1172626 2606 2595 2432 2197 2179 878 ------
NM_170734chr1172626 2606 2595 2432 2197 2179 878 ------
NM_170735chr1172626 2606 2595 2432 2197 2179 878 ------
NM_171998chrX12430 1767 1406 --
NM_172037chr851051 581 453 332 53 ------
NM_172058chr841555 1466 447 134 --170 --
NM_172059chr841555 1466 447 134 --170 --
NM_172060chr841555 1466 447 134 --170 --
NM_172069chr221974 137 ------
NM_172071chr186417 6210 5760 5708 5700 4529 2574 1335 --26998 4587 11050
NM_172103chr642369 2257 867 201 1100 --1992
NM_172105chr642369 2257 867 201 1100 --1992
NM_172127chr42499 337 ------
NM_172128chr42455 293 ------
NM_172216chr1242832 2774 1098 869 1500 22734 1900 --
NM_172226chr1242930 2872 1196 967 1598 22832 1998 --
NM_172315chr1511210 ----1907
NM_172316chr1511210 ----1907
NM_172373chr133405 285 189 ------
NM_173075chr421414 1281 --1362 --
NM_173167chr17122739 2560 2251 2114 2005 972 816 596 483 233 190 158 ----2732 117
NM_173198chr932910 639 630 32708 1202 429 ----
NM_173200chr932910 639 630 32708 1202 429 ----
NM_173214chr16116997 6703 5290 2375 2353 1945 1529 1428 1068 998 247 --37905 5097 829 --
NM_173355chr2----1270 --
NM_173359chr321605 714 157 ----
NM_173463chr463563 3385 2772 1510 1401 503 12928 ----
NM_173470chrX72947 2425 2218 1039 1022 593 198 ------
NM_173475chr1621659 434 ------
NM_173478chr173855 236 98 ------
NM_173495chrX72493 2058 653 504 286 184 36 ------
NM_173508chr121222 1157 ------
NM_173511chr273756 3606 3367 2875 2789 1593 238 13625 42587 2569 2518 1427 --
NM_173515chr6180 ------
NM_173517chr71182 ----131
NM_173536chr424316 3452 15133 14212 --
NM_173542chr121579 ------
NM_173560chr6------1230
NM_173562chr662201 913 592 537 265 81 1810 ----
NM_173642chr167995 3179 2675 2559 2173 1611 28490 2963 ----
NM_173648chr21843 --1867 --
NM_173672chr61682 1637 --11894
NM_173683chr821447 705 11774 1489 --
NM_173794chrX292 67 --1427 --
NM_173808chr121529 542 1407 --13874
NM_173809chr1061225 1038 955 557 55 28 --11380 --
NM_173826chr32542 108 1321 1385 --
NM_173830chr62235 112 ------
NM_173848chr81348 ----1261
NM_173854chr122052 955 12348 22243 251 --
NM_173872chr42835 587 ----1702
NM_174858chr11974 174 11162 --
NM_174911chr833941 1268 1252 21577 797 ----
NM_174916chr1541913 919 428 262 ------
NM_175061chr711456 --11487 --
NM_175566chr11--1381 ----
NM_175607chr32653 191 11196 ----
NM_175610chr15--1367 ----
NM_175612chr32653 191 11196 ----
NM_175629chr231191 1178 930 ------
NM_175733chr1122218 317 ------
NM_175736chr1257513 6298 5201 3077 1940 26268 5040 1442 --
NM_175767chr551774 1542 1533 1257 538 --21828 1441 --
NM_175848chr20--11372 ----
NM_175848chr20--11372 ----
NM_175849chr20--11372 ----
NM_175849chr20--11372 ----
NM_175850chr20--11372 ----
NM_175850chr20--11372 ----
NM_175854chr1342770 2442 1807 170 ------
NM_175856chr52632 204 1130 ----
NM_175863chr621016 861 ------
NM_175876chr182808 2781 2572 1999 999 619 530 341 ----2381 96
NM_175907chr1862604 2129 403 259 139 55 12535 12472 --
NM_176081chr10115695 5208 4933 4525 4360 3970 3745 2380 1513 950 161 13994 44492 4132 3807 1797 --
NM_176083chr10115695 5208 4933 4525 4360 3970 3745 2380 1513 950 161 13994 44492 4132 3807 1797 --
NM_176814chr71287 11277 1596 --
NM_176863chr1742163 2084 1537 752 ------
NM_177401chr1941399 528 341 125 --11788 --
NM_177424chr151917 1392 572 144 59 12097 1325 --
NM_177438chr1473559 1594 1504 1323 1104 691 641 ------
NM_177559chr2021058 937 ------
NM_177560chr2021058 937 ------
NM_177947chrX11477 ------
NM_177948chrX11477 ------
NM_177966chr311903 11711 1352 --
NM_177968chr211660 12174 ----
NM_177974chr1531852 627 440 ------
NM_177989chr3147 ------
NM_177990chr2031400 716 668 1171 ----
NM_177995chr911577 31763 578 460 11462 --
NM_178011chr1033089 737 406 --22867 2365 1330
NM_178013chr1443002 2685 2634 2534 --11079 --
NM_178042chr3147 ------
NM_178120chr221386 382 ------
NM_178123chr211007 --1110 --
NM_178126chr1752241 1981 787 630 458 1654 ----
NM_178135chr421090 52 11114 2923 446 --
NM_178140chr552547 2134 2120 1934 1827 ------
NM_178151chrX127019 5865 5574 5538 5114 5031 4932 2500 2187 1395 922 338 --12176 --
NM_178152chrX127019 5865 5574 5538 5114 5031 4932 2500 2187 1395 922 338 --12176 --
NM_178153chrX127019 5865 5574 5538 5114 5031 4932 2500 2187 1395 922 338 --12176 --
NM_178154chr141746 ------
NM_178155chr141746 ------
NM_178156chr141746 ------
NM_178157chr141746 ------
NM_178423chr711283 1888 --1447
NM_178424chr51187 ------
NM_178425chr711283 1888 --1447
NM_178426chr121753 1618 ------
NM_178427chr121653 1518 ------
NM_178454chr11676 --1662 --
NM_178496chr34948 524 317 129 ------
NM_178498chr1133802 3197 299 --13894 13755
NM_178509chr1762803 1394 1216 941 685 328 ------
NM_178517chr171168 --1115 --
NM_178812chr831554 1131 226 --1648 --
NM_178835chr4----127 --
NM_178864chr112248 215 ------
NM_181077chr152690 176 --11947 --
NM_181332chrX22165 99 ----11837
NM_181351chr1122614 2441 --1408 --
NM_181358chr164031 2860 2602 820 194 169 13806 23104 570 --
NM_181359chr131746 1007 667 31770 1688 410 ----
NM_181457chr221251 135 144 ----
NM_181458chr221384 268 1177 ----
NM_181459chr221150 34 ------
NM_181460chr221197 81 ------
NM_181521chr1666898 5068 1523 1044 713 249 ----12558
NM_181532chrX--1240 ----
NM_181537chr17159 1166 ----
NM_181659chr2023227 2528 ----13302
NM_181659chr2023227 2528 ----13302
NM_181671chr171683 ------
NM_181672chrX51376 528 486 405 347 ----11588
NM_181673chrX51376 528 486 405 347 ----11588
NM_181701chr981977 1809 1672 1649 711 328 255 116 ------
NM_181706chr111365 22038 840 21809 650 --
NM_181712chr121606 642 11665 --11369
NM_181762chrX1389 ------
NM_181777chrX1389 ------
NM_181782chr622073 1969 21585 675 22020 422 1915
NM_181783chr1211847 11500 ----
NM_181784chr251971 1607 956 630 304 ------
NM_181828chr2253222 2387 2376 1362 289 13045 --13187
NM_181829chr2253222 2387 2376 1362 289 13045 --13187
NM_181830chr2253222 2387 2376 1362 289 13045 --13187
NM_181832chr2253237 2402 2391 1377 304 13060 --13202
NM_181836chr532526 2017 1020 --2915 643 --
NM_181838chr531402 1311 482 ------
NM_181861chr1241064 764 600 548 32517 2387 788 ----
NM_181868chr1241064 764 600 548 32517 2387 788 ----
NM_181869chr1241149 849 685 633 32602 2472 873 ----
NM_182314chrX1644 --11690 11283
NM_182398chr14171 ------
NM_182485chr433394 3380 916 ------
NM_182492chr221263 ------
NM_182493chr1635326 1746 658 34988 1394 645 14798 13288
NM_182515chr1956646 6295 5053 4109 287 56161 5246 4821 1931 121 14084 11810
NM_182522chr331179 887 284 ------
NM_182641chr1721559 1507 --1370 --
NM_182646chr433394 3380 916 ------
NM_182648chr141728 ------
NM_182697chr711431 ------
NM_182700chr71734 --1719 --
NM_182715chr711004 ------
NM_182729chr1221620 588 ----1263
NM_182742chr1221620 588 ----1263
NM_182743chr1221620 588 ----1263
NM_182763chr132635 2594 1882 --22016 212 --
NM_182764chr201164 ------
NM_182765chr1011640 186 ----
NM_182767chr1231741 1554 313 1776 ----
NM_182830chr14159 1375 22230 2182 --
NM_182898chr744882 1820 1536 297 45190 4190 2018 1557 22045 1358 --
NM_182899chr744882 1820 1536 297 45190 4190 2018 1557 22045 1358 --
NM_182918chr21--1306 1176 1277
NM_182920chr311161 --1549 --
NM_182936chr14------1176
NM_182948chr142884 728 520 335 --12353 12698
NM_182964chr1132514 898 474 --22784 2040 13302
NM_183002chr14------1176
NM_183004chr1433673 2526 1115 11067 23119 2966 --
NM_183043chr13----1359 --
NM_183044chr13----1359 --
NM_183047chr201653 --1774 --
NM_183048chr201653 --1774 --
NM_183065chr1731049 889 859 ------
NM_183078chr652855 2729 1219 997 627 11021 1443 --
NM_183079chr2041448 1054 1014 92 ------
NM_183238chr1233301 3069 2620 12870 --1431
NM_183353chrX21075 410 ------
NM_183393chr31381 1748 ----
NM_183394chr31381 1748 ----
NM_183398chr5------11362
NM_183399chr5------11362
NM_183400chr5------11362
NM_183401chr5------11362
NM_183416chr121578 198 ----1159
NM_183419chr821324 106 1301 181 --
NM_183422chr132903 732 ------
NM_184234chr203860 561 330 1594 ----
NM_194247chr254401 3720 3024 1557 446 --23771 1492 --
NM_194250chr21177 ------
NM_194271chr121502 ------
NM_194278chr1463761 3354 2917 1505 1012 789 --12632 --
NM_194281chr18168 137 ----
NM_194282chr432994 2955 1136 22876 1160 1967 --
NM_194285chr1122163 422 ----11247
NM_194286chr1296157 5256 5243 4678 4463 4407 4210 1929 835 --24586 4217 11439
NM_194292chr1------197
NM_194301chr141191 --1343 --
NM_194314chr154361 3888 3510 1858 104 24883 1730 1339 25417 127
NM_194328chr943064 1278 964 170 --11075 --
NM_194329chr943064 1278 964 170 --11075 --
NM_194330chr943064 1278 964 170 --11075 --
NM_194332chr943064 1278 964 170 --11075 --
NM_194434chr1864177 3677 3606 2074 1987 322 25611 5112 21735 1003 --
NM_194442chr111486 11139 11235 1283
NM_194454chr721217 404 ------
NM_194455chr721217 404 ------
NM_194456chr721217 404 ------
NM_194463chrX2215 65 ------
NM_197941chr522122 1992 ----12441
NM_198040chr12973 776 ------
NM_198066chr1462796 2774 2599 2334 2154 1057 22623 415 ----
NM_198086chr1441993 1968 1602 352 --1517 --
NM_198123chr821412 651 --11195 --
NM_198124chr821412 651 --11195 --
NM_198128chr1852032 2022 1782 690 227 --12327 --
NM_198151chr7--1470 1624 --
NM_198181chr1532073 2051 700 22722 2470 ----
NM_198212chr72945 571 11514 ----
NM_198217chr13--1896 21132 254 --
NM_198218chr13--1896 21132 254 --
NM_198219chr13--1896 21132 254 --
NM_198240chr1221361 164 ------
NM_198261chr121526 ------
NM_198262chr121526 ------
NM_198268chr164031 2860 2602 820 194 169 13806 23104 570 --
NM_198269chr164031 2860 2602 820 194 169 13806 23104 570 --
NM_198270chrX53404 2675 2269 212 188 12853 13438 190
NM_198273chr533176 2250 134 2669 213 22523 919 --
NM_198279chrX3496 291 217 ----1235
NM_198324chr1241133 994 932 70 ------
NM_198336chr731617 603 104 ------
NM_198390chr162602 126 ----11614
NM_198391chr2021399 1309 ----1170
NM_198395chr53826 365 192 ----1966
NM_198400chr152207 103 12581 ----
NM_198401chr821486 67 ------
NM_198404chr131596 ----1891
NM_198465chrX32953 2763 1864 ------
NM_198503chr132227 2125 459 ------
NM_198504chr3149 ------
NM_198513chr821287 372 ------
NM_198549chr142122 2069 2031 1331 23332 1070 ----
NM_198581chr2107511 6603 6451 5767 5492 5440 5385 5031 4863 2633 25683 2758 25659 5165 32466 2146 358
NM_198794chr1431440 371 265 11202 ----
NM_198834chr1752234 2044 700 303 138 ------
NM_198836chr1752234 2044 700 303 138 ------
NM_198837chr1752234 2044 700 303 138 ------
NM_198838chr1752234 2044 700 303 138 ------
NM_198839chr1752234 2044 700 303 138 ------
NM_198859chr313906 --14234 --
NM_198892chr4--139 ----
NM_198900chr1257513 6298 5201 3077 1940 26268 5040 1442 --
NM_198903chr5--1212 145 --
NM_198904chr5--1212 145 11936
NM_198935chr2042881 2355 548 392 ------
NM_198956chr71734 --1719 --
NM_198990chr743090 2523 1048 990 22141 776 32842 2453 1256 --
NM_199003chr811139 1538 1356 --
NM_199040chr1232825 1013 901 23710 1451 139 13276
NM_199053chr43208 201 85 ----1789
NM_199072chr762947 2921 2026 1075 765 415 --13225 12635
NM_199144chr203462 370 57 ----1535
NM_199160chr922071 1440 ------
NM_199169chr2043206 2908 2499 279 ------
NM_199170chr2043206 2908 2499 279 ------
NM_199171chr2043206 2908 2499 279 ------
NM_199189chr5------1335
NM_199203chr203462 370 57 ----1535
NM_199229chr221168 406 1300 ----
NM_199320chr4----12376 --
NM_199320chr4----12376 --
NM_199324chr433218 1166 630 23683 3370 ----
NM_199355chr161615 ----11382
NM_199421chr1444694 3754 3329 1700 13778 23587 1840 11707
NM_199436chr22749 572 33034 2031 445 1116 --
NM_199440chr21148 ------
NM_199454chr133980 1675 1057 --2762 194 --
NM_199461chr1033302 362 216 22871 348 ----
NM_199462chr194838 4564 3378 3365 1760 1544 1131 638 238 24904 970 ----
NM_199478chrX51625 1497 473 160 143 ------
NM_199482chr251989 1758 1517 445 349 --11592 --
NM_199483chr202283 217 ------
NM_199487chr201149 ------
NM_201267chr2190 ------
NM_201434chr17------1214
NM_201437chr811471 1213 21004 168 --
NM_201548chr21142 --1104 --
NM_201570chr1051520 1279 490 76 43 11709 --1653
NM_201571chr1051520 1279 490 76 43 11709 --1653
NM_201572chr1051520 1279 490 76 43 11709 --1653
NM_201590chr1051520 1279 490 76 43 11709 --1653
NM_201593chr1051520 1279 490 76 43 11709 --1653
NM_201596chr1051520 1279 490 76 43 11709 --1653
NM_201597chr1051520 1279 490 76 43 11709 --1653
NM_201624chr141126 414 248 217 ----1438
NM_201999chr431138 784 163 11078 ----
NM_203301chr1431256 1229 1076 ------
NM_203327chr2084122 4065 3161 3060 2870 2863 1319 178 --13580 --
NM_203342chr121325 140 --23627 444 --
NM_203343chr121325 140 --23627 444 --
NM_203349chr1541932 1624 618 176 12159 ----
NM_203350chr1173 11422 --1674
NM_203364chr1111053 ------
NM_203437chr23691 365 22 ------
NM_203446chr2111111 12483 12117 --
NM_203458chr143440 3376 3124 980 ----11278
NM_203459chr132472 929 881 ------
NM_203463chr264506 1978 1898 1308 1298 246 --3921 511 443 --
NM_203464chr141072 884 865 352 1234 ----
NM_203487chr13----1324 --
NM_203504chr492591 2567 2253 1917 1874 1616 1606 923 23 ------
NM_203505chr492591 2567 2253 1917 1874 1616 1606 923 23 ------
NM_205768chr141793 773 611 87 1418 11937 1814
NM_205836chr51604 ------
NM_205860chr152839 913 894 698 617 --22176 2009 --
NM_206594chr142998 850 554 181 13162 13340 13010
NM_206595chr142998 850 554 181 13162 13340 13010
NM_206839chr151531 ------
NM_206853chr621591 1279 1367 163 13545
NM_206854chr633409 1194 348 21628 1281 11324 14806
NM_206855chr644374 4003 2159 1313 12246 22289 532 25771 4051
NM_206860chr10--1439 ----
NM_206861chr10--1439 ----
NM_206862chr10--1439 ----
NM_206866chr2143177 2750 725 534 12455 23194 1204 --
NM_206907chr542243 687 557 247 1711 --1928
NM_206909chr897567 7012 5969 5866 5457 1878 1530 1188 150 17211 26975 5076 15783
NM_206927chr111343 1687 ----
NM_206928chr111343 1687 ----
NM_206929chr111343 1687 ----
NM_206930chr111343 1687 ----
NM_207012chr1063551 3391 3348 3268 992 340 ------
NM_207015chr33939 528 389 1756 11509 --
NM_207043chr132255 2183 1945 ----1849
NM_207044chr132255 2183 1945 ----1849
NM_207047chr132255 2183 1945 ----1849
NM_207299chr9----1871 --
NM_207304chr1361962 769 628 391 209 188 --21729 956 --
NM_207336chr7139 --1332 --
NM_207337chr123886 782 153 1122 ----
NM_207352chr442168 870 703 224 22678 419 ----
NM_207371chr1041410 1116 1061 489 ------
NM_207396chr131216 284 116 1308 11762 --
NM_207406chr4116574 6219 5715 5365 4377 4181 2465 2301 1855 1783 751 14192 ----
NM_207520chr21307 --1107 --
NM_207521chr21307 --1107 --
NM_207647chr932362 2216 1950 ----12498
NM_212464chr15----21617 1445 --
NM_212467chr15----32194 2022 159 --
NM_212471chr1712101 12274 11870 --
NM_212472chr1712101 12274 11870 --
NM_212558chr984217 4002 2752 1634 1141 869 621 589 11495 11382 --
NM_213594chr1231308 1194 371 ------
NM_213611chr12--1340 1146 --
NM_213618chr113557 464 286 ------
NM_213662chr1731918 1880 1560 22191 969 ----