TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3675-3p
miRNA Sequence: CAUCUCUAAGGAACUCCCCCAA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000125chr6113982 3967 2958 2898 1672 1057 743 454 357 343 202 1785 --11399
NM_000216chrX133990 3802 3262 3231 3046 2932 1358 998 915 756 699 224 167 ------
NM_000259chr1565860 5107 1957 1349 1258 1122 14954 --35177 4108 561
NM_000793chr14145062 4831 4742 3867 3540 3528 3194 894 851 763 670 622 363 248 --13131 11358
NM_001001668chr1984141 3857 3779 3669 1717 1585 1536 407 --23630 776 11606
NM_001002814chr8113702 3577 3137 3043 2676 1405 1220 583 574 294 262 13452 22723 2690 1702
NM_001003674chr18145684 4820 4446 2682 2466 2269 2231 2207 1898 1699 849 823 526 29 26528 311 25676 4759 --
NM_001003675chr18145684 4820 4446 2682 2466 2269 2231 2207 1898 1699 849 823 526 29 26528 311 25676 4759 --
NM_001004065chr952719 2531 2456 1087 376 31441 1142 953 13706 11015
NM_001007023chr14145062 4831 4742 3867 3540 3528 3194 894 851 763 670 622 363 248 --13131 11358
NM_001010867chr1136639 6379 5578 5562 5069 4928 4775 4580 4217 4194 1565 565 504 --46291 5333 4795 2164 --
NM_001014797chr10167343 6877 6772 6439 6270 6143 6112 6006 5793 5691 5206 3134 2300 1546 1192 959 15116 26977 6961 --
NM_001017440chr7257677 7501 7243 6987 6819 6492 5458 5302 5097 2956 2809 2704 2592 2448 2429 2406 2378 2358 2229 1135 998 765 626 525 294 12138 15610 --
NM_001017970chr14101700 1014 624 562 468 333 326 302 291 193 ------
NM_001024647chr12156925 5349 5235 5034 2822 2635 2534 2321 2197 1641 1383 926 855 838 626 25705 1679 26033 1126 11231
NM_001024956chr1174975 4012 3597 2291 2113 1875 305 ----35741 4449 4160
NM_001033045chr2134446 3630 3564 3445 3130 2858 1525 1391 1188 1134 1057 791 564 --13933 --
NM_001039547chr3167947 7854 7448 7303 6276 6093 5244 5188 5086 4945 2796 1796 1427 1390 1378 1088 172 ----
NM_001042355chr16105014 5000 4921 4899 4608 4253 4087 3561 2040 887 --45354 3998 1935 476 --
NM_001042412chr16105014 5000 4921 4899 4608 4253 4087 3561 2040 887 --45354 3998 1935 476 --
NM_001042533chr383089 2685 1158 1118 996 968 713 564 --12433 13121
NM_001042599chr2166757 5708 5657 5456 5029 4948 2731 2559 2355 2054 1881 1679 259 172 131 27 --25215 2851 11481
NM_001099678chr375147 4132 4003 2498 1128 1019 347 24510 974 14515 21837 1773
NM_001100108chr1147433 7222 6395 5484 3220 3137 2455 2366 2050 1787 1139 1132 1011 258 1199 26523 3206 --
NM_001106chr3138941 8259 6969 6585 3810 3492 2890 2017 1804 1606 1577 799 424 --38354 5981 3426 --
NM_001167chrX76092 5662 4711 4119 2669 2090 2037 15972 41687 479 466 385 --
NM_001259chr7145886 5098 5054 5003 4146 4002 2432 2057 1929 1035 1014 850 709 454 15084 15846 --
NM_001609chr1074494 3974 3338 3210 1430 536 197 23184 1672 43894 2906 2796 450 --
NM_001616chr21784 11287 --32453 2165 1333
NM_002025chrX149264 8703 8596 6871 6212 6101 5738 5628 3640 2799 2729 2649 1373 875 12702 --37741 6765 2656
NM_002336chr12104731 3488 3131 3087 1949 1738 1190 623 139 91 13499 --24590 151
NM_002481chr1177791 7499 7282 6853 6734 6242 5910 5257 5236 3203 1361 1246 1082 1071 1058 805 256 23011 2379 11291 --
NM_002581chr995032 4683 4544 4349 3844 3564 1631 610 107 21290 631 31719 503 393 23547 1787
NM_002737chr17126528 5912 5445 5211 4179 2600 2299 2133 1825 809 463 373 --14862 11094
NM_002837chr12104526 3037 1812 713 652 625 533 418 128 82 --53227 1805 1410 1356 816 --
NM_003034chr12158120 7842 7444 7435 7175 6962 6952 6271 6153 5670 5177 4942 2631 1987 1238 --47069 6539 2698 2691 --
NM_003108chr297158 6520 6319 5375 5046 4662 4630 2167 524 --11200 25972 537
NM_003410chrX41984 995 454 208 12832 22959 1135 2803 30
NM_003468chr293816 1534 1453 1328 1138 755 659 615 126 1855 --1743
NM_004171chr11159072 8833 8579 8368 6197 6163 5936 3727 3696 3650 3629 1608 536 446 140 29175 1901 47529 6653 6276 6270 --
NM_004338chr18145684 4820 4446 2682 2466 2269 2231 2207 1898 1699 849 823 526 29 26528 311 25676 4759 --
NM_004412chr1095732 5706 4845 4793 2013 1715 1479 1004 218 --34972 3961 1082 --
NM_004464chr421068 1056 23147 257 --32972 1241 832
NM_004586chrX75023 4074 2094 1117 969 759 743 24594 2074 34579 4555 372 --
NM_004866chr574169 3994 3895 3562 1924 1415 1001 1949 33599 1517 450 1363
NM_005235chr2166757 5708 5657 5456 5029 4948 2731 2559 2355 2054 1881 1679 259 172 131 27 --25215 2851 11481
NM_005504chr1285315 5297 5248 2224 1327 1170 1019 33 24684 1848 24070 1490 25700 890
NM_005840chrX106930 6400 6391 6378 5515 3048 1982 1869 1701 75 11069 37228 6421 5963 --
NM_005935chr4144985 4420 4334 4309 3892 3534 3461 3452 1802 1703 1691 1069 220 199 13428 11173 --
NM_006371chr3114678 4478 4013 3719 1968 1926 1838 1323 1224 891 393 23309 1166 11262 11099
NM_006918chr1174975 4012 3597 2291 2113 1875 305 ----35741 4449 4160
NM_007050chr20167406 7241 6733 6101 6014 5861 5821 4966 2285 2202 2098 2028 1329 1069 402 190 15957 46057 6044 2652 1251 15168
NM_007203chr952719 2531 2456 1087 376 31441 1142 953 13706 11015
NM_007249chr13129208 7863 7762 7588 6095 2704 1363 1083 975 923 760 517 37435 7121 1462 13131 --
NM_012164chr9137413 6876 6740 5893 5641 5136 5084 2389 1694 1621 1097 756 260 14996 ----
NM_012193chr11155042 4745 4457 4283 4108 3862 3803 3788 3557 3528 3465 3295 1382 1199 224 25271 1454 ----
NM_012214chr2126138 5740 5135 4894 4756 4734 4614 4143 2219 1640 1331 402 14491 14870 --
NM_012382chr563736 3560 1584 1494 1422 65 --33866 3055 1291 182
NM_012465chr1073423 2411 2395 1160 1150 416 187 12507 --22819 142
NM_013255chr7168854 8426 8069 7916 7670 7238 7001 6560 6118 5624 5601 5433 3208 1819 824 123 22249 1190 15663 37486 3120 1196
NM_013989chr14145062 4831 4742 3867 3540 3528 3194 894 851 763 670 622 363 248 --13131 11358
NM_014048chr1683994 3898 3735 3573 511 496 463 438 14416 11384 175
NM_014155chr1187479 2757 2558 590 454 387 230 58 --26131 1434 11142
NM_014721chr6157017 6624 6464 6363 5483 4650 4566 2910 2600 2592 2566 2532 2353 929 506 24666 2011 ----
NM_015026chr1284423 4333 4302 4235 4060 3865 3231 3198 2350 235 --11151
NM_015051chr973091 2716 2593 2473 2159 948 326 23389 427 22537 338 --
NM_015247chr16105014 5000 4921 4899 4608 4253 4087 3561 2040 887 --45354 3998 1935 476 --
NM_015291chr153360 2529 2221 1300 329 --23172 2742 1887
NM_015553chr6114519 4201 3923 3810 3761 3192 1872 1469 961 721 698 1763 13831 --
NM_015852chr7132680 1133 1049 965 797 629 545 461 377 293 209 125 41 12412 ----
NM_015886chr875599 5476 3855 1943 1216 1138 68 24681 765 21932 1795 1606
NM_016206chr3148025 7569 5858 3480 3017 2580 1578 1554 1525 1331 1086 911 860 451 15847 15702 --
NM_016260chr2127542 7279 6666 5903 5444 3013 2674 2578 1587 871 483 326 26725 2058 14623 --
NM_016530chr1593497 3165 1581 1565 1188 1033 418 216 36 1849 --13671
NM_016953chr295437 5408 5100 3940 3730 2148 2028 833 193 ----24600 485
NM_018440chr8108129 7605 6355 2101 1883 1430 1323 630 125 46 1175 18271 18301
NM_020443chr1156623 6115 5751 4767 2604 2181 1456 1372 1089 991 647 620 495 410 132 --14359 --
NM_020734chr1273172 3117 2574 2265 2206 201 133 1145 --11255
NM_020772chr1756425 6110 5590 3065 2390 16846 --23167 2678
NM_020830chr253227 2480 2204 1278 556 12812 12457 11262
NM_020935chr274135 3631 3438 1587 998 773 396 11496 --22954 959
NM_021061chr8113942 3359 3252 3241 3171 3115 3031 2757 821 244 223 --11620 1655
NM_021629chr381930 1905 1238 950 917 643 496 41 --1650 13105
NM_022456chr12156925 5349 5235 5034 2822 2635 2534 2321 2197 1641 1383 926 855 838 626 25705 1679 26033 1126 11231
NM_024423chr1883511 3301 1555 1375 1334 1327 1174 1046 1213 23351 2967 --
NM_024947chr3108719 7639 7483 6404 3631 2437 2158 2133 1751 790 22767 429 28235 3355 --
NM_024989chr2137728 6944 6450 2754 2360 1869 1800 1520 1412 1061 724 320 101 31768 592 236 13165 --
NM_030674chr1245170 3946 2278 1050 11199 1206 21459 516
NM_030806chr1199024 8831 8380 7678 7516 7336 7244 6914 6757 6030 5697 3520 3368 3085 3060 2918 1525 933 555 16022 41792 1153 505 461 16137
NM_031468chr7257677 7501 7243 6987 6819 6492 5458 5302 5097 2956 2809 2704 2592 2448 2429 2406 2378 2358 2229 1135 998 765 626 525 294 12138 15610 --
NM_032105chr1167924 7632 7415 6986 6867 6375 6043 5390 5369 1494 1379 1215 1204 1191 938 389 23144 2512 11424 --
NM_032446chr543504 2534 1062 707 --1201 22836 517
NM_032778chr383089 2685 1158 1118 996 968 713 564 --12433 13121
NM_033143chr432839 1399 1387 23478 588 --33303 1572 1163
NM_033430chr4103377 3327 2987 2725 2693 1385 1292 728 168 37 1757 --12943
NM_033437chr4103377 3327 2987 2725 2693 1385 1292 728 168 37 1757 --12943
NM_033656chr21105743 5598 4600 4113 4073 2310 1733 1581 864 817 22303 1336 1975 --
NM_133170chr20167406 7241 6733 6101 6014 5861 5821 4966 2285 2202 2098 2028 1329 1069 402 190 15957 46057 6044 2652 1251 15168
NM_138286chr19113149 3103 2864 2750 1209 992 897 524 454 397 225 --23410 1291 --
NM_144571chr4116604 6164 5853 5706 4416 4403 4380 2815 2377 1841 747 --16920 --
NM_145307chr1054421 1431 831 768 690 14636 11599 13134
NM_147150chr952719 2531 2456 1087 376 31441 1142 953 13706 11015
NM_152529chr2134446 3630 3564 3445 3130 2858 1525 1391 1188 1134 1057 791 564 --13933 --
NM_152787chrX93654 3430 2946 2876 2701 1201 1165 751 665 43231 1330 223 213 11246 --
NM_153182chr383089 2685 1158 1118 996 968 713 564 --12433 13121
NM_153456chr13135634 5157 4931 4910 4785 4483 4201 3873 2129 934 676 611 74 16183 54898 2221 1676 1668 163 --
NM_173468chr475784 5437 3836 2199 2022 1037 802 15940 45087 4270 944 918 --
NM_173582chr11125776 5633 5195 5169 4743 3854 3841 2179 1897 1572 1125 193 33938 1881 1843 --14533
NM_173632chr19103299 2728 2187 2149 644 572 399 231 168 84 ----12338
NM_173642chr1159090 8627 8368 7050 6477 6390 3699 3460 2778 2571 2335 2230 1210 541 468 49252 8221 6042 3635 36809 1890 890 --
NM_175623chr12156925 5349 5235 5034 2822 2635 2534 2321 2197 1641 1383 926 855 838 626 25705 1679 26033 1126 11231
NM_175624chr12167020 5444 5330 5129 2917 2730 2629 2416 2292 1736 1478 1021 950 933 721 55 25800 1774 26128 1221 11326
NM_175625chr12167020 5444 5330 5129 2917 2730 2629 2416 2292 1736 1478 1021 950 933 721 55 25800 1774 26128 1221 11326
NM_175736chr12186496 5797 4828 3009 2895 2628 2557 2285 1851 1479 1336 1274 999 645 607 524 419 327 12720 --12133
NM_175861chr12105155 4804 4599 4560 4316 4053 1491 1397 1099 819 15599 1317 --
NM_175910chr19122195 2102 1654 1613 859 780 696 612 528 278 192 108 22094 446 ----
NM_176081chr1095732 5706 4845 4793 2013 1715 1479 1004 218 --34972 3961 1082 --
NM_176083chr1095732 5706 4845 4793 2013 1715 1479 1004 218 --34972 3961 1082 --
NM_181481chr18145684 4820 4446 2682 2466 2269 2231 2207 1898 1699 849 823 526 29 26528 311 25676 4759 --
NM_181482chr18145684 4820 4446 2682 2466 2269 2231 2207 1898 1699 849 823 526 29 26528 311 25676 4759 --
NM_181483chr18145684 4820 4446 2682 2466 2269 2231 2207 1898 1699 849 823 526 29 26528 311 25676 4759 --
NM_194071chr7155141 4237 4034 4013 3632 3566 3495 3483 1764 1607 985 780 352 136 103 11263 ----
NM_194283chr593872 3716 3586 3262 3033 1134 953 859 778 13328 33574 3277 2574 11627
NM_198900chr12186496 5797 4828 3009 2895 2628 2557 2285 1851 1479 1336 1274 999 645 607 524 419 327 12720 --12133
NM_207306chr173706 3232 1751 1741 1435 1067 495 --284392 3378 2930 1391 1355 1319 1283 1247 1211 1175 1139 1103 1031 995 959 923 887 855 819 783 747 711 675 639 603 567 531 459 --
NM_207406chr466172 4845 4795 4683 1678 378 25679 327 56019 4054 1832 1373 1196 16283