TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3674
miRNA Sequence: AUUGUAGAACCUAAGAUUGGCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000024chr51528 ------
NM_000038chr551294 621 607 248 44 1319 ----
NM_000051chr1133510 2641 2340 22312 2252 --12828
NM_000052chrX63483 3416 2575 2444 1079 270 --1258 13438
NM_000084chrX74751 4544 4242 1797 544 362 133 11542 --26736 733
NM_000091chr252211 1823 1782 1018 315 22711 1105 12773 11950
NM_000092chr2104341 4269 4105 3841 3693 3418 3346 3315 2960 708 1316 24308 384 13501
NM_000108chr751867 1703 343 175 168 --1582 1467
NM_000109chrX62209 1786 740 683 265 179 --4898 692 165 97 --
NM_000112chr584934 4525 3896 3804 3708 3597 1407 369 24293 1233 ----
NM_000115chr1342162 1974 753 242 --2864 646 --
NM_000129chr631498 1366 1288 11127 ----
NM_000138chr151489 22611 1942 ----
NM_000141chr10--11412 1436 11476
NM_000142chr431286 1269 1116 --11311 1613
NM_000163chr562229 1643 1579 763 641 479 ----1704
NM_000166chrX1634 ------
NM_000167chrX3476 383 42 21517 1315 --21782 1704
NM_000168chr733353 448 23 ------
NM_000176chr523906 3605 --1467 --
NM_000183chr2------1384
NM_000189chr221940 144 1760 2557 316 1747
NM_000202chrX31405 1041 645 --11127 11260
NM_000210chr232372 1478 318 ----21758 855
NM_000212chr17172 ------
NM_000216chrX43807 1249 298 215 11080 12803 2639 625
NM_000217chr1254108 3441 1197 718 552 13975 ----
NM_000232chr492425 2363 2174 916 749 688 507 139 74 23160 2008 13233 --
NM_000237chr861783 1701 1331 1228 473 347 21468 638 --177
NM_000245chr742066 1857 637 592 11724 ----
NM_000248chr342623 2449 2414 2079 2536 197 21019 190 --
NM_000252chrX2173 162 --11199 11035
NM_000259chr1596045 5337 4402 1853 1716 1555 681 410 245 25305 758 34076 1460 710 11756
NM_000264chr942485 2126 831 685 23193 2596 12337 1174
NM_000267chr1722927 2737 2401 255 13328 22487 1342
NM_000276chrX72216 2070 1818 817 579 369 265 --11488 --
NM_000304chr173847 289 206 --1755 --
NM_000314chr1052162 1207 1045 602 577 --21117 741 --
NM_000321chr1331554 1177 553 --11772 1510
NM_000328chrX----2387 136 1397
NM_000332chr686256 6065 5882 4974 2201 2079 1273 89 15565 22554 624 --
NM_000337chr566536 6222 5815 4189 1631 727 26395 2202 11718 --
NM_000346chr1711582 1617 12007 --
NM_000351chrX74084 3680 1539 1020 785 421 98 23075 56 1415 34027 3303 2921
NM_000362chr2253536 2592 1050 608 574 --12388 --
NM_000368chr944156 3891 506 492 23931 476 --11015
NM_000390chrX43280 3020 1186 630 12658 --21151 750
NM_000393chr262033 859 804 698 553 183 --21922 1720 11523
NM_000408chr223481 2878 --13461 23361 3323
NM_000428chr1432544 2389 2338 12484 11056 1837
NM_000430chr1773759 3704 3395 1371 1025 497 195 13809 12444 --
NM_000439chr542301 1599 753 229 11581 --1375
NM_000461chr374572 4419 4199 3734 836 817 32 14402 13830 --
NM_000462chr1521399 1256 ------
NM_000484chr215833 787 372 220 206 1901 ----
NM_000486chr1253236 2742 2655 553 21 13088 ----
NM_000489chrX33221 2844 387 11294 13365 11281
NM_000495chrX--11016 ----
NM_000522chr731018 1011 796 1378 1174 1497
NM_000533chrX41575 422 264 57 11971 11231 11658
NM_000536chr112638 553 ------
NM_000555chrX76281 6072 4982 2646 1733 1705 361 26288 2783 56507 6183 5857 3125 1290 --
NM_000596chr72563 184 --2550 535 --
NM_000601chr7290 48 ------
NM_000615chr1151866 1205 910 881 679 --1729 1866
NM_000617chr1222263 24 1385 11828 --
NM_000618chr12136193 5368 4577 2296 2279 2272 2158 1615 484 458 435 246 57 34154 1785 669 --21432 1288
NM_000618chr12136193 5368 4577 2296 2279 2272 2158 1615 484 458 435 246 57 34154 1785 669 --21432 1288
NM_000621chr1311351 2404 170 --11296
NM_000633chr1855175 5130 4640 3908 235 11611 15092 --
NM_000663chr1632927 2909 2782 ------
NM_000681chr1071384 1272 1264 1258 341 167 133 ------
NM_000686chrX1626 1509 3560 403 222 11132
NM_000701chr1145 ----1307
NM_000719chr12104904 4883 4776 4671 4395 4347 2689 1769 336 192 ----1822
NM_000724chr1051828 1669 1336 93 87 ----1584
NM_000726chr251479 1389 528 293 225 ----11183
NM_000739chr72704 681 1114 1302 --
NM_000782chr2041046 307 285 102 1221 183 --
NM_000793chr1494234 3873 3640 3581 1129 1088 451 377 284 ----11980
NM_000800chr5--41668 1634 1278 435 ----
NM_000807chr44710 630 555 544 ------
NM_000809chr4168150 8137 7990 7634 7503 7376 6793 6751 6301 6224 6155 6089 5831 2874 2796 2307 27272 5671 46775 5652 1022 785 29187 2254
NM_000812chr41395 ----1257
NM_000813chr583628 3418 3408 1571 1093 1078 834 227 14533 ----
NM_000814chr1543233 1552 1259 859 23145 2557 23329 601 13059
NM_000826chr452424 2201 891 440 398 12637 22492 2395 --
NM_000855chr111260 ------
NM_000857chr41435 ------
NM_000866chr371603 1561 1525 1432 322 314 130 --11904 --
NM_000868chrX92601 1919 969 748 610 477 456 182 120 1669 1148 22373 2142
NM_000875chr1556964 6377 4634 1247 155 1472 25819 5636 1538
NM_000876chr62994 184 --189 --
NM_000891chr1733341 2727 1307 --136 --
NM_000899chr1274071 4027 3456 3350 3122 1673 1137 --21478 424 1216
NM_000901chr452560 2262 996 931 567 12180 --1677
NM_000902chr362421 2060 1062 1046 668 465 ----22330 853
NM_000908chr52643 532 --1723 --
NM_000921chr121156 ------
NM_000933chr2061187 1175 1090 688 656 484 2273 199 1427 --
NM_000944chr44899 418 293 149 1528 --12384
NM_000945chr242033 1614 357 311 11834 --21406 1328
NM_000950chrX63569 3287 3184 2721 2663 904 11467 ----
NM_000956chr141946 41137 1124 197 151 ----
NM_000961chr2042922 2860 1092 867 43678 2603 1582 216 ----
NM_000965chr32817 363 ------
NM_000966chr1221035 862 1720 ----
NM_000983chr121046 83 21098 484 1656 11418
NM_001001132chr2121055 1036 1240 --11086
NM_001001323chr1283069 2576 2539 2138 2029 1242 894 215 22949 144 1740 --
NM_001001331chr332239 2222 626 2872 425 --1808
NM_001001344chrX52478 819 551 513 372 1104 --1589
NM_001001395chr1252812 2464 2309 2199 1051 12349 ----
NM_001001396chr174270 4169 4043 3691 641 453 33 24360 4353 13209 22721 263
NM_001001419chr594712 4172 1142 1085 1050 965 600 161 120 1510 --11412
NM_001001420chr594712 4172 1142 1085 1050 965 600 161 120 1510 --11412
NM_001001433chr2063217 2972 1232 951 488 310 ----12193
NM_001001481chr853048 2238 1360 1300 1019 23458 2660 --12505
NM_001001483chr111161 ----1387
NM_001001521chr2147 ------
NM_001001556chr151347 ----11526
NM_001001557chr822167 497 32054 1719 1605 12121 --
NM_001001664chr222712 1273 33606 3545 3006 1666 33953 3642 486
NM_001001668chr1951332 1140 1114 805 99 1321 24208 2602 1678
NM_001001701chr452358 1685 670 260 138 21545 63 ----
NM_001001791chr1021550 580 ----1167
NM_001001890chr2184288 3563 3345 3183 1571 1291 962 715 ------
NM_001001924chr841606 1530 675 52 ----1847
NM_001001925chr841606 1530 675 52 ----1847
NM_001001931chr841606 1530 675 52 ----1847
NM_001001933chr12159 147 --1205 --
NM_001001974chr1051677 1578 785 406 376 ------
NM_001001995chrX51828 624 435 67 35 ------
NM_001002233chr842196 2131 1420 172 --22100 1370 --
NM_001002243chr22694 169 1306 ----
NM_001002257chr293111 2999 2718 2616 2547 1393 925 767 166 12863 33066 2283 893 --
NM_001002258chr261904 1377 1303 714 307 238 ----1378
NM_001002275chr1------1462
NM_001002811chr141308 626 431 358 ------
NM_001002812chr141308 626 431 358 ------
NM_001002812chr141308 626 431 358 ------
NM_001002814chr863916 3431 3219 2695 1420 172 13053 11370 --
NM_001002838chrX71562 1401 1366 1269 724 662 388 ------
NM_001002860chr1444085 3461 3007 1686 --24455 4340 31622 942 279
NM_001002909chr1762188 1515 894 880 578 276 ----1820
NM_001002914chr17----11270 --
NM_001002926chr742770 803 271 42 --32376 481 288 1105
NM_001003407chr1055098 4677 3346 1850 1727 --34062 1455 1078 --
NM_001003408chr1055098 4677 3346 1850 1727 --34062 1455 1078 --
NM_001003652chr18107947 6765 6740 6203 5626 2116 1819 1620 1448 1266 --46163 2616 2151 1065 21168 1038
NM_001003679chr162158 2073 1432 402 78 57 123 --12245
NM_001003688chr43972 847 212 ------
NM_001003712chr1273672 3483 3344 2833 620 329 251 --14057 11076
NM_001003760chr643242 2474 984 349 13375 --13075
NM_001003792chr32952 824 1267 --2975 912
NM_001003793chr32952 824 1267 --2975 912
NM_001003800chr923575 3210 33709 2510 540 12657 --
NM_001003805chr14183 ------
NM_001004019chr3191 1416 ----
NM_001004065chr962650 1580 752 660 292 138 33272 1518 1231 1263 --
NM_001004106chr5161 ------
NM_001004317chr633992 3630 3328 11148 34312 1739 1487 --
NM_001004330chr1221508 178 ----11745
NM_001004346chr431262 462 98 182 1335 --
NM_001004419chr1284481 4437 4398 3884 3265 3066 1837 1133 13021 14258 --
NM_001004441chr511239 1490 21608 644 1516
NM_001004720chr231016 962 867 ----1891
NM_001004722chr231185 1131 1036 1106 --11060
NM_001005266chr151610 ------
NM_001005267chr151610 ------
NM_001005268chr151610 ------
NM_001005269chr151610 ------
NM_001005367chr19----1350 --
NM_001005386chr252394 2288 816 660 391 ------
NM_001005404chr1793780 3632 3626 3392 3364 2777 1701 1089 1043 --24391 1445 14324
NM_001005463chr1032609 2547 1751 22219 130 2753 449 12392
NM_001005473chr5176558 6322 5896 5501 5098 4209 4060 2337 1612 1177 1098 777 549 497 357 349 162 35553 655 184 35443 1439 1411 --
NM_001005502chr12115132 4889 4675 4506 4465 3492 1669 909 386 240 68 1313 12010 --
NM_001005609chrX53662 1191 749 569 224 12390 ----
NM_001005746chr251479 1389 528 293 225 ----11183
NM_001005747chr251479 1389 528 293 225 ----11183
NM_001005845chr831782 1340 1216 11444 21664 593 11264
NM_001006600chr522241 1866 1250 --1573
NM_001006618chr9----1249 --
NM_001006626chr72704 681 1114 1302 --
NM_001006627chr72704 681 1114 1302 --
NM_001006628chr72704 681 1114 1302 --
NM_001006629chr72704 681 1114 1302 --
NM_001006630chr72704 681 1114 1302 --
NM_001006631chr72704 681 1114 1302 --
NM_001006632chr72704 681 1114 1302 --
NM_001006684chrX----1486 --
NM_001006945chr12197 184 --1577 --
NM_001007023chr1494234 3873 3640 3581 1129 1088 451 377 284 ----11980
NM_001007024chr1772711 2683 1115 706 574 529 370 ----14107
NM_001007025chr1772711 2683 1115 706 574 529 370 ----14107
NM_001007067chr82384 207 ------
NM_001007068chr82384 207 ------
NM_001007069chr82384 207 ------
NM_001007070chr82384 207 ------
NM_001007075chr451132 1030 770 352 21 ------
NM_001007097chr994962 4037 1682 1534 1514 1205 1058 491 460 24370 400 1537 11977
NM_001007099chr11786 2333 224 ----
NM_001007100chr11786 2333 224 ----
NM_001007214chr121172 108 1195 ----
NM_001007246chr2151977 1612 1405 177 123 2113 94 ----
NM_001007248chr19124 1330 ----
NM_001007257chr111175 21480 1273 11306 --
NM_001007466chr654565 858 784 676 585 21725 1216 --23737 519
NM_001007527chr52647 90 ------
NM_001007793chr101117 152 ----
NM_001008226chr1521783 455 ------
NM_001008239chr1873691 2694 1486 1268 1100 881 26 ------
NM_001008392chr3113393 2466 2448 2442 2436 2430 2424 889 492 442 391 11093 23139 709 --
NM_001008393chr452385 1824 650 469 34 22293 2024 1444 12707
NM_001008401chr1941461 449 186 104 1581 --11484
NM_001008408chr753991 2549 2246 1283 279 12443 15262 --
NM_001008491chr232026 559 552 21603 779 ----
NM_001008492chr232026 559 552 21603 779 ----
NM_001008495chr831917 589 240 --11621 --
NM_001008564chr1362059 1857 829 820 664 322 12096 --1623
NM_001008567chr9------1118
NM_001008660chr1151531 1282 1010 568 129 --11302 --
NM_001008707chr141247 1102 11403 --
NM_001008726chr1431534 427 360 ----1510
NM_001008738chr572792 2600 1939 1879 1004 824 134 --32523 2393 665 2426 283
NM_001008777chr173639 571 529 1501 ----
NM_001008801chr1982143 1598 1536 857 813 691 440 85 2525 170 --22164 2080
NM_001008860chr152741 242 1541 ----
NM_001008892chr152741 242 1541 ----
NM_001008894chr152741 242 1541 ----
NM_001008897chr61531 ------
NM_001008925chr473515 2968 2670 2161 370 323 135 --32768 782 63 --
NM_001009554chr434377 1156 393 --31819 1536 594 14018
NM_001009554chr434377 1156 393 --31819 1536 594 14018
NM_001009555chr451380 1158 1140 399 179 ----11396
NM_001009569chr104659 321 182 127 1553 11316 1429
NM_001009814chr13------167
NM_001009880chr2274511 4205 3594 3502 1607 1459 264 13410 34700 4424 1068 14057
NM_001009881chr13529 473 199 ------
NM_001009882chr13529 473 199 ------
NM_001009894chr1261709 1609 1562 679 392 256 ------
NM_001009899chr396351 5519 5074 4824 4179 1466 1404 959 238 22481 43 12026 16397
NM_001009909chr11113977 3685 3593 3253 3146 2456 1524 1102 962 673 393 ------
NM_001009959chr231753 1709 560 1303 --1546
NM_001009960chr72340 225 31011 245 219 22532 2249 --
NM_001009993chr244390 4317 3751 2831 --1394 --
NM_001009996chr3--1100 ----
NM_001010000chr1883340 2789 2525 2385 1295 894 568 101 52861 2692 974 462 364 12781 --
NM_001010853chr663121 2536 2031 1097 995 584 --23283 2574 --
NM_001010861chr172575 2256 2077 1014 549 343 218 ----11003
NM_001010862chrX63257 3004 2333 2048 765 337 12975 13207 --
NM_001010867chr1136203 6057 5276 5214 5006 4942 2119 2057 1910 1522 1228 544 422 ----11066
NM_001010876chr6174 ------
NM_001010888chrX114595 4514 4169 4033 3184 1301 1073 1057 898 738 488 23350 745 23091 102 23696 3102
NM_001010895chr931986 1923 829 1197 12031 --
NM_001010897chr13------1380
NM_001010922chr193537 2877 1664 1418 1345 1316 1237 622 560 --13912 --
NM_001010932chr7290 48 ------
NM_001010986chrX82486 2439 2433 2401 2140 1704 1589 774 129 ----
NM_001011513chr453909 3397 2977 2671 1639 --23718 3490 23388 375
NM_001011515chr42817 119 ------
NM_001011516chr42817 119 ------
NM_001011537chr312296 ------
NM_001011546chr20------1138
NM_001011553chr73931 772 319 ------
NM_001011663chr103866 795 46 11020 ----
NM_001011666chr796582 6520 5895 5648 5290 4909 4820 1038 992 1516 25757 4766 11912
NM_001011708chr252245 2153 554 394 376 --22859 1919 1360
NM_001011713chr1431290 539 290 ------
NM_001011722chr1------1392
NM_001011722chr1------1392
NM_001012267chr911546 --21940 1469 --
NM_001012393chr1184724 3663 3567 3464 3337 636 566 61 11670 11438 --
NM_001012398chr16----1946 --
NM_001012614chr4--1283 ----
NM_001012755chrX54911 4705 3957 1259 59 12047 24176 3692 24506 114
NM_001012761chr532337 2087 891 1854 140 --
NM_001012977chrX--11086 160 --
NM_001013399chr641142 865 853 396 1230 ----
NM_001013406chr741522 1360 1287 245 ----21685 205
NM_001013437chr183413 172 128 ------
NM_001013438chr36708 672 252 188 177 73 --1200 --
NM_001013439chr34554 98 34 23 --146 --
NM_001013620chr12118327 7206 6503 6201 5694 3183 2811 2422 2384 2318 795 37772 6569 5426 46025 1850 922 624 56233 2392 1119 470 57
NM_001013629chr1042139 1788 1320 587 12035 12123 11720
NM_001013642chr14879 851 390 286 ------
NM_001013699chr122567 154 ------
NM_001014286chr131102 ----1347
NM_001014434chr12176 153 1580 182 1214
NM_001014449chr161198 ------
NM_001014451chr161198 ------
NM_001014796chr12191 48 ------
NM_001014796chr12191 48 ------
NM_001014797chr1097781 7296 6819 6696 2827 2122 2013 1257 693 15336 21183 834 22991 1912
NM_001015045chr472378 1788 1772 1720 1002 703 429 42039 2019 482 101 --1337
NM_001015048chr1483101 2812 2751 2692 2651 2502 595 577 --1991 12854
NM_001015049chr1483101 2812 2751 2692 2651 2502 595 577 --1991 12854
NM_001015877chrX32609 2378 2197 --1390 1997
NM_001015887chr341754 1525 1232 538 11603 --11307
NM_001017395chr352923 1328 1269 657 122 --22717 92 --
NM_001017420chr831367 1247 279 ----11004
NM_001017923chr1421138 450 --1295 11374
NM_001017926chr831519 1393 442 --1196 --
NM_001017977chr12345 72 ------
NM_001017992chr521129 321 ------
NM_001018009chr311178 ------
NM_001018025chrX2675 167 1792 --2339 22
NM_001018038chr91175 ----163
NM_001018054chr12352 89 1180 --1534
NM_001018065chr995982 5087 4619 4556 4205 2152 1707 1648 1284 ----34938 387 99
NM_001018066chr995982 5087 4619 4556 4205 2152 1707 1648 1284 ----34938 387 99
NM_001018074chr523906 3605 --1467 --
NM_001018075chr523906 3605 --1467 --
NM_001018076chr523906 3605 --1467 --
NM_001018077chr523906 3605 --1467 --
NM_001018111chr733854 3591 302 23990 3803 --12505
NM_001020658chr121370 314 ------
NM_001020658chr121370 314 ------
NM_001024094chr523906 3605 --1467 --
NM_001024372chr852016 2002 1952 484 416 3564 343 27 11689 --
NM_001024649chr542660 2139 1826 50 ------
NM_001024666chrX------1603
NM_001024847chr362461 1817 1589 352 344 334 --1252 --
NM_001024934chr61184 127 ----
NM_001024935chr61184 127 ----
NM_001024936chr61184 127 ----
NM_001024947chr52982 108 1713 --11061
NM_001024948chr153504 2473 2268 2214 453 32993 1181 280 1700 --
NM_001024956chr1155467 5181 5171 4934 3998 25885 881 34618 4127 1081 22340 998
NM_001025076chr1074879 4188 4009 2475 2390 2187 525 11226 25385 4535 12143
NM_001025077chr1066237 5546 5367 1883 1106 720 24626 2584 46743 5893 4786 134 --
NM_001025079chr344020 3816 2679 1336 --23895 930 13632
NM_001025108chr284119 3959 3598 3400 1325 1297 1249 839 ------
NM_001025201chr2134 ----1499
NM_001025205chr31156 1452 ----
NM_001025252chr852598 1243 268 116 42 32377 501 287 23193 361 2762 316
NM_001025253chr852598 1243 268 116 42 32377 501 287 23193 361 2762 316
NM_001025266chr3104728 4279 3445 3264 3122 3110 3025 1849 1570 168 34870 1180 1039 24215 1656 --
NM_001025579chr1711003 11164 ----
NM_001025580chrX52956 1262 960 814 37 33491 1611 1240 24194 1375 --
NM_001025595chr421630 372 --1200 --
NM_001025616chr42206 131 11409 1155 --
NM_001025777chr2180 ----11039
NM_001029858chr663005 2217 1330 1268 117 103 13273 ----
NM_001029863chr662932 2843 2389 2212 1097 489 63141 3127 2715 2518 779 211 --1524
NM_001029875chr56917 844 541 531 366 161 12852 --11897
NM_001029997chr191303 2713 274 1548 1294
NM_001030007chr1683960 3558 3317 3159 1547 374 340 275 13746 ----
NM_001030055chr14104675 3855 3107 1749 1727 1373 1204 631 433 324 31095 228 164 ----
NM_001030272chr112354 62 2443 361 ----
NM_001030273chr112354 62 2443 361 ----
NM_001030287chr111135 ----1307
NM_001031623chr621527 1420 1101 11226 11102
NM_001031689chr91117 ------
NM_001031690chr753114 2978 2600 997 974 --22395 640 --
NM_001031692chr7269 43 ------
NM_001031695chr2241554 1424 1346 86 34812 570 22 2634 466 --
NM_001031700chr452084 508 480 459 147 1334 12534 21755 592
NM_001031710chr7--1134 --11001
NM_001031711chr511567 ------
NM_001031712chr61405 1127 1271 1283
NM_001031723chr41453 ------
NM_001031732chr473203 2630 1394 1383 1197 735 384 --171 --
NM_001031804chr1634113 929 328 34076 3232 1527 13873 13479
NM_001031812chr531888 1546 502 22104 1724 ----
NM_001032282chr821285 79 1457 11329 --
NM_001032283chr123772 746 738 1427 ----
NM_001032284chr123772 746 738 1427 ----
NM_001032293chr171152 ------
NM_001032380chr101406 31683 589 76 21831 616 --
NM_001032394chr641799 528 197 162 ----188
NM_001033030chr32279 182 --2261 96 --
NM_001033031chr32279 182 --2261 96 --
NM_001033032chr32279 182 --2261 96 --
NM_001033045chr253943 3740 3081 985 174 51672 1021 929 831 467 23686 972 24037 4008
NM_001033047chr43697 680 311 ----1869
NM_001033049chr2142286 1969 1693 471 ------
NM_001033059chr62727 444 --1287 --
NM_001033087chr202275 164 12748 12270 --
NM_001033117chr344625 3008 438 336 ------
NM_001033557chr211237 ------
NM_001033561chr174888 118 92 52 ------
NM_001033578chr882412 2194 2147 1604 753 572 312 42 21895 1771 ----
NM_001033659chr173667 437 388 11144 ----
NM_001033925chr1041620 809 766 696 1266 ----
NM_001034837chr52119 87 1767 ----
NM_001034838chr52119 87 1767 ----
NM_001034850chr52611 340 1323 ----
NM_001035chr121285 321 1814 11220 --
NM_001035003chr43950 499 407 11255 ----
NM_001035004chr43950 499 407 11255 ----
NM_001037132chr741891 1740 685 285 --11424 --
NM_001037133chr741891 1740 685 285 --11424 --
NM_001037164chr721252 718 11821 21273 75 11308
NM_001037165chr7128966 8830 8453 7710 7669 7349 7055 5811 5749 2581 2327 876 12608 18947 --
NM_001037172chr321230 170 ----11411
NM_001037174chr21909 21792 67 1119 11730
NM_001037317chr172575 2256 2077 1014 549 343 218 ----11003
NM_001037324chr31721 ------
NM_001037332chr522423 1941 ----11627
NM_001037333chr522423 1941 ----11627
NM_001037533chr12211 102 ------
NM_001037535chrX31547 1529 541 --1482 1267
NM_001037536chrX31547 1529 541 --1482 1267
NM_001037540chrX31547 1529 541 --1482 1267
NM_001037553chr2164929 4786 3281 1605 1271 387 23867 1980 24468 3312 --
NM_001037582chr43687 584 61 --11770 --
NM_001037631chr22866 199 11019 ----
NM_001037872chr23548 266 252 ----1219
NM_001037954chr1143358 3045 2776 667 32927 2644 480 23407 3037 --
NM_001038493chr21972 --11207 --
NM_001039538chr2103412 3363 3201 3102 2966 2332 1276 1121 217 139 33551 2356 1421 ----
NM_001039547chr3118044 7827 7820 7723 7224 7128 7084 6684 6388 2689 1661 16206 35822 3038 1467 11674
NM_001039580chr484948 4767 3860 3822 1746 1364 947 788 24888 1382 11145 54802 1929 1493 1446 1125
NM_001039585chr152770 1236 1214 829 791 13752 1127 1102
NM_001039590chrX62727 2601 1246 1093 313 145 43896 3756 1371 324 23977 360 1405
NM_001039591chrX62727 2601 1246 1093 313 145 43896 3756 1371 324 23977 360 1405
NM_001039616chr19155 ------
NM_001039618chr1165621 5098 4391 4083 3843 2201 25277 3759 35946 5217 829 --
NM_001039693chr274150 4033 4016 3834 1601 459 97 33463 1370 1033 ----
NM_001039840chrX65965 5720 4112 1062 646 605 65421 4781 3675 1770 1746 1375 25668 2020 --
NM_001039937chr1363620 2562 1588 1376 686 154 ----1133
NM_001040020chr741534 1058 477 403 159 --1978
NM_001040057chr741349 1107 961 73 11408 ----
NM_001040101chr441576 575 290 23 ----21110 370
NM_001040108chr1443284 844 538 446 ----32089 2007 967
NM_001040110chr741655 1372 343 52 --11678 --
NM_001040113chr163946 714 362 1785 1155 --
NM_001040142chr282338 2185 1939 758 568 515 142 42 12457 --2395 116
NM_001040143chr282338 2185 1939 758 568 515 142 42 12457 --2395 116
NM_001040152chr7135125 5088 4762 4723 4297 4162 4050 3771 3559 3466 3110 1527 797 ----13728
NM_001040153chr132770 193 ----1903
NM_001040157chr432380 351 90 32757 2388 1784 ----
NM_001040159chr43547 265 31 ----31516 605 48
NM_001040181chr33791 774 373 1840 123 11043
NM_001040182chr33791 774 373 1840 123 11043
NM_001040183chr33791 774 373 1840 123 11043
NM_001040199chr33791 774 373 1840 123 11043
NM_001040200chr33791 774 373 1840 123 11043
NM_001040202chr452542 2481 2394 1031 611 22387 2370 --22241 179
NM_001040284chr1665336 4389 4087 881 566 254 2734 172 15945 23764 1229
NM_001040402chr443065 994 671 209 1216 12562 --
NM_001040429chr1352457 2386 1278 1005 86 1410 12805 --
NM_001040441chr195499 4928 3971 3584 1456 935 802 263 42 13775 22059 36 11192
NM_001040446chr572597 2320 2223 2057 722 527 77 --22767 2394 12232
NM_001040450chr1532429 207 150 12024 1422 --
NM_001040453chr1532429 207 150 12024 1422 --
NM_001040653chr32824 124 ----1102
NM_001040665chr784713 3972 3417 3185 2007 1018 77 66 --21848 1513 --
NM_001040697chr111552 --1240 2408 110
NM_001040712chr9103493 3152 3045 3011 2868 2403 1378 771 251 33 23597 3305 1740 13363
NM_001042355chr16115245 4277 3932 3884 3653 2035 1905 1756 1308 872 508 24415 1789 2561 533 21300 826
NM_001042388chr182878 633 ------
NM_001042404chr191862 1532 1451 1434 1358 1270 668 332 104 --11987 11345
NM_001042406chr6149 11120 ----
NM_001042412chr16115245 4277 3932 3884 3653 2035 1905 1756 1308 872 508 24415 1789 2561 533 21300 826
NM_001042413chr944073 2960 1511 1333 11374 --11222
NM_001042422chr17------172
NM_001042423chr17------172
NM_001042440chr582061 1911 1829 1806 1392 668 354 32 11696 ----
NM_001042441chr582061 1911 1829 1806 1392 668 354 32 11696 ----
NM_001042442chr582061 1911 1829 1806 1392 668 354 32 11696 ----
NM_001042443chr582061 1911 1829 1806 1392 668 354 32 11696 ----
NM_001042444chr582061 1911 1829 1806 1392 668 354 32 11696 ----
NM_001042445chr582061 1911 1829 1806 1392 668 354 32 11696 ----
NM_001042446chr582061 1911 1829 1806 1392 668 354 32 11696 ----
NM_001042453chrX41380 1249 652 606 --21655 327 --
NM_001042473chr1011965 --1860 1637
NM_001042481chr1472546 2513 2505 2448 1921 929 72 1198 --1758
NM_001042486chr2021270 1041 --1362 --
NM_001042492chr1722927 2737 2401 255 13328 22487 1342
NM_001042493chr641928 1916 1449 716 ------
NM_001042494chr15113876 3815 3777 3440 2877 2644 2443 1471 1308 825 180 33179 2410 1288 12431 11196
NM_001042495chr15113876 3815 3777 3440 2877 2644 2443 1471 1308 825 180 33179 2410 1288 12431 11196
NM_001042496chr15113876 3815 3777 3440 2877 2644 2443 1471 1308 825 180 33179 2410 1288 12431 11196
NM_001042497chr15113876 3815 3777 3440 2877 2644 2443 1471 1308 825 180 33179 2410 1288 12431 11196
NM_001042517chr132959 61 ------
NM_001042533chr353145 2277 1310 929 667 11250 12526 22077 614
NM_001042550chr941838 1796 617 288 2758 150 1672 --
NM_001042555chr1234223 3527 3219 24574 1790 14455 --
NM_001042599chr2167667 7435 6832 6517 6038 5858 5306 5045 4971 2830 2617 2385 872 730 416 227 16568 22678 497 --
NM_001042601chr351026 687 652 266 55 12249 --11217
NM_001042603chr1254404 1183 767 716 373 24546 1901 14210 --
NM_001042646chr331739 771 702 ------
NM_001042669chr42206 131 11409 1155 --
NM_001042681chr162523 2327 514 445 273 67 185 ----
NM_001042682chr162523 2327 514 445 273 67 185 ----
NM_001042682chr162523 2327 514 445 273 67 185 ----
NM_001042683chr66585 549 515 258 215 70 ----1199
NM_001042728chr1221035 862 1720 ----
NM_001042749chrX51900 1645 629 405 211 11948 22054 574 --
NM_001042750chrX51900 1645 629 405 211 11948 22054 574 --
NM_001042751chrX51900 1645 629 405 211 11948 22054 574 --
NM_001042784chr4124 ------
NM_001044722chr531888 1546 502 22104 1724 ----
NM_001044723chr531888 1546 502 22104 1724 ----
NM_001046chr563020 2814 2701 2353 2131 754 --11992 1515
NM_001071775chr1331807 738 196 11640 141 --
NM_001083620chr452422 2199 890 439 397 12635 22490 2393 --
NM_001095chr123652 335 188 ------
NM_001099678chr3166315 6309 5816 5631 5583 4635 2375 2213 1767 1435 1357 891 747 643 602 372 --26059 306 --
NM_001100108chr197880 7375 5899 5357 5072 2569 897 553 151 26823 539 ----
NM_001106chr3109667 8751 8137 7065 6260 6249 5969 5930 3911 3704 29239 411 ----
NM_001109977chr4--185 ----
NM_001117chr1832288 2128 2120 --12468 1170
NM_001121chr1051675 1655 1284 613 479 ----1146
NM_001123chr102329 110 ------
NM_001124chr111706 ------
NM_001128chr1683960 3558 3317 3159 1547 374 340 275 13746 ----
NM_001149chr1041191 890 880 202 --1404 1319
NM_001151chr42195 31 --148 --
NM_001156chr102448 191 ------
NM_001159chr21642 ----1196
NM_001160chr1252728 2145 1009 711 514 22586 125 ----
NM_001167chrX75614 5141 4734 1928 1658 1652 258 32702 1709 950 12329 15293
NM_001172chr142217 118 ----1568
NM_001173chr14104675 3855 3107 1749 1727 1373 1204 631 433 324 31095 228 164 ----
NM_001174chrX52043 1932 1631 1504 205 21915 1897 --183
NM_001177chr123907 590 127 42048 1877 1593 938 ----
NM_001178chr112354 62 2443 361 ----
NM_001179chr41206 ------
NM_001186chr2143210 2296 1057 1046 22171 1228 1169 1356
NM_001187chr211622 1584 ----
NM_001198chr652377 1885 492 255 243 --22390 415 196
NM_001200chr202714 451 ----21171 180
NM_001201chr493816 3754 3182 3161 3101 2881 2676 637 125 11141 11123 12577
NM_001204chr286202 5708 3025 2930 1871 1505 1402 120 15087 14732 16307
NM_001206chr922891 2127 11205 23015 894 --
NM_001219chr732303 226 45 196 12261 12066
NM_001222chr1091970 1830 1673 1541 1445 1358 1243 767 212 1125 ----
NM_001237chr4----21144 86 --
NM_001237chr4----21144 86 --
NM_001238chr19190 ------
NM_001241chr221967 912 21636 46 32430 561 344 12064
NM_001241chr221967 912 21636 46 32430 561 344 12064
NM_001254chr176881 809 434 137 76 55 ----1890
NM_001256chr1762644 2436 2406 2298 946 494 --124 --
NM_001257chr16189 --1145 --
NM_001259chr755741 4684 4523 4380 369 42251 2122 1391 80 35795 5178 1624 35235 1563 1273
NM_001270chr511118 1207 ----
NM_001289chrX41197 315 228 176 ------
NM_001304chr1743179 1476 1011 568 13529 23636 924 --
NM_001310chr1252174 2120 861 518 456 22813 424 1129 1202
NM_001326chr11187 ------
NM_001328chr4--1283 ----
NM_001329chr1021292 146 1468 2421 337 11583
NM_001331chr1132686 1133 1039 1658 22456 675 --
NM_001338chr211498 ------
NM_001343chr51533 21720 1555 11199 --
NM_001346chr352316 2239 681 352 50 12828 11833 --
NM_001351chr331643 1584 411 11632 21441 253 --
NM_001356chrX------11563
NM_001358chr42376 131 ------
NM_001364chr1154549 3225 1879 1224 748 34040 3901 1525 --1559
NM_001380chr1021019 1001 ------
NM_001390chr1863619 3416 3025 2380 2262 1174 --1446 --
NM_001396chr2142414 2204 1089 118 12105 ----
NM_001399chrX53662 1191 749 569 224 12390 ----
NM_001401chr921583 1023 ----21422 1114
NM_001402chr642039 1744 1277 492 12025 ----
NM_001407chr331735 1190 1179 --21158 1122 --
NM_001412chrX83752 3573 3073 1430 1040 862 455 49 32522 2508 255 --13556
NM_001416chr171449 ------
NM_001419chr1944648 4243 4081 1492 --24824 3877 --
NM_001423chr1222017 1377 ------
NM_001427chr741984 1583 1299 156 1189 12042 --
NM_001429chr221799 ----1977
NM_001430chr2----1109 --
NM_001431chr641062 938 183 109 ------
NM_001438chr133450 1251 948 22890 1041 12636 --
NM_001444chr81135 ------
NM_001448chrX51725 1713 1694 1221 364 ------
NM_001449chrX51260 1150 267 229 141 11047 ----
NM_001452chr61685 --1577 --
NM_001453chr611485 11763 11269 --
NM_001458chr71649 1118 ----
NM_001482chr151381 ----1843
NM_001483chr721049 150 --1726 --
NM_001491chr652580 2529 2118 916 250 11699 ----
NM_001498chr651270 1170 967 466 45 ----1989
NM_001527chr6104680 4326 3363 3331 2974 785 587 544 418 368 --21190 613 --
NM_001530chr146745 419 398 154 101 76 ------
NM_001546chr641456 1120 434 211 --2558 490 --
NM_001553chr42190 25 ----1171
NM_001584chr1111201 1822 --290 42
NM_001587chrX72216 2070 1818 817 579 369 265 --11488 --
NM_001609chr1043348 3295 915 404 14476 23906 3073 --
NM_001616chr212407 --23422 1389 2456 228
NM_001621chr792852 2658 2484 1102 996 634 570 250 203 1788 ----
NM_001621chr792852 2658 2484 1102 996 634 570 250 203 1788 ----
NM_001634chr62727 444 --1287 --
NM_001635chr73958 322 100 1943 ----
NM_001650chr1831480 1114 950 --13073 23584 161
NM_001655chr1171741 1690 1620 813 780 490 429 11798 188 --
NM_001660chr3159 ------
NM_001668chr132014 1865 1708 ----1889
NM_001674chr111135 ----1307
NM_001677chr14347 138 125 116 --21057 940 --
NM_001679chr31534 ------
NM_001682chr1262783 2290 2253 1852 956 608 12663 1454 --
NM_001683chr332239 2222 626 2872 425 --1808
NM_001684chr163987 3886 3760 3408 358 170 24077 4070 12926 --
NM_001689chr261904 1377 1303 714 307 238 ----1378
NM_001690chr342367 1940 1906 1618 --1395 --
NM_001701chr951602 1383 1341 1044 233 ------
NM_001706chr31763 --2715 74 2723 329
NM_001709chr113634 403 217 --1149 --
NM_001713chr5--31015 146 58 ----
NM_001718chr621120 437 --11079 --
NM_001730chr131586 ------
NM_001730chr131586 ------
NM_001731chr123895 344 297 --1927 --
NM_001742chr72493 208 --1525 21609 1486
NM_001743chr21603 ------
NM_001744chr5----2479 438 --
NM_001745chr53448 90 55 133 ----
NM_001746chr542660 2139 1826 50 ------
NM_001748chr121125 288 11145 ----
NM_001750chr582061 1911 1829 1806 1392 668 354 32 11696 ----
NM_001752chr111136 --1604 --
NM_001753chr731861 1746 536 11149 11828 --
NM_001754chr2184288 3563 3345 3183 1571 1291 962 715 ------
NM_001755chr1682175 1899 1794 1741 637 581 543 83 11696 ----
NM_001759chr1231255 593 322 22019 168 35064 4437 617 --
NM_001777chr344020 3816 2679 1336 --23895 930 13632
NM_001788chr73931 772 319 ------
NM_001792chr182965 215 1136 --1836
NM_001795chr1651540 1379 1297 1062 462 21183 321 11508 11529
NM_001797chr161122 ------
NM_001822chr2134 ----1499
NM_001825chr5----1121 --
NM_001829chr41266 ----1107
NM_001855chr93833 593 227 --1125 --
NM_001858chr694455 3878 3351 1954 1799 1660 1376 836 528 13464 54952 4852 1641 577 223 23930 765
NM_001859chr933870 1294 166 --23903 3248 12526
NM_001873chr43490 435 36 ----1543
NM_001874chr12115132 4889 4675 4506 4465 3492 1669 909 386 240 68 1313 12010 --
NM_001875chr241077 1012 688 353 ----1390
NM_001884chr54495 446 402 373 ------
NM_001895chr20--21144 438 --1908
NM_001903chr53902 844 626 ------
NM_001918chr189131 8842 7728 7499 6978 3177 2663 453 28769 7891 48420 6154 1730 84 68540 8100 7219 6734 5778 3273
NM_001924chr11535 1511 ----
NM_001938chr121303 347 ----2333 34
NM_001954chr61782 --1734 --
NM_001957chr482327 2038 1607 771 667 655 549 211 11641 --1182
NM_001968chr42361 354 2702 689 ----
NM_001969chr1452847 2806 995 908 119 53304 2951 624 432 41 13837 12659
NM_001977chr421779 340 --175 1247
NM_001981chr132161 1597 1523 22142 745 21857 65 11688
NM_001987chr1234317 3011 1055 44129 2945 1571 992 ----
NM_001992chr53691 684 229 12193 11494 11374
NM_001993chr131047 899 210 2974 27 2893 764 --
NM_001998chr3191 1416 ----
NM_002006chr455364 3672 1850 1402 406 45651 5160 4178 4064 13920 12025
NM_002009chr1542645 2585 426 380 1624 ----
NM_002015chr1353247 2262 1241 525 259 ------
NM_002024chrX32141 1860 1421 21879 1819 --12032
NM_002025chrX158373 7888 7621 6323 6088 3373 2856 2407 1916 1699 1190 935 857 284 171 47328 6863 6536 6445 28031 6260 --
NM_002033chr1183650 2659 2597 1483 1048 1011 928 675 33721 3335 3051 33309 834 782 13683
NM_002035chr1873870 3098 2644 1568 846 665 146 ----13067
NM_002040chr2143136 2450 423 222 ------
NM_002044chr151347 ----11526
NM_002048chr92843 481 ------
NM_002055chr17----11366 --
NM_002063chrX31246 913 861 ------
NM_002069chr731767 708 255 ----11915
NM_002076chr1262675 2356 2175 1286 1008 21 22897 2527 ----
NM_002077chr932169 2028 281 2793 773 21645 134 --
NM_002080chr1621020 261 ------
NM_002082chr5124 ------
NM_002086chr1712097 2225 202 ----
NM_002111chr443594 2571 2371 199 13860 12364 --
NM_002114chr61479 ------
NM_002128chr1331817 821 603 --12309 2718 38
NM_002137chr762255 2186 1795 1766 1611 864 12093 2691 644 22284 851
NM_002146chr171962 11183 ----
NM_002158chr243220 3153 2504 1069 13734 21342 45 --
NM_002160chr91435 ------
NM_002165chr201336 --1366 --
NM_002203chr594136 3487 3208 3183 2763 2709 1445 1114 276 33262 2741 411 1990 11630
NM_002210chr243323 1051 854 457 --13565 --
NM_002211chr1031126 745 303 ----2765 389
NM_002214chr7145251 5105 5063 5009 4839 4420 3987 2152 1914 1794 1238 678 378 308 15075 44954 4895 3876 2205 14327
NM_002221chr162878 2756 2191 1173 820 118 12922 ----
NM_002222chr31939 --11156 11173
NM_002223chr1232852 577 366 13488 23093 1310 --
NM_002224chr6------1726
NM_002227chr141335 1287 476 52 --1935 --
NM_002228chr13960 777 371 2480 365 11122 11167
NM_002242chr22185 109 1192 21988 1674 1370
NM_002247chr1052300 2163 1964 920 116 12384 12334 --
NM_002264chr364902 4311 3825 1319 939 414 44352 1921 1420 1333 11943 --
NM_002265chr17--1961 ----
NM_002268chr361697 1662 735 344 298 257 ------
NM_002270chr5175642 5455 5276 5040 4568 4240 4160 3963 3492 1231 1090 603 397 250 97 72 59 45331 5265 1550 435 11882 --
NM_002285chr284119 3959 3598 3400 1325 1297 1249 839 ------
NM_002293chr11480 --32697 2474 1821 --
NM_002296chr131690 1409 35 ----123
NM_002313chr1055098 4677 3346 1850 1727 --34062 1455 1078 --
NM_002332chr12----1750 --
NM_002336chr1275038 4617 4393 4223 3750 1673 1295 24407 3379 1977 23836 3128
NM_002351chrX1662 2683 93 21627 36 1242
NM_002356chr62721 563 22816 1144 2555 95 --
NM_002358chr42104 69 ----1451
NM_002359chr171688 1130 --1747
NM_002374chr2103412 3363 3201 3102 2966 2332 1276 1121 217 139 33551 2356 1421 ----
NM_002381chr22996 161 1757 ----
NM_002382chr1411320 11329 ----
NM_002383chr161912 ------
NM_002395chr61568 11273 ----
NM_002397chr541709 649 331 294 11481 11843 --
NM_002399chr1511377 ------
NM_002431chr141321 ------
NM_002444chrX1411 11536 11391 --
NM_002460chr673314 2892 2381 1451 954 911 468 12819 12759 13782
NM_002466chr20138 ------
NM_002480chr1221098 286 ----11010
NM_002481chr1127949 7507 6686 6195 5806 5686 5380 2906 387 165 154 145 16402 11562 15625
NM_002487chr152645 88 ------
NM_002500chr231094 949 206 199 --169
NM_002508chr131992 1822 1645 ------
NM_002514chr821060 424 31073 253 28 --1269
NM_002515chr142583 214 11461 ----
NM_002518chr231105 940 233 1766 1855 --
NM_002519chr1131517 1005 978 31411 1048 482 11272 1241
NM_002522chr1773958 3807 1262 854 329 315 263 23171 3025 --1592
NM_002526chr651625 1351 335 214 105 11562 --11451
NM_002540chr9----1592 1686
NM_002542chr31221 ------
NM_002544chr171323 ------
NM_002545chr1184724 3663 3567 3464 3337 636 566 61 11670 11438 --
NM_002581chr9125673 5498 5468 4936 4905 4891 4623 4276 2204 2198 1416 310 25052 4302 44874 4594 3649 981 15007
NM_002585chr1--1367 ----
NM_002590chr131106 ------
NM_002591chr201586 1633 ----
NM_002594chr2051922 1644 982 974 160 1485 ----
NM_002595chr123783 265 110 21195 153 ----
NM_002612chr781977 1821 1554 1470 706 439 191 44 1454 ----
NM_002613chr1653747 3582 1608 1324 1126 14793 25243 3907 14730
NM_002623chr202523 277 ------
NM_002628chr311233 ------
NM_002633chr11418 1498 1147 --
NM_002641chrX31924 409 126 --1387 149
NM_002645chr1163136 3026 2752 2362 1100 914 1249 21175 338 --
NM_002648chr6----1134 --
NM_002655chr895262 4937 4599 4463 4141 3799 3656 3620 3605 14482 34106 3882 3864 1291
NM_002656chr62986 69 1235 1975 --
NM_002657chr2063881 3045 2994 1308 662 584 --2936 750 13082
NM_002660chr201424 ------
NM_002670chr361586 1164 1007 639 482 55 11118 --11446
NM_002687chr14------11009
NM_002699chr11505 ----1101
NM_002706chr21520 ------
NM_002709chr273537 3445 3020 2558 1039 664 482 ----23632 2295
NM_002710chr122935 870 ------
NM_002711chr71169 2847 626 ----
NM_002718chr34589 309 255 122 42205 1067 1023 969 11812 12040
NM_002731chr152083 1994 1149 1054 159 23165 2007 ----
NM_002734chr1772019 1787 1702 1641 1474 847 690 11676 ----
NM_002736chr741898 1634 867 122 11845 1129 --
NM_002737chr1765632 4816 4754 2667 1287 177 11572 11892 --
NM_002738chr163768 323 245 1991 ----
NM_002745chr2284036 3712 3625 3401 1801 1432 1086 342 23885 808 24192 1050 14315
NM_002748chr153326 298 159 --1799 1914
NM_002755chr152646 310 ------
NM_002786chr112235 76 ------
NM_002811chr16--148 --1369
NM_002813chr1221532 321 ------
NM_002814chrX2510 235 158 ----
NM_002821chr61800 --1834 --
NM_002822chr1231720 1345 621 --1504 11331
NM_002828chr185702 393 140 74 30 ------
NM_002833chr1521621 1292 --11519 1603
NM_002835chr71786 ------
NM_002837chr1274591 3694 3316 3122 1584 1232 285 44084 1379 1035 79 21818 805 23755 1626
NM_002839chr9103493 3152 3045 3011 2868 2403 1378 771 251 33 23597 3305 1740 13363
NM_002841chr33507 251 110 1648 ----
NM_002844chr641174 477 353 121 11202 ----
NM_002852chr31454 2474 425 ----
NM_002857chr172379 1871 1030 671 485 429 256 12585 ----
NM_002863chr14----157 --
NM_002867chr13479 276 165 ----1241
NM_002868chr1221626 478 --12038 --
NM_002869chr1121366 520 11499 --1208
NM_002873chr52476 395 ------
NM_002874chr951682 1592 1526 705 398 ----12264
NM_002882chr22----1103 --
NM_002886chr355003 4363 2065 1040 862 --15039 --
NM_002892chr143669 590 68 11072 11502 --
NM_002893chrX1328 ------
NM_002897chr21164 --1173 --
NM_002898chr122677 173 ----1422
NM_002902chr15191 ----1529
NM_002906chr1122362 1658 --1808 --
NM_002912chr61188 1685 ----
NM_002927chr16687 663 640 631 563 118 ----1508
NM_002941chr321230 444 1198 ----
NM_002968chr163910 354 124 ------
NM_002971chr33890 840 373 2854 472 11031 1190
NM_002977chr2103344 2749 2688 2183 1121 853 560 533 297 27 1593 --23360 638
NM_002979chr11786 2333 224 ----
NM_002994chr421735 661 ----11471
NM_002998chr841555 1416 584 195 1666 ----
NM_003010chr1732137 877 546 12112 ----
NM_003013chr43846 621 583 ------
NM_003014chr74585 518 381 315 --21188 601 --
NM_003017chr6----1226 --
NM_003024chr213781 365 232 1339 1805 --
NM_003030chr321513 339 --11754 --
NM_003034chr12177926 7255 6724 5727 5467 5156 2931 2897 2717 1845 1585 1566 1523 969 761 615 579 37764 7120 6091 15067 12495
NM_003042chr322057 673 ----12200
NM_003043chr351408 1394 486 323 75 13830 ----
NM_003051chr1------21965 512
NM_003054chr10------1291
NM_003060chr52986 244 21103 215 ----
NM_003068chr83940 338 168 1776 11019 1954
NM_003069chrX----2799 291 --
NM_003070chr92676 103 ----1120
NM_003071chr331504 554 156 21719 1703 --21774 795
NM_003074chr331556 1537 293 ----12051
NM_003077chr171323 ------
NM_003079chr173642 328 315 --1863 --
NM_003092chr20142 ------
NM_003094chr151152 1036 194 158 113 ------
NM_003099chr15126338 6253 5744 5564 4662 2641 2620 1878 1853 1786 1532 230 24560 683 12475 --
NM_003100chr51296 --2330 314 --
NM_003108chr275981 4838 4645 2353 1709 1461 487 35912 4586 742 25491 5381 26077 811
NM_003112chr773158 2612 2410 2044 416 226 44 12315 ----
NM_003113chr2--1623 --135
NM_003114chr82540 115 1122 1165 --
NM_003128chr222702 589 1192 --1533
NM_003131chr6177 ----1746
NM_003134chr15--1565 1392 --
NM_003137chr651860 1823 1536 1461 528 ----1724
NM_003144chr621522 489 11806 --11766
NM_003149chr3--1272 11185 --
NM_003161chr17113137 2525 2311 2301 2241 1355 1342 1084 740 391 67 ------
NM_003178chr361964 1876 1491 1473 728 503 ------
NM_003184chr83838 802 384 1115 ----
NM_003185chr203967 922 324 11015 2382 99 --
NM_003199chr1875067 4663 2058 1954 1723 1078 975 24057 3945 --12133
NM_003201chr102709 670 1377 ----
NM_003206chr6----1143 --
NM_003211chr1211402 --21755 1533 --
NM_003221chr694195 4061 3629 3610 1456 1199 1122 840 716 23566 2963 11061 11258
NM_003223chr16----1747 196
NM_003234chr322081 1548 41786 1642 912 90 12326 --
NM_003236chr252650 2425 963 688 414 22330 250 22603 2378 --
NM_003242chr362461 1817 1589 352 344 334 --1252 --
NM_003247chr642037 1438 649 317 1620 1471 --
NM_003253chr2131645 746 296 ------
NM_003255chr1792416 2385 1987 1058 1044 956 720 483 466 134 ----
NM_003262chr3105157 4974 4750 4483 2032 1516 1189 1008 289 227 --34896 4836 885 1744
NM_003269chr611129 ----11318
NM_003270chrX1420 ------
NM_003274chr2142775 2459 1139 821 ----22667 2304
NM_003286chr2041179 1044 403 377 ------
NM_003298chr345719 1434 1095 770 55469 5065 4903 4777 1755 25704 4833 25393 4304
NM_003299chr12152 ------
NM_003304chr321497 618 --11464 11050
NM_003338chr106784 602 457 331 270 256 11315 1279 11739
NM_003339chr531584 1327 620 --1245 130
NM_003340chr421364 223 ------
NM_003341chr32664 171 1480 2220 111 --
NM_003342chr1792607 2529 2430 2268 2130 1166 1002 904 141 1939 --13268
NM_003344chr731725 1236 62 ------
NM_003345chr16----160 --
NM_003350chr8----1270 --
NM_003373chr1061784 1559 1286 1272 1262 549 ------
NM_003375chr10--1384 ----
NM_003379chr62759 448 ------
NM_003387chr232933 696 561 12403 11804 --
NM_003392chr364075 3015 2919 2663 1499 544 12714 1566 13652
NM_003399chrX4793 719 332 312 ------
NM_003400chr23882 819 606 --133 --
NM_003406chr84523 436 133 41 ----11801
NM_003409chr183944 330 80 ------
NM_003410chrX62751 2337 908 644 460 258 22492 761 32845 974 953 --
NM_003411chrY61246 607 495 286 247 144 ------
NM_003412chr322251 813 ------
NM_003413chrX71827 1717 1310 652 547 267 233 --21420 768 1224
NM_003423chr19102592 2550 2538 2206 2051 1857 914 534 90 53 31833 624 360 2558 109 --
NM_003430chr1931653 1088 458 41592 425 375 207 11608 3543 486 291
NM_003439chr742872 2625 969 644 1401 33036 959 628 --
NM_003453chr134698 543 520 262 ------
NM_003454chr1631435 1377 1265 ------
NM_003457chr171152 ------
NM_003458chr353903 3298 2810 2532 283 --22524 113 1639
NM_003463chr693120 3038 2696 2622 2611 2503 2341 655 508 ------
NM_003468chr223495 1385 24091 3746 1320 13359
NM_003471chr331861 1528 745 1496 2939 862 --
NM_003473chr104757 284 217 159 1302 ----
NM_003474chr1042243 1909 1775 120 1871 12169 --
NM_003478chr1143205 3132 3000 2748 1135 ----
NM_003482chr1252480 2444 2336 2318 2151 22015 412 ----
NM_003483chr1232903 1989 1812 1800 12718 --
NM_003489chr2153299 2585 1058 754 661 --12221 11016
NM_003505chr741951 1812 1580 691 1154 ----
NM_003506chr81498 ------
NM_003557chr111353 --21409 1201 --
NM_003558chr9------1533
NM_003566chr1243339 2323 1327 955 22882 2491 ----
NM_003569chr62658 467 ------
NM_003574chr1845288 5066 4912 554 12234 --15411
NM_003581chr231016 962 867 ----1891
NM_003583chr1263695 3626 3083 2737 1408 315 --23253 1566 12911
NM_003590chr2113618 3599 3493 2896 1625 1610 1587 1452 924 318 221 13360 23669 192 13678
NM_003591chr101395 --1129 --
NM_003592chr72494 155 ------
NM_003597chr222326 1939 21770 516 1317 1301
NM_003603chr442046 756 576 500 --1665 --
NM_003615chr353935 3838 2733 1181 435 11540 13856 43166 2606 2464 1427
NM_003617chr131919 1818 75 24442 3760 --13360
NM_003622chr1232377 2315 881 21896 1697 --12622
NM_003626chr1121025 927 1275 1500 135
NM_003629chr152963 2492 2239 82 63 13194 146 13364
NM_003633chr542051 1704 815 710 ------
NM_003646chr111569 ------
NM_003659chr23857 219 160 ------
NM_003663chr322828 2676 21321 165 1928 --
NM_003671chr953614 3404 3001 1058 52 1889 --12573
NM_003672chr121799 310 2564 189 ----
NM_003676chr12883 321 1640 ----
NM_003677chr1242088 1919 1661 509 32168 1566 1407 1260 --
NM_003679chr182959 2919 2899 2794 2450 1329 1013 728 42524 2281 510 242 13166 --
NM_003692chr92370 147 1388 ----
NM_003716chr331001 784 201 --1210 --
NM_003718chr7157 --1397 1443
NM_003728chr41487 1513 ----
NM_003743chr272247 2221 1618 1509 1468 1397 96 21749 1640 ----
NM_003749chr1322075 2057 --1892 --
NM_003759chr464213 4199 3933 2814 1564 1011 ----11574
NM_003763chr2063217 2972 1232 951 488 310 ----12193
NM_003766chr172194 181 --1106 --
NM_003778chr31750 1578 1743 --
NM_003787chr1841517 1108 1101 439 11294 --1642
NM_003797chr112153 144 ------
NM_003799chr1851254 1000 896 586 347 ----33061 1291 1112
NM_003800chr642128 1549 404 192 ----11753
NM_003806chr122273 261 ------
NM_003816chr821396 954 11058 21278 207 --
NM_003819chr1--1106 ----
NM_003822chr153027 2397 1131 1088 477 2779 627 ----
NM_003825chr1511562 ------
NM_003831chr1831695 1499 705 --2373 358 --
NM_003858chr141607 1691 ----
NM_003861chr1442193 1942 751 429 3647 45 31 ----
NM_003862chr5179 ------
NM_003872chr222359 586 11207 --1489
NM_003873chr1032377 2114 993 12203 --12287
NM_003884chr351814 1692 1379 718 670 11402 --174
NM_003887chr25666 590 530 290 155 --11847 --
NM_003895chr2142069 1691 551 514 42134 1964 1455 627 1525 --
NM_003899chr1312568 --21770 262 --
NM_003901chr1042582 898 560 405 --12408 12559
NM_003902chr11710 --1343 --
NM_003908chr2021388 1355 ----1332
NM_003909chr893036 2814 2383 2290 1158 814 535 220 77 12506 52663 2313 1127 1096 495 1557
NM_003913chr634091 3407 686 21484 874 13152 --
NM_003916chrX31478 1057 938 21016 562 ----
NM_003922chr151375 ------
NM_003927chr181919 --1756 1976
NM_003930chr742543 2290 2008 621 ----22562 39
NM_003931chr61184 127 ----
NM_003934chr931293 1286 75 1257 ----
NM_003941chr73821 557 222 22141 572 --1191
NM_003948chr442684 2525 2443 760 22139 385 --11865
NM_003953chr122166 229 --1281 --
NM_003955chr1711239 --11433 --
NM_003958chr6103948 3191 2785 2671 1566 1415 1037 975 852 568 12626 13749 --
NM_003961chr161211 ------
NM_003966chr5167067 6739 6674 6510 6331 5673 5630 4735 3044 3018 3000 2807 2224 1882 1750 713 31560 901 725 26749 4856 15106
NM_003972chr1031291 930 222 ----1423
NM_003980chr61275 176 2425 49 1558
NM_003983chr1663996 3492 2811 1174 779 702 --1559 --
NM_003985chr17--1666 ----
NM_003994chr1274071 4027 3456 3350 3122 1673 1137 --21478 424 1216
NM_004001chr1------1462
NM_004006chrX62209 1786 740 683 265 179 --4898 692 165 97 --
NM_004007chrX62209 1786 740 683 265 179 --4898 692 165 97 --
NM_004009chrX62209 1786 740 683 265 179 --4898 692 165 97 --
NM_004010chrX62209 1786 740 683 265 179 --4898 692 165 97 --
NM_004011chrX62209 1786 740 683 265 179 --4898 692 165 97 --
NM_004012chrX62209 1786 740 683 265 179 --4898 692 165 97 --
NM_004013chrX62209 1786 740 683 265 179 --4898 692 165 97 --
NM_004014chrX62209 1786 740 683 265 179 --4898 692 165 97 --
NM_004015chrX62209 1786 740 683 265 179 --4898 692 165 97 --
NM_004016chrX62123 1700 654 597 179 93 --3812 606 79 --
NM_004017chrX62209 1786 740 683 265 179 --4898 692 165 97 --
NM_004018chrX62123 1700 654 597 179 93 --3812 606 79 --
NM_004019chrX1118 ----1297
NM_004020chrX62209 1786 740 683 265 179 --4898 692 165 97 --
NM_004021chrX62123 1700 654 597 179 93 --3812 606 79 --
NM_004022chrX62123 1700 654 597 179 93 --3812 606 79 --
NM_004023chrX62123 1700 654 597 179 93 --3812 606 79 --
NM_004028chr1831480 1114 950 --13073 23584 161
NM_004034chr102448 191 ------
NM_004050chr1422670 729 ----12658
NM_004055chr1131588 335 46 12275 --11643
NM_004067chr741244 1172 1114 978 1381 --11015
NM_004068chr31156 1452 ----
NM_004080chr741493 520 408 268 ------
NM_004087chr352046 1946 1427 767 128 1689 --11243
NM_004093chr1372957 2573 2300 751 560 526 305 12146 12279 11276
NM_004094chr1442490 1027 943 374 --1543 --
NM_004100chr641784 1657 685 83 21845 181 21007 210 --
NM_004109chr1162178 1802 1587 1525 772 442 1194 ----
NM_004113chr321730 137 21471 564 ----
NM_004124chr1463098 2368 2224 835 493 299 --1269 --
NM_004136chr1573063 2033 1323 1222 914 818 559 143 ----
NM_004170chr921470 140 1383 31588 546 251 --
NM_004171chr11129545 9382 9117 9011 8949 8719 8076 6082 2422 2253 2079 2017 48755 8735 8709 1225 28497 6717 37634 6554 6064
NM_004172chr542061 1985 433 275 21821 301 --1616
NM_004180chr21475 163 ----
NM_004187chrX21148 1060 11157 ----
NM_004202chrY--1724 2658 39 --
NM_004207chr17------172
NM_004225chr851414 1278 1236 538 83 --1216 --
NM_004227chr742872 1217 1110 666 22858 613 ----
NM_004229chrX52229 1876 1783 1752 895 1282 11409 --
NM_004232chr1863715 3638 3589 3191 2832 475 21121 1082 32430 1405 572 166
NM_004235chr94886 740 570 108 2813 263 ----
NM_004267chr3--145 --1360
NM_004272chr531609 566 73 1224 --11441
NM_004274chr1442562 2511 358 58 11184 ----
NM_004279chr72636 253 --1674 1659
NM_004288chr22750 387 ----1773
NM_004290chr551229 989 983 939 415 1236 ----
NM_004316chr123867 861 833 21130 1122 ----
NM_004329chr103948 936 36 --11036 --
NM_004330chr1541178 1143 929 61 1108 ----
NM_004331chr852347 1949 1930 869 117 12683 32658 2358 1794 --
NM_004337chr821971 1609 11812 21476 604 32134 1942 340
NM_004342chr762158 2126 1626 898 500 412 22295 1689 11819 21842 1535
NM_004346chr421011 257 --11195 --
NM_004369chr21122 ------
NM_004370chr652004 1513 1416 614 468 11603 1456 --
NM_004384chr531888 1546 502 22104 1724 ----
NM_004385chr52693 602 ------
NM_004392chr1382548 2469 2377 2214 1997 1921 1628 257 11757 --1151
NM_004395chr51171 ------
NM_004397chr1143967 3408 1733 852 21651 25 11392 --
NM_004404chr232026 559 552 21603 779 ----
NM_004407chr44930 644 241 74 1407 ----
NM_004408chr9------1206
NM_004424chr16----1151 --
NM_004432chr942258 487 436 317 ------
NM_004434chr141247 1102 11403 --
NM_004438chr252291 1213 1106 370 135 1869 22087 818 1722
NM_004458chrX12216 12544 ----
NM_004459chr1741875 1847 1582 726 21698 680 --11388
NM_004464chr4144319 3848 3546 3509 3450 2966 2878 2727 2714 635 562 445 320 52 14185 --21384 1345
NM_004469chrX1107 ------
NM_004472chr53661 504 220 --1600 --
NM_004481chr122309 966 ------
NM_004492chr15125 ------
NM_004496chr1441202 971 438 431 21238 214 ----
NM_004499chr51467 ------
NM_004501chr151341 1172 816 732 253 ----13281
NM_004503chr12--1711 1245 2586 301
NM_004504chr272687 2537 2391 1088 655 593 565 1953 --1919
NM_004506chr6123 ----1292
NM_004515chr1171 --1242 --
NM_004516chr191392 ------
NM_004519chr81218 ------
NM_004520chr52772 231 ----1167
NM_004521chr10183 --1250 --
NM_004523chr1031595 1502 1170 --11150 11514
NM_004525chr221282 464 2416 243 --2179 60
NM_004529chr91891 ------
NM_004535chr2011278 1232 ----
NM_004537chr122174 74 ------
NM_004563chr141163 ------
NM_004571chr2132765 877 54 22630 803 22740 2134 22530 840
NM_004575chr431298 530 524 11439 ----
NM_004580chr1521669 579 1134 ----
NM_004586chrX74674 4212 3684 1478 1312 1041 90 --11982 --
NM_004593chr34700 241 169 117 ------
NM_004600chr1------1534
NM_004607chr5----154 1200
NM_004612chr9134669 4520 4483 4440 4302 3688 3062 1758 1596 1585 1476 472 360 23190 1943 14603 13959
NM_004615chrX2984 324 1705 ----
NM_004620chr11--1157 ----
NM_004622chr232070 375 184 ------
NM_004631chr12352 89 1180 --1534
NM_004637chr331303 1048 377 ------
NM_004641chr104659 321 182 127 1553 11316 1429
NM_004650chrX--11818 --1551
NM_004657chr231406 1177 1098 21419 1324 --1503
NM_004660chrY32141 920 509 2868 31 --11509
NM_004664chr121206 ----1276
NM_004671chr18------1293
NM_004687chr1742121 1521 1353 485 11568 --11698
NM_004705chr111599 1793 ----
NM_004713chr143694 545 254 ------
NM_004719chr1241890 700 172 166 ----142
NM_004722chr7--1201 1273 --
NM_004725chr1011338 11273 1460 --
NM_004726chrX95464 5079 4817 3859 2299 1905 1810 1802 654 21203 600 1256 1351
NM_004730chr572133 2124 1874 769 463 213 97 ------
NM_004734chr1352331 1088 995 726 406 --32783 2207 946 --
NM_004736chr121756 1627 --2287 46 --
NM_004745chr8127059 6964 5160 5042 4715 4423 4411 1596 1319 1089 697 455 36265 4331 398 11577 11929
NM_004747chr1011408 1295 1323 --
NM_004748chr1532907 1214 711 1140 11250 1656
NM_004765chr16------153
NM_004768chr131126 764 156 --31168 353 286 --
NM_004772chr551464 1148 450 269 141 --1232 11077
NM_004774chr1743161 2956 2000 1055 13143 ----
NM_004775chr1842135 1683 474 136 12339 1292 11643
NM_004781chr141137 569 264 212 ------
NM_004781chr141137 569 264 212 ------
NM_004788chr1122542 1989 --1740 12467
NM_004796chr1441582 768 723 468 ------
NM_004798chr2063079 2663 1228 884 866 363 --13592 --
NM_004808chr1053281 2870 2548 2495 2395 53032 2524 2464 2424 234 ----
NM_004815chr1104910 4856 4272 4242 3590 3171 1636 1385 629 566 13576 ----
NM_004817chr92665 635 ------
NM_004834chr252876 1154 910 263 222 13320 --13137
NM_004840chrX42238 2123 2054 480 --32300 643 368 12311
NM_004841chr1184 1825 1725 1817
NM_004842chr621618 1296 ----21758 576
NM_004844chr311178 ------
NM_004850chr241376 501 401 287 1170 ----
NM_004857chr14124461 3653 3429 3238 1842 1630 1617 1555 1435 1060 657 429 14264 13951 11809
NM_004859chr1752975 2887 2530 2067 2045 33102 386 144 --12085
NM_004863chr1464290 3974 1674 1287 1199 947 24783 4512 --14087
NM_004866chr544655 3213 1596 888 11906 34916 4044 699 167
NM_004867chrX3702 686 158 --2678 49 --
NM_004869chr1831567 1454 653 1442 1296 --
NM_004871chr1772711 2683 1115 706 574 529 370 ----14107
NM_004873chr1483101 2812 2751 2692 2651 2502 595 577 --1991 12854
NM_004874chr8------1510
NM_004897chr102887 248 1240 139 --
NM_004898chr452884 2851 2417 2020 1999 1170 1705 12086
NM_004904chr796582 6520 5895 5648 5290 4909 4820 1038 992 1516 25757 4766 11912
NM_004911chr72257 204 1524 ----
NM_004912chr741522 1360 1287 245 ----21685 205
NM_004926chr1431371 730 357 11479 ----
NM_004929chr851404 1292 1009 159 63 ----21351 1057
NM_004932chr521573 1121 ----11696
NM_004938chr9------11207
NM_004946chr51426 ------
NM_004956chr784387 3498 3473 2930 1687 1261 463 295 23849 1186 151 11364
NM_004965chr212697 313 ------
NM_004969chr10--1170 ----
NM_004972chr92422 39 ------
NM_004975chr204979 777 234 84 ------
NM_004985chr1284076 3893 3160 2967 2779 1656 773 633 23103 690 32765 1631 1316 1607
NM_004987chr21330 ------
NM_004992chrX56184 5579 2480 2060 1186 17418 1423 17247
NM_004992chrX56184 5579 2480 2060 1186 17418 1423 17247
NM_004993chr1411021 ----11211
NM_004999chr654318 3375 3061 1036 410 ----33435 3121 108
NM_005003chr16------1163
NM_005006chr23735 701 69 --1813 --
NM_005010chr741891 1740 685 285 --11424 --
NM_005011chr741655 1372 343 52 --11678 --
NM_005025chr3184 ------
NM_005028chr1062070 941 779 580 166 123 1888 12094 12208
NM_005032chrX21105 936 ------
NM_005037chr3----1163 --
NM_005050chr142992 757 1271 --1445
NM_005054chr22616 148 11709 11736 184
NM_005056chr1254648 1427 1011 960 617 34790 2145 211 14454 --
NM_005065chr1444864 4849 1108 872 35002 4521 3822 24215 1560 --
NM_005066chr11830 1808 ----
NM_005077chr91189 1102 --1147
NM_005079chr852598 1243 268 116 42 32377 501 287 23193 361 2762 316
NM_005087chr34554 98 34 23 --146 --
NM_005105chr142188 784 492 161 ------
NM_005110chr52601 224 ------
NM_005116chr2061379 892 346 294 101 95 --1886 --
NM_005119chr111229 11313 --1870
NM_005121chr1751107 822 718 160 72 23568 3050 21413 970 11143
NM_005126chr362324 2264 2153 1891 1402 649 ------
NM_005134chr182878 633 ------
NM_005135chr15113876 3815 3777 3440 2877 2644 2443 1471 1308 825 180 33179 2410 1288 12431 11196
NM_005154chr151658 ------
NM_005156chr995287 2039 2007 1823 1796 1693 1309 1000 883 14217 13937 1220
NM_005157chr921986 1779 ------
NM_005159chr151112 1186 --1898
NM_005164chr1272625 1948 1918 1667 917 831 816 --1905 --
NM_005168chr231475 1453 1278 21595 658 11497 1408
NM_005171chr1231239 835 350 21275 442 1943 --
NM_005180chr1051524 1401 1194 1081 302 1142 21262 591 11467
NM_005188chr11117836 7737 6938 5763 3286 3111 2173 1922 1720 838 532 17472 ----
NM_005190chr641142 865 853 396 1230 ----
NM_005191chr3----11437 1518
NM_005194chr201174 1601 ----
NM_005197chr1445764 4881 4194 946 14782 11623 1250
NM_005203chr101175 ------
NM_005204chr102921 68 ------
NM_005207chr2263531 3181 3171 2645 2601 120 13722 ----
NM_005214chr22829 162 1982 ----
NM_005224chr192677 669 ------
NM_005233chr342624 2397 2211 1692 11644 ----
NM_005235chr2167667 7435 6832 6517 6038 5858 5306 5045 4971 2830 2617 2385 872 730 416 227 16568 22678 497 --
NM_005238chr1123081 2992 --1841 --
NM_005241chr3--11397 21129 72 --
NM_005244chr201704 ------
NM_005249chr14136 1871 ----
NM_005254chr1531296 562 227 1113 ----
NM_005257chr1811071 ------
NM_005259chr281418 1184 1164 1019 367 269 131 110 ------
NM_005261chr82646 68 1302 ----
NM_005264chr103881 817 613 ------
NM_005277chr441851 1703 1308 423 --21503 208 --
NM_005284chr64511 480 180 152 ------
NM_005296chrX2189 43 3948 349 61 --1827
NM_005302chr7------1147
NM_005308chr101363 ------
NM_005318chr2211053 ------
NM_005327chr41244 1695 ----
NM_005339chr483868 3584 3550 3310 1305 1200 984 78 24242 3024 13155 13339
NM_005342chrX3535 399 169 2943 109 ----
NM_005359chr1855512 4686 2155 811 327 44672 1867 1133 50 21579 1556 2908 356
NM_005376chr121126 985 ------
NM_005385chr332522 208 144 32488 1724 652 ----
NM_005397chr733854 3591 302 23990 3803 --12505
NM_005398chr1051371 1305 1034 957 522 --1473 --
NM_005406chr1831529 1115 191 11138 --1621
NM_005410chr51678 1738 ----
NM_005436chr1063943 3704 3651 572 463 386 --23986 182 1559
NM_005443chr42443 231 --1411 --
NM_005455chr161734 1640 1498 1346 364 121 --2716 330 --
NM_005475chr1293276 2952 2277 1267 914 903 704 380 217 23053 2350 --12781
NM_005493chr63564 143 126 1637 1863 --
NM_005497chr1745763 4771 1749 230 --24832 4032 15442
NM_005502chr962637 2464 2416 2363 2101 835 --23310 754 --
NM_005504chr1296515 5194 2655 2431 1160 789 764 657 135 14159 15057 15969
NM_005506chr452358 2116 2054 593 330 1823 21061 963 22788 2352
NM_005509chr531864 1274 312 11598 ----
NM_005513chr351454 634 624 326 217 11173 ----
NM_005522chr731171 458 95 ------
NM_005524chr31266 ------
NM_005526chr81289 ----1374
NM_005530chr154942 563 291 23 ------
NM_005542chr741733 1506 1282 589 ------
NM_005575chr51853 2627 205 --1238
NM_005578chr384464 4194 3540 3475 3349 1204 625 270 --11151 34087 3206 1501
NM_005584chr131622 ------
NM_005587chr153765 216 124 1199 ----
NM_005595chr1133 ------
NM_005596chr9106460 5472 5159 4802 4728 3920 1185 816 344 260 12141 25765 4681 36100 1245 1178
NM_005607chr81841 ------
NM_005625chr82384 207 ------
NM_005627chr621018 97 1670 ----
NM_005639chr122450 23 11601 --1703
NM_005644chr11100 --1143 --
NM_005647chrX52825 1225 956 453 148 ------
NM_005655chr821285 79 1457 11329 --
NM_005664chr154902 435 378 132 1878 --1927
NM_005665chr1114758 4402 4196 3052 2980 1950 1450 899 571 303 151 11025 --21405 444
NM_005667chr2----2355 289 --
NM_005668chr574449 4108 3583 3311 1740 1151 733 23597 166 23833 262 --
NM_005685chr71115 ------
NM_005686chr121555 1258 ------
NM_005688chr33336 307 277 --11074 --
NM_005715chr662550 2307 2195 1729 1065 510 ------
NM_005717chr121181 274 ----11240
NM_005722chr252394 2288 816 660 391 ------
NM_005725chr132471 1950 836 1710 --22245 1725
NM_005737chr242162 2148 1801 160 ----11859
NM_005738chr721252 718 11821 21273 75 11308
NM_005739chr1572196 2059 1935 1631 664 542 85 --1788 1381
NM_005746chr752655 2484 927 744 632 1868 ----
NM_005748chr1273047 2654 1064 842 447 209 123 22186 1149 21169 835 --
NM_005756chrX41145 444 155 65 1268 ----
NM_005759chr243594 1879 1772 554 14565 1509 --
NM_005765chrX2788 98 --1579 --
NM_005779chr543514 1103 351 185 1473 11015 11212
NM_005786chr181835 ----1803
NM_005788chr112291 275 --1809 1795
NM_005792chr162469 83 ----1226
NM_005807chr15699 688 582 476 186 ------
NM_005808chr3113393 2466 2448 2442 2436 2430 2424 889 492 442 391 11093 23139 709 --
NM_005813chr271932 959 881 665 494 425 88 2737 98 22372 2168 --
NM_005817chr191656 --138 --
NM_005826chr12235 55 1555 ----
NM_005832chr341279 1037 404 152 --11395 11339
NM_005836chr8----151 --
NM_005839chr12154 91 ------
NM_005840chrX96984 5748 5355 2921 2372 2350 1200 650 214 25738 2235 46173 2760 1836 1631 --
NM_005843chr261641 1625 1478 1369 1280 268 --1146 31843 1563 665
NM_005853chr161417 ------
NM_005859chr511478 --11373 --
NM_005863chr102580 474 21252 1140 1332 --
NM_005880chr1621318 185 1412 11535 1152
NM_005885chr521121 36 21428 1251 ----
NM_005896chr22146 59 --3209 139 52 --
NM_005898chr1153000 2242 286 200 149 23195 3184 22748 2051 1369
NM_005899chr1751397 1350 1147 552 149 ----11049
NM_005900chr43972 847 212 ------
NM_005901chr18107947 6765 6740 6203 5626 2116 1819 1620 1448 1266 --46163 2616 2151 1065 21168 1038
NM_005902chr1543498 1697 1228 1153 13329 23957 1140 --
NM_005903chr594712 4172 1142 1085 1050 965 600 161 120 1510 --11412
NM_005906chr62664 25 1225 1271 178
NM_005909chr574123 3909 3112 1427 1196 550 517 22651 224 13566 13196
NM_005910chr1734112 4079 740 ----13854
NM_005922chr6160 ------
NM_005924chr72160 74 ------
NM_005935chr465071 4381 4083 3768 1496 772 34253 3732 1091 33394 1518 991 15175
NM_005941chr874131 4080 3329 3224 2573 1146 260 23579 921 31174 977 677 --
NM_005955chr195025 4688 4138 3618 2168 1801 1609 670 602 24304 4001 14161 --
NM_005966chr231605 1537 646 1270 1209 --
NM_005977chr132763 291 ----1899
NM_005999chr11100 ------
NM_006005chr41311 ------
NM_006007chr9113765 3703 3346 2818 1569 953 781 704 314 237 111 1195 21094 761 --
NM_006009chr12132 ------
NM_006011chr15103932 3424 3117 2915 1460 1268 1151 1144 1121 151 --13461 --
NM_006016chr642322 1540 521 209 12278 --12024
NM_006036chr252459 1778 674 524 153 2665 605 --1322
NM_006037chr274537 3051 1734 1589 1417 557 507 11281 14295 --
NM_006047chr2063411 2908 2223 1296 668 154 ----12813
NM_006048chr111256 ----11178
NM_006055chr292996 2945 2583 2497 2304 2055 912 534 22 ------
NM_006063chr22374 346 ------
NM_006080chr752523 1859 1045 719 647 --42754 2290 799 112 --
NM_006089chrX41893 1875 1333 725 --1421 1307
NM_006094chr842044 1982 1837 110 12022 ----
NM_006095chr494167 3846 3160 2967 1762 1490 1379 1220 622 54481 4225 3347 3264 718 23487 1304 43878 3361 1707 657
NM_006106chr1143024 2816 2258 1102 12978 12775 --
NM_006107chr17--1478 1413 --
NM_006114chr191473 ------
NM_006133chr1121528 526 ----12448
NM_006135chr141192 1183 457 214 ------
NM_006136chr731065 519 244 ------
NM_006139chr242893 2815 2632 2117 21894 1874 ----
NM_006145chr192726 147 ------
NM_006153chr32185 113 --1639 --
NM_006154chr1582677 2656 1178 967 949 916 487 196 22715 1149 ----
NM_006155chr232026 559 552 21603 779 ----
NM_006158chr821241 261 11167 21467 289 1678
NM_006166chr1262406 2356 2057 1746 1664 648 ----12153
NM_006167chr852329 1976 1607 720 647 --1335 --
NM_006182chr12191 48 ------
NM_006183chr122140 22 --1110 --
NM_006186chr21330 --11287 --
NM_006194chr1411228 --1891 1323
NM_006197chr841844 758 701 343 ----1310
NM_006203chr584794 4383 4059 3543 2089 1451 1241 553 44927 4470 4390 3404 1973 34616 4102 3592
NM_006206chr422655 1985 12442 --1808
NM_006218chr31121 ------
NM_006224chr1732389 1754 738 ----22449 747
NM_006237chr1311560 12219 1535 --
NM_006241chr332413 2306 23 1373 1576 11961
NM_006246chr1421078 94 ----11199
NM_006251chr563062 1287 974 631 569 312 22300 1139 1872 12492
NM_006256chr152340 2069 1076 866 585 ------
NM_006258chr1041469 1283 185 141 --11477 --
NM_006264chr41177 ----1208
NM_006265chr811351 2601 48 ----
NM_006267chr261598 1444 635 551 533 65 11634 --1114
NM_006281chr82344 101 ------
NM_006281chr82344 101 ------
NM_006282chr2074319 4133 4084 3172 3110 1523 298 ----13870
NM_006283chr854864 4220 1558 823 32 ----1587
NM_006298chr643325 982 506 120 1949 11223 --
NM_006306chrX35600 5531 1317 34060 3615 1823 ----
NM_006312chr122952 672 ------
NM_006313chr1241689 1667 375 208 --1223 --
NM_006315chr444495 3839 1120 179 ------
NM_006321chr361901 1510 1414 477 303 43 22126 1545 ----
NM_006322chr131598 ------
NM_006323chr42536 240 --135 --
NM_006324chr16176 --141 --
NM_006330chr81185 ----11572
NM_006345chr431072 873 204 11041 --164
NM_006352chr122086 58 21513 798 ----
NM_006364chr1441097 1059 885 103 21113 295 ----
NM_006366chr621193 334 11245 11073 --
NM_006371chr3115318 5030 4537 4144 3868 1948 1650 1397 945 522 287 11914 25075 1153 --
NM_006373chr1711162 ------
NM_006375chrX51751 1628 677 395 174 ------
NM_006380chr1774213 3786 3516 3348 1391 565 559 ----1945
NM_006382chr171289 ------
NM_006393chr1074517 3529 2984 1806 1510 1434 957 21576 199 1102 1714
NM_006401chr91434 ------
NM_006407chr331332 1043 310 ----1564
NM_006420chr2053200 2555 721 141 34 1321 --1595
NM_006421chr8131 1897 1350 --
NM_006422chr122216 90 ------
NM_006439chr41578 169 ----
NM_006451chr55994 856 244 179 89 1367 ----
NM_006457chr453909 3397 2977 2671 1639 --23718 3490 23388 375
NM_006459chr102350 87 ----11609
NM_006460chr1751552 705 562 315 43 ------
NM_006467chr552233 1826 516 460 156 12250 32003 1493 379 --
NM_006471chr182241 83 ------
NM_006482chr1263695 3626 3083 2737 1408 315 --23253 1566 12911
NM_006489chr142583 214 11461 ----
NM_006494chr191346 --1620 --
NM_006496chr151965 1411 1370 82 31 31452 584 213 1673 11634
NM_006500chr1131064 301 175 ----11118
NM_006517chrX2341 68 11692 --1880
NM_006520chrX51085 606 394 278 189 ------
NM_006526chr2031937 1511 164 --1152 1807
NM_006534chr2043313 2954 1047 187 ------
NM_006538chr21295 13133 --13805
NM_006539chr16------1109
NM_006544chr1476040 5788 5384 4767 1040 542 40 24678 3758 --24286 1191
NM_006546chr1775173 4907 2448 1848 1520 478 472 ------
NM_006557chr941729 1533 676 655 1665 11365 --
NM_006558chr81423 ------
NM_006561chr1074879 4188 4009 2475 2390 2187 525 11226 25385 4535 12143
NM_006572chr1741390 817 621 112 --22886 84 --
NM_006575chr1421405 158 1969 11264 --
NM_006587chr441488 1413 624 317 1132 --1222
NM_006599chr16148066 7661 6604 6155 6139 6107 3281 3137 1660 1250 1200 1163 860 778 35775 3208 143 16465 37331 7196 1302
NM_006603chrX51900 1645 629 405 211 11948 22054 574 --
NM_006614chr373336 2963 1227 1033 917 420 133 ------
NM_006624chr1031955 1870 283 1384 --11995
NM_006625chr131154 1052 775 ------
NM_006625chr131154 1052 775 ------
NM_006625chr131154 1052 775 ------
NM_006626chr922711 2619 ------
NM_006628chr1574609 4378 3510 1587 1380 1238 1142 13819 21440 870 --
NM_006629chr1822461 692 12434 21830 652 --
NM_006642chr1148 ----136
NM_006646chr1362379 2123 596 325 130 61 1891 21945 371 --
NM_006654chr1234223 3527 3219 24574 1790 14455 --
NM_006660chr15----2327 69 1344
NM_006667chrX3463 116 86 1974 ----
NM_006699chr192730 2516 2130 1812 984 950 433 404 43 42392 1772 1742 57 --12585
NM_006705chr9----1458 --
NM_006706chr52845 68 ------
NM_006713chr53745 624 60 --1344 --
NM_006716chr741375 248 210 105 ----1152
NM_006717chr933308 2399 410 13009 22127 750 --
NM_006718chr62986 69 1235 1975 --
NM_006720chr1055098 4677 3346 1850 1727 --34062 1455 1078 --
NM_006721chr102329 110 ------
NM_006722chr342623 2449 2414 2079 2536 197 21019 190 --
NM_006724chr6160 ------
NM_006726chr43380 306 224 --1338 --
NM_006727chr51380 --1560 --
NM_006729chrX105634 5439 5205 4657 4283 3614 1649 1249 1140 992 1211 35427 4083 3845 33789 1842 112
NM_006746chrX31547 1529 541 --1482 1267
NM_006750chr1678038 6189 5668 5148 2404 2036 1223 22901 123 27552 6333 37974 7783 1380
NM_006754chr741171 849 291 142 ------
NM_006759chr2147 ------
NM_006761chr171105 ------
NM_006765chr81218 --140 1250
NM_006766chr832162 309 223 ------
NM_006775chr663003 2769 2756 728 672 543 --12209 --
NM_006777chrX21121 942 12563 32274 2067 2033 11112
NM_006800chrX1586 ------
NM_006814chr2042304 2289 415 329 1927 --12673
NM_006823chr81487 ------
NM_006826chr23402 365 47 --1314 --
NM_006832chr142955 679 ------
NM_006838chr123582 542 364 21362 244 21929 1857 --
NM_006839chr2----1113 --
NM_006846chr51246 ------
NM_006850chr12969 235 ----1212
NM_006851chr1222728 1915 ----32456 796 263
NM_006852chr1742806 2285 2142 405 ------
NM_006854chr751843 1430 1424 1396 225 --1371 --
NM_006870chr20------1138
NM_006873chr242176 1179 1142 1067 32544 1356 652 33248 2958 222 --
NM_006884chr321513 339 --11754 --
NM_006885chr1683619 3583 3538 3298 1405 1121 185 83 --34038 3118 1702 13281
NM_006888chr1453536 2496 630 168 116 --21273 223 12597
NM_006896chr73940 892 26 177 ----
NM_006910chr163392 365 148 ------
NM_006914chr951333 1228 335 144 97 ------
NM_006915chrX1253 12101 12332 11611
NM_006918chr1155467 5181 5171 4934 3998 25885 881 34618 4127 1081 22340 998
NM_006920chr241316 141 113 41 --1495 --
NM_006922chr272316 2281 2127 741 560 167 39 22175 1775 12139 21898 366
NM_006924chr1763804 3251 862 766 619 155 34436 4381 3736 --11044
NM_006939chr143823 458 378 1114 --3921 276 99
NM_006940chr1231896 1807 415 --1339 --
NM_006948chr214591 544 463 141 ----1326
NM_006981chr952653 2508 2184 665 164 21868 560 --12446
NM_006988chr2131161 336 288 11087 ----
NM_006996chr151915 1536 1182 508 41 ------
NM_007005chr931356 1173 550 --21542 1465 1968
NM_007006chr1642826 2540 2288 2170 12396 ----
NM_007007chr12144366 4336 4042 3182 3011 1865 1825 1141 939 863 677 469 397 154 14386 24398 4286 --
NM_007008chr2--1864 ----
NM_007011chr1585862 5702 5696 5624 5332 2294 2013 1611 26865 2598 15347 --
NM_007013chr82731 269 ------
NM_007023chr2--3862 811 383 --1103
NM_007026chr172543 120 1559 ----
NM_007034chr12863 171 --1843 --
NM_007036chr51161 --1905 --
NM_007038chr21125753 5649 5493 4979 4969 4316 4229 2257 1081 593 488 243 11545 35365 4364 1648 34054 1810 460
NM_007039chr1431856 644 44 ----11871
NM_007043chr1241726 1376 1310 715 21359 636 ----
NM_007049chr62950 380 2832 148 2970 938 --
NM_007050chr20138086 8016 8009 7481 6815 6335 5248 5192 5125 2833 474 422 157 27454 6552 ----
NM_007054chr583838 3670 3638 3470 3281 2958 2716 164 13864 190 11048
NM_007067chr1721561 1516 ------
NM_007078chr1072880 2867 2427 2411 2217 2079 1125 ------
NM_007099chr2--1267 ----
NM_007107chr342157 887 642 392 --2860 463 --
NM_007111chr131808 ------
NM_007114chr332177 162 143 43273 2687 2195 815 1353 12421
NM_007124chr64717 631 402 394 ----11662
NM_007125chrY31370 989 55 ------
NM_007129chr131744 2957 919 ----
NM_007146chr1721925 962 --12422 22616 747
NM_007147chr1921175 1123 --11039 --
NM_007159chr31478 ----1170
NM_007166chr1151531 1282 1010 568 129 --11302 --
NM_007172chr222783 295 --12725 --
NM_007173chr1142411 2352 2163 149 ------
NM_007174chr122338 39 11761 12070 --
NM_007195chr1873606 3225 2691 2448 1241 736 77 ------
NM_007198chr861571 1482 1137 1102 330 214 21638 408 11313 --
NM_007203chr962650 1580 752 660 292 138 33272 1518 1231 1263 --
NM_007212chr152151 1804 1528 448 189 ------
NM_007218chr82918 680 1726 ----
NM_007222chr831519 1393 442 --1196 --
NM_007235chr12------1479
NM_007238chr2064895 3556 3517 1460 734 209 23118 520 --1648
NM_007242chr161198 ------
NM_007249chr13158987 6500 6481 5737 3691 3545 3247 2040 1456 1400 1128 1033 871 440 424 33536 1766 535 --48781 8695 3555 3396
NM_007287chr362421 2060 1062 1046 668 465 ----22330 853
NM_007288chr362421 2060 1062 1046 668 465 ----22330 853
NM_007289chr362421 2060 1062 1046 668 465 ----22330 853
NM_007294chr17--21359 53 --11096
NM_007295chr17--21359 53 --11096
NM_007296chr17--21359 53 --11096
NM_007297chr17--21359 53 --11096
NM_007298chr17--21359 53 --11096
NM_007299chr17--21359 53 --11096
NM_007300chr17--21359 53 --11096
NM_007302chr17--21359 53 --11096
NM_007303chr17--21359 53 --11096
NM_007304chr17--21359 53 --11096
NM_007305chr17--21359 53 --11096
NM_007313chr921986 1779 ------
NM_007315chr221248 128 --11502 --
NM_007322chr191582 ------
NM_007332chr821350 1000 11334 11129 --
NM_007345chr183617 463 107 22368 416 1800 2213 125
NM_007347chr1563233 2302 2056 373 113 45 ------
NM_007351chr451092 1009 837 790 321 1740 197 --
NM_007358chr131694 1560 712 ----11600
NM_007373chr1031527 482 63 ------
NM_007375chr172597 2415 2403 1744 622 537 269 12094 ----
NM_012069chrX52648 1897 1074 846 684 1934 1308 --
NM_012072chr2084400 3953 3258 3245 1261 742 512 171 34275 3933 3828 24176 240 --
NM_012073chr521232 118 11388 21367 74 --
NM_012081chr563738 2687 2655 1012 610 266 22675 1072 23405 2392 22318 1406
NM_012083chr103986 860 462 ------
NM_012089chr141449 1084 444 214 ------
NM_012090chr1------11239
NM_012092chr221457 635 --21569 329 1370
NM_012095chr1072959 2582 2142 1039 805 657 467 33309 2515 2173 ----
NM_012096chr353361 1488 1374 849 533 12994 62704 2663 2488 1434 905 461 11392
NM_012097chr21909 21792 67 1119 11730
NM_012102chr162523 2327 514 445 273 67 185 ----
NM_012104chr1182798 2623 2523 2403 1193 1173 1140 904 --13442 --
NM_012104chr1182798 2623 2523 2403 1193 1173 1140 904 --13442 --
NM_012120chr662849 2233 900 844 331 133 22725 338 2565 357 12416
NM_012137chr152889 2729 2560 2209 2112 ----1123
NM_012141chr1363620 2562 1588 1376 686 154 ----1133
NM_012153chr1162549 1974 879 585 577 294 --22487 2200 12561
NM_012154chr81641 --1238 --
NM_012157chr33944 724 119 ------
NM_012158chr1341534 1493 1136 274 1514 --11249
NM_012161chr42354 131 ----11112
NM_012164chr9127467 5849 5517 5022 2344 2282 1906 1828 1677 1474 1168 783 47532 7121 6963 5250 27011 975 --
NM_012175chr112593 88 1299 ----
NM_012180chr41713 ------
NM_012193chr1185366 4809 4196 4064 4002 3677 1037 484 11415 --1450
NM_012197chr921315 310 ------
NM_012199chr164236 3061 3052 1485 809 135 ----11625
NM_012214chr286315 6105 5322 4232 2258 2130 955 551 54394 2097 1796 1186 580 ----
NM_012215chr103642 317 262 ----1735
NM_012218chr1942948 2162 228 33 22275 912 --1770
NM_012223chr2----21288 1084 --
NM_012234chr353781 2749 2736 1073 316 12980 --11022
NM_012238chr1021608 1375 11247 ----
NM_012247chr104737 728 659 101 176 1783 --
NM_012249chr273149 2780 2186 590 368 272 63 23119 775 22945 1166 1142
NM_012250chr114519 332 241 69 11022 --1485
NM_012252chr785391 5175 5144 4841 4679 3332 1058 928 1341 34030 3534 556 11116
NM_012262chr165085 3572 3326 1746 1716 999 24732 4466 --23398 942
NM_012281chr782409 1552 971 742 736 583 550 90 ------
NM_012287chr3104553 4449 4225 4096 4025 3638 1404 1372 1036 278 11174 --13993
NM_012290chr241230 678 216 114 ------
NM_012294chr742905 1120 897 31 --11156 12688
NM_012297chr442641 2300 2257 639 2985 969 2514 257 --
NM_012300chr531955 625 318 11646 ----
NM_012301chr722179 1431 11896 --12089
NM_012302chr12505 474 2496 224 ----
NM_012307chr1821068 920 1241 2769 418 --
NM_012309chr1164758 4610 4573 3074 1961 1685 ----2954 711
NM_012317chrX1671 ------
NM_012319chr1811037 1144 --1843
NM_012327chr1821623 1027 --11189 --
NM_012328chr721360 942 --21044 554 --
NM_012329chr1741695 1549 535 289 ----1263
NM_012330chr102272 54 1617 --1248
NM_012338chr7----11150 11017
NM_012381chr6169 ------
NM_012388chr1533169 555 518 ----12898
NM_012406chr122262 72 ------
NM_012420chr1031947 789 214 --22019 743 --
NM_012421chr14463 424 124 43 ------
NM_012429chr22----11385 --
NM_012446chr52420 405 1231 1528 --
NM_012448chr1722540 1574 22180 595 ----
NM_012464chr462656 2593 2100 1957 1795 184 11163 1262 12303
NM_012465chr1043384 2479 1323 1172 --22862 216 --
NM_012471chrX2600 231 11584 ----
NM_012479chr752256 972 602 591 435 22006 460 ----
NM_012482chr13442 248 82 ------
NM_013229chr1252728 2145 1009 711 514 22586 125 ----
NM_013230chrY31460 1155 542 11260 31475 1176 397 11625
NM_013231chr1444375 4314 3632 3055 1202 1504 --
NM_013233chr231413 584 184 11440 ----
NM_013238chr13199 165 1202 31234 722 625
NM_013243chr1551164 1049 904 411 122 --1140 --
NM_013254chr12----2505 98 --
NM_013257chr882412 2194 2147 1604 753 572 312 42 21895 1771 ----
NM_013261chr493690 3505 3477 2973 2594 2503 1084 184 109 22847 924 13165 --
NM_013269chr1284408 4364 4325 3811 3192 2993 1764 1060 12948 14185 --
NM_013281chr201225 183 --11114
NM_013282chr194963 927 251 167 ------
NM_013286chr323825 2954 33722 3571 3383 --13285
NM_013302chr16114527 4492 4136 4073 1337 1212 1180 1121 1019 365 193 23969 1411 --24719 4513
NM_013309chr1561986 1949 1896 613 453 226 1880 --22200 248
NM_013322chr741736 1606 620 226 11234 11297 --
NM_013341chr252245 2153 554 394 376 --22859 1919 1360
NM_013346chrX157 ------
NM_013354chr831276 516 387 11024 ----
NM_013357chr83697 309 178 --1608 --
NM_013373chr2221019 1013 --11028 --
NM_013374chr392777 2642 2310 713 626 308 276 80 60 1341 1139 --
NM_013380chr192763 632 ----1327
NM_013381chr1232286 1771 1654 11531 12179 --
NM_013390chr9------11464
NM_013423chrX31005 894 466 3877 859 145 1271 --
NM_013427chrX31005 894 466 3877 859 145 1271 --
NM_013437chr82999 69 ----1352
NM_013448chr143709 236 180 ------
NM_013449chr1232724 2537 2443 ------
NM_013450chr22174 74 ----11282
NM_013952chr252386 2052 1716 1699 655 ------
NM_013953chr252386 2052 1716 1699 655 ------
NM_013989chr1494234 3873 3640 3581 1129 1088 451 377 284 ----11980
NM_013992chr252386 2052 1716 1699 655 ------
NM_013993chr61782 --1734 --
NM_013994chr61782 --1734 --
NM_013995chrX52379 2351 2259 2013 215 2159 30 ----
NM_014000chr1061784 1559 1286 1272 1262 549 ------
NM_014007chr91364 ----21241 928
NM_014011chr262537 1637 920 885 730 199 41691 639 439 219 1403 1578
NM_014021chr152635 2476 921 602 417 13328 13308 --
NM_014028chr653291 3248 2613 1290 651 32736 2410 1344 --12191
NM_014043chr331601 1085 1020 ----177
NM_014048chr1694519 4430 4292 4268 4157 3287 1847 1148 83 34231 3972 685 24376 194 14997
NM_014071chr201136 ----150
NM_014079chr311022 ------
NM_014089chr1362059 1857 829 820 664 322 12096 --1623
NM_014112chr895364 5347 3517 2023 1749 1623 1408 1314 363 24271 3877 21973 1555 --
NM_014117chr1661703 916 486 201 126 65 ------
NM_014141chr795007 4980 4954 3895 2109 2094 784 510 348 44741 4331 809 410 34924 4472 727 21962 1899
NM_014155chr11107197 7114 6563 6546 5257 2376 2365 2202 1654 1149 --1261 15099
NM_014157chr1633449 698 618 53779 2781 530 463 44 13800 --
NM_014178chr143514 209 176 --165 --
NM_014181chr252933 813 646 418 368 --22527 2444 12952
NM_014191chr122809 119 ----162
NM_014220chr33700 585 255 --2822 298 1124
NM_014231chr122744 623 --1754 --
NM_014240chr331464 1438 511 44138 4109 1525 524 22735 847 --
NM_014243chr491823 1448 1353 768 602 437 373 181 95 2631 233 ----
NM_014253chrX21587 869 --12509 --
NM_014263chr1031468 1264 350 --21512 75 11412
NM_014267chr113663 178 48 1126 --1824
NM_014278chr42464 63 1428 ----
NM_014283chr141377 470 207 180 21021 462 --1189
NM_014289chrX21415 945 1318 11307 21143 978
NM_014290chr91211 ------
NM_014294chr831300 1189 492 2971 425 11138 21089 302
NM_014296chr31208 --11437 --
NM_014309chr2241544 1414 1336 76 24802 560 2624 456 --
NM_014315chr14----1167 --
NM_014317chr101266 1222 ----
NM_014319chr1231885 631 416 1533 21270 37 --
NM_014331chr4157856 7560 7520 7364 6265 5296 5288 1969 1195 1008 959 482 402 385 91 11764 35070 1164 303 16163
NM_014333chr1132316 2060 1716 22845 2806 1735 12776
NM_014344chr111825 1653 ----
NM_014372chr121971 1507 ----1703
NM_014376chr522423 1941 ----11627
NM_014379chr83853 659 168 ----124
NM_014381chr1443284 844 538 446 ----32089 2007 967
NM_014382chr331416 617 291 21776 1664 ----
NM_014392chr441576 575 290 23 ----21110 370
NM_014393chr821820 381 12375 ----
NM_014410chr18------1311
NM_014415chr33641 166 98 --168 --
NM_014418chr1432003 198 147 ----21811 302
NM_014421chr482004 1868 1796 1684 1507 1445 1403 748 --41949 1935 1353 502 11808
NM_014423chr5125302 5211 1812 1476 1384 1343 718 642 601 575 515 220 34297 760 369 24791 1515 11464
NM_014426chr202641 493 --1588 1138
NM_014429chr33639 613 607 --1178 --
NM_014445chr341979 1800 390 331 ------
NM_014447chr421629 372 --1200 --
NM_014452chr621031 445 ----11081
NM_014454chr6----154 1969
NM_014455chr1--1385 1187 1170
NM_014458chr131375 1315 156 11290 11083 --
NM_014494chr1652180 753 630 208 112 12014 --11561
NM_014500chrX2201 40 ------
NM_014506chr941669 1482 640 201 ------
NM_014517chr31321 11539 ----
NM_014548chr151395 ------
NM_014572chr1321613 345 ------
NM_014573chr1741202 311 253 38 21843 1792 --21610 1588
NM_014574chr14155 21200 1097 --11422
NM_014575chr3--1217 ----
NM_014577chr221320 --2748 362 --
NM_014584chr1441596 1507 1072 521 ------
NM_014585chr251265 1152 975 514 241 --21214 986 2904 376
NM_014592chr52119 87 1767 ----
NM_014602chr3149 ------
NM_014603chr1711342 ----11674
NM_014606chr421283 1185 --1406 --
NM_014607chr231552 1398 464 --1815 1109
NM_014612chr921538 202 1320 ----
NM_014613chr543080 2666 2536 868 --32931 2435 2051 --
NM_014614chr241356 1337 995 150 11117 181 --
NM_014615chr1653284 3067 2934 2775 719 2532 102 13449 --
NM_014629chr871231 1050 1026 469 201 90 65 ------
NM_014630chr1553758 3581 3485 3086 3015 --23524 2804 --
NM_014635chr231139 130 112 11687 11714 148
NM_014636chr9124086 3730 3303 3240 3229 3055 2882 1680 1531 1221 404 217 --12658 --
NM_014647chr1631775 799 51 1879 22295 1427 11577
NM_014666chr541232 1136 935 119 ----1891
NM_014667chr372047 2017 1781 1560 1536 1518 35 ------
NM_014670chr231580 1014 202 ----1336
NM_014671chr731595 1443 276 129 1461 11095
NM_014674chr323658 720 1730 13679 23786 557
NM_014675chr1----1468 --
NM_014676chr121370 314 ------
NM_014677chr821343 1091 2878 42 ----
NM_014682chr812030 21932 1523 2376 111 --
NM_014686chr1942567 2541 2518 573 ----11954
NM_014690chr753114 2978 2600 997 974 --22395 640 --
NM_014693chr31721 ------
NM_014701chr1523265 3227 12466 21303 670 1767
NM_014702chr673371 3118 2889 1213 1183 539 73 12959 ----
NM_014705chr71601 --21627 1432 146
NM_014707chr762205 1732 1563 150 136 120 --1775 --
NM_014711chr1641928 374 309 73 ----2531 265
NM_014721chr6136755 6545 6054 5530 4913 2314 2214 1893 1850 1525 1310 1295 1203 11701 26879 2088 --
NM_014729chr842211 856 848 579 --11542 --
NM_014733chr542244 1711 690 304 --21887 215 --
NM_014735chrX31945 524 392 --1174 2688 451
NM_014736chr152289 67 ------
NM_014739chr673568 3347 2763 1203 378 123 22 34197 804 670 1288 --
NM_014743chr452927 1257 1248 760 452 --12959 12662
NM_014747chr175788 5649 4803 3919 2223 1258 610 15571 25190 3815 14896
NM_014748chr2145 ------
NM_014751chr841804 1686 1566 223 --2289 80 --
NM_014755chr293716 3444 1386 1275 1161 1143 753 571 514 33752 2786 660 2360 121 --
NM_014757chr52956 842 --12122 1470
NM_014765chr111958 --12125 1215
NM_014766chr723500 1176 --42411 527 307 180 23766 1489
NM_014776chr1232251 2207 2101 1346 13171 188
NM_014781chr8--11004 ----
NM_014787chr162707 2197 1973 1832 783 607 ------
NM_014790chr53326 106 54 --2500 179 --
NM_014803chr1062614 2322 1962 1815 553 489 --12064 --
NM_014810chr183252 3221 2939 2828 1320 1213 641 400 1867 13133 13262
NM_014812chr191862 1532 1451 1434 1358 1270 668 332 104 --11987 11345
NM_014819chr5--1582 32453 1731 867 21971 47
NM_014820chr381967 1873 1818 1572 1544 553 385 357 --1790 11622
NM_014824chr1131983 1566 31 --11365 --
NM_014828chr143769 608 551 ----11644
NM_014829chr572204 1710 1546 1538 792 616 63 2740 493 171 1637
NM_014836chr101406 31683 589 76 21831 616 --
NM_014839chr192220 2163 2088 2041 1624 731 439 432 389 22487 2206 ----
NM_014844chr1454211 3227 2619 1087 437 43330 3092 1120 1081 ----
NM_014850chr344625 3008 438 336 ------
NM_014862chr1544211 3315 1689 1071 ------
NM_014864chr174069 3130 1252 1067 819 760 374 23220 465 --137
NM_014867chr813450 23349 3083 23405 1031 1943
NM_014868chr121196 ------
NM_014872chr932370 2098 1799 ------
NM_014873chr1104680 4580 4497 4329 4011 3248 1339 648 386 71 33273 3024 1770 --24306 619
NM_014876chr2251764 1752 1646 647 412 --168 12238
NM_014877chr17217772 7699 7009 6878 6524 6412 6041 5979 5610 5166 2943 2539 2515 2210 2094 1600 1497 1377 992 375 81 27061 304 17690 --
NM_014883chr472378 1788 1772 1720 1002 703 429 42039 2019 482 101 --1337
NM_014888chr741534 1058 477 403 159 --1978
NM_014893chrY82350 1991 1665 1629 459 449 380 234 12179 42222 2124 2107 754 --
NM_014898chr1971873 1769 1699 1668 1634 668 365 --1816 --
NM_014900chr21957 --1318 1267
NM_014901chr542010 1558 1524 162 ------
NM_014902chr2021270 1041 --1362 --
NM_014903chr1232165 1557 944 --32195 905 340 --
NM_014904chr1043626 2992 2946 915 21375 1205 13271 --
NM_014905chr251491 823 664 529 101 --11917 --
NM_014906chr17114022 3674 3496 3339 2921 2754 2702 2605 2529 1251 909 33482 2870 956 --64011 3943 3624 2618 1637 887
NM_014912chr10103209 2923 2833 2364 1343 1317 1092 955 681 157 42548 2391 1393 966 23483 2275 --
NM_014918chr15--1324 2425 105 --
NM_014920chr663649 2786 1535 1241 1169 78 --11490 32974 1061 364
NM_014923chr1331669 1652 404 11958 ----
NM_014924chr1453211 2601 2177 688 31 --13153 12532
NM_014932chr341518 761 441 80 ------
NM_014933chr41126 ------
NM_014934chr1343971 3545 3292 1603 ----33995 2457 1480
NM_014938chr1222402 1616 ------
NM_014939chr1851519 419 304 218 59 1117 11229 --
NM_014946chr252982 2040 966 451 98 181 1841 1591
NM_014947chr162902 1237 988 710 463 330 --23169 2998 --
NM_014949chr11181 1409 --11071
NM_014950chr1411783 21623 364 21669 1087 --
NM_014953chr1354002 3544 3201 707 132 42903 1576 723 377 ----
NM_014961chr442031 1768 769 96 --42065 1647 397 342 --
NM_014962chr2032673 2353 525 1818 1654 32501 1968 79
NM_014978chr1041745 1623 1404 544 1521 ----
NM_014982chr1455121 3638 1980 864 569 --34992 2006 1297 11866
NM_014988chr4102721 2629 2417 2014 1923 1785 1091 715 512 389 12173 ----
NM_014989chr661840 1658 1335 370 360 200 11321 ----
NM_014991chr453243 2583 2123 1312 95 ------
NM_014997chr732617 2518 411 22689 84 ----
NM_014999chr122567 309 1533 21464 1253 1204
NM_015000chr1233136 2867 119 1423 1134 23033 575
NM_015001chr12198 46 11005 ----
NM_015002chr1231506 1488 354 1178 1789 1700
NM_015008chr352923 1328 1269 657 122 --22717 92 --
NM_015009chr32267 139 1829 ----
NM_015015chr1921739 287 21374 557 --21385 358
NM_015025chr252215 1844 1066 124 84 12617 ----
NM_015026chr1254184 3855 1755 1629 248 34679 4121 1507 23259 461 --
NM_015032chr1352759 2635 2438 935 665 12709 32000 1845 430 --
NM_015035chr2075684 5623 4538 4454 2357 927 336 12473 26353 2308 --
NM_015040chr253148 2776 1093 1026 659 12770 --2981 482
NM_015042chr153617 568 483 --21156 1126 --
NM_015046chr922786 261 --22331 2113 --
NM_015051chr913382 23425 3187 --13045
NM_015054chr121182 --1500 1416
NM_015056chr2172636 2152 1983 1946 677 560 235 42023 992 201 53 12443 --
NM_015057chr131105 1569 --125
NM_015061chr91568 ------
NM_015064chr1253162 565 520 425 169 1467 --11217
NM_015068chr7103977 3940 3614 3575 3149 3014 2902 2623 2411 379 ----12580
NM_015071chr595891 5830 5676 5666 5178 2393 497 199 33 21520 1453 26022 445 36432 5693 5461
NM_015074chr174206 4179 3708 3595 1894 1519 635 14425 ----
NM_015075chrX31801 1780 1651 --12034 --
NM_015076chr674308 4254 3526 1726 759 614 61 34021 3784 3292 ----
NM_015087chr1342441 2340 2036 1908 1121 ----
NM_015091chr146809 781 564 299 289 41 ------
NM_015092chr1694048 3731 3650 3547 3349 1186 1091 597 206 12886 --12988
NM_015097chr352173 1513 575 511 175 --12144 --
NM_015110chr981975 1786 1709 983 800 655 581 153 1280 1876 11631
NM_015115chr443065 994 671 209 1216 12562 --
NM_015130chr421329 1172 1882 11016 --
NM_015132chr731981 1296 93 11543 1167 --
NM_015137chr882176 2081 1989 910 755 733 532 376 1460 12165 21928 418
NM_015143chr431123 1076 129 1508 ----
NM_015147chr233219 936 556 --33296 670 187 2988 528
NM_015149chr152158 1998 486 391 299 ------
NM_015156chr1463985 3620 3509 3025 668 85 21232 653 12840 --
NM_015158chr92587 27 ------
NM_015163chr1461938 1705 1432 526 145 136 11786 1642 --
NM_015172chr121620 151 --11326 --
NM_015176chr121176 297 --21702 564 --
NM_015185chrX32906 1959 1109 --22776 1068 --
NM_015191chr1142449 2283 2050 446 12040 --11969
NM_015192chr2032584 2531 2383 2814 68 12266 --
NM_015199chr362587 2296 675 660 527 374 12394 12075 1174
NM_015200chr452328 2077 1744 1677 391 ----2566 61
NM_015206chr1553453 2859 1173 1153 576 --13288 1125
NM_015208chr1831368 1088 785 33748 3153 751 22559 98 --
NM_015215chr132312 625 143 --22100 596 12350
NM_015230chr431365 437 81 1559 11898 --
NM_015231chr115967 657 134 127 64 1380 --1300
NM_015234chr641340 1248 320 279 ------
NM_015235chr1042175 2037 1893 1682 1267 1297 --
NM_015236chr441174 1154 1064 352 ----1950
NM_015247chr16115245 4277 3932 3884 3653 2035 1905 1756 1308 872 508 24415 1789 2561 533 21300 826
NM_015250chr931877 1512 135 22011 812 ----
NM_015251chr1642158 1473 677 579 ----1288
NM_015252chr22935 855 ----1699
NM_015264chr2274511 4205 3594 3502 1607 1459 264 13410 34700 4424 1068 14057
NM_015265chr272401 2259 2215 1881 434 428 393 ------
NM_015268chr32669 641 ----2273 129
NM_015269chr13529 473 199 ------
NM_015271chr473955 3373 3333 3003 1667 462 236 43694 899 744 44 14242 1221
NM_015272chr1671988 1712 1590 1435 1407 762 640 --1100 21659 1579
NM_015275chr1261744 820 797 630 354 316 ------
NM_015277chr183708 299 272 31262 1219 578 --11812
NM_015278chr621332 1106 1808 23436 1234 --
NM_015282chr221924 121 --11932 --
NM_015285chr1872297 2201 2100 1826 1599 514 213 22137 871 12405 --
NM_015291chr143241 756 633 351 1899 --12492
NM_015299chr1493373 2808 2595 2530 942 850 844 807 795 2906 594 11041 --
NM_015310chr8128096 7936 6667 5909 5776 2981 2213 2145 1685 1542 909 812 37841 5134 1888 38104 2080 1589 17141
NM_015313chr1144738 4732 3356 1695 21405 864 --34720 3418 1796
NM_015314chr752510 2315 1998 690 188 ------
NM_015315chr542508 369 342 190 ----12964
NM_015317chr242570 1924 1046 624 --22411 397 22543 1007
NM_015319chr12------1485
NM_015326chr152428 2020 483 466 447 22392 620 11147 --
NM_015328chr742986 2978 2952 1169 12755 12434 --
NM_015335chr1252654 2539 2283 160 46 22234 1975 --179
NM_015336chr121132 22329 934 12235 11878
NM_015344chr832018 1432 229 2662 432 ----
NM_015347chr1231125 588 318 12699 ----
NM_015349chr632963 2479 2295 23070 2196 --1454
NM_015352chr2023286 2941 22693 777 1355 --
NM_015355chr1731976 1869 573 1444 1594 --
NM_015358chr21--1876 ----
NM_015359chr852853 2845 2132 947 269 11162 1784 12959
NM_015361chr21817 ----1973
NM_015365chrX52956 1262 960 814 37 33491 1611 1240 24194 1375 --
NM_015375chr141051 1039 596 506 13868 --13545
NM_015382chr14----1230 --
NM_015387chr231548 853 256 11652 1626 --
NM_015393chr431402 1197 160 --31070 541 438 22686 2402
NM_015396chr331382 1358 280 ----21123 452
NM_015397chr931756 1359 29 21681 713 ----
NM_015419chrX5987 940 423 271 227 --2722 151 --
NM_015420chr8------163
NM_015429chr31712 --21136 109 1180
NM_015446chr141633 1173 597 408 --1348 --
NM_015447chr91497 ----2709 678
NM_015455chr553545 3539 880 685 594 12729 12586 --
NM_015458chr8105311 5148 4783 4597 4258 4220 3609 1193 646 83 24542 852 24961 615 14731
NM_015475chr22999 977 1894 ----
NM_015477chr15--1198 --1392
NM_015484chr11913 --1849 1665
NM_015508chr321271 582 1238 --11181
NM_015509chr1221179 626 ----1490
NM_015525chr621075 29 --1860 --
NM_015535chr273792 3730 3053 3032 1593 1320 953 43987 3136 764 358 14179 13578
NM_015550chr773303 3095 2977 2896 2735 1258 143 13119 1168 13378
NM_015553chr644110 3240 1109 688 23166 1378 --11660
NM_015554chr1562885 2754 2178 2056 1981 51 32285 882 688 1718 --
NM_015555chr621527 1420 1101 11226 11102
NM_015564chr571414 1383 843 694 656 291 48 33435 2192 1131 ----
NM_015565chr2141745 679 427 421 --11868 1212
NM_015568chr2073976 3957 3524 2816 2692 2676 631 --23065 3026 13842
NM_015569chr141658 1504 1116 595 ----11409
NM_015570chr731719 1345 672 11523 ----
NM_015571chr63970 790 587 ------
NM_015575chr263571 3414 3240 3140 2713 2548 21286 790 1103 --
NM_015576chr341988 1160 878 79 --42659 2343 2013 1068 --
NM_015578chr1911848 12022 11485 --
NM_015602chr121399 680 --11350 11438
NM_015630chr22978 366 ------
NM_015635chr941774 1641 1580 553 1246 22203 1849 1473
NM_015642chr3------1317
NM_015652chr102105 37 ------
NM_015678chr1331306 525 91 1344 ----
NM_015691chrX32457 2285 147 ----12950
NM_015695chr642125 1537 1438 507 --1771 --
NM_015702chr2----1129 159
NM_015713chr852996 2860 2675 2489 2462 --23323 2443 128
NM_015714chr11348 ------
NM_015833chr2142286 1969 1693 471 ------
NM_015845chr181142 2598 300 ----
NM_015850chr842159 1578 674 429 ------
NM_015852chr793498 3288 2747 2648 774 557 473 186 53 113470 3277 2472 1227 1146 894 810 726 642 306 222 --21307 1062
NM_015866chr111175 21480 1273 11306 --
NM_015869chr3----1163 --
NM_015878chr862254 2141 1902 1782 1502 323 12118 21919 167 --
NM_015888chr122978 820 --12186 --
NM_015891chr631459 737 94 11970 ----
NM_015892chr1052476 1965 1680 1504 798 --1966 162
NM_015902chr81263 ----172
NM_015906chr164262 3938 2941 1455 144 109 34389 4137 2967 ----
NM_015938chr32374 236 --21009 807 --
NM_015967chr15792 373 320 89 34 3393 209 47 --1875
NM_015975chrX41187 697 571 359 1192 21131 314 --
NM_015986chr173959 949 281 11248 ----
NM_015990chr451132 1030 770 352 21 ------
NM_015994chr142630 261 ----1686
NM_015995chr1575568 5480 5392 4649 3413 1444 661 ------
NM_016009chr164844 4316 4180 3969 3575 1615 21040 215 11758 --
NM_016023chr841927 1783 1729 1508 --12117 11596
NM_016040chr162623 2403 2057 1904 514 496 31067 473 389 11815 11960
NM_016045chr2011297 31687 1156 495 11513 --
NM_016048chr52835 256 1184 ----
NM_016072chr1242048 735 398 111 1137 11805 --
NM_016073chr1531071 831 730 ------
NM_016076chr153201 2542 2075 722 278 --12265 1302
NM_016078chr175860 796 399 391 317 --11143 1943
NM_016083chr663733 3493 3116 566 352 198 13460 23853 398 11473
NM_016090chr113669 238 140 --1102 --
NM_016097chr1811062 1190 2726 709 1684
NM_016098chr61177 ------
NM_016107chr561289 1078 530 515 467 78 ------
NM_016120chrX----21211 881 --
NM_016121chr12386 82 --2203 96 11005
NM_016131chr232154 422 416 22341 58 --1328
NM_016133chr251530 1369 1135 213 171 11615 ----
NM_016138chr1651500 1212 440 291 153 11836 --21731 28
NM_016152chr32817 363 ------
NM_016179chr131215 ------
NM_016200chr72699 145 ------
NM_016206chr3158374 7779 7311 7039 6716 6559 6506 6430 5756 1971 1865 1804 1173 926 661 68752 7525 7129 2597 1095 618 36776 6093 2867 13115
NM_016211chr41126 ------
NM_016219chr9----1463 --
NM_016224chr621611 304 ----22231 1534
NM_016227chr141377 470 207 180 21021 462 --1189
NM_016234chr103742 709 407 --1861 --
NM_016248chr1393972 2477 1255 1193 1162 1119 910 611 216 22521 833 --1603
NM_016252chr21386 ------
NM_016255chr632987 523 423 53297 2863 2664 2103 823 1618 --
NM_016257chr143398 2165 853 815 1183 1556 --
NM_016260chr2146876 6513 6098 5954 5522 4914 2783 2533 2264 2095 648 627 595 68 ------
NM_016271chr1842158 1483 516 35 ------
NM_016272chr2252229 2184 1071 646 285 1166 ----
NM_016275chr332540 351 198 --11819 2577 523
NM_016277chr691433 1154 1130 1048 627 257 218 143 79 11403 11204 11269
NM_016279chr5--1110 1348 --
NM_016281chr1211054 170 --125
NM_016289chr222202 1705 ------
NM_016316chr23548 266 252 ----1219
NM_016322chr952721 2283 2221 2133 1206 --1469 --
NM_016328chr71115 ------
NM_016356chr632944 2298 1807 32767 556 121 ----
NM_016374chr121369 593 21530 1030 --11551
NM_016374chr121369 593 21530 1030 --11551
NM_016376chr1763549 3527 3054 2888 638 469 ----1939
NM_016377chr621618 1296 ----21758 576
NM_016395chr1551384 753 561 410 330 11905 11964 --
NM_016396chr1562720 2466 2008 1044 485 265 11896 --13029
NM_016424chr1711497 21983 181 21918 804 --
NM_016426chr221645 1191 ----
NM_016436chr2032415 995 912 22506 852 ----
NM_016441chr221514 576 22031 440 42393 2347 788 154 --
NM_016451chr11130 ------
NM_016454chr15148 ------
NM_016467chr24961 424 110 30 --11413 --
NM_016470chr201429 ----1480
NM_016485chr642260 1870 1412 321 22097 387 11538 1290
NM_016507chr1752871 2222 1129 508 105 1120 --12565
NM_016513chr663649 2786 1535 1241 1169 78 --11490 32974 1061 364
NM_016530chr1553206 3182 2834 680 410 --13373 23296 987
NM_016531chr473454 3325 3304 3033 2864 908 87 23430 861 --34041 3342 3292
NM_016542chrX41380 1249 652 606 --21655 327 --
NM_016603chr522162 1930 2457 267 ----
NM_016605chr552449 2229 1104 1014 533 12622 12100 1640
NM_016607chrX31558 1116 256 ------
NM_016613chr452084 508 480 459 147 1334 12534 21755 592
NM_016620chr121023 172 --11040 11262
NM_016626chr1841483 497 435 34 --1476 11294
NM_016628chr101324 --1672 1342
NM_016644chr52499 39 ------
NM_016651chr1411179 ------
NM_016654chr1531296 562 227 1113 ----
NM_016824chr1051675 1655 1284 613 479 ----1146
NM_016834chr1734112 4079 740 ----13854
NM_016835chr1734112 4079 740 ----13854
NM_016836chr21164 --1173 --
NM_016839chr21164 --1173 --
NM_016841chr1734112 4079 740 ----13854
NM_016929chr644174 1521 1290 400 14636 --14417
NM_016936chr1662004 1652 1558 870 646 305 ------
NM_016946chr173182 2622 2588 726 333 107 30 ----13509
NM_016950chr43547 265 31 ----31516 605 48
NM_016952chr1141620 862 575 513 --1812 12620
NM_016953chr2105960 5349 4968 1915 1884 1624 1284 1016 395 36 44259 3959 1393 26 33913 1215 1033 11513
NM_017410chr12--11129 ----
NM_017412chr821031 1000 2884 346 31239 1081 929 --
NM_017415chr553668 1607 917 708 596 --1275 12787
NM_017416chrX1150 ------
NM_017420chr1443629 2558 1190 143 22875 2821 2654 288 --
NM_017423chr482083 1946 1496 591 447 228 179 80 31748 1567 675 2193 162 --
NM_017426chr41572 ----1525
NM_017440chr122456 194 ------
NM_017444chr841246 546 351 328 1614 --11787
NM_017447chr2174349 3673 3068 1735 1252 1073 494 13419 14419 24238 1098
NM_017451chr1711111 ------
NM_017522chr12352 89 1180 --1534
NM_017545chr201379 ------
NM_017548chr332032 813 399 --11524 2251 93
NM_017563chr386388 5212 5202 4453 3929 3867 1578 514 25554 2545 --36361 1080 360
NM_017567chr2------190
NM_017569chr131139 ----1384
NM_017594chr973383 3372 3266 3091 2331 489 349 12268 13115 --
NM_017599chr1231569 1302 121 --11344 21922 46
NM_017610chr1531570 355 154 ------
NM_017617chr941552 1526 1433 173 ------
NM_017628chr495183 4492 2106 2004 1983 1748 1239 1082 598 ----15169
NM_017629chr151836 1612 584 542 141 --1291 --
NM_017632chr41127 ------
NM_017634chr841454 1448 1245 733 1743 11520 11353
NM_017637chr9179352 9342 9085 7915 7419 6536 6515 6166 3698 2315 1781 1691 1407 1395 837 762 602 47147 5862 2948 411 ----
NM_017641chr121217 1143 11070 1276
NM_017643chr1763129 2866 2182 1239 747 41 1390 22583 2285 --
NM_017644chr3144779 4342 4121 3741 1973 1925 1738 1438 949 687 669 295 179 162 --34996 1483 64 12027
NM_017650chr7105008 4832 4164 4108 3669 2155 1811 1161 473 415 --1159 --
NM_017657chr22694 169 1306 ----
NM_017658chr1484559 4163 4155 3021 2869 1738 956 252 11791 33818 3135 1586 24108 2889
NM_017666chrX32008 1377 903 11792 --11823
NM_017672chr1521383 837 1859 ----
NM_017684chr1542058 1738 478 210 --157 --
NM_017693chr1331379 1027 271 11512 ----
NM_017694chr281776 1491 676 589 479 439 215 165 ------
NM_017709chr164154 3280 2808 1349 641 228 13129 1167 --
NM_017714chr20----2800 341 1318
NM_017719chr351627 712 537 313 221 ------
NM_017736chr1652468 2460 2120 359 276 42821 2663 781 597 147 12212
NM_017737chr142213 712 609 533 21702 624 ----
NM_017742chr183522 284 95 --1351 --
NM_017752chrX31991 1652 379 --1597 11801
NM_017753chr93821 799 51 --1845 --
NM_017754chr673691 3621 3608 3470 1739 1124 995 --33584 1421 727 --
NM_017758chr1741463 519 446 129 --11530 --
NM_017762chr1521976 1644 --11848 --
NM_017768chr13788 668 186 ------
NM_017769chr1442610 2251 2024 578 22461 2357 12472 11172
NM_017770chr623017 427 --32491 671 381 --
NM_017780chr83819 645 62 ------
NM_017784chr321020 375 --1938 --
NM_017786chr8----1601 --
NM_017799chr1411214 ----1477
NM_017811chr932927 2090 512 22014 1942 12934 1300
NM_017813chr865445 5125 2240 904 881 290 24314 3808 34226 4061 407 14179
NM_017831chr18124470 4161 3546 3331 2893 1799 1737 1373 1322 1232 233 188 14701 23299 986 14038
NM_017848chrX74663 4305 3532 3078 1597 1311 987 --13575 13936
NM_017851chr1521261 927 1412 21221 344 --
NM_017902chr10105651 5427 5248 4947 4571 3823 2239 1080 673 421 ------
NM_017913chr93352 301 41 --1319 1392
NM_017915chr123982 936 451 1799 1114 139
NM_017919chr9125327 5300 5173 4748 4399 4148 3542 2157 1344 1127 858 289 ----25767 4426
NM_017926chr144595 349 291 280 ----1222
NM_017933chr231438 599 330 --21576 542 --
NM_017934chr6------135
NM_017935chr42574 34 --1249 --
NM_017938chrX41725 1615 1577 784 1769 1112 11861
NM_017943chr141743 21044 46 ----
NM_017952chr264573 3872 2891 1410 1233 670 193 --11781
NM_017972chr144595 349 291 280 ----1222
NM_017987chr1082196 2174 2042 1358 600 152 129 40 31472 1399 537 ----
NM_018000chr232248 1696 130 ----22155 1550
NM_018003chr151549 1924 22166 683 1214
NM_018011chr131250 --1148 126
NM_018014chr21356 1506 --11108
NM_018017chr1052431 2066 1774 460 287 22262 875 22364 149 11115
NM_018018chr1241632 656 621 43 11389 31424 1214 1196 --
NM_018027chr1053279 3065 3036 2388 576 12219 1762 --
NM_018030chr181695 1207 --137
NM_018036chr1423948 1777 ----23478 669
NM_018051chr72133 71 ------
NM_018061chr111105 139 ----
NM_018064chr61248 ------
NM_018072chr1------1145
NM_018078chr441020 763 724 96 --1873 1312
NM_018085chr1117262 6258 5751 5480 5317 5261 3130 3039 2862 2407 1841 15232 1560 1904
NM_018092chr1651556 1282 1210 394 167 1106 ----
NM_018103chr1176 ----1308
NM_018105chr831113 191 141 ------
NM_018106chr7144 ------
NM_018114chr3--1100 ----
NM_018117chr10--1782 ----
NM_018120chr821515 304 1191 --1611
NM_018124chr162221 93 1168 --1932
NM_018125chr1------1392
NM_018126chr451599 1444 1304 117 108 124 --11387
NM_018147chr32279 182 --2261 96 --
NM_018150chr12883 153 ------
NM_018155chr342968 922 832 334 126 12333 --
NM_018157chr1243230 3206 2242 953 42843 667 628 562 12076 22043 278
NM_018159chrX31691 318 157 21273 693 ----
NM_018164chr122114 74 ------
NM_018171chr121639 --2367 197 --
NM_018184chr352114 1909 1841 574 38 11719 1376 --
NM_018191chr1351678 1407 1386 89 72 --11592 1842
NM_018195chr1142064 1996 486 43 ------
NM_018202chr11217 ------
NM_018211chr182024 1761 763 744 507 457 238 39 11954 ----
NM_018217chr20147 ------
NM_018221chr2----1330 --
NM_018222chr1161937 1797 1728 1703 452 126 ------
NM_018227chr432715 1983 1956 ----1249
NM_018243chr442888 1445 1401 1316 33672 3548 980 1807 12689
NM_018244chr2021258 1095 21134 1070 ----
NM_018247chr64933 628 395 29 --23021 1978 11122
NM_018254chr162407 2050 1864 966 954 280 --1189 --
NM_018263chr242305 2153 1969 161 1241 --11642
NM_018285chr15133 ------
NM_018287chr1041340 1048 976 481 ------
NM_018293chr352928 1139 806 237 57 --22095 390 1423
NM_018299chr853048 2238 1360 1300 1019 23458 2660 --12505
NM_018302chr442064 1874 659 124 12000 ----
NM_018312chr1121340 735 1520 22161 110 --
NM_018313chr33678 471 424 2875 646 --1538
NM_018323chr431154 268 151 1367 ----
NM_018325chr981520 1340 1065 1055 614 366 333 137 11176 2429 235 --
NM_018327chr203668 661 398 --11577 11814
NM_018330chr1021076 76 31668 490 368 ----
NM_018339chr951769 1702 1373 1268 106 1629 --1519
NM_018362chr1183306 1440 1280 479 442 321 238 75 22990 1582 13568 --
NM_018364chr183443 3110 2844 2687 1338 471 157 106 11642 1435 1115
NM_018367chr1152056 1909 1828 992 793 --22478 81 --
NM_018372chr12197 184 --1577 --
NM_018373chr1456092 5492 4339 271 91 35779 5305 1545 16495 25962 2004
NM_018374chr7134897 4424 4109 4103 4043 3853 3513 2004 1835 799 546 253 112 --11551 13812
NM_018388chrX51347 1127 1036 501 60 --1411 --
NM_018393chr111247 ----1216
NM_018409chr483049 2525 2426 2297 914 273 119 62 22045 235 1905 --
NM_018424chr921367 586 21343 1281 1514 11469
NM_018429chr53653 643 263 --22402 2182 --
NM_018431chr204573 421 243 214 --1148 --
NM_018433chr22189 155 ------
NM_018442chr12345 72 ------
NM_018445chr151576 ------
NM_018448chr1221107 955 ------
NM_018452chr6_random62710 2568 972 952 543 378 3925 599 465 ----
NM_018460chr2158 ------
NM_018466chrX1124 --1736 192
NM_018475chr43668 72 21 ------
NM_018476chrX157 ------
NM_018482chr841898 1862 790 494 21684 502 32265 605 270 12365
NM_018489chr122189 877 12168 --12251
NM_018490chr1121702 1636 1560 21671 394 --
NM_018557chr241756 1186 362 216 --21697 228 --
NM_018566chr154680 3530 1362 672 180 --35048 1156 195 11134
NM_018569chr441635 1538 1462 574 1137 21059 999 11609
NM_018584chr11450 ----1208
NM_018590chr1021432 1406 11367 --11492
NM_018638chr1275712 5411 4381 4200 3526 3434 1444 35238 4918 1467 --24931 230
NM_018640chr1252812 2464 2309 2199 1051 12349 ----
NM_018649chr102597 480 ------
NM_018650chr172011 1379 719 620 368 314 178 --1457 --
NM_018667chr1622782 860 --1263 1256
NM_018684chrX21245 932 ------
NM_018693chr2----192 --
NM_018695chr522241 1866 1250 --1573
NM_018698chrX51498 702 488 196 85 ------
NM_018703chr163392 365 148 ------
NM_018708chr1921643 1027 --11561 --
NM_018710chr84958 862 386 233 --21167 364 --
NM_018718chr741758 291 246 92 ------
NM_018719chr741178 467 197 88 1160 ----
NM_018724chr11549 ----1638
NM_018841chr153537 3146 2762 1175 709 23684 2460 43570 2482 1556 766 --
NM_018844chr731935 1751 236 --21790 741 --
NM_018846chr7--1134 --11001
NM_018898chr582270 2092 926 695 683 575 125 94 1934 ----
NM_018899chr582270 2092 926 695 683 575 125 94 1934 ----
NM_018900chr582270 2092 926 695 683 575 125 94 1934 ----
NM_018901chr582270 2092 926 695 683 575 125 94 1934 ----
NM_018902chr582270 2092 926 695 683 575 125 94 1934 ----
NM_018903chr582270 2092 926 695 683 575 125 94 1934 ----
NM_018904chr582270 2092 926 695 683 575 125 94 1934 ----
NM_018905chr582270 2092 926 695 683 575 125 94 1934 ----
NM_018906chr582270 2092 926 695 683 575 125 94 1934 ----
NM_018907chr582270 2092 926 695 683 575 125 94 1934 ----
NM_018908chr582270 2092 926 695 683 575 125 94 1934 ----
NM_018909chr582270 2092 926 695 683 575 125 94 1934 ----
NM_018910chr582270 2092 926 695 683 575 125 94 1934 ----
NM_018911chr582270 2092 926 695 683 575 125 94 1934 ----
NM_018945chr643430 2931 2505 2499 13459 23108 560 --
NM_018948chr141385 1280 1248 206 --1214 --
NM_018951chr71247 11095 ----
NM_018970chr763132 2021 1170 1009 156 132 ----1730
NM_018976chr1242507 2300 1844 396 --22082 1139 12004
NM_018993chr2021207 68 11310 1562 1457
NM_018999chr1074826 4233 3393 1979 1765 1396 55 1837 14676 11410
NM_019000chr52611 340 1323 ----
NM_019004chr732317 927 595 --22207 1868 22358 1532
NM_019006chr15----2633 206 138
NM_019022chr1863156 3136 2808 2428 2223 88 ----11144
NM_019027chr442577 2132 952 346 ----11857
NM_019028chr111161 ----1387
NM_019035chr431876 1686 1620 --11345 --
NM_019036chr6149 11120 ----
NM_019042chr7--11039 1269 1492
NM_019044chr253993 3618 3561 1100 62 ------
NM_019045chrX3770 274 43 --1745 --
NM_019051chr9--2420 165 ----
NM_019058chr101748 ------
NM_019063chr211906 --21723 1561 --
NM_019067chrX134708 4654 4274 4212 4081 3886 3604 3324 3242 1806 1524 318 95 34670 630 616 1553 13641
NM_019071chr73654 137 122 ------
NM_019072chr5124183 3995 3839 3425 3357 3208 2646 2614 1568 1401 712 687 24124 3005 ----
NM_019074chr153979 66 57 ------
NM_019084chr1052568 565 535 480 208 12507 1460 --
NM_019102chr71283 ------
NM_019102chr71283 ------
NM_019114chr93926 680 447 11700 ----
NM_019117chrX83201 2825 2625 976 729 618 145 95 1274 22733 2697 32816 1232 848
NM_019555chr351556 1350 1240 1182 322 ------
NM_019556chrX41148 1005 249 184 1406 ----
NM_019590chr1051187 1121 596 434 214 2579 229 2208 60 --
NM_019593chr2052044 635 501 331 143 11202 1264 --
NM_019895chr33791 774 373 1840 123 11043
NM_019903chr1051675 1655 1284 613 479 ----1146
NM_020039chr123652 335 188 ------
NM_020064chr9--1727 ----
NM_020116chr41684 1536 273 39 --
NM_020120chr2180 ----11039
NM_020122chr295260 5159 4571 4070 2015 1795 1677 1023 574 --15603 24308 2200
NM_020130chr831434 896 102 1183 1906 11025
NM_020132chr2164929 4786 3281 1605 1271 387 23867 1980 24468 3312 --
NM_020141chr142401 2269 2120 2015 1193 ----
NM_020144chr741910 1657 1637 1376 1185 --11450
NM_020150chr1032073 1436 820 ------
NM_020154chr151121 190 ----
NM_020156chr72217 62 2471 146 ----
NM_020159chr431181 386 65 ----1243
NM_020177chr533115 3042 443 31035 1018 629 1151 12749
NM_020178chr173909 266 43 ----1155
NM_020182chr2053624 3045 1126 748 147 23032 574 33647 390 272 --
NM_020193chr1151345 996 950 473 237 11220 ----
NM_020198chr1741096 1067 492 163 1410 --21464 438
NM_020199chr541095 1083 813 233 ------
NM_020204chr12176 153 1580 182 1214
NM_020205chr143460 2245 1301 216 ------
NM_020225chr4172 ------
NM_020245chr654471 764 690 582 491 21631 1122 --23643 425
NM_020336chr2063222 2964 1384 1220 1157 46 --11498 --
NM_020337chr453030 2845 1969 552 121 22690 2395 --12103
NM_020341chr2021298 336 ------
NM_020342chr252475 1919 1613 997 114 12101 ----
NM_020346chr1111110 31567 509 330 ----
NM_020369chr71108 ------
NM_020378chr191583 ------
NM_020390chr3134785 4584 4555 3671 3064 3017 1970 1462 1056 994 832 396 219 24529 4504 33196 3002 723 24291 1482
NM_020403chr1321774 118 1441 21784 88 --
NM_020416chr432038 1782 788 22671 1853 11660 --
NM_020425chr641928 1916 1449 716 ------
NM_020432chr732316 176 121 ------
NM_020443chr155810 2134 2017 1935 1643 1305 --16081
NM_020452chr142118 1981 1356 342 ----11886
NM_020455chr641799 528 197 162 ----188
NM_020456chr1362213 2153 1768 1706 709 32 12128 1396 --
NM_020457chr16179 1612 1530 --
NM_020463chr251459 600 367 46 38 ------
NM_020465chr1621585 1377 11534 11398 11577
NM_020466chr664924 4543 3804 3315 1514 1034 14945 24500 4073 14685
NM_020473chrX31924 409 126 --1387 149
NM_020474chr1831694 590 111 --3747 497 236 --
NM_020532chr2--1864 ----
NM_020630chr102686 129 ------
NM_020640chr382292 2041 1852 1844 1599 783 756 729 ------
NM_020647chr842121 1775 1554 60 ------
NM_020648chr1832779 2286 1797 --32821 2506 616 --
NM_020651chr22724 359 11465 ----
NM_020653chr17----132 --
NM_020654chr321410 1219 --11504 --
NM_020673chr2096411 6039 5909 5114 4886 3030 1881 1076 894 --27711 1499 27800 2734
NM_020686chr1632927 2909 2782 ------
NM_020697chr81150 ------
NM_020698chr1252914 2844 2756 140 77 21056 396 ----
NM_020699chr165233 4837 4493 4365 4245 347 --11007 --
NM_020711chr231753 1709 560 1303 --1546
NM_020717chrX43276 3188 971 723 11705 25041 3120 --
NM_020718chr1696626 6233 5828 4580 4415 2100 1614 1583 512 25883 1271 --22414 2365
NM_020727chr2173617 3302 3080 1189 967 719 215 11416 24002 3344 --
NM_020728chr752968 2948 2055 373 220 23098 915 --11985
NM_020734chr1222913 426 2362 195 --1186
NM_020737chr62285 98 ------
NM_020739chr1532907 1214 711 1140 11250 1656
NM_020742chrX52479 2423 1076 398 202 22248 2124 12193 12542
NM_020749chr841606 1530 675 52 ----1847
NM_020752chr1052859 2717 2322 2060 617 21140 730 32935 2625 2422 --
NM_020755chr631280 501 266 21090 407 11552 --
NM_020760chr231672 1640 578 --11938 --
NM_020768chr543038 2640 812 493 22315 1150 --13001
NM_020769chrX2936 219 --1955 1841
NM_020771chr631463 505 311 ----1469
NM_020772chr1778423 8062 7767 5727 2216 1936 33 28584 5279 48594 6968 5258 697 17438
NM_020774chr1875716 4883 4561 4487 4183 1377 382 1162 35028 4660 4653 25869 963
NM_020778chr15124344 3994 3703 1628 1404 1243 745 548 382 338 327 290 ------
NM_020783chr1822165 67 22198 1670 ----
NM_020786chr162505 243 ----2494 392
NM_020787chr1731534 565 120 1977 ----
NM_020791chr17196 2343 60 21163 979 11330
NM_020794chr131441 1407 1340 ----1170
NM_020796chr533055 2745 248 31908 990 456 1845 --
NM_020800chr321397 554 ----11145
NM_020801chr52366 167 12215 --1616
NM_020803chr44964 685 608 96 --11507 --
NM_020805chr1821781 556 1144 21485 183 1260
NM_020809chr1162315 1832 1625 592 408 292 --12110 --
NM_020810chr1441218 1064 660 649 22782 2492 12413 22231 125
NM_020819chr62965 471 ------
NM_020821chr1542058 1738 478 210 --157 --
NM_020830chr273124 3034 2497 1047 974 587 526 2954 110 33199 3042 923 --
NM_020841chr1273672 3483 3344 2833 620 329 251 --14057 11076
NM_020843chr151138 ------
NM_020844chr876867 6478 2395 2343 1744 1164 119 --57257 5905 5889 5547 567 1787
NM_020853chr1231099 924 912 --12816 12600
NM_020854chr1841453 597 351 187 1589 11148 --
NM_020858chr1522311 670 ------
NM_020859chr463816 3617 3574 3549 2609 1181 13221 1418 --
NM_020860chr44888 414 326 245 1907 ----
NM_020861chr61879 ----139
NM_020866chr1311080 ------
NM_020870chr421960 1394 --1298 --
NM_020871chrX52435 2124 574 402 337 11774 11870 --
NM_020872chr331429 335 214 --11498 2624 584
NM_020899chr1752462 1945 1918 831 552 11880 --12451
NM_020917chr1933143 2858 1267 22880 476 11419 22933 2513
NM_020918chr1053553 2825 2668 252 177 ------
NM_020921chr1443662 1151 1030 1004 1332 12483 11469
NM_020922chrX71562 1401 1366 1269 724 662 388 ------
NM_020925chr121183 306 2988 45 --1915
NM_020929chr11------1109
NM_020935chr233138 2916 681 ----23375 648
NM_020940chr1072947 2657 1046 963 629 297 212 ------
NM_020948chr193264 3212 2343 1371 1274 1141 1022 691 362 --12583 --
NM_020951chr1941709 429 371 343 --22042 264 --
NM_020962chr1562264 2131 1700 824 577 308 22444 2048 ----
NM_020964chr1893674 3505 3446 3198 3073 3027 1500 469 45 ----14834
NM_020975chr1021745 1626 ----11618
NM_020987chr1041191 890 880 202 --1404 1319
NM_021005chr1531033 190 106 --1467 --
NM_021007chr282338 2185 1939 758 568 515 142 42 12457 --2395 116
NM_021012chr1712650 ----1439
NM_021032chr321730 137 21471 564 ----
NM_021033chr1353005 2957 427 371 186 12558 31361 254 226 22165 107
NM_021038chr343316 2526 2406 829 11071 12520 21321 446
NM_021069chr442046 756 576 500 --1665 --
NM_021072chr582562 2137 2041 2030 1853 900 882 444 1169 --2935 831
NM_021083chrX33599 2955 1116 33248 2313 1380 13391 11316
NM_021090chr2264764 4495 4242 3488 3141 1027 ------
NM_021097chr2----22545 1941 --
NM_021106chr9----1505 --
NM_021111chr931193 422 259 ----1183
NM_021132chr101533 ----1303
NM_021136chr142657 614 179 ----
NM_021145chr7154 1945 1905 --
NM_021148chr782409 2371 2360 2228 2028 1874 1677 710 32001 1907 259 ----
NM_021159chr451744 1612 1506 1392 1095 ------
NM_021183chrX41647 935 757 668 12484 184 12380
NM_021190chr121322 214 --11162 --
NM_021205chr132890 2624 1900 1531 ----
NM_021238chr1231895 1738 153 21807 70 --12039
NM_021239chr1411057 ----11019
NM_021249chr1411295 11121 1283 --
NM_021252chr1051469 1436 1422 1391 260 --1199 --
NM_021255chr1454096 2885 2835 1127 344 12738 122 --
NM_021619chr911112 ----11220
NM_021622chr1051677 1578 785 406 376 ------
NM_021627chr32969 410 ------
NM_021629chr334727 1738 55 11027 --21341 123
NM_021645chr1342212 2109 1703 73 22227 1670 --1678
NM_021647chr434377 1156 393 --31819 1536 594 14018
NM_021648chr672369 1718 696 473 245 209 26 ----12553
NM_021783chrX42301 2194 1839 324 1124 12209 22428 1904
NM_021813chr685535 5524 4115 3718 1789 395 284 120 45343 5031 4076 1715 13650 --
NM_021814chr651628 1606 1525 1087 105 ------
NM_021815chr253015 2956 2709 2014 519 11139 12205 --
NM_021818chr1431384 1319 128 11326 ----
NM_021905chr642049 1480 442 316 --1544 --
NM_021911chr583628 3418 3408 1571 1093 1078 834 227 14533 ----
NM_021912chr1543233 1552 1259 859 23145 2557 23329 601 13059
NM_021914chr143941 718 281 22029 322 12286 --
NM_021943chr651574 870 856 842 710 21660 1581 --11553
NM_021949chrX52773 1114 846 808 667 1399 --1884
NM_021956chr611038 --1179 --
NM_021960chr151993 1926 750 708 434 22737 1083 ----
NM_021961chr11137530 5586 5441 5354 5316 4986 4802 2499 2057 1181 875 379 316 1719 ----
NM_021964chr3126612 6255 5922 5504 4291 2342 1654 1518 1502 1207 898 422 35331 2011 1316 24062 2638 11216
NM_021967chr53989 430 139 --11109 155
NM_021973chr4------1668
NM_021998chrX41234 1063 959 115 21121 271 ----
NM_021999chr133760 266 60 ------
NM_022037chr22871 42 1784 ----
NM_022041chr1622214 1925 1144 22356 2012 11987
NM_022045chr81278 ------
NM_022048chr15106006 5333 4304 2289 2168 1819 919 636 412 284 14987 15074 22520 2158
NM_022051chr13576 250 36 --1724 --
NM_022058chr231484 1371 118 --1673 --
NM_022062chr11----1348 --
NM_022066chr17--2912 108 1986 --
NM_022087chr72641 554 ------
NM_022091chr61105 31840 689 657 12072 1993
NM_022118chr133565 74 22 ------
NM_022130chr541106 453 379 101 11194 --1120
NM_022131chr351313 1134 1074 532 284 --11110 --
NM_022133chr841914 505 497 132 11625 ----
NM_022166chr1654995 4396 2290 1593 262 25279 4971 --1514
NM_022173chr22871 42 1784 ----
NM_022336chr241797 1611 824 719 22135 1917 12293 1414
NM_022351chr873859 3618 3190 3163 2530 1165 1025 13313 1151 --
NM_022361chr61432 1549 --1179
NM_022444chr751855 1497 676 441 122 --1254 11623
NM_022459chr1385103 4713 4348 4263 2161 2101 2037 1334 14437 15588 21496 40
NM_022461chr32278 125 ----1341
NM_022475chr41271 ------
NM_022476chr16----1946 --
NM_022477chr2031714 1232 1170 ----2672 396
NM_022482chr2052509 1861 1605 198 119 1634 --11776
NM_022491chr1242971 1402 1174 902 ----12840
NM_022495chr141361 ------
NM_022550chr51108 ------
NM_022552chr23786 459 449 ------
NM_022566chr151550 ------
NM_022574chr71176 1134 11966 --
NM_022716chr141123 1077 681 345 42918 1232 714 105 ----
NM_022725chr1122123 58 --11766 2547 45
NM_022726chr631549 1287 1236 ----11309
NM_022733chr11402 --1888 --
NM_022739chr1741054 990 303 134 1941 ----
NM_022757chr33889 408 201 ------
NM_022763chr362898 2204 2074 1956 916 114 22340 672 ----
NM_022768chr11130 ------
NM_022771chr121380 ----1150
NM_022778chr111170 --11256 --
NM_022781chr962186 949 654 550 294 162 32154 351 153 ----
NM_022782chr121358 --2323 115 --
NM_022802chr1021292 146 1468 2421 337 11583
NM_022824chr541549 474 408 370 --11276 1717
NM_022831chr12706 375 11845 ----
NM_022832chr4112592 2583 2524 2483 2400 1860 644 376 324 209 159 22572 1868 ----
NM_022841chr1562704 2590 1834 547 327 272 ------
NM_022843chr132139 120 ----11363
NM_022844chr163946 714 362 1785 1155 --
NM_022845chr1682129 1853 1748 1695 591 535 497 37 11650 ----
NM_022893chr273149 3063 2606 2048 838 565 332 ------
NM_022898chr1434574 1939 1103 24449 1536 ----
NM_022901chr931613 1516 648 --31576 1278 220 21624 696
NM_022902chr52428 345 1358 ----
NM_022910chr1621585 1377 11534 11398 11577
NM_022912chr21697 2741 586 22185 466 12586
NM_022918chr1142189 436 391 289 12052 11878 1407
NM_022965chr431286 1269 1116 --11311 1613
NM_022970chr10--11412 1436 11476
NM_022977chrX12216 12544 ----
NM_022978chr53989 430 139 --11109 155
NM_023000chr143669 590 68 11072 11502 --
NM_023001chr143669 590 68 11072 11502 --
NM_023016chr242815 2530 2189 2154 2945 341 12340 11107
NM_023039chr5--1364 --1426
NM_023071chr1211134 ------
NM_023074chr191960 --1105 --
NM_023105chr842159 1578 674 429 ------
NM_023106chr842159 1578 674 429 ------
NM_023110chr842159 1578 674 429 ------
NM_023111chr842159 1578 674 429 ------
NM_023929chr852093 2057 1988 1731 1717 --22337 1970 --
NM_023934chrX51890 1453 483 300 55 ------
NM_023943chr31185 --1155 --
NM_024007chr522309 338 2354 52 32298 305 186 22835 427
NM_024016chr173832 788 689 --2844 550 --
NM_024052chr1742456 1995 922 289 1796 ----
NM_024094chr83913 665 578 --1844 --
NM_024295chr8----11821 12003
NM_024311chr171165 ------
NM_024315chr72450 391 ------
NM_024336chr162382 86 ------
NM_024339chr16----173 --
NM_024345chr935870 4883 539 55746 5489 5271 3721 2016 15105 --
NM_024415chr51179 ------
NM_024423chr1883536 3288 2978 2912 1096 895 766 230 23838 1436 ----
NM_024430chr1861748 1374 521 499 187 124 1753 --1206
NM_024511chr462949 2531 2167 1264 453 391 --1870 --
NM_024513chr353203 2461 784 321 168 12469 --23344 2897
NM_024519chr162294 284 ------
NM_024524chr312959 22566 1131 ----
NM_024525chr1------1641
NM_024529chr11170 --1362 --
NM_024541chr1031239 693 298 ------
NM_024546chr1341236 1215 439 88 ------
NM_024556chr115481 464 391 326 79 154 ----
NM_024561chr1321407 166 ------
NM_024569chr122243 306 --1358 --
NM_024582chr41969 123 ----
NM_024590chr431695 1227 747 --11809 --
NM_024613chr841839 1385 670 370 21376 639 31887 1870 195 --
NM_024616chr311460 1954 21544 156 11118
NM_024624chr251316 515 413 178 171 --1340 --
NM_024626chr131327 1034 42 ----156
NM_024631chr112621 413 --1429 --
NM_024639chr651921 864 764 615 124 ----1204
NM_024641chr672655 2331 1155 1111 748 346 139 12560 3670 505 290 11994
NM_024646chr163940 3904 3199 2664 811 782 --33213 1300 279 --
NM_024665chr364398 4188 3606 3208 1329 112 34229 3357 442 13793 34343 3643 1802
NM_024670chr1021462 249 11124 2412 114 --
NM_024700chr13920 910 256 1328 ----
NM_024702chr17168 ----1102
NM_024713chr1531317 1039 659 ----164
NM_024721chr862714 2446 2371 1858 1801 981 --12212 12174
NM_024725chr114814 680 165 100 ------
NM_024740chr11114147 3640 3626 3373 3002 1165 1063 781 692 204 70 24051 2921 21083 676 11626
NM_024744chr232660 834 537 2629 338 127 --
NM_024749chr141943 1778 80 49 --11523 --
NM_024751chr441713 1591 1404 587 2660 167 1187 --
NM_024761chr995260 5190 4478 4303 4043 4007 1949 932 283 --11836 --
NM_024763chr111097 --31202 1028 176 1905
NM_024770chr286432 6028 5611 5231 4069 1553 1049 453 36203 6049 5515 26482 4985 34564 1287 1246
NM_024812chr851910 1896 1846 378 310 2458 237 11583 --
NM_024817chr15115299 5196 5117 4801 4668 4275 3760 3695 1359 1134 174 25961 1869 25753 4131 --
NM_024824chr1431592 1202 681 11681 11732 172
NM_024828chr911074 21527 1258 1392 1269
NM_024835chr17------1344
NM_024837chr1531684 1469 238 ----31572 1552 1178
NM_024881chr1973782 3316 3010 2835 2618 2540 350 ------
NM_024887chr141713 1698 1639 645 11985 21648 1335 --
NM_024899chr182265 49 ------
NM_024908chr152186 137 1592 ----
NM_024913chr761636 1455 1414 1169 653 382 ------
NM_024927chr171209 ------
NM_024930chr562685 2629 2290 1744 957 193 12355 1770 --
NM_024947chr3179585 9555 9204 9141 9111 9072 8404 7376 6662 3298 2418 2269 1935 1429 1145 353 213 47729 7105 1325 1061 35820 2021 154 39626 1049 525
NM_024948chr102713 305 1292 ----
NM_024949chr444470 3356 1931 1877 --11075 --
NM_024953chr1212409 12186 22699 35 1320
NM_024979chr1341576 1194 566 505 --1413 --
NM_024989chr2127216 6804 6604 6481 6392 5627 5401 2975 2863 2253 1182 356 36681 2602 2316 1121 --
NM_024993chr21148 11431 --11647
NM_025040chr1942080 2010 1539 492 22496 1974 ----
NM_025054chr833674 2863 1538 1353 1861 21152 206
NM_025069chr82171 158 ------
NM_025077chr1------1238
NM_025104chr1741457 1197 295 97 --1258 11494
NM_025125chr10232 24 1533 --11407
NM_025134chr1692552 2110 633 615 450 389 383 364 229 --11740 11638
NM_025151chr842196 2131 1420 172 --22100 1370 --
NM_025152chr1441876 1351 675 291 2231 84 22006 1443 --
NM_025160chr154247 3673 3155 2613 158 54178 3778 3763 3350 3084 23260 1587 --
NM_025184chrX3817 766 160 ----1714
NM_025191chr173327 2979 2760 2355 2348 666 253 ----12631
NM_025221chr43950 499 407 11255 ----
NM_025222chr382971 2694 2410 1955 915 609 522 119 --12143 --
NM_025235chr1071841 809 551 514 440 374 64 21943 1713 11934 1486
NM_025244chr2--147 ----
NM_025268chr141391 ------
NM_030621chr14104186 3581 3487 3024 1690 1541 1463 873 777 726 ------
NM_030623chr2--21675 117 ----
NM_030627chr583231 3082 3006 2884 2858 941 276 147 21284 182 12613 --
NM_030637chr142639 187 1291 ----
NM_030647chr7126343 5431 5286 4876 4686 4090 2096 2046 1903 1136 1007 716 25466 1531 --21879 1521
NM_030648chr4105580 5438 5123 4819 4242 3852 3640 1924 1609 660 14164 25391 595 --
NM_030650chr253438 2919 733 706 490 11569 2662 460 --
NM_030660chr1411021 ----11211
NM_030670chr1251676 796 582 385 249 1407 ----
NM_030671chr1251676 796 582 385 249 1407 ----
NM_030674chr1275103 5042 5015 4566 1594 458 91 44342 1872 1098 838 35857 3983 166 11082
NM_030751chr1031697 1612 503 1510 11606 11772
NM_030751chr1031697 1612 503 1510 11606 11772
NM_030752chr61531 ------
NM_030755chr1492912 2515 2271 1078 955 844 569 303 139 ----23006 1981
NM_030759chr101642 ------
NM_030762chr1241910 1896 1581 1434 --11872 --
NM_030773chr2021655 91 21803 526 --11494
NM_030777chr2052290 1698 587 525 259 --52488 2472 2334 2318 1551 --
NM_030780chr881630 1132 631 569 274 154 117 83 11095 --11327
NM_030786chr121708 1651 --21456 444 1497
NM_030791chr141556 ------
NM_030806chr199112 7825 7629 7038 6676 3579 3442 2829 318 13535 35733 344 288 --
NM_030808chr171917 11078 ----
NM_030809chr1232478 2131 1950 --12220 1533
NM_030816chr1113320 3200 2865 2754 2272 1049 648 359 353 347 308 13087 --12955
NM_030918chr174105 1961 1685 1588 1383 1300 125 --11426 --
NM_030920chr141838 1540 379 315 31811 709 92 11591 --
NM_030922chr152741 242 1541 ----
NM_030938chr172765 459 --1113 --
NM_030939chr63897 832 450 3854 737 726 1921 --
NM_030949chr641537 440 362 311 --11504 --
NM_030952chr11425 ------
NM_030953chr5----134 1246
NM_030960chr61351 161 ----
NM_030972chr192568 167 2588 86 ----
NM_031216chr1842218 1977 1933 1392 --1664 --
NM_031243chr762255 2186 1795 1766 1611 864 12093 2691 644 22284 851
NM_031266chr51467 ------
NM_031267chr7157 --1397 1443
NM_031268chr1653747 3582 1608 1324 1126 14793 25243 3907 14730
NM_031283chr21142 ------
NM_031291chr42502 460 --1123 --
NM_031296chr442271 1766 859 92 11868 --1733
NM_031305chr42206 131 11409 1155 --
NM_031362chr242137 1749 944 241 22637 1031 12699 11876
NM_031365chr252273 1885 1844 1080 377 22773 1167 12835 12012
NM_031366chr252273 1885 1844 1080 377 22773 1167 12835 12012
NM_031371chr121369 593 21530 1030 --11551
NM_031371chr121369 593 21530 1030 --11551
NM_031372chr421394 1047 21122 1102 ----
NM_031411chr582270 2092 926 695 683 575 125 94 1934 ----
NM_031422chr182461 183 --2537 73 --
NM_031431chr1351612 1281 353 330 70 11701 ----
NM_031442chrX83025 2613 2607 728 276 188 169 59 1229 ----
NM_031445chr273158 2976 2693 2114 1076 831 507 11352 13225 --
NM_031452chr153535 98 86 ------
NM_031461chr841996 1686 906 287 --1259 22086 156
NM_031469chr662618 1579 1281 1266 1195 156 2605 502 ----
NM_031483chr2063559 2923 2270 1259 376 345 33492 2474 629 11294 3687 580 192
NM_031844chr151341 1172 816 732 253 ----13281
NM_031845chr2103412 3363 3201 3102 2966 2332 1276 1121 217 139 33551 2356 1421 ----
NM_031847chr2103412 3363 3201 3102 2966 2332 1276 1121 217 139 33551 2356 1421 ----
NM_031849chr582270 2092 926 695 683 575 125 94 1934 ----
NM_031857chr582270 2092 926 695 683 575 125 94 1934 ----
NM_031858chr1751397 1350 1147 552 149 ----11049
NM_031860chr582270 2092 926 695 683 575 125 94 1934 ----
NM_031862chr1751397 1350 1147 552 149 ----11049
NM_031889chr421358 52 ------
NM_031892chrX----1360 --
NM_031915chr131222 ----1287
NM_031922chr64544 504 494 383 ----1403
NM_031935chr12976 293 ------
NM_031954chr1232728 2530 1094 11059 --12541
NM_031966chr5------135
NM_032012chr994884 4349 3818 3614 3268 1096 1085 1008 659 13783 14387 21537 1017
NM_032013chr2031714 1232 1170 ----2672 396
NM_032042chr552700 2058 1046 721 649 ----1663
NM_032047chr3102424 1937 1865 1666 1622 1577 1547 924 872 77 ------
NM_032102chr1132428 2174 285 1433 ----
NM_032121chrX42146 2050 1103 778 1717 12850 --
NM_032128chr42907 142 ----2972 753
NM_032138chr132474 137 ----1540
NM_032142chr183200 71 65 ------
NM_032144chr221227 369 11356 --158
NM_032145chr641801 609 396 90 ------
NM_032149chr4150 1156 ----
NM_032154chr103866 795 46 11020 ----
NM_032160chr18103686 3233 3117 2858 1689 1608 1219 1118 1043 768 32825 425 252 --23322 1062
NM_032182chr101538 --11643 31496 353 342
NM_032186chr121023 172 --11040 11262
NM_032189chr1333217 2012 1767 23311 1501 14537 --
NM_032199chr1022422 1162 13762 13186 1792
NM_032219chr41116 ------
NM_032221chr201679 22023 1992 21746 1671 --
NM_032228chr1143088 2585 1120 31 --2605 211 --
NM_032229chr1321176 362 --11057 --
NM_032246chr1561356 1301 959 829 315 221 21051 969 --1275
NM_032250chr93570 294 89 ------
NM_032256chr123793 412 253 --1861 1883
NM_032268chr1662921 1314 1280 1201 367 126 1710 --1307
NM_032288chr312296 ------
NM_032312chr22822 103 195 ----
NM_032321chr232336 2217 929 --32677 782 117 1737
NM_032352chr1441207 1148 949 528 1413 1340 --
NM_032373chr1075266 5237 4606 3832 3599 1321 210 21845 1809 35028 1255 417 22071 1901
NM_032413chr152124 60 ----2269 39
NM_032435chr142385 2188 2094 1521 ------
NM_032439chr1021117 258 11266 1589 11145
NM_032440chr1042892 2393 1052 914 22246 432 22017 478 1233
NM_032445chr1541031 759 567 544 22335 1971 1700 --
NM_032446chr533717 3045 2781 12668 13036 --
NM_032452chr1431512 1081 261 ------
NM_032456chr42597 435 --4614 581 421 123 --
NM_032457chr443666 1554 1257 32 170 --13925
NM_032458chrX52939 2708 2527 2094 307 --1720 11327
NM_032466chr831273 1154 559 ----11643
NM_032468chr831273 1154 559 ----11643
NM_032492chr32640 170 --1849 --
NM_032505chr332027 1853 1031 12391 --12572
NM_032509chr832585 1854 1022 1447 ----
NM_032510chr1842416 1567 989 214 ----1304
NM_032521chr20113143 3095 3082 3074 2574 2246 2200 1010 948 561 130 12469 --13228
NM_032538chr612711 ------
NM_032547chr411391 21359 949 --1998
NM_032558chr931495 1148 25 ------
NM_032560chr144936 877 801 325 ------
NM_032574chr2146 ------
NM_032582chr1731694 1367 1187 ------
NM_032590chr1211010 --1247 157
NM_032626chr163293 279 252 ------
NM_032632chr1431784 1637 1480 ------
NM_032682chr332913 2849 869 --12942 --
NM_032711chr171688 1130 --1747
NM_032778chr353145 2277 1310 929 667 11250 12526 22077 614
NM_032784chr62273 226 ----2676 375
NM_032787chr31299 1325 1314 --
NM_032793chr11286 ------
NM_032801chr1142381 2308 1013 746 12505 ----
NM_032802chr15121 ----143
NM_032812chr102241 37 ------
NM_032828chr19114874 4828 4074 3057 1772 1713 1684 1617 798 420 209 14378 11465 1582
NM_032829chr1241161 852 784 775 1942 --11094
NM_032832chr641548 1207 1062 78 ----1117
NM_032833chr141916 1670 617 463 ----12599
NM_032837chr1762092 2046 1541 698 123 67 1771 1736 --
NM_032838chr1931096 429 119 2801 414 ----
NM_032842chr741363 456 251 188 1244 ----
NM_032859chr1383923 3564 2933 2889 1163 1113 491 159 32468 1039 656 23937 1475 33661 2614 2439
NM_032869chr841982 446 373 360 ------
NM_032873chr1194123 3967 3663 3439 1790 1642 1530 1439 647 1266 23529 2808 13839
NM_032875chr171787 1109 ----
NM_032906chr41228 2883 801 ----
NM_032949chr131106 ------
NM_032961chr441163 1115 921 259 11214 21156 445 --
NM_032968chrX53760 3135 2815 2728 1180 23276 2822 53747 3149 1074 677 136 --
NM_032969chrX53760 3135 2815 2728 1180 23276 2822 53747 3149 1074 677 136 --
NM_032973chrY53752 3130 2723 2685 1180 23271 2817 53739 3144 1074 677 136 --
NM_032975chr1863619 3416 3025 2380 2262 1174 --1446 --
NM_032980chr1863619 3416 3025 2380 2262 1174 --1446 --
NM_032991chr421011 257 --11195 --
NM_033020chr164262 3938 2941 1455 144 109 34389 4137 2967 ----
NM_033030chr221143 152 11029 31117 458 265 1197
NM_033044chr1------11239
NM_033055chr141030 873 188 123 ------
NM_033056chr102562 233 1213 ----
NM_033081chr2051487 1082 530 376 149 31147 936 495 1167 --
NM_033083chr333368 1233 611 --21173 1041 12521
NM_033088chr12709 645 ------
NM_033119chr163887 691 280 ----1928
NM_033136chr521204 42 51849 1815 1459 616 112 ----
NM_033137chr521204 42 51849 1815 1459 616 112 ----
NM_033138chr762158 2126 1626 898 500 412 22295 1689 11819 21842 1535
NM_033139chr762158 2126 1626 898 500 412 22295 1689 11819 21842 1535
NM_033140chr762158 2126 1626 898 500 412 22295 1689 11819 21842 1535
NM_033143chr4164650 4179 3877 3840 3781 3297 3209 3058 3045 966 893 776 651 383 277 39 14516 --21715 1676
NM_033157chr762158 2126 1626 898 500 412 22295 1689 11819 21842 1535
NM_033181chr663733 3493 3116 566 352 198 13460 23853 398 11473
NM_033208chr161121 ------
NM_033211chr511682 2414 214 1716 --
NM_033222chr92534 482 11075 --21269 395
NM_033224chr7158061 8054 8028 7207 6731 6669 4916 2912 2593 2144 1786 1489 1085 814 21 47564 3026 1066 222 1524 17304
NM_033225chr852735 2702 1981 707 178 1520 13009 --
NM_033274chr523147 898 13006 33547 2837 2537 11103
NM_033281chr5----147 --
NM_033285chr853330 3039 1794 1222 464 1843 31584 1513 92 11613
NM_033290chrX53342 2326 1209 265 230 33073 2906 359 21227 326 11425
NM_033300chr12352 89 1180 --1534
NM_033326chr1142106 1836 401 289 1622 12138 --
NM_033331chr953614 3404 3001 1058 52 1889 --12573
NM_033360chr1294197 4014 3281 3088 2900 1777 894 754 26 23224 811 32886 1752 1437 1728
NM_033380chrX--11016 ----
NM_033381chrX--11016 ----
NM_033425chr1143358 3045 2776 667 32927 2644 480 23407 3037 --
NM_033427chr7--1693 --1801
NM_033429chr1552593 2541 2417 721 677 --12283 1575
NM_033430chr421254 32 23691 282 33162 3085 51 --
NM_033437chr421254 32 23691 282 33162 3085 51 --
NM_033495chrX------1259
NM_033505chr266364 6171 5890 4700 2366 1548 15371 34991 4190 277 21754 1160
NM_033512chr84591 264 179 122 11986 --12750
NM_033535chr42354 131 ----11112
NM_033540chr32937 236 ----11084
NM_033551chr542508 369 342 190 ----12964
NM_033624chr1231506 1488 354 1178 1789 1700
NM_033644chr531955 625 318 11646 ----
NM_033645chr531955 625 318 11646 ----
NM_033656chr21104993 4660 4266 1316 1013 460 425 402 392 88 14679 25541 4545 --
NM_052832chr863020 2419 2146 926 501 114 199 22370 373 12642
NM_052834chr1872297 2201 2100 1826 1599 514 213 22137 871 12405 --
NM_052840chr151385 1437 ----
NM_052854chr11------1449
NM_052867chr13--31137 1009 520 21383 93 1513
NM_052875chr1112082 ------
NM_052879chr1253543 3501 3433 1394 1205 ------
NM_052880chr2231459 1401 61 ----11387
NM_052885chr1274912 4504 3867 961 631 542 207 2492 460 11349 13963
NM_052886chr83678 414 207 21956 1772 11700 --
NM_052898chr831330 649 612 ------
NM_052900chr841635 1127 391 193 --21707 1489 1657
NM_052905chr261915 1557 1501 1370 250 72 21704 1342 1491 11776
NM_052906chr2215084 ----1237
NM_052910chr1331981 372 346 11945 --1640
NM_052911chr184258 238 208 94 ------
NM_052913chr6----126 --
NM_052917chr253058 2769 850 565 34 22217 502 1454 12264
NM_052918chr1043105 738 513 22 12960 13484 --
NM_052927chr511719 22001 1555 21584 1490 1137
NM_052937chr862562 2126 754 725 693 581 1277 11690 --
NM_052954chr2132060 688 402 --12251 22045 1964
NM_053016chr9186909 6541 6289 6087 6041 5762 5420 5169 5038 2725 2536 2427 2414 2121 1977 1836 971 80 35754 4855 1052 --15258
NM_053023chr1162653 2466 2198 2174 1153 1072 --1729 12143
NM_053024chr321555 59 ------
NM_053025chr321751 1509 ------
NM_053026chr321751 1509 ------
NM_053027chr321751 1509 ------
NM_053028chr321751 1509 ------
NM_053031chr321751 1509 ------
NM_053032chr321751 1509 ------
NM_053042chr433058 852 363 2762 389 ----
NM_053043chr753991 2549 2246 1283 279 12443 15262 --
NM_053056chr1122447 819 2833 282 12067 --
NM_053064chr1462613 2508 2398 2241 2046 1986 13016 1703 12600
NM_053281chrX121 ------
NM_054016chr122042 1855 ------
NM_054016chr122042 1855 ------
NM_054016chr122042 1855 ------
NM_054114chr64805 738 695 530 ------
NM_057159chr921583 1023 ----21422 1114
NM_057164chr21122 ------
NM_057165chr21122 ------
NM_057166chr21122 ------
NM_057167chr21122 ------
NM_057169chr1232251 2207 2101 1346 13171 188
NM_057170chr1232251 2207 2101 1346 13171 188
NM_057175chr441720 593 528 515 ------
NM_057182chr19190 ------
NM_057749chr84522 271 151 78 ----2485 222
NM_058170chr1----41451 1430 203 57 --
NM_058172chr431750 401 196 ----11194
NM_058237chr143703 389 316 1301 ----
NM_058240chr1441728 1536 1133 210 11421 11252 --
NM_058241chr221867 812 11536 32330 461 244 11964
NM_058241chr221867 812 11536 32330 461 244 11964
NM_078469chr103421 335 107 11259 ----
NM_078470chr104933 743 333 318 --31913 681 81 12077
NM_078476chr641758 1188 644 205 11640 31778 1746 618 --
NM_078483chr573368 3132 3058 1188 826 242 21 13577 11230 --
NM_078629chrX1586 ------
NM_078630chrX1586 ------
NM_080422chr182134 26 134 ----
NM_080546chr9--11582 1237 12327
NM_080597chr181695 1207 --137
NM_080645chr652004 1513 1416 614 468 11603 1456 --
NM_080654chr1111079 11063 1357 1216
NM_080655chr92225 94 ------
NM_080666chr1431534 427 360 ----1510
NM_080676chr202275 164 12748 12270 --
NM_080683chr41177 ----1208
NM_080684chr41177 ----1208
NM_080685chr41177 ----1208
NM_080743chr672530 2275 2147 1634 1611 339 239 32242 494 191 --11903
NM_080759chr1382548 2469 2377 2214 1997 1921 1628 257 11757 --1151
NM_080760chr1382548 2469 2377 2214 1997 1921 1628 257 11757 --1151
NM_080798chr101175 ------
NM_080799chr101175 ------
NM_080800chr101175 ------
NM_080801chr101175 ------
NM_080802chr101175 ------
NM_080803chr101175 ------
NM_080804chr101175 ------
NM_080805chr101175 ------
NM_080806chr101175 ------
NM_080807chr101175 ------
NM_080808chr101175 ------
NM_080809chr101175 ------
NM_080810chr101175 ------
NM_080811chr101175 ------
NM_080812chr101175 ------
NM_080813chr101175 ------
NM_080814chr101175 ------
NM_080815chr101175 ------
NM_080821chr2062328 2089 1792 843 472 431 1286 ----
NM_080867chr1434132 3638 755 34425 1724 1629 54672 3101 1824 1098 704 190
NM_080872chr8104048 4027 3129 3113 3090 2692 2654 2599 1279 1234 13908 13100 12946
NM_080881chr51171 ------
NM_080927chr332948 2920 270 13016 --122
NM_100264chr101324 --1672 1342
NM_100486chr101324 --1672 1342
NM_130387chr341241 972 874 142 1292 ----
NM_130391chr9103493 3152 3045 3011 2868 2403 1378 771 251 33 23597 3305 1740 13363
NM_130392chr9103493 3152 3045 3011 2868 2403 1378 771 251 33 23597 3305 1740 13363
NM_130393chr9103493 3152 3045 3011 2868 2403 1378 771 251 33 23597 3305 1740 13363
NM_130434chr152353 155 21205 1118 ----
NM_130436chr2142414 2204 1089 118 12105 ----
NM_130438chr2142991 2781 2087 695 12682 1186 --
NM_130469chr141646 --1772 1729
NM_130768chr7193 ------
NM_130795chr9----1505 --
NM_130798chr1511562 ------
NM_130808chr31336 ------
NM_130809chr551225 846 495 253 130 ------
NM_130838chr1521399 1256 ------
NM_130839chr1521399 1256 ------
NM_130847chr1185319 5251 5084 1514 1428 1090 693 613 25376 5095 --11449
NM_133170chr20138086 8016 8009 7481 6815 6335 5248 5192 5125 2833 474 422 157 27454 6552 ----
NM_133264chr1783866 3816 3708 3671 2839 2772 712 196 23682 1075 23317 1470 --
NM_133326chr13338 332 132 ------
NM_133338chr52476 395 ------
NM_133339chr52476 395 ------
NM_133340chr52476 395 ------
NM_133341chr52476 395 ------
NM_133342chr52476 395 ------
NM_133343chr52476 395 ------
NM_133344chr52476 395 ------
NM_133367chr673453 2954 2427 1305 842 590 558 ------
NM_133370chr473203 2630 1394 1383 1197 735 384 --171 --
NM_133372chr572792 2600 1939 1879 1004 824 134 --32523 2393 665 2426 283
NM_133433chr54841 678 587 28 ------
NM_133443chr1621827 200 --21819 298 22272 1947
NM_133445chr963482 2398 1023 937 902 336 ------
NM_133468chr762438 2237 2200 1614 900 209 ------
NM_133473chr1921835 1507 ----21820 432
NM_133474chr431444 1135 33 1676 ----
NM_133477chr453153 3067 2408 609 430 --2835 529 --
NM_133486chrX189 --1440 --
NM_133496chr194307 3657 3605 3583 3522 3174 2977 751 105 --23483 1720 --
NM_133631chr321230 444 1198 ----
NM_133638chr511323 --11009 --
NM_133646chr254521 4490 4425 4418 131 --14896 13434
NM_133647chr15113876 3815 3777 3440 2877 2644 2443 1471 1308 825 180 33179 2410 1288 12431 11196
NM_134427chr9----1505 --
NM_134428chr91297 --1249 --
NM_138270chrX33221 2844 387 11294 13365 11281
NM_138286chr1953820 3754 3390 3303 84 23173 467 23812 3616 --
NM_138288chr1422238 1496 151 12194 --
NM_138290chr7152 ------
NM_138292chr1133510 2641 2340 22312 2252 --12828
NM_138340chr182619 552 ------
NM_138389chr4------1199
NM_138394chr2143 ------
NM_138409chr62241 67 21381 1082 ----
NM_138423chr1552193 1831 893 733 485 32156 1963 1423 --11974
NM_138426chr752455 1560 772 314 64 --1398 --
NM_138428chr151541 1197 525 446 260 1333 ----
NM_138453chr5------1213
NM_138455chr82250 121 ------
NM_138459chr643682 2421 1192 260 33618 3320 2856 22572 1465 21179 71
NM_138468chr285727 5618 4981 4668 2123 1859 1142 711 26295 255 11821 --
NM_138473chr1284723 4448 3425 2007 1866 1783 1303 410 ------
NM_138494chr72340 225 31011 245 219 22532 2249 --
NM_138559chr21346 1496 --11098
NM_138576chr1434574 1939 1103 24449 1536 ----
NM_138621chr21295 13133 --13805
NM_138633chr621618 1296 ----21758 576
NM_138638chr143941 718 281 22029 322 12286 --
NM_138711chr3----1163 --
NM_138712chr3----1163 --
NM_138713chr16148066 7661 6604 6155 6139 6107 3281 3137 1660 1250 1200 1163 860 778 35775 3208 143 16465 37331 7196 1302
NM_138714chr16148066 7661 6604 6155 6139 6107 3281 3137 1660 1250 1200 1163 860 778 35775 3208 143 16465 37331 7196 1302
NM_138731chr1473525 3499 1509 1257 1202 757 235 1639 11554 --
NM_138771chr731372 1268 113 --2341 100 --
NM_138773chr51645 ----1919
NM_138782chr582392 2093 2043 1769 921 671 211 52 2130 38 1546 11513
NM_138811chr741144 1074 320 127 ------
NM_138931chr31763 --2715 74 2723 329
NM_138959chr1126793 6311 5802 5295 4701 4584 2631 1872 916 574 309 149 15458 25261 1448 11207
NM_138970chr1441582 768 723 468 ------
NM_138971chr1182798 2623 2523 2403 1193 1173 1140 904 --13442 --
NM_138971chr1182798 2623 2523 2403 1193 1173 1140 904 --13442 --
NM_138972chr1182798 2623 2523 2403 1193 1173 1140 904 --13442 --
NM_138972chr1182798 2623 2523 2403 1193 1173 1140 904 --13442 --
NM_138973chr1182798 2623 2523 2403 1193 1173 1140 904 --13442 --
NM_138973chr1182798 2623 2523 2403 1193 1173 1140 904 --13442 --
NM_139035chrX----2799 291 --
NM_139045chr92676 103 ----1120
NM_139048chr3--2882 866 --1937
NM_139072chr24724 702 673 139 ------
NM_139168chr531399 1342 22 ------
NM_139182chr431365 437 81 1559 11898 --
NM_139201chr12----1180 1704
NM_139207chr1231510 848 748 --11612 --
NM_139242chr1561460 1165 1071 1049 1032 162 21152 517 163 --
NM_139246chr942163 860 776 139 2829 597 1467 --
NM_139266chr2------130
NM_139283chr1211002 1600 ----
NM_139286chr9------1208
NM_139312chr1031468 1264 350 --21512 75 11412
NM_139316chr73958 322 100 1943 ----
NM_139318chr141229 --1254 --
NM_139321chr2074231 4104 3794 2810 847 659 61 --1373 --
NM_144488chr9----1505 --
NM_144489chr9----1505 --
NM_144570chr1662874 2863 2133 1962 1033 718 --12378 11139
NM_144571chr434698 1399 547 26248 395 16026 1208
NM_144574chr141543 ------
NM_144578chr1444223 3461 2167 857 11948 74259 2079 1859 1816 1295 383 347 --
NM_144583chr241735 1170 228 162 --11807 --
NM_144588chr1021530 1308 ------
NM_144595chr132770 193 ----1903
NM_144599chr1545207 1641 1061 185 1771 --21458 1026
NM_144607chr1752525 2390 2169 1934 365 --21833 313 1384
NM_144609chr1731355 1145 121 1159 ----
NM_144664chr1142484 675 369 32 11995 ----
NM_144709chr22167 131 ------
NM_144710chr22195 106 ------
NM_144721chr422615 808 1426 1511 --
NM_144766chr16687 663 640 631 563 118 ----1508
NM_144775chr1774880 4481 4409 4294 4221 3785 944 14014 13594 --
NM_144777chr13155 ------
NM_144778chr1342220 1902 1883 35 11015 22252 759 --
NM_144949chr262537 1637 920 885 730 199 41691 639 439 219 1403 1578
NM_144963chr822126 237 1461 --22715 2672
NM_144965chr9------1163
NM_144967chrX2748 293 1821 ----
NM_144973chr1244446 4403 2061 724 33650 840 542 11998 25358 139
NM_144977chr11666 ----1560
NM_145000chr52170 163 ----132
NM_145011chr1061742 1644 777 673 418 111 41549 665 611 463 --11978
NM_145025chr6170 1383 ----
NM_145036chr171381 ------
NM_145037chr331485 411 237 --1589 --
NM_145044chr331482 1217 450 --1330 1432
NM_145052chrX21064 39 1211 1683 --
NM_145055chr1873691 2694 1486 1268 1100 881 26 ------
NM_145112chr1411320 11329 ----
NM_145113chr1421592 159 11601 ----
NM_145117chr111575 21242 568 23022 2650 22591 830
NM_145165chr1442667 2399 705 650 22638 2393 2553 46 --
NM_145176chr653290 3182 2839 962 600 1594 33423 3307 3176 13369
NM_145203chr131708 --2843 812 --
NM_145239chr1621053 138 --1981 --
NM_145251chr142471 445 --3245 176 138 --
NM_145259chr2105989 5771 5740 5692 5572 5353 4994 2821 2278 2073 56473 2709 2595 1170 270 24948 1328 45874 1675 653 292
NM_145268chr71222 --194 --
NM_145284chrX72071 1675 960 863 502 306 103 --11936 1843
NM_145291chr43465 401 348 --1368 --
NM_145303chr6----1366 --
NM_145307chr1094438 4389 4083 3625 3575 3565 2981 966 715 11341 23366 38 --
NM_145313chr1021165 598 1170 ----
NM_145320chr773303 3095 2977 2896 2735 1258 143 13119 1168 13378
NM_145321chr773303 3095 2977 2896 2735 1258 143 13119 1168 13378
NM_145322chr773303 3095 2977 2896 2735 1258 143 13119 1168 13378
NM_145647chr8----1189 --
NM_145649chr652580 2529 2118 916 250 11699 ----
NM_145655chr652580 2529 2118 916 250 11699 ----
NM_145686chr252876 1154 910 263 222 13320 --13137
NM_145687chr252876 1154 910 263 222 13320 --13137
NM_145690chr84523 436 133 41 ----11801
NM_145698chr1011965 --1860 1637
NM_145735chr1352132 1879 1869 1011 798 21860 888 32657 842 785 --
NM_145753chr341573 1275 569 51 --21093 1066 11031
NM_145793chr103881 817 613 ------
NM_145803chr11--1157 ----
NM_145808chr772634 2584 2191 2075 1253 518 373 12709 --1360
NM_145891chr162408 390 --31429 1166 1076 --
NM_145892chr162408 390 --31429 1166 1076 --
NM_145893chr162530 512 --31551 1288 1198 --
NM_145909chr611253 ----1203
NM_145911chr16------1333
NM_147150chr962650 1580 752 660 292 138 33272 1518 1231 1263 --
NM_147156chr1021249 250 ------
NM_147175chrX42043 1395 683 140 ----12152
NM_147181chr43950 499 407 11255 ----
NM_147182chr43950 499 407 11255 ----
NM_147183chr43950 499 407 11255 ----
NM_147189chr831715 533 263 22096 181 ----
NM_147223chr272430 2404 1801 1692 1651 1580 279 21932 1823 ----
NM_147233chr272247 2221 1618 1509 1468 1397 96 21749 1640 ----
NM_148174chr862254 2141 1902 1782 1502 323 12118 21919 167 --
NM_148894chr431224 1155 431 ------
NM_148955chr15126338 6253 5744 5564 4662 2641 2620 1878 1853 1786 1532 230 24560 683 12475 --
NM_148976chr112235 76 ------
NM_152133chr64805 738 695 530 ------
NM_152227chr202641 493 --1588 1138
NM_152233chr1411295 11121 1283 --
NM_152261chr1232163 275 73 22108 605 11968 11701
NM_152265chr12397 69 ------
NM_152271chr831031 746 230 --1442 1151
NM_152275chr21717 ------
NM_152277chr52638 218 ------
NM_152280chr14886 779 589 301 2583 121 11007 --
NM_152282chr321230 170 ----11411
NM_152291chr41688 3391 337 240 136 --
NM_152317chr121227 ------
NM_152330chr1472546 2513 2505 2448 1921 929 72 1198 --1758
NM_152344chr1741173 1070 966 400 ------
NM_152352chr1873045 2826 2789 2636 2581 2547 182 12370 --1496
NM_152375chr122645 1864 ------
NM_152407chr552713 2341 2138 1127 809 --1333 --
NM_152409chr583504 3156 3109 2685 715 584 513 366 1700 13140 --
NM_152414chr811122 ------
NM_152422chr92499 288 11646 ----
NM_152424chrX43555 1570 654 529 ------
NM_152437chr1242457 2334 2326 334 ----12006
NM_152442chr1211169 ------
NM_152448chr15------141
NM_152470chr1853786 2675 1583 744 114 14017 --24050 3482
NM_152487chr1--11279 1517 --
NM_152519chr272190 1970 1780 1525 676 261 103 1238 --1195
NM_152520chr241192 931 769 193 --21199 903 --
NM_152523chr2--2711 228 --146
NM_152529chr253943 3740 3081 985 174 51672 1021 929 831 467 23686 972 24037 4008
NM_152538chr341754 1525 1232 538 11603 --11307
NM_152556chr732031 935 123 22016 341 --1784
NM_152574chr92355 161 ------
NM_152581chrX1436 ----11039
NM_152589chr12----160 --
NM_152594chr1531924 703 430 1251 12348 --
NM_152605chr19--11363 ----
NM_152608chr172524 2489 2354 2247 617 555 206 --2998 49 --
NM_152609chr11363 ------
NM_152622chr53946 780 459 11248 --33171 916 617
NM_152624chr566890 6538 5685 2715 1322 1176 17362 --16124
NM_152629chr944073 2960 1511 1333 11374 --11222
NM_152636chr1143070 831 150 74 ----1965
NM_152638chr1211257 ------
NM_152641chr1252623 2379 2131 389 252 --12707 32568 802 421
NM_152667chr2041372 1065 1001 351 ------
NM_152678chr332686 2322 236 ------
NM_152688chr6--1818 --2240 202
NM_152695chrX41864 1565 243 219 --22329 2193 1785
NM_152699chr373277 3131 3104 2820 2758 1118 87 23646 3540 ----
NM_152716chr1141629 1245 240 138 ------
NM_152721chr182629 220 ----1473
NM_152727chr16----1302 --
NM_152734chr695008 4174 3746 2203 1779 1769 933 917 152 15424 ----
NM_152739chr72804 769 --1231 --
NM_152748chr72352 57 ------
NM_152753chr63758 589 510 11920 --1648
NM_152754chr763540 3173 2823 2813 592 245 23090 41 23075 719 --
NM_152756chr593487 3103 2911 1389 1310 1216 937 714 485 13933 ----
NM_152758chr852918 2782 2569 1981 1072 --22363 30 --
NM_152765chr842247 2106 768 589 ------
NM_152774chr752253 681 582 435 293 --22737 2160 12091
NM_152780chrX21233 231 ------
NM_152787chrX53908 3634 2762 1008 373 33960 819 203 11263 --
NM_152789chr741349 1107 961 73 11408 ----
NM_152793chr764895 4555 4412 1252 702 417 25044 3137 21851 1297 --
NM_152826chr15126338 6253 5744 5564 4662 2641 2620 1878 1853 1786 1532 230 24560 683 12475 --
NM_152836chr841914 505 497 132 11625 ----
NM_152837chr841914 505 497 132 11625 ----
NM_152838chr2063411 2908 2223 1296 668 154 ----12813
NM_152860chr12------1460
NM_152890chr11399 --11293 --
NM_152903chr1362711 2180 1771 1764 910 295 1178 12443 1454
NM_152914chr1794411 4355 4308 4063 3587 2869 993 719 234 --1637 --
NM_152924chr1585862 5702 5696 5624 5332 2294 2013 1611 26865 2598 15347 --
NM_152989chr1231896 1807 415 --1339 --
NM_152991chr112683 674 ------
NM_152996chr151683 1514 745 557 52 --21891 545 --
NM_152999chr784713 3972 3417 3185 2007 1018 77 66 --21848 1513 --
NM_153013chr532513 978 242 1688 11731 --
NM_153020chr641522 1477 1457 1044 1254 1349 1442
NM_153029chr1693857 3723 3155 3007 2600 1243 524 234 179 ----13293
NM_153042chr631809 1610 100 --11795 --
NM_153050chr2264764 4495 4242 3488 3141 1027 ------
NM_153051chr2264764 4495 4242 3488 3141 1027 ------
NM_153182chr353145 2277 1310 929 667 11250 12526 22077 614
NM_153184chr31479 11902 41622 791 674 464 11235
NM_153186chr92587 27 ------
NM_153188chr5175642 5455 5276 5040 4568 4240 4160 3963 3492 1231 1090 603 397 250 97 72 59 45331 5265 1550 435 11882 --
NM_153207chr12113814 3596 3210 3181 2745 2663 2643 2557 1535 1509 387 1403 23904 904 --
NM_153226chr102458 86 ----1895
NM_153235chr692428 1901 1727 1490 964 805 704 542 340 ----1681
NM_153262chr133120 2398 2036 13022 --1890
NM_153271chr1511242 --11408 --
NM_153321chr173847 289 206 --1755 --
NM_153322chr173847 289 206 --1755 --
NM_153331chr31511 ------
NM_153332chr853065 2944 1281 952 243 23202 1988 12180 12268
NM_153333chrX----1486 --
NM_153343chr42490 150 12390 22310 1744 11513
NM_153347chr1152511 2487 2349 1783 416 12759 ----
NM_153354chr51295 1188 1265 --
NM_153362chr62637 222 ------
NM_153365chr432570 2486 766 1751 12248 12551
NM_153371chr1331646 604 542 1953 11589 --
NM_153377chr12--1147 ----
NM_153456chr1376136 5082 4823 4338 1991 1789 1323 55668 3861 2383 1896 626 15686 --
NM_153607chr532840 2744 1185 1265 1108 22452 1088
NM_153610chr51175 ----1606
NM_153616chr1522311 670 ------
NM_153617chr1522311 670 ------
NM_153618chr1522311 670 ------
NM_153619chr1553549 1081 938 529 347 ------
NM_153620chr721562 486 ------
NM_153634chr1231607 481 383 21622 32 11141 --
NM_153645chr222783 295 --12725 --
NM_153686chr442124 706 174 165 ------
NM_153689chr232273 1802 284 22321 939 11917 --
NM_153690chr31616 ------
NM_153693chr12--1711 1245 2586 301
NM_153706chr51191 ------
NM_153712chr263046 2327 1462 1389 971 628 ----11410
NM_153715chr71247 11095 ----
NM_153756chr151931 1600 569 417 111 1719 11759 1734
NM_153759chr23786 459 449 ------
NM_153810chr1044959 4545 3597 1391 11971 --21954 247
NM_153828chr2--1864 ----
NM_153831chr81841 ------
NM_170606chr721900 1415 ----11886
NM_170607chr1741151 347 92 53 11506 ----
NM_170665chr12104323 4098 3542 3489 3245 3017 1845 1214 633 474 ----14170
NM_170674chr1511377 ------
NM_170675chr1511053 ------
NM_170676chr1511053 ------
NM_170677chr1511377 ------
NM_170679chr521198 1093 --1254 --
NM_170692chr1184 1825 1725 1817
NM_170709chr882412 2194 2147 1604 753 572 312 42 21895 1771 ----
NM_170710chr453152 2702 2387 2372 796 --12364 --
NM_170731chr113634 403 217 --1149 --
NM_170732chr113634 403 217 --1149 --
NM_170733chr113634 403 217 --1149 --
NM_170734chr113634 403 217 --1149 --
NM_170735chr113634 403 217 --1149 --
NM_170750chrX3656 95 63 1204 ----
NM_170754chr12------1485
NM_171998chrX92278 2106 1885 1862 982 962 784 719 699 2911 326 ----
NM_172037chr821265 1128 11392 --11097
NM_172069chr242303 426 75 64 ----12384
NM_172070chr211388 22214 44 21773 1497 --
NM_172071chr196433 6051 2884 2370 2332 2270 2144 2055 968 21680 1263 27453 228 --
NM_172103chr641784 1657 685 83 21845 181 21007 210 --
NM_172105chr641784 1657 685 83 21845 181 21007 210 --
NM_172110chr201704 ------
NM_172111chr201704 ------
NM_172112chr201704 ------
NM_172113chr201704 ------
NM_172127chr441906 1489 221 67 ------
NM_172128chr441862 1445 177 23 ------
NM_172159chr331861 1528 745 1496 2939 862 --
NM_172160chr331861 1528 745 1496 2939 862 --
NM_172169chr1091970 1830 1673 1541 1445 1358 1243 767 212 1125 ----
NM_172170chr1091970 1830 1673 1541 1445 1358 1243 767 212 1125 ----
NM_172171chr1091970 1830 1673 1541 1445 1358 1243 767 212 1125 ----
NM_172173chr1091970 1830 1673 1541 1445 1358 1243 767 212 1125 ----
NM_172193chr1441160 1062 949 61 1207 1339 1881
NM_172218chr82540 115 1122 1165 --
NM_172315chr1511377 ------
NM_172316chr1511377 ------
NM_172373chr132300 221 ----11216
NM_172375chr1411163 --11188 --
NM_173060chr582061 1911 1829 1806 1392 668 354 32 11696 ----
NM_173061chr582061 1911 1829 1806 1392 668 354 32 11696 ----
NM_173063chr582061 1911 1829 1806 1392 668 354 32 11696 ----
NM_173074chr22256 232 ------
NM_173171chr21330 --11287 --
NM_173172chr231046 638 224 196 11595 --
NM_173173chr21330 --11287 --
NM_173198chr952653 2508 2184 665 164 21868 560 --12446
NM_173200chr952653 2508 2184 665 164 21868 560 --12446
NM_173214chr16148066 7661 6604 6155 6139 6107 3281 3137 1660 1250 1200 1163 860 778 35775 3208 143 16465 37331 7196 1302
NM_173463chr453790 3281 3198 2784 782 13441 --23230 1262
NM_173468chr4105731 5225 4933 2400 2284 1675 855 741 284 198 15866 1658 --
NM_173469chr1551238 1139 964 389 361 11154 ----
NM_173470chrX32818 2025 348 --22520 1981 --
NM_173471chr311058 ----11095
NM_173473chr1042530 2408 971 524 12181 ----
NM_173475chr1651381 1272 525 483 109 1408 ----
NM_173491chr51322 11019 1535 --
NM_173497chr1021036 1022 1451 ----
NM_173508chr121080 787 ------
NM_173515chr62724 57 ------
NM_173517chr7----1424 --
NM_173519chr831283 835 760 1602 11749 --
NM_173531chr19103386 3123 3087 2794 2630 1276 1077 834 729 322 ----22688 163
NM_173552chr321784 813 11682 32488 2135 1551 1192
NM_173556chr112373 134 --1421 --
NM_173557chr181296 ------
NM_173560chr6----1472 --
NM_173576chr103926 485 236 1571 --1152
NM_173582chr1156003 5828 4717 4311 823 16215 14347 32289 1220 505
NM_173602chr1243672 3485 3319 2410 --31033 554 142 --
NM_173609chr151610 ------
NM_173631chr1931097 949 235 --11325 --
NM_173632chr1963142 2500 2085 1206 1119 630 --1393 --
NM_173642chr1117784 7688 7066 7040 6945 6824 6624 6067 3658 3300 1599 15904 16593 2651 178
NM_173644chr2061825 1383 683 526 337 130 11744 --11943
NM_173645chr21466 --194 --
NM_173648chr2299 92 1773 --21037 781
NM_173665chr51588 192 2675 160 --
NM_173667chr541955 1933 1901 826 ----1382
NM_173672chr682548 2200 1884 1663 1601 991 327 132 32051 1798 487 --12538
NM_173694chrX92552 2505 2499 2467 2206 1770 1655 840 41 195 ----
NM_173698chrX81988 1918 1781 1521 1322 735 649 465 ------
NM_173808chr1114440 3868 2989 1657 1572 1509 1288 1230 1046 678 381 11455 43360 2718 1633 286 31617 431 340
NM_173822chr221699 417 22130 1393 11907 --
NM_173825chr383029 2530 2403 2130 1186 950 867 806 ------
NM_173826chr321458 93 --2586 469 --
NM_173829chr555535 4622 1603 731 588 35607 5527 1949 14037 22473 788
NM_173872chr42367 198 ----2360 39
NM_174890chr102213 160 ----1633
NM_174907chr3133 --197 --
NM_174916chr1542277 2263 1480 924 12013 2768 345 --
NM_174921chr45841 764 475 353 198 1269 1110 --
NM_174934chr1123304 3068 22797 2706 23585 2308 --
NM_175056chr332080 2045 1887 12108 32024 1780 1390 11575
NM_175607chr341263 1081 666 252 11414 2465 207 21329 1105
NM_175612chr341263 1081 666 252 11414 2465 207 21329 1105
NM_175624chr12127235 6940 6915 6331 5775 5106 2930 2305 1631 1371 902 561 22456 611 34794 2476 1904 25961 2530
NM_175625chr12127235 6940 6915 6331 5775 5106 2930 2305 1631 1371 902 561 22456 611 34794 2476 1904 25961 2530
NM_175629chr23786 459 449 ------
NM_175736chr12147553 7426 6727 6373 6321 5828 5158 5108 4876 2787 2399 633 617 45 17702 27602 5981 --
NM_175854chr1352143 1041 957 769 64 ------
NM_175866chr131258 999 380 ------
NM_175876chr141994 1831 961 89 12718 --1592
NM_175884chr7191 --11003 11243
NM_175907chr1842672 1850 1043 468 12195 --1501
NM_175920chr51853 2627 205 --1238
NM_175921chr574107 3899 3885 3591 2739 1726 1330 ----1285
NM_176787chr1821623 1027 --11189 --
NM_176792chr102206 126 11331 11164 11351
NM_176814chr751386 1292 1229 546 138 1304 --1293
NM_176816chr541754 460 231 150 --1470 31982 1537 1239
NM_176823chr163020 2708 2439 1473 1338 257 13599 23767 3423 --
NM_177438chr14104186 3581 3487 3024 1690 1541 1463 873 777 726 ------
NM_177559chr20--21144 438 --1908
NM_177560chr20--21144 438 --1908
NM_177947chrX31558 1116 256 ------
NM_177948chrX31558 1116 256 ------
NM_177966chr351842 1627 1374 1277 402 21932 1485 1199 --
NM_177967chr1331072 299 213 ----11021
NM_177968chr251506 816 802 489 204 1637 ----
NM_177969chr21520 ------
NM_177974chr1552193 1831 893 733 485 32156 1963 1423 --11974
NM_177985chr21909 21792 67 1119 11730
NM_177990chr2021298 336 ------
NM_177995chr92499 288 11646 ----
NM_178010chr1231896 1807 415 --1339 --
NM_178011chr1083175 3076 2952 2883 2368 2074 394 181 12447 ----
NM_178033chr12185 52 ------
NM_178037chr1253162 565 520 425 169 1467 --11217
NM_178038chr1253162 565 520 425 169 1467 --11217
NM_178120chr2----11029 --
NM_178123chr22139 61 1227 ----
NM_178126chr1741790 1732 1657 1545 --1508 11469
NM_178140chr531855 830 740 1113 ----
NM_178150chr101280 ------
NM_178151chrX76281 6072 4982 2646 1733 1705 361 26288 2783 56507 6183 5857 3125 1290 --
NM_178152chrX76281 6072 4982 2646 1733 1705 361 26288 2783 56507 6183 5857 3125 1290 --
NM_178153chrX76281 6072 4982 2646 1733 1705 361 26288 2783 56507 6183 5857 3125 1290 --
NM_178313chr241853 1629 381 240 ----1617
NM_178423chr711065 --1458 --
NM_178425chr711065 --1458 --
NM_178426chr142114 1965 1808 51 ------
NM_178427chr132014 1865 1708 ----1889
NM_178496chr32140 85 1574 ----
NM_178505chr1083601 3451 3329 2459 1149 1139 803 196 33293 2336 655 1404 --
NM_178509chr1763498 3117 2980 2951 896 199 1877 44132 1544 1530 854 1535
NM_178565chr821641 1601 ------
NM_178566chr92502 187 31651 1344 662 --1418
NM_178578chr2042304 2289 415 329 1927 --12673
NM_178584chr22195 106 ------
NM_178585chr453243 2583 2123 1312 95 ------
NM_178812chr831576 474 320 21193 365 2570 295 --
NM_178819chr8----1251 --
NM_180991chr552489 728 404 370 27 ----1110
NM_181054chr145891 800 300 247 222 ------
NM_181077chr1521443 461 --1903 --
NM_181265chr453152 2702 2387 2372 796 --12364 --
NM_181302chr141543 ------
NM_181308chr141543 ------
NM_181332chrX52479 2423 1076 398 202 22248 2124 12193 12542
NM_181339chr12969 235 ----1212
NM_181351chr1151866 1205 910 881 679 --1729 1866
NM_181353chr202593 452 --1623 --
NM_181354chr83696 649 546 --11582 --
NM_181358chr174230 3765 1663 1524 1252 279 123 --14006 34202 3113 354
NM_181361chr341279 1037 404 152 --11395 11339
NM_181443chr2032673 2353 525 1818 1654 32501 1968 79
NM_181453chr231139 130 112 11687 11714 148
NM_181457chr221035 918 --1343 --
NM_181458chr221168 1051 --1476 --
NM_181459chr22934 817 --1242 --
NM_181460chr22981 864 --1289 --
NM_181489chr376082 4864 2549 2149 1334 775 252 15037 --15352
NM_181504chr533969 1350 1016 33197 1445 1370 --13631
NM_181523chr533969 1350 1016 33197 1445 1370 --13631
NM_181524chr533969 1350 1016 33197 1445 1370 --13631
NM_181571chr1041086 1074 776 167 ------
NM_181645chr112532 186 1225 1492 3596 168 74
NM_181659chr2043313 2954 1047 187 ------
NM_181659chr2043313 2954 1047 187 ------
NM_181701chr942356 2321 1798 551 ----1159
NM_181702chr82646 68 1302 ----
NM_181705chr555350 4437 3727 1241 1185 25423 4188 25715 51 2466 340
NM_181712chr142002 453 387 375 --11715 --
NM_181726chr42170 161 --157 --
NM_181782chr662193 2096 1822 1787 1779 691 11937 12106 --
NM_181787chr863622 3587 2418 2402 1031 947 23732 1269 31043 463 211 --
NM_181836chr552372 2051 727 455 371 --1797 --
NM_181837chr6169 ------
NM_181838chr531584 1327 620 --1245 130
NM_181839chr81487 ------
NM_181861chr1252728 2145 1009 711 514 22586 125 ----
NM_181868chr1252728 2145 1009 711 514 22586 125 ----
NM_181869chr1262813 2230 1094 796 599 72 22671 210 ----
NM_181876chr432038 1782 788 22671 1853 11660 --
NM_181886chr421364 223 ------
NM_181887chr421364 223 ------
NM_181888chr421364 223 ------
NM_181889chr421364 223 ------
NM_181890chr421364 223 ------
NM_181891chr421364 223 ------
NM_181892chr421411 270 ------
NM_181893chr421364 223 ------
NM_181897chr34589 309 255 122 42205 1067 1023 969 11812 12040
NM_182314chrX51751 1628 677 395 174 ------
NM_182485chr422616 156 32882 1399 439 ----
NM_182503chr675242 5085 1550 1016 623 441 111 ----15482
NM_182511chr18--11278 ----
NM_182524chr43758 609 39 ------
NM_182551chr293111 2999 2718 2616 2547 1393 925 767 166 12863 33066 2283 893 --
NM_182565chr171234 ------
NM_182609chr1921093 352 1200 ----
NM_182641chr1741875 1847 1582 726 21698 680 --11388
NM_182643chr842044 1982 1837 110 12022 ----
NM_182646chr422616 156 32882 1399 439 ----
NM_182648chr143709 236 180 ------
NM_182666chr32664 171 1480 2220 111 --
NM_182691chr731299 1071 90 --1380 --
NM_182692chr731299 1071 90 --1380 --
NM_182697chr731725 1236 62 ------
NM_182715chr741171 849 291 142 ------
NM_182717chr1051491 1479 1181 1028 572 ------
NM_182718chr1041086 1074 776 167 ------
NM_182719chr1041086 1074 776 167 ------
NM_182720chr1051491 1479 1181 1028 572 ------
NM_182721chr1051491 1479 1181 1028 572 ------
NM_182722chr1051491 1479 1181 1028 572 ------
NM_182723chr1051491 1479 1181 1028 572 ------
NM_182724chr1041086 1074 776 167 ------
NM_182725chr1041086 1074 776 167 ------
NM_182763chr151982 1915 739 697 423 22726 1072 ----
NM_182765chr1082143 2049 1849 935 873 742 516 483 ----2662 622
NM_182767chr1241807 1793 723 182 1526 ----
NM_182769chr1041086 1074 776 167 ------
NM_182770chr1041086 1074 776 167 ------
NM_182771chr1041086 1074 776 167 ------
NM_182772chr1041086 1074 776 167 ------
NM_182789chr55994 856 244 179 89 1367 ----
NM_182797chr2061207 1195 1110 708 676 504 2293 219 1447 --
NM_182811chr201424 ------
NM_182830chr1421960 1804 2912 24 12306 11412
NM_182848chr1331444 244 221 --2575 507 1201
NM_182850chr1041086 1074 776 167 ------
NM_182853chr1051491 1479 1181 1028 572 ------
NM_182898chr796582 6520 5895 5648 5290 4909 4820 1038 992 1516 25757 4766 11912
NM_182899chr796582 6520 5895 5648 5290 4909 4820 1038 992 1516 25757 4766 11912
NM_182907chr652377 1885 492 255 243 --22390 415 196
NM_182911chr2--147 ----
NM_182936chr1441728 1536 1133 210 11421 11252 --
NM_182948chr152083 1994 1149 1054 159 23165 2007 ----
NM_182964chr111575 21242 568 23022 2650 22591 830
NM_182970chr2023678 2743 ----13164
NM_182972chr182811 2697 2227 1991 1895 845 731 160 11773 12599 --
NM_182976chr1133 ------
NM_183002chr1441728 1536 1133 210 11421 11252 --
NM_183004chr1452847 2806 995 908 119 53304 2951 624 432 41 13837 12659
NM_183006chr2021270 1041 --1362 --
NM_183011chr1051491 1479 1181 1028 572 ------
NM_183012chr1051491 1479 1181 1028 572 ------
NM_183013chr1051491 1479 1181 1028 572 ------
NM_183043chr132763 291 ----1899
NM_183044chr132763 291 ----1899
NM_183050chr672305 2169 1649 684 509 277 192 --22158 1859 --
NM_183060chr1041086 1074 776 167 ------
NM_183078chr6103854 3097 2691 2577 1472 1321 943 881 758 474 12532 13655 --
NM_183227chr691433 1154 1130 1048 627 257 218 143 79 11403 11204 11269
NM_183234chr1521669 579 1134 ----
NM_183235chr1521669 579 1134 ----
NM_183236chr1521669 579 1134 ----
NM_183323chr55994 856 244 179 89 1367 ----
NM_183353chrX----21211 881 --
NM_183376chr1552274 1648 965 838 580 --11703 --
NM_183393chr331001 784 201 --1210 --
NM_183394chr331001 784 201 --1210 --
NM_183398chr551229 989 983 939 415 1236 ----
NM_183399chr551229 989 983 939 415 1236 ----
NM_183400chr551229 989 983 939 415 1236 ----
NM_183401chr551229 989 983 939 415 1236 ----
NM_183416chr131783 1336 103 1334 --2701 628
NM_194071chr785211 4982 4868 3681 2191 1965 1581 46 ------
NM_194247chr294426 3980 3817 2801 2794 1175 839 412 22 11285 ----
NM_194259chr16----160 --
NM_194260chr16----160 --
NM_194261chr16----160 --
NM_194282chr482322 2259 1986 1080 1016 932 914 411 1885 1663 --
NM_194283chr554198 4049 3169 2669 687 23894 2921 43762 3176 918 97 14208
NM_194285chr1143375 3306 2214 45 12597 22086 1364 12293
NM_194291chr832831 2740 2679 ----12538
NM_194298chr1041984 1691 574 351 --11278 --
NM_194301chr142415 250 --11116 1401
NM_194314chr1135371 5280 4746 4238 4187 3895 2212 1940 1592 1420 1208 1069 747 25220 374 24499 506 --
NM_194317chr292425 2254 2220 1905 1873 1850 1032 969 271 11885 ----
NM_194328chr962186 949 654 550 294 162 32154 351 153 ----
NM_194329chr962186 949 654 550 294 162 32154 351 153 ----
NM_194330chr962186 949 654 550 294 162 32154 351 153 ----
NM_194332chr962186 949 654 550 294 162 32154 351 153 ----
NM_194356chr1232308 2259 560 1347 32071 926 174 --
NM_194434chr1845288 5066 4912 554 12234 --15411
NM_194442chr131690 1409 35 ----123
NM_194449chr183981 922 216 --1999 --
NM_194454chr741522 1360 1287 245 ----21685 205
NM_194455chr741522 1360 1287 245 ----21685 205
NM_194456chr741522 1360 1287 245 ----21685 205
NM_197941chr53926 528 486 ----1723
NM_197955chr152124 60 ----2269 39
NM_197968chr134698 543 520 262 ------
NM_197970chr221143 152 11029 31117 458 265 1197
NM_198087chr1631435 1377 1265 ------
NM_198088chr1631435 1377 1265 ------
NM_198123chr841635 1127 391 193 --21707 1489 1657
NM_198124chr841635 1127 391 193 --21707 1489 1657
NM_198128chr1842158 1483 516 35 ------
NM_198141chr153999 180 86 ------
NM_198158chr342623 2449 2414 2079 2536 197 21019 190 --
NM_198159chr342623 2449 2414 2079 2536 197 21019 190 --
NM_198177chr342623 2449 2414 2079 2536 197 21019 190 --
NM_198178chr342623 2449 2414 2079 2536 197 21019 190 --
NM_198181chr1512696 22836 2267 1912 12790
NM_198204chr1741151 347 92 53 11506 ----
NM_198205chr1741151 347 92 53 11506 ----
NM_198220chr20142 ------
NM_198225chr101406 31683 589 76 21831 616 --
NM_198267chr71586 ----1566
NM_198268chr174230 3765 1663 1524 1252 279 123 --14006 34202 3113 354
NM_198269chr174230 3765 1663 1524 1252 279 123 --14006 34202 3113 354
NM_198270chrX63525 3354 2806 2665 2598 403 33510 3318 2758 --12135
NM_198273chr582678 2404 2380 2159 1275 1179 555 371 12934 --13041
NM_198279chrX6808 394 213 158 148 33 11161 ----
NM_198281chr443219 1106 607 88 32778 2512 928 12481 21178 169
NM_198316chr12------1485
NM_198320chr12115132 4889 4675 4506 4465 3492 1669 909 386 240 68 1313 12010 --
NM_198336chr741645 1418 1194 501 1744 ----
NM_198391chr201225 183 --11114
NM_198400chr1582677 2656 1178 967 949 916 487 196 22715 1149 ----
NM_198450chrX42129 1903 1509 37 1887 ----
NM_198465chrX62968 2340 2251 590 345 54 21143 721 22040 308 --
NM_198467chr7--1104 ----
NM_198468chr633517 3274 2848 1542 34092 3973 390 34409 3631 213
NM_198503chr132206 1639 902 2726 33 --32007 1539 431
NM_198513chr83665 624 64 3475 288 166 12056 --
NM_198549chr122776 252 22223 79 11303 21311 712
NM_198581chr2186943 6801 6131 6029 5542 5274 4915 4773 4715 2963 2778 2726 2535 1907 1152 693 499 80 24765 1314 22124 1992 --
NM_198584chr852491 2149 1656 964 786 ------
NM_198715chr19