TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3675-5p
miRNA Sequence: UAUGGGGCUUCUGUAGAGAUUUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51181 ----1440
NM_000021chr143893 873 23 --2966 301 --
NM_000035chr93328 296 27 ------
NM_000037chr8112256 2079 2069 1865 1839 1705 1606 906 569 537 438 --11697 --
NM_000038chr52636 270 ------
NM_000052chrX93305 2159 1292 1117 753 599 554 437 267 ------
NM_000053chr1341456 818 762 214 ------
NM_000074chrX3907 854 791 ----1206
NM_000082chr54604 237 124 100 --1703 --
NM_000084chrX186760 6729 6719 6675 6303 5868 5833 5769 5382 4957 4586 4217 1842 1669 1460 1134 1037 927 ------
NM_000087chr4----137 --
NM_000104chr232728 2523 2176 1404 12276 1155
NM_000109chrX1903 ------
NM_000125chr653624 3103 1664 730 54 2776 590 33922 2919 1458 --
NM_000134chr44577 559 428 80 ------
NM_000138chr1542293 1727 1707 782 ------
NM_000141chr101474 --11164 11281
NM_000158chr3121 ------
NM_000163chr531943 1802 1618 ------
NM_000168chr793240 2682 2642 2333 2198 2157 974 597 277 ------
NM_000192chr1261492 991 974 634 315 249 --1349 --
NM_000208chr1954460 3931 1602 822 38 --14437 11048
NM_000216chrX43322 2521 1436 343 12864 13467 --
NM_000217chr1265027 4179 3663 3470 1005 31 ------
NM_000223chr172136 103 --122 --
NM_000231chr133613 411 42 ------
NM_000237chr81138 ------
NM_000244chr116634 608 520 499 192 102 ------
NM_000245chr742021 1677 394 193 ------
NM_000248chr322022 1929 --23065 2889 --
NM_000259chr1553862 2400 1862 537 442 14163 ----
NM_000264chr933276 771 256 11199 ----
NM_000267chr1753450 2668 2143 546 85 ----1989
NM_000271chr181248 --1518 --
NM_000278chr10122084 1812 1803 1769 608 431 328 239 134 128 122 60 --21838 926 11849
NM_000286chr17196 1652 ----
NM_000291chrX4783 717 702 206 ------
NM_000314chr101916 22452 154 13204 --
NM_000319chr1241151 994 824 135 ------
NM_000332chr6116643 6506 5999 5688 4674 2872 2117 803 666 450 240 --25733 2750 --
NM_000333chr31122 ------
NM_000334chr1772153 2005 1836 609 442 381 56 --1215 --
NM_000335chr391859 1815 1537 821 809 710 201 129 123 --31523 898 727 --
NM_000337chr595627 4735 4669 4422 1994 1328 1279 323 279 25980 2173 15607 --
NM_000346chr1721930 566 ------
NM_000353chr165835 452 181 103 86 --133 --
NM_000362chr2283548 3133 2693 2304 1218 547 334 183 --23027 2924 --
NM_000368chr9104699 3739 3292 1915 1871 1688 1242 1160 1057 210 1807 24607 4037 --
NM_000376chr12112890 2696 2502 1002 931 633 563 507 405 133 98 --12587 --
NM_000378chr11132 ------
NM_000380chr91495 ------
NM_000389chr681388 1131 1122 486 383 264 127 44 --11004 --
NM_000390chrX43046 2601 1229 938 23054 824 ----
NM_000408chr252929 2499 1198 1142 549 --1521 12601
NM_000430chr1753033 2338 1171 841 70 1790 1386 --
NM_000435chr194730 724 270 46 --1892 --
NM_000445chr87784 775 742 636 287 275 209 ------
NM_000448chr1122696 1238 ------
NM_000451chrX21378 328 --12130 --
NM_000452chr1321772 1316 ----11403
NM_000461chr374330 4101 3310 3219 3190 3135 793 14364 11124 --
NM_000462chr1521176 110 ------
NM_000478chr11541 ------
NM_000480chr1141604 1586 1119 360 --1445 --
NM_000486chr12102753 2649 2617 2239 2097 935 919 716 68 27 ----13052
NM_000489chrX53380 3138 3104 3070 2333 --12905 --
NM_000503chr831305 613 64 ------
NM_000525chr1171058 640 413 389 278 164 95 11534 ----
NM_000533chrX2635 72 ------
NM_000539chr391335 1291 1273 1214 1059 505 315 223 42 11358 ----
NM_000546chr1741146 879 150 44 ------
NM_000555chrX65822 5151 5026 2283 2014 503 27598 2693 --16800
NM_000567chr14908 892 156 56 1136 ----
NM_000594chr63759 610 43 ------
NM_000599chr2153548 3506 3477 3212 3191 3164 2998 1460 1397 1310 1299 1089 875 807 48 23715 967 13405 --
NM_000609chr1092522 2304 2083 1234 687 605 505 375 101 --32819 1074 364 --
NM_000615chr1142859 2810 2422 928 1504 ----
NM_000618chr12106204 5646 5539 5405 5204 5168 2153 2028 1281 1271 --26281 2417 --
NM_000618chr12106204 5646 5539 5405 5204 5168 2153 2028 1281 1271 --26281 2417 --
NM_000621chr1331456 1344 292 --1131 --
NM_000633chr1834591 996 337 --1276 --
NM_000635chr1971330 1113 1018 614 317 253 78 ------
NM_000719chr12166533 6470 6325 6293 6194 6023 5940 5532 5258 4466 2393 2350 2114 1387 267 73 --14523 --
NM_000720chr34327 179 146 33 ----171
NM_000723chr17121604 1598 1317 1220 1187 1171 691 548 434 332 259 185 ------
NM_000725chr1271006 991 858 285 217 154 130 1835 1358 --
NM_000738chr116973 871 773 762 101 82 --1821 --
NM_000759chr174760 175 97 21 ----164
NM_000767chr1941407 1251 333 132 11006 ----
NM_000793chr1464929 4449 3787 3298 1080 1024 11495 64289 3602 1926 1463 225 90 1151
NM_000795chr112281 62 --1147 --
NM_000801chr201790 ------
NM_000806chr531285 555 75 1774 ----
NM_000809chr467484 6056 3583 3349 3202 1858 18652 1346 --
NM_000810chr151393 185 1191 --
NM_000813chr574818 4564 2106 1960 1477 816 364 11092 1257 --
NM_000814chr1563955 3550 2724 2672 1667 1189 --11379 --
NM_000815chr12431 177 ------
NM_000817chr221252 300 ------
NM_000831chr1186005 5939 5926 5742 5730 5393 5306 5233 4864 4858 4759 4399 3908 3885 1234 1014 989 877 1494 75818 5514 5413 5058 4260 1880 1639 12138
NM_000838chr632297 1868 587 12659 ----
NM_000840chr72191 66 ------
NM_000845chr71364 ------
NM_000875chr15156308 6043 5891 5878 5851 5514 4849 2716 2373 1713 1475 1024 965 903 614 12399 42503 943 676 428 --
NM_000876chr651066 384 260 251 164 --11085 --
NM_000880chr81196 ------
NM_000891chr1733602 665 194 --2776 163 --
NM_000899chr1224339 343 --1937 --
NM_000901chr422371 1709 ------
NM_000903chr161425 --11141 --
NM_000908chr5--1298 1698 --
NM_000912chr832850 2811 244 12406 1721 --
NM_000926chr11149283 9073 8967 8870 8395 8220 7850 7082 3628 2858 2768 2565 1399 1386 27971 5837 18942 19035
NM_000944chr412215 --11872 --
NM_000945chr221319 45 --1142 --
NM_000949chr5----1128 --
NM_000950chrX43041 2573 1137 1011 --11458 --
NM_000961chr20113836 3773 3410 3326 2897 2501 1355 1258 843 59 49 --33634 557 540 --
NM_000963chr132445 1616 1570 ------
NM_001001132chr2121230 171 162 ----
NM_001001323chr1232876 2742 2390 ----198
NM_001001331chr332652 1862 34 --22388 1809 --
NM_001001342chr1031491 1414 1340 --11115 --
NM_001001395chr1262578 2413 2097 632 173 61 ------
NM_001001419chr594669 1573 1458 1221 1131 1056 437 291 235 ------
NM_001001420chr594669 1573 1458 1221 1131 1056 437 291 235 ------
NM_001001433chr2082592 2184 1024 980 853 700 547 70 ------
NM_001001481chr863155 2193 918 687 301 292 1962 ----
NM_001001484chr1012345 22001 1831 1205 --
NM_001001521chr21281 ------
NM_001001523chr1101141 987 939 900 887 414 222 88 61 31 1247 ----
NM_001001549chr732548 2408 2215 --11988 --
NM_001001550chr732548 2408 2215 --11988 --
NM_001001555chr732548 2408 2215 --11988 --
NM_001001557chr811592 12103 1411 --
NM_001001694chr2272206 2188 2021 1910 1864 102 29 --11497 12315
NM_001001794chr22233 25 ------
NM_001001890chr2182719 1694 1499 1418 1389 271 218 29 ------
NM_001002032chr173613 288 239 ------
NM_001002033chr173713 339 43 ------
NM_001002233chr831590 1553 55 ------
NM_001002259chr123331 296 77 ------
NM_001002762chr1062833 2812 2004 1927 525 269 --12204 1452
NM_001002814chr873348 3324 3297 3178 1553 1119 55 23759 3746 ----
NM_001002838chrX51813 699 468 345 105 ------
NM_001002860chr1453845 3532 997 933 45 1566 ----
NM_001002909chr1742074 1669 1594 641 1662 11711 --
NM_001003396chr6148 ------
NM_001003397chr6148 ------
NM_001003407chr1084565 4104 4042 3863 3597 3215 792 543 1741 1926 154
NM_001003408chr1084565 4104 4042 3863 3597 3215 792 543 1741 1926 154
NM_001003652chr18117646 7586 7500 7359 5478 2822 1675 749 273 208 75 2946 762 122 18189
NM_001003674chr1895817 5585 4930 4808 2666 2525 2346 1129 972 --36163 5828 4856 --
NM_001003675chr1895817 5585 4930 4808 2666 2525 2346 1129 972 --36163 5828 4856 --
NM_001003676chr1161044 812 679 415 378 285 --2652 65 --
NM_001003677chr114600 235 176 130 --1208 --
NM_001003681chr2222090 640 1726 11926 --
NM_001003694chr33561 242 154 1580 ----
NM_001003760chr6103284 3219 1221 1115 1014 902 690 683 677 567 2532 485 ----
NM_001003794chr372765 1975 1957 1891 1062 403 233 1475 12924 --
NM_001003800chr952745 1424 1109 879 745 11515 11124 --
NM_001004065chr973229 2988 2960 2562 2427 480 179 1521 ----
NM_001004304chr12122894 2860 2742 2637 2368 2039 1260 1111 968 160 103 77 --189 --
NM_001004308chrX31472 1015 366 ------
NM_001004317chr664284 3556 3242 3082 1715 52 ------
NM_001004342chr1135832 5808 5593 4956 4707 4575 2294 1913 1456 1110 797 685 423 24865 2001 11783 --
NM_001004356chr461463 1419 1214 1110 1096 1055 ----11505
NM_001004358chr461463 1419 1214 1110 1096 1055 ----11505
NM_001004360chr221709 83 ------
NM_001004419chr1284404 4358 4304 4278 3591 626 130 92 11786 ----
NM_001004439chr1591191 1024 1013 482 347 311 193 126 78 1516 ----
NM_001005210chr1162284 2277 1831 708 105 24 1677 ----
NM_001005266chr151219 ------
NM_001005267chr151219 ------
NM_001005268chr151219 ------
NM_001005269chr151219 ------
NM_001005335chr19----124 --
NM_001005366chr121671 ------
NM_001005386chr211697 ------
NM_001005404chr17114070 3999 3879 1788 1340 1240 1224 1183 723 528 310 1984 12839 --
NM_001005473chr576137 5846 5675 5197 5047 4727 199 15468 ----
NM_001005476chr2----1680 --
NM_001005505chr361592 500 384 361 166 70 1593 ----
NM_001005609chrX93851 3541 3331 3267 839 802 760 215 123 --12735 --
NM_001005612chrX2467 356 --128 --
NM_001005743chr1421121 120 ------
NM_001005744chr1421121 120 ------
NM_001005745chr1421121 120 ------
NM_001005782chr22194 104 ------
NM_001005909chr3143 ------
NM_001006115chr342780 2388 2179 764 --12135 --
NM_001006600chr512198 --1900 --
NM_001006634chr162572 122 ------
NM_001006658chr12230 101 --128 --
NM_001006944chr113675 511 291 130 ----
NM_001006946chr251566 1525 1394 602 168 --31533 782 356 --
NM_001007023chr1464929 4449 3787 3298 1080 1024 11495 64289 3602 1926 1463 225 90 1151
NM_001007094chr1043817 3397 2792 470 24438 1221 ----
NM_001007098chr12309 74 1288 --1644
NM_001007156chr15121829 1726 1701 1689 1652 1556 1290 1270 392 386 172 134 --21850 1709 --
NM_001007233chr54604 237 124 100 --1703 --
NM_001007237chr152534 796 746 689 268 --12097 --
NM_001007246chr2121733 658 ------
NM_001007271chr105862 837 769 157 141 ------
NM_001007279chr226806 751 732 692 589 279 --1759 --
NM_001007466chr674839 3509 3382 1898 1137 1110 89 --13907 --
NM_001007471chr92556 44 --1342 --
NM_001007553chr1----1345 --
NM_001007559chr1811731 ------
NM_001007794chr12643 146 --1182 --
NM_001008220chr5173769 3654 3648 3501 3492 3413 3153 2993 2712 2639 2619 2568 954 918 892 865 842 1295 13548 --
NM_001008225chr72711 127 1153 ----
NM_001008239chr1853284 2394 427 415 48 13007 ----
NM_001008392chr363050 2641 1415 1298 109 51 --23195 1125 --
NM_001008410chr232173 658 652 ------
NM_001008495chr821647 1397 --1781 --
NM_001008541chr1031753 710 596 --1812 --
NM_001008541chr1031753 710 596 --1812 --
NM_001008563chr961232 1182 1161 391 30 22 --11323 --
NM_001008564chr1352221 1472 1450 840 614 ------
NM_001008701chr1972953 2869 2582 2054 892 638 137 ------
NM_001008709chr112286 25 ------
NM_001008711chr8175 ------
NM_001008777chr171189 ------
NM_001008938chr11175 159 ----
NM_001009566chr151325 271 264 201 67 ------
NM_001009899chr342088 1647 1441 1410 --14445 --
NM_001009909chr1132628 1463 186 13058 --1242
NM_001009993chr254235 3843 3599 1728 153 13359 14246 --
NM_001010844chr61168 ------
NM_001010854chr14277 38 ------
NM_001010867chr1216479 6396 5896 5789 5599 5251 5219 2434 2361 2094 1536 1370 1028 620 584 281 269 252 221 180 161 --42132 1078 373 82 --
NM_001010888chrX2642 525 24513 3436 1280 --
NM_001010891chr566675 5448 5330 5194 2009 1512 ------
NM_001010922chr194052 3974 3869 3056 1661 955 597 585 566 23205 1567 13412 13880
NM_001011537chr331953 613 268 ------
NM_001011546chr202523 156 ------
NM_001011658chrX32132 1399 364 ------
NM_001011666chr776257 5775 4205 1827 1303 639 614 1494 25168 4552 16032
NM_001011708chr252756 2304 1131 292 174 --12093 --
NM_001011713chr1421504 407 ------
NM_001011885chr1511197 --11721 --
NM_001012267chr971982 1924 1557 1255 715 525 313 --1424 --
NM_001012329chr172278 1667 975 661 496 131 95 --11824 12382
NM_001012338chr15154 ------
NM_001012393chr1184608 3519 3474 1953 1502 486 370 298 2986 42 ----
NM_001012426chr6203242 3193 3182 3140 2898 2792 2654 2519 2491 2402 1191 1095 974 859 744 720 691 632 544 94 --161 --
NM_001012427chr6203242 3193 3182 3140 2898 2792 2654 2519 2491 2402 1191 1095 974 859 744 720 691 632 544 94 --161 --
NM_001012614chr42592 243 ------
NM_001012753chr197956 872 434 287 248 205 166 183 ----
NM_001012756chr1952999 2449 2423 760 579 ------
NM_001012761chr552523 1054 989 792 413 --1799 --
NM_001013031chr1063328 2470 2421 2394 735 710 12577 ----
NM_001013406chr731765 1613 360 1496 ----
NM_001013415chr4----11352 --
NM_001013620chr1256417 5981 5282 2937 1553 27544 1233 ----
NM_001013635chr1231022 276 266 ------
NM_001013690chr12112424 2247 1970 1917 1747 991 915 516 488 444 376 ------
NM_001013839chr1772368 2102 1689 1678 800 663 617 --1314 --
NM_001014797chr10107714 7681 7658 7609 7531 7450 6020 2926 2395 2328 1441 37706 2812 2322 --
NM_001014839chr14932 370 335 201 ------
NM_001014841chr14932 370 335 201 ------
NM_001014987chr166472 368 361 233 227 109 1140 1460 --
NM_001014988chr166472 368 361 233 227 109 1140 1460 --
NM_001014989chr166472 368 361 233 227 109 1140 1460 --
NM_001015053chr1771465 1362 1285 642 431 242 140 --1226 --
NM_001015877chrX21015 620 ------
NM_001015887chr321442 497 150 1183 --
NM_001017395chr372961 2766 2273 1371 1208 1097 421 --12469 --
NM_001017396chr262051 1632 1451 1400 445 283 ------
NM_001017535chr12112890 2696 2502 1002 931 633 563 507 405 133 98 --12587 --
NM_001017916chr1751617 716 623 376 322 11589 ----
NM_001017917chr1751617 716 623 376 322 11589 ----
NM_001017923chr1421317 439 ------
NM_001017970chr1431710 320 297 ----1632
NM_001017979chr42715 148 ------
NM_001017995chr5204271 4210 4089 4056 3730 3482 3348 3320 1929 1837 1829 1689 1664 1626 1222 697 566 431 341 139 --1964 11380
NM_001018005chr15151 ------
NM_001018024chrX----124 --
NM_001018050chr22103340 3314 3109 2815 2372 2314 2191 1076 862 148 --22656 2511 --
NM_001018052chr22103340 3314 3109 2815 2372 2314 2191 1076 862 148 --22656 2511 --
NM_001018054chr12975 487 --243 28 --
NM_001018060chr22186 ------
NM_001018064chr941597 1563 1400 845 ------
NM_001018067chr154654 4076 1259 979 756 ------
NM_001018068chr154654 4076 1259 979 756 ------
NM_001018069chr154654 4076 1259 979 756 ------
NM_001018108chr1592158 2095 2036 1758 1609 702 590 98 59 11439 ----
NM_001018111chr753455 1618 1364 1068 41 --13255 --
NM_001020658chr13452 116 26 ------
NM_001020658chr13452 116 26 ------
NM_001020818chr1941883 1348 1322 395 --1653 --
NM_001020819chr1941883 1348 1322 395 --1653 --
NM_001020820chr1941883 1348 1322 395 --1653 --
NM_001020821chr1941883 1348 1322 395 --1653 --
NM_001022chr19----133 --
NM_001023567chr1531757 960 579 --11779 --
NM_001023587chr3----162 --
NM_001024071chr143363 243 162 --1410 --
NM_001024218chr143577 568 525 ------
NM_001024380chr832034 638 237 --11639 --
NM_001024381chr832034 638 237 --11639 --
NM_001024455chrX72332 2065 1860 824 435 422 369 1293 22249 81 --
NM_001024649chr582990 2982 2892 2651 2199 2182 1915 129 ------
NM_001024660chr32561 491 11278 ----
NM_001024666chrX3493 104 63 ------
NM_001024808chr12112654 2515 2257 2184 1980 1060 1048 850 634 547 75 --12508 --
NM_001024845chr16944 845 785 718 38 26 --1358 --
NM_001024847chr382529 1647 1629 868 852 776 718 711 11778 21716 541 --
NM_001024858chr14122586 2580 2475 2392 2300 910 808 777 549 215 188 132 11867 ----
NM_001024912chr1951830 1357 1223 188 86 ------
NM_001024948chr113397 ------
NM_001025076chr1095163 5139 4284 3838 2244 2204 2192 1330 216 15219 ----
NM_001025077chr10106521 6497 5642 5196 2688 1574 886 412 146 54 26577 1131 ----
NM_001025108chr262831 2799 1368 1089 716 648 23675 3616 ----
NM_001025205chr31385 ------
NM_001025266chr363826 1913 1693 1349 654 108 ------
NM_001025389chr1141604 1586 1119 360 --1445 --
NM_001025390chr1141604 1586 1119 360 --1445 --
NM_001025579chr173776 253 148 --1175 1407
NM_001025580chrX63607 3314 1390 739 708 616 ------
NM_001025596chr111400 ------
NM_001025616chr41682 11946 --1184
NM_001025780chr921144 1026 ------
NM_001029858chr663352 3213 2602 2483 1305 488 --13066 --
NM_001029859chr1172407 2178 2149 2126 1519 140 35 11748 1323 --
NM_001029863chr643171 2457 241 36 --32774 2260 453 --
NM_001029875chr552585 2277 2196 1200 260 ------
NM_001029896chrX1277 ------
NM_001030006chr1772605 2254 1797 1738 1651 1043 264 12296 ----
NM_001030007chr1643089 1237 888 809 --53795 3692 3487 3025 2751 --
NM_001030287chr15213 174 165 47 36 ------
NM_001031628chr124543 385 141 124 --138 --
NM_001031679chr1283285 2638 2517 1187 1015 948 837 781 ------
NM_001031680chr1152168 2161 2037 1960 1913 1734 1635 749 683 676 547 403 133 122 105 1254 1971 --
NM_001031690chr7112747 1934 1925 1919 1157 806 748 574 463 417 364 ------
NM_001031694chr13723 369 362 1662 1731 --
NM_001031694chr13723 369 362 1662 1731 --
NM_001031695chr2285416 5350 4997 4942 4596 1196 1059 735 11387 ----
NM_001031702chr31674 --1136 --
NM_001031716chr2144 ------
NM_001031723chr41306 --1402 --
NM_001031740chr151575 1116 600 265 28 ------
NM_001031804chr1684287 3662 3599 1314 1170 1150 768 341 1296 21388 1098 --
NM_001031812chr5----12153 --
NM_001032279chr111143 ------
NM_001032282chr841185 140 119 92 ------
NM_001032283chr1221091 111 ----1945
NM_001032284chr1221091 111 ----1945
NM_001032296chr1352427 2319 843 718 710 12179 1808 --
NM_001032380chr1021844 1371 ------
NM_001033044chr141769 1548 1454 216 ------
NM_001033045chr274201 3331 3220 2720 1378 455 108 21610 704 13547 --
NM_001033056chr141769 1548 1454 216 ------
NM_001033059chr63396 381 124 ------
NM_001033117chr374105 3474 1715 1664 789 244 235 --1937 11739
NM_001033507chr141889 1741 1441 614 135 11695 1626
NM_001033518chr782356 2344 2338 2181 1757 903 842 523 1156 ----
NM_001033519chr782356 2344 2338 2181 1757 903 842 523 1156 ----
NM_001033520chr782356 2344 2338 2181 1757 903 842 523 1156 ----
NM_001033551chr17163293 3157 3080 2533 2525 1331 1271 1185 945 932 598 562 363 287 90 51 ------
NM_001033578chr842014 1857 870 704 --1102 --
NM_001033677chr124382 372 335 70 ------
NM_001033723chr872379 2266 2017 1049 1006 630 591 12362 12333 --
NM_001034837chr5----1278 --
NM_001034838chr5----1278 --
NM_001034850chr5----21500 651 --
NM_001034954chr1072644 2396 2359 2062 1015 362 344 1780 ----
NM_001034955chr1072644 2396 2359 2062 1015 362 344 1780 ----
NM_001034956chr1072644 2396 2359 2062 1015 362 344 1780 ----
NM_001034957chr1072644 2396 2359 2062 1015 362 344 1780 ----
NM_001035260chr1011634 1198 ----
NM_001035511chr141450 1369 869 429 1173 ----
NM_001035512chr131557 1476 536 1280 ----
NM_001035513chr131557 1476 536 1280 ----
NM_001037132chr721871 321 1401 ----
NM_001037133chr721871 321 1401 ----
NM_001037290chr112326 153 --1655 --
NM_001037331chr181129 ------
NM_001037332chr582270 1565 597 505 461 302 183 172 1198 1568 --
NM_001037333chr582270 1565 597 505 461 302 183 172 1198 1568 --
NM_001037334chr1842440 2428 511 112 ----1206
NM_001037582chr42621 316 --11133 --
NM_001037631chr23994 255 30 ------
NM_001037954chr1172939 2830 2346 2176 976 417 393 12187 ----
NM_001038493chr261392 625 608 460 319 304 ------
NM_001038640chr1541025 916 647 166 ------
NM_001038707chr181621 1570 1435 730 695 139 121 40 --12178 --
NM_001038707chr181621 1570 1435 730 695 139 121 40 --12178 --
NM_001039199chr20104326 3738 3572 2017 1643 1535 1420 1365 529 185 13166 ----
NM_001039350chr771567 1461 1301 1103 633 313 198 ------
NM_001039457chr1129 ------
NM_001039459chr75725 396 353 228 207 --1811 --
NM_001039550chr25821 666 570 81 59 --1243 --
NM_001039574chr141032 384 317 140 ------
NM_001039577chr184491 4217 1760 930 878 862 739 679 13727 ----
NM_001039590chrX33455 2648 1390 --23063 379 --
NM_001039591chrX33455 2648 1390 --23063 379 --
NM_001039618chr1145481 4827 960 280 ------
NM_001039619chr141254 ------
NM_001039690chr1671923 1838 913 829 738 378 189 --31470 934 526 --
NM_001039840chrX34606 3982 3856 --11685 --
NM_001039885chr1951032 1013 965 491 319 ------
NM_001039888chr12590 305 ------
NM_001039905chr1541564 369 180 53 --1165 --
NM_001039916chr123481 418 335 1304 1109 --
NM_001039917chr123481 418 335 1304 1109 --
NM_001039918chr123481 418 335 1304 1109 --
NM_001039919chr123481 418 335 1304 1109 --
NM_001039920chr123481 418 335 1304 1109 --
NM_001039960chr1251569 1385 640 304 43 1188 ----
NM_001040057chr7----11286 --
NM_001040108chr1452616 2246 1321 1207 487 ------
NM_001040110chr741849 1477 627 227 --11869 --
NM_001040144chr1671923 1838 913 829 738 378 189 --31470 934 526 --
NM_001040146chr1671923 1838 913 829 738 378 189 --31470 934 526 --
NM_001040151chr11144343 4004 3632 3551 3445 3384 3355 2991 856 396 323 193 92 56 13234 1102 --
NM_001040152chr795038 4093 2012 1744 1481 1131 821 336 82 24761 3430 157 1242
NM_001040214chr64768 708 608 535 32036 1817 428 ----
NM_001040260chr42898 882 ----11116
NM_001040261chr42898 882 ----11116
NM_001040284chr1642167 1299 958 92 ------
NM_001040402chr443222 2810 2683 881 ------
NM_001040429chr1332245 1234 1211 23428 417 ----
NM_001040455chr1181316 1162 1115 476 387 343 299 92 1420 ----
NM_001040458chr54750 728 321 90 --1486 --
NM_001040619chr19663 624 615 497 486 160 150 123 116 ------
NM_001040624chr852514 2431 1916 513 192 --22639 2005 --
NM_001040625chr852514 2431 1916 513 192 --22639 2005 --
NM_001040626chr852514 2431 1916 513 192 --22639 2005 --
NM_001040627chr852514 2431 1916 513 192 --22639 2005 --
NM_001040628chr852514 2431 1916 513 192 --22639 2005 --
NM_001040629chr852514 2431 1916 513 192 --22639 2005 --
NM_001040630chr852514 2431 1916 513 192 --22639 2005 --
NM_001040633chr7123 --167 --
NM_001040709chr192395 2229 2187 2156 1846 1803 521 452 102 --1812 12266
NM_001040712chr9----13035 --
NM_001040715chr1641052 923 356 44 ------
NM_001040876chr421287 94 --1339 --
NM_001042368chr91609 --1621 --
NM_001042406chr62496 416 ------
NM_001042413chr983171 2982 2508 1606 1389 755 414 260 ------
NM_001042424chr492990 2563 2529 2067 2059 1991 1028 654 236 --23021 932 11011
NM_001042453chrX2270 46 --191 --
NM_001042473chr1032124 1781 1411 11717 ----
NM_001042479chrX31350 1324 128 --1402 --
NM_001042480chrX31350 1324 128 --1402 --
NM_001042492chr1753450 2668 2143 546 85 ----1989
NM_001042494chr1573672 3457 2619 2451 170 145 55 --11189 --
NM_001042495chr1573672 3457 2619 2451 170 145 55 --11189 --
NM_001042496chr1573672 3457 2619 2451 170 145 55 --11189 --
NM_001042497chr1573672 3457 2619 2451 170 145 55 --11189 --
NM_001042537chrX21682 78 --1546 --
NM_001042539chr1631084 956 183 ------
NM_001042548chr2129 ------
NM_001042555chr1274171 3936 3555 3541 3506 3201 3155 11453 ----
NM_001042599chr2127625 6791 5740 5335 5257 4954 1704 1124 864 694 602 42 36191 5770 898 27775 4841 --
NM_001042603chr12104934 4849 4181 3956 3806 3262 1800 1373 1332 488 ----13852
NM_001042604chr334793 3467 1783 --1328 11631
NM_001042632chr2062363 1910 701 577 285 233 1126 12095 --
NM_001042633chr2062363 1910 701 577 285 233 1126 12095 --
NM_001042646chr361648 1642 579 484 357 26 11523 ----
NM_001042669chr41682 11946 --1184
NM_001042678chr14408 326 147 103 --188 --
NM_001042679chr14408 326 147 103 --188 --
NM_001042681chr132620 2003 389 12254 21619 864 --
NM_001042682chr132620 2003 389 12254 21619 864 --
NM_001042682chr132620 2003 389 12254 21619 864 --
NM_001043318chr14103773 3588 3515 3394 2718 2538 931 924 782 651 23665 3202 ----
NM_001043351chr131644 1507 502 1424 1702 --
NM_001044305chr61226 --11182 --
NM_001044722chr5----12153 --
NM_001044723chr5----12153 --
NM_001046chr532321 1914 601 1746 1153 --
NM_001048183chr153774 2787 2515 1332 834 ------
NM_001079874chr121797 1510 ------
NM_001092chr1772036 2028 2018 1674 1628 195 189 1224 22544 535 --
NM_001095chr1291700 1624 1290 1214 717 544 412 266 178 ------
NM_001099678chr365556 5309 4898 4669 4545 1861 --1181 --
NM_001106chr3168371 8072 7370 7311 7233 7136 6724 3081 2966 2819 2523 2190 1168 1145 901 299 27148 84 18107 --
NM_001113490chrX33590 1262 595 13151 ----
NM_001116chr1682761 2609 2347 2147 799 596 385 131 --22240 631 --
NM_001117chr1852117 1555 998 966 496 ------
NM_001122679chr51181 ----1440
NM_001123chr10145 168 ----
NM_001126chr12365 118 ------
NM_001128chr1643089 1237 888 809 --53795 3692 3487 3025 2751 --
NM_001136chr6266 22 ------
NM_001140chr176552 439 107 101 89 33 ------
NM_001144chr1631032 344 67 --31116 332 83 --
NM_001147chr81140 ------
NM_001148chr452129 1933 1837 434 324 ------
NM_001167chrX86174 5858 5624 4493 4127 2541 1965 802 ------
NM_001172chr141520 ------
NM_001174chrX61812 1784 726 581 475 183 1764 --11977
NM_001186chr2112760 12290 1743 --
NM_001191chr2071163 1132 935 425 296 213 48 --11047 --
NM_001196chr2221104 902 ------
NM_001204chr297035 5099 4985 4929 4792 3019 1241 1189 893 35130 4815 611 1603 --
NM_001206chr922852 86 ------
NM_001222chr1081782 1776 1648 1634 1624 792 627 401 ------
NM_001231chr14485 341 158 28 --1321 --
NM_001234chr34294 126 111 25 ------
NM_001241chr21403 ------
NM_001241chr21403 ------
NM_001257chr162321 116 ------
NM_001259chr7156345 6302 6254 6190 6132 5618 5441 5390 4188 4156 1509 1191 1062 599 76 14562 16087 --
NM_001273chr122136 62 ------
NM_001278chr1031096 943 74 ------
NM_001280chr193642 555 524 ------
NM_001282chr1772605 2254 1797 1738 1651 1043 264 12296 ----
NM_001292chr1521001 754 ------
NM_001304chr1743061 2941 1120 1023 ------
NM_001310chr122420 50 --188 --
NM_001315chr642165 859 242 109 --11931 --
NM_001326chr11151 ------
NM_001328chr42592 243 ------
NM_001329chr1021056 392 --11605 --
NM_001331chr1192281 1847 1740 934 664 626 219 210 133 --21832 682 12057
NM_001346chr372850 2653 2227 1952 1739 703 362 12669 ----
NM_001364chr1193783 3761 3713 3681 3505 2944 987 394 382 11923 24718 1666 --
NM_001380chr104743 90 48 42 ------
NM_001382chr112384 74 ------
NM_001387chr552950 2462 1942 230 125 12583 ----
NM_001397chr1122524 2154 1975 1922 1000 938 752 617 579 482 275 59 --1957 --
NM_001399chrX93851 3541 3331 3267 839 802 760 215 123 --12735 --
NM_001401chr941290 1183 213 201 11263 ----
NM_001406chr1731508 502 180 --1661 --
NM_001407chr371456 566 505 428 363 341 122 --1155 --
NM_001408chr161489 1273 543 414 98 90 1464 --11673
NM_001416chr172196 25 --1337 --
NM_001417chr1251931 1798 1470 484 303 ------
NM_001419chr1964306 4126 3608 1321 800 728 ------
NM_001420chr1972691 1144 1127 862 372 129 109 --1216 --
NM_001423chr1251570 1257 708 697 324 --1301 --
NM_001426chr22143 91 ------
NM_001431chr631190 1151 193 ------
NM_001432chr453408 2894 1538 628 62 ------
NM_001438chr173524 1419 1204 1177 302 197 25 1164 ----
NM_001447chr561084 1037 580 541 220 200 --1398 --
NM_001448chrX11404 ------
NM_001449chrX4492 423 369 135 --11253 172
NM_001454chr177925 900 273 228 150 126 114 --2945 633 --
NM_001458chr72172 26 --1632 --
NM_001465chr521584 1437 --11328 --
NM_001482chr153774 689 31 ------
NM_001493chrX5495 102 90 59 30 --2679 553 --
NM_001494chr101740 ------
NM_001497chr942804 2652 2272 1834 ------
NM_001523chr194270 101 66 25 ------
NM_001533chr19----124 --
NM_001541chr11----1137 --
NM_001542chr152534 796 746 689 268 --12097 --
NM_001543chr5134830 4024 3647 3622 3128 2939 1531 1384 1105 817 783 687 622 --11794 --
NM_001560chrX62420 2291 1755 887 59 52 ------
NM_001584chr1131106 1034 477 ------
NM_001606chr9134 ------
NM_001614chr173672 92 82 ------
NM_001614chr173672 92 82 ------
NM_001616chr253514 3307 2556 2538 835 13452 22848 850 --
NM_001620chr113576 324 103 ------
NM_001621chr743037 2209 949 551 ------
NM_001621chr743037 2209 949 551 ------
NM_001626chr19112665 2624 2548 1360 1265 1025 813 694 506 292 194 --53486 1205 911 747 445 12688
NM_001634chr63396 381 124 ------
NM_001642chr1111248 --1414 --
NM_001655chr1151514 1471 1375 466 160 --11395 --
NM_001659chr12142445 2357 2306 2277 2004 1773 1713 1707 1700 1078 1058 649 85 64 12022 22217 2068 --
NM_001663chr1422196 2048 1768 ----
NM_001668chr122026 599 1413 ----
NM_001674chr15213 174 165 47 36 ------
NM_001678chr1781763 1743 1629 1196 575 569 127 21 --11463 --
NM_001683chr332652 1862 34 --22388 1809 --
NM_001699chr1941774 1262 482 136 11611 ----
NM_001702chr85490 444 402 234 119 ------
NM_001706chr33958 679 86 ------
NM_001709chr1152668 2386 2073 1902 782 ------
NM_001737chr5124 ------
NM_001742chr731135 222 79 ------
NM_001743chr22556 140 ------
NM_001746chr582990 2982 2892 2651 2199 2182 1915 129 ------
NM_001754chr2182719 1694 1499 1418 1389 271 218 29 ------
NM_001755chr1632224 1808 857 1912 1517 --
NM_001759chr1294628 4121 3955 3786 3717 3648 3525 1248 1172 14512 ----
NM_001761chr1661764 1754 1349 624 480 331 --1343 --
NM_001773chr151267 1220 514 442 123 11338 1959 --
NM_001789chr331320 311 42 11291 ----
NM_001797chr16----1628 --
NM_001802chr164671 659 212 56 --1112 --
NM_001810chr203227 182 104 --2713 683 --
NM_001821chr153511 1687 1538 1112 851 179 ----
NM_001829chr43391 361 316 ------
NM_001833chr91234 ------
NM_001843chr12127 --193 --
NM_001858chr675020 4994 3390 3192 1354 939 76 13177 ----
NM_001859chr9113671 3326 3010 1472 1245 1103 786 619 272 226 76 13121 ----
NM_001872chr131388 ------
NM_001893chr171292 ------
NM_001895chr2061163 1101 392 365 327 298 ----1809
NM_001901chr63897 718 397 ------
NM_001915chr1751617 716 623 376 322 11589 ----
NM_001936chr771567 1461 1301 1103 633 313 198 ------
NM_001939chrX103642 3353 3141 2715 1490 1425 731 622 547 100 11064 ----
NM_001945chr551151 1072 1065 993 339 2281 145 ----
NM_001946chr1231105 775 95 --1180 --
NM_001949chr6102092 1250 1132 1105 734 726 713 586 238 231 12100 1996 --
NM_001950chr164653 599 510 211 ----1616
NM_001956chr13541 471 112 ------
NM_001965chr2----1160 --
NM_001968chr41590 --1909 --
NM_001969chr1463465 2714 2577 1313 687 52 ------
NM_001980chr1261905 1651 1482 854 583 474 --12099 --
NM_001981chr142280 2081 1960 601 --1640 --
NM_001999chr5--11292 11125 --
NM_002006chr442016 1681 738 157 ------
NM_002010chr131100 ------
NM_002014chr124647 595 422 217 ------
NM_002015chr1362898 2362 2237 2057 532 519 11327 23113 442 11210
NM_002023chr161599 1518 1302 1246 435 38 1263 ----
NM_002025chrX108641 7966 7584 6406 3657 3526 2907 1342 743 655 17392 37689 2821 2286 --
NM_002035chr1853233 2603 1380 914 889 1656 ----
NM_002037chr64153 55 44 32 ------
NM_002040chr2122301 298 12108 ----
NM_002048chr94531 246 233 44 ------
NM_002055chr1741191 539 472 160 11267 31359 1148 31 --
NM_002061chr141716 1498 1333 727 1168 ----
NM_002063chrX135 ------
NM_002065chr141769 1548 1454 216 ------
NM_002072chr91211 ------
NM_002077chr961831 1813 1497 447 276 263 ------
NM_002082chr54940 899 892 48 1771 ----
NM_002086chr1762048 1919 1713 1453 790 739 11427 ----
NM_002092chr464730 4637 4263 3259 3220 882 34039 3337 913 ----
NM_002103chr1981044 934 358 212 157 110 87 44 ------
NM_002114chr61159 1413 ----
NM_002126chr1743584 2801 315 127 1615 11634 11214
NM_002128chr1321013 847 --12500 --
NM_002146chr174887 534 263 247 ------
NM_002160chr91165 ------
NM_002168chr15183 ------
NM_002189chr104554 194 128 95 ------
NM_002199chr41317 --1638 --
NM_002202chr51435 --1124 --
NM_002205chr127922 715 381 262 187 53 24 ------
NM_002207chr32530 106 ------
NM_002214chr784346 3910 2114 1930 1497 1275 953 152 ------
NM_002221chr192891 2770 2459 1877 1148 842 789 642 565 ------
NM_002235chr1261660 1608 1125 1060 629 507 --1316 --
NM_002247chr1031740 650 260 --11924 --
NM_002253chr41463 1893 1315 --
NM_002254chr292328 1774 903 843 559 548 527 514 401 1393 ----
NM_002264chr3104753 4302 4123 3107 1937 1713 1208 985 347 78 ------
NM_002267chr134644 439 247 92 --1729 --
NM_002270chr545517 1783 1513 26 14045 --15075
NM_002281chr123235 135 27 ------
NM_002285chr262831 2799 1368 1089 716 648 23675 3616 ----
NM_002293chr132530 1706 1084 ------
NM_002296chr111471 ------
NM_002298chr1331563 417 63 11668 21358 646 --
NM_002313chr1084565 4104 4042 3863 3597 3215 792 543 1741 1926 154
NM_002314chr761152 1032 878 343 323 146 ----1406
NM_002319chr78798 770 420 274 201 145 94 63 ------
NM_002333chr1971055 1044 888 493 429 267 33 11080 1222 --
NM_002334chr1191991 1736 1298 738 623 535 303 250 84 1122 1383 --
NM_002343chr3138 ------
NM_002346chr87599 556 535 437 172 154 119 ------
NM_002353chr12170 53 --1494 --
NM_002355chr1231192 459 92 1448 ----
NM_002359chr1794181 3809 3659 3066 1623 1503 442 375 242 --13302 --
NM_002373chr1571289 1279 1144 498 491 484 167 ------
NM_002375chr3121666 1580 1564 725 696 659 634 483 332 193 83 36 --22335 387 --
NM_002382chr1441087 1049 185 42 --11159 --
NM_002384chr1821001 381 ------
NM_002387chr585126 4103 3639 2046 1348 879 612 143 23595 3413 ----
NM_002390chr1781923 1653 1595 736 642 554 281 67 --1259 --
NM_002397chr531491 875 157 11777 ----
NM_002398chr261188 1055 259 227 164 135 ------
NM_002401chr17122229 1972 1948 1884 1846 1799 1601 1010 533 289 224 185 ------
NM_002419chr115462 387 337 94 28 ------
NM_002429chr1251355 602 487 270 47 --11193 --
NM_002430chr2221983 308 --12026 --
NM_002467chr81146 ------
NM_002480chr123925 329 292 --11001 --
NM_002501chr19254131 4080 4063 3944 3714 3641 3495 3462 3375 3363 3290 3228 3116 3020 2516 1341 1001 928 846 732 608 493 371 213 138 --23014 978 --
NM_002505chr641435 1273 1246 397 11315 ----
NM_002507chr17111877 1553 1464 1272 688 576 471 384 147 52 25 --1257 --
NM_002508chr141721 1611 575 131 ------
NM_002509chr205794 316 139 42 29 ------
NM_002515chr1471629 1376 788 757 701 609 47 --11581 --
NM_002522chr17163857 3699 3648 3278 3068 2704 2657 2402 1342 1239 964 810 379 199 179 153 --1239 --
NM_002530chr15154 ------
NM_002545chr1184608 3519 3474 1953 1502 486 370 298 2986 42 ----
NM_002556chr1161920 1776 1726 1676 674 313 ------
NM_002569chr1591411 1331 1308 1107 1057 274 268 262 131 --2572 382 --
NM_002576chr1131023 442 107 --21173 23 --
NM_002577chr383716 2851 2599 1241 1011 782 761 323 --12786 --
NM_002581chr995184 3654 1815 1482 1379 996 659 252 210 15572 ----
NM_002587chr53456 390 77 ------
NM_002588chr581267 1128 592 348 317 293 222 78 11656 ----
NM_002589chr4----125 --
NM_002594chr2082504 2053 1577 790 580 314 190 61 11597 ----
NM_002595chr1221679 692 ------
NM_002601chr21338 ------
NM_002608chr2271382 1361 1259 1238 486 248 64 ------
NM_002609chr531234 559 152 1270 31518 1499 532 --
NM_002646chr161884 1810 1724 1682 850 434 --11923 --
NM_002653chr57897 677 670 641 325 96 82 ----1687
NM_002655chr83706 297 50 ----11719
NM_002657chr20153174 2494 1506 1348 1257 1135 1034 972 805 682 407 202 195 75 62 23527 2376 1469 --
NM_002670chr321245 46 ----11018
NM_002673chr32597 186 ----1538
NM_002693chr154400 357 338 264 ------
NM_002698chr19132869 2574 2567 2104 1981 757 708 520 320 209 194 162 43 ------
NM_002707chr2----1323 --
NM_002708chr112286 25 ------
NM_002709chr212980 --1561 --
NM_002710chr121376 ------
NM_002713chr131216 1192 920 --11186 --
NM_002716chr1163561 2992 1246 1189 1012 408 11435 ----
NM_002719chr1441708 1640 144 115 ------
NM_002721chr93476 456 203 ------
NM_002730chr1991306 1270 1232 1114 892 423 402 199 95 11243 ----
NM_002731chr142566 2505 1167 919 --21174 315 --
NM_002742chr141556 ------
NM_002745chr2244174 1762 1297 901 ------
NM_002752chr52132 98 ------
NM_002758chr17----1377 --
NM_002760chrY125960 5742 5051 4982 4681 4669 4130 3778 1258 1095 951 67 14198 14298 --
NM_002776chr19121828 1660 1649 1454 1358 1329 1244 661 595 378 189 171 --168 --
NM_002811chr16------1511
NM_002824chr122444 358 --2352 340 --
NM_002827chr2041329 308 180 121 1396 ----
NM_002828chr182847 713 ----188
NM_002837chr1274053 3952 2913 993 957 914 75 --1459 --
NM_002839chr9----13035 --
NM_002843chr1143196 2464 689 66 --1727 --
NM_002844chr611297 ------
NM_002847chr751380 1349 1322 558 21 --1591 --
NM_002849chr121717 --1918 --
NM_002851chr73511 501 100 ------
NM_002855chr11193436 3307 3229 2458 2363 1480 1470 1411 1304 1209 994 893 748 737 726 656 268 212 128 --2852 840 --
NM_002857chr171930 1775 855 822 217 126 30 --11038 --
NM_002868chr1271957 1920 1499 940 934 334 60 22188 2014 ----
NM_002869chr1151716 1708 426 418 411 ------
NM_002886chr375205 5154 4925 1990 1760 609 272 ------
NM_002899chr3125 ------
NM_002904chr62197 37 ----130
NM_002911chr1961429 1313 1245 447 303 254 --21539 265 --
NM_002912chr62255 204 ------
NM_002918chr1991040 807 758 425 293 247 94 88 21 --1314 --
NM_002940chr421287 94 --1339 --
NM_002942chr32478 251 ------
NM_002957chr983853 3523 2998 1483 1285 797 779 331 ------
NM_002959chr1114321 4218 4093 3931 3687 3663 3105 504 369 92 69 13421 ----
NM_002977chr252903 2724 2694 1306 345 ------
NM_002996chr1681957 801 707 361 289 232 142 56 163 1482 --
NM_002997chr251566 1525 1394 602 168 --31533 782 356 --
NM_002998chr841510 737 445 133 --11958 --
NM_003001chr131557 1476 536 1280 ----
NM_003010chr1751961 1911 1811 944 221 --11803 --
NM_003011chr921704 145 11053 ----
NM_003012chr872776 2740 2267 1165 673 176 65 1165 12050 --
NM_003013chr42105 36 ------
NM_003016chr171626 ------
NM_003022chrX145 --1401 --
NM_003045chr13164526 4179 4118 3676 3567 3473 1323 1306 925 694 664 434 313 297 153 37 11300 1861 13558
NM_003047chr141350 987 382 329 --1317 --
NM_003055chr101378 ------
NM_003060chr531245 1018 174 ------
NM_003068chr8--1410 1694 --
NM_003070chr91219 ------
NM_003074chr321822 116 ------
NM_003075chr121252 ------
NM_003076chr1291409 1171 1050 564 554 319 223 211 180 ----168
NM_003108chr296554 6537 5404 5064 2801 2616 2569 1836 1342 16699 ----
NM_003112chr733071 652 278 1220 11068 --
NM_003128chr241866 1768 518 406 12516 11065 12130
NM_003131chr671724 1709 1419 879 323 223 215 ------
NM_003137chr642187 2096 2026 281 --11936 1853
NM_003155chr821138 370 --22690 1997 --
NM_003156chr1191225 1033 490 450 327 293 217 152 90 --1558 --
NM_003168chr173925 836 273 ----1395
NM_003173chrX51400 401 326 315 195 --1202 --
NM_003174chr10125 ------
NM_003181chr63215 176 120 ------
NM_003199chr1845114 4517 530 100 15526 ----
NM_003200chr1982253 1832 1668 1545 1464 768 748 55 --31921 1539 273 12131
NM_003202chr561201 1191 609 585 395 55 140 ----
NM_003214chr651201 901 574 477 110 ------
NM_003217chr1281480 1445 1235 504 483 391 235 51 11683 1467 --
NM_003221chr673741 3464 3135 2817 2784 2762 474 --11659 11301
NM_003234chr362087 1556 706 484 233 115 1697 ----
NM_003242chr382529 1647 1629 868 852 776 718 711 11778 21716 541 --
NM_003246chr1541948 1525 1414 159 ------
NM_003253chr2131745 1292 48 ------
NM_003255chr1782319 1695 951 699 517 510 200 112 --1603 --
NM_003257chr1511275 ------
NM_003269chr6171 ------
NM_003270chrX21074 263 11175 ----
NM_003272chr1------1138
NM_003286chr203787 447 71 ------
NM_003291chr131214 ------
NM_003317chr14387 39 21 ------
NM_003319chr24757 405 384 355 ------
NM_003320chr1143332 2785 2709 547 ------
NM_003324chr1261386 1286 1254 1170 959 81 ------
NM_003325chr222284 191 1530 ----
NM_003339chr51361 --1105 --
NM_003340chr441088 140 104 94 ------
NM_003342chr1733245 2660 2105 12753 12672 --
NM_003344chr711678 --1531 --
NM_003345chr162459 374 ----189
NM_003347chr2252215 2150 822 742 44 --22028 1888 1719
NM_003352chr22194 104 ------
NM_003367chr191419 --1548 --
NM_003369chr1152177 1951 1848 1829 905 --22165 576 --
NM_003392chr363120 1740 1718 1093 919 26 ------
NM_003403chr142829 255 ------
NM_003404chr201127 11546 ----
NM_003406chr851625 1567 460 141 72 --128 --
NM_003410chrX22027 1180 22296 403 12040 --
NM_003412chr342565 2537 678 32 13038 11973 --
NM_003421chr1043817 3397 2792 470 24438 1221 ----
NM_003430chr1931561 333 48 11410 ----
NM_003458chr363465 2969 2643 1508 610 169 23200 910 23703 2669 --
NM_003459chr29716 654 468 253 165 159 153 147 47 --1622 --
NM_003463chr663233 3167 1360 641 304 137 1922 ----
NM_003468chr273952 3211 2830 1637 1061 553 164 ------
NM_003471chr32681 253 ------
NM_003478chr1122567 1026 13196 ----
NM_003482chr12112420 1720 997 928 745 682 498 453 363 241 160 ------
NM_003483chr1262934 2548 2537 2399 842 218 ------
NM_003485chr1461226 1014 989 173 58 25 ------
NM_003489chr2133211 598 311 ------
NM_003496chr71801 ----1107
NM_003507chr221945 407 --11453 11273
NM_003557chr161195 312 207 187 145 72 ------
NM_003559chr17143136 2978 2738 2572 1298 1268 1165 908 807 726 645 419 371 250 13837 23575 3428 --
NM_003564chr14488 264 175 90 1202 ----
NM_003566chr1232693 1136 213 ------
NM_003574chr1854859 4400 3685 1981 915 11750 2901 565 --
NM_003575chr771579 1443 1308 1262 1159 1074 361 ----11224
NM_003576chr1352427 2319 843 718 710 12179 1808 --
NM_003583chr1233323 413 407 ----1719
NM_003590chr243409 2549 1568 1503 ------
NM_003603chr4----1358 --
NM_003612chr153530 177 26 ------
NM_003617chr143256 3241 1629 66 34886 3250 47 1875 --
NM_003624chr1931209 1042 202 ------
NM_003628chr2----1680 --
NM_003629chr153502 3159 3086 1385 1175 --32977 2904 2555 --
NM_003632chr176565 252 189 136 125 64 --1267 --
NM_003633chr542231 1034 369 42 ------
NM_003635chr101493 ------
NM_003644chr17156220 6137 5618 5495 4985 2479 2129 1486 1265 836 658 641 514 343 243 23993 173 1683 15953
NM_003655chr172546 289 ------
NM_003659chr21957 ------
NM_003679chr153410 3254 2417 296 287 --22252 857 --
NM_003680chr13705 551 243 1682 166 --
NM_003682chr113824 665 26 ------
NM_003713chr141214 1178 1110 446 ------
NM_003714chr572986 2490 2312 1152 1099 680 386 ------
NM_003735chr581267 1128 592 348 317 293 222 78 11656 ----
NM_003736chr581267 1128 592 348 317 293 222 78 11656 ----
NM_003743chr272201 2010 1649 1529 1450 479 389 ------
NM_003744chr1421121 120 ------
NM_003763chr2082592 2184 1024 980 853 700 547 70 ------
NM_003792chr9129 ------
NM_003800chr612100 --1612 --
NM_003821chr85581 461 434 411 136 ------
NM_003822chr172545 737 577 507 426 235 101 12557 --1801
NM_003825chr152978 588 1269 ----
NM_003840chr852037 1916 378 99 34 12275 3646 479 359 --
NM_003861chr1452537 2440 2433 868 380 ----12384
NM_003873chr101539 1640 ----
NM_003877chr123802 747 342 1366 ----
NM_003883chr5125 ------
NM_003884chr311474 ------
NM_003885chr172730 107 ------
NM_003887chr232060 1787 556 ------
NM_003893chr105486 324 111 58 43 ------
NM_003899chr1361660 620 529 398 354 255 --52061 1641 973 584 439 --
NM_003901chr1082703 1841 1751 978 892 742 597 141 ----1100
NM_003924chr42416 174 ------
NM_003936chr27901 757 474 272 264 105 34 ------
NM_003939chr1062659 1197 812 657 527 315 33283 3012 22 1971 --
NM_003942chr113675 511 291 130 ----
NM_003948chr432369 983 223 ----22098 814
NM_003958chr663854 3225 2743 1202 377 251 11500 --12898
NM_003966chr567623 7506 7499 3077 2286 881 11861 46865 5055 137 58 --
NM_003983chr1664018 3930 3459 3354 2719 1551 1372 ----
NM_003987chr10122084 1812 1803 1769 608 431 328 239 134 128 122 60 --21838 926 11849
NM_003988chr10132161 1889 1880 1846 1443 685 508 405 316 211 205 199 137 --11915 11926
NM_003994chr1224339 343 --1937 --
NM_004006chrX1903 ------
NM_004007chrX1903 ------
NM_004009chrX1903 ------
NM_004010chrX1903 ------
NM_004011chrX1903 ------
NM_004012chrX1903 ------
NM_004013chrX1903 ------
NM_004014chrX1903 ------
NM_004015chrX1903 ------
NM_004016chrX1817 ------
NM_004017chrX1903 ------
NM_004018chrX1817 ------
NM_004020chrX1903 ------
NM_004021chrX1817 ------
NM_004022chrX1817 ------
NM_004023chrX1817 ------
NM_004024chr19572 533 524 406 395 160 150 123 116 ------
NM_004040chr24949 277 178 92 --2384 318 --
NM_004047chr1129 ------
NM_004050chr1461980 1800 1074 1014 953 634 ------
NM_004056chr811085 1227 ----
NM_004060chr521010 101 1521 ----
NM_004062chr162239 205 --2260 44 --
NM_004068chr31385 ------
NM_004073chr12273 84 ------
NM_004077chr1251272 1226 1063 871 477 --11143 --
NM_004087chr321595 1546 --11380 --
NM_004090chr1772375 2353 2211 1057 418 356 134 22563 2243 ----
NM_004093chr1333206 368 259 ------
NM_004094chr1462570 2335 2038 883 326 193 12627 1226 --
NM_004097chr23582 365 126 ------
NM_004117chr631742 1630 27 ------
NM_004123chr17156 ------
NM_004169chr174651 609 595 89 --1616 --
NM_004186chr33745 346 159 ------
NM_004200chr11193026 2934 2904 2853 2588 2349 2234 2219 2121 1106 1057 1029 958 943 775 436 342 137 45 22626 1002 31022 178 156 --
NM_004202chrY2477 177 ------
NM_004209chr168893 803 785 432 403 204 54 28 --11152 --
NM_004225chr841512 1338 1200 1047 ------
NM_004227chr7102620 2559 2318 1178 856 823 810 747 213 120 --1400 --
NM_004230chr1962258 2252 1454 904 458 108 12341 ----
NM_004247chr17--173 1282 --
NM_004261chr1----1361 --
NM_004263chr271588 735 728 505 467 285 200 ------
NM_004269chr9123 ------
NM_004273chr10154990 4911 4653 4448 4090 4084 3857 3739 3341 1689 1573 1170 1038 156 138 24483 3439 64892 1719 1550 1118 991 47 --
NM_004274chr1442766 2752 276 262 --175 --
NM_004276chr124382 372 335 70 ------
NM_004279chr732114 1916 739 2557 543 ----
NM_004296chr14123823 3527 3211 3104 2787 2749 2679 2595 911 844 610 63 1464 --23881 3359
NM_004311chr10112999 2912 2832 2500 2215 1016 696 671 429 152 107 ------
NM_004319chr1102902 2142 2128 2104 2053 1935 620 443 338 180 ------
NM_004321chr2133527 3462 3255 2989 2965 2265 2256 1338 1163 1148 608 597 51 --11275 --
NM_004338chr1895817 5585 4930 4808 2666 2525 2346 1129 972 --36163 5828 4856 --
NM_004342chr732241 1855 1795 11705 ----
NM_004346chr421326 1319 11025 ----
NM_004349chr841013 893 332 60 ------
NM_004350chr1152168 2161 2037 1960 1913 1734 1635 749 683 676 547 403 133 122 105 1254 1971 --
NM_004364chr194978 478 402 313 ------
NM_004370chr671809 1649 1528 1341 815 522 285 ------
NM_004380chr1662540 2404 2123 2114 1907 1018 ------
NM_004383chr155479 465 239 132 101 --4517 491 472 154 --
NM_004384chr5----12153 --
NM_004386chr1981702 1657 1507 930 812 623 252 36 11769 12078 --
NM_004392chr1321063 172 11899 ----
NM_004393chr352033 1978 1859 1749 899 --11509 --
NM_004394chr571567 1375 1346 718 702 173 33 1472 126 --
NM_004397chr1153447 3390 3159 3135 412 33042 3003 2768 13630 1961
NM_004416chr1291053 756 742 720 697 380 368 357 185 ------
NM_004419chr103116 99 30 ------
NM_004420chr11122255 2161 2051 1513 951 780 600 551 543 520 301 23 11745 ----
NM_004423chr382709 2333 538 437 365 315 207 62 12529 2683 24 --
NM_004426chr1211390 ------
NM_004428chr12553 143 1812 ----
NM_004430chr85980 902 822 372 113 --1658 --
NM_004431chr14710 625 273 250 --2721 25 --
NM_004433chr151769 1515 448 396 357 ------
NM_004436chr13491 158 50 ------
NM_004437chr1103603 2939 2776 2421 1413 1272 1148 802 761 40 --12763 --
NM_004438chr282878 2711 2622 2047 1120 846 358 46 ----1642
NM_004439chr41129 ------
NM_004442chr151369 1177 477 53 39 ------
NM_004443chr32740 180 ------
NM_004447chr123798 279 26 ------
NM_004457chr2193 21087 101 ----
NM_004464chr444041 3759 3387 915 --23774 1102 --
NM_004468chr16498 441 435 203 177 121 131 1560 --
NM_004474chr151035 755 342 142 67 ------
NM_004475chr1781180 1111 1087 1021 769 486 402 281 ------
NM_004480chr142635 587 2288 205 ----
NM_004481chr181776 1747 840 641 553 513 419 388 22483 1007 --11808
NM_004484chrX131 ------
NM_004500chr1451379 161 138 123 32 --1174 --
NM_004501chr13483 442 352 23995 2657 ----
NM_004504chr242762 2434 2066 172 ------
NM_004508chr101739 ------
NM_004514chr1741896 679 479 348 ------
NM_004521chr10----1262 --
NM_004528chr1------1109
NM_004529chr91218 11418 ----
NM_004532chr32316 41 ------
NM_004537chr1231320 535 421 ------
NM_004549chr1141302 1118 1095 22 ------
NM_004554chr1441338 363 44 38 --11860 11615
NM_004555chr16134 ------
NM_004556chr66931 895 244 105 42 33 --1406 --
NM_004586chrX94993 4456 4356 3380 1590 1459 1366 1213 105 ------
NM_004588chr11133233 3188 3120 2895 2859 2851 2764 2560 1395 1223 1194 838 716 12912 21059 801 --
NM_004593chr3129 ------
NM_004598chr563190 2680 2452 496 330 102 ------
NM_004602chr2061421 1304 1125 1061 520 445 ------
NM_004603chr751042 962 874 844 127 --1166 --
NM_004612chr953896 3619 3409 3320 1471 24204 537 ----
NM_004615chrX3832 303 173 ------
NM_004621chr1151248 348 316 176 145 ------
NM_004630chr1141062 921 815 386 ----2469 225
NM_004631chr12975 487 --243 28 --
NM_004634chr33561 242 154 1580 ----
NM_004637chr321010 135 --2493 486 --
NM_004643chr142619 296 1157 ----
NM_004646chr192436 380 ----2812 98
NM_004654chrY1102 ------
NM_004655chr172948 396 ----11187
NM_004656chr361082 787 446 343 103 69 --11094 1193
NM_004660chrY1914 11497 1182 --
NM_004661chr541228 863 482 58 ----1127
NM_004663chr15------1455
NM_004687chr172835 328 --11928 --
NM_004703chr1732415 2373 1694 ------
NM_004705chr111106 --1758 --
NM_004711chr22193501 3447 3366 3333 3165 3111 2842 2551 2397 1311 1126 950 925 823 793 535 208 115 34 --23566 96 --
NM_004715chr181127 ------
NM_004717chr721332 356 --21160 345 --
NM_004718chr2----1523 --
NM_004719chr1232799 2454 2277 ----11807
NM_004734chr1353235 3175 2378 2217 828 ------
NM_004742chr341461 1260 459 47 --11872 --
NM_004745chr876925 6753 6675 6035 6029 160 131 11541 34638 1812 1674 --
NM_004747chr10----1370 --
NM_004748chr1531560 820 402 --11040 --
NM_004775chr1821714 852 ------
NM_004783chr165656 213 194 135 114 ------
NM_004796chr1442008 976 302 218 ------
NM_004798chr2083268 3208 3054 3041 1223 984 823 539 12377 ----
NM_004805chr22562 289 --11353 --
NM_004807chr2102254 2098 1669 943 680 569 508 463 457 109 1475 21696 950 --
NM_004808chr1062752 2623 2311 2155 876 821 23342 591 13014 --
NM_004815chr154482 3694 3358 1492 198 24402 3124 34049 3419 1027 --
NM_004822chr17133984 3705 3678 3418 3367 3346 2894 2837 2498 1379 647 588 392 --1866 --
NM_004824chr63446 386 62 ------
NM_004834chr272746 2591 969 849 316 181 126 12533 22445 646 --
NM_004845chrX104142 3076 2668 2610 1662 1323 1070 1013 987 879 ------
NM_004850chr211265 ------
NM_004859chr1722192 612 ----12742
NM_004865chr61138 ------
NM_004866chr544374 4263 4203 412 1238 ----
NM_004884chr1581616 1606 1143 1137 662 625 501 178 ------
NM_004887chr52937 244 --1411 --
NM_004896chr1011549 1113 ----
NM_004898chr442550 2489 2177 877 --22798 2335 --
NM_004904chr776257 5775 4205 1827 1303 639 614 1494 25168 4552 16032
NM_004911chr72610 582 ------
NM_004912chr731765 1613 360 1496 ----
NM_004924chr192326 60 --2395 69 --
NM_004926chr1441859 520 99 84 2168 60 --1277
NM_004943chr1981131 921 771 329 262 196 118 31 ------
NM_004947chr372484 2089 757 746 740 692 84 ------
NM_004956chr733281 3215 3027 ------
NM_004961chrX61516 1447 1167 475 434 428 --1122 --
NM_004976chr11194989 4983 4964 4799 4370 4232 4141 3890 3768 3671 3288 2046 1998 1779 1666 1387 1295 1255 849 34831 611 514 ----
NM_004978chr181695 1291 1091 1047 571 411 361 192 ------
NM_004979chrX61139 768 478 472 279 259 ------
NM_004985chr121357 --1112 --
NM_004992chrX248165 7931 7889 7747 7362 6847 6671 6177 5797 5742 5530 5183 3083 2963 2817 2492 1982 1398 1346 1277 643 587 576 346 12648 57705 2401 2166 1674 417 --
NM_004992chrX248165 7931 7889 7747 7362 6847 6671 6177 5797 5742 5530 5183 3083 2963 2817 2492 1982 1398 1346 1277 643 587 576 346 12648 57705 2401 2166 1674 417 --
NM_004993chr1451362 1355 1348 529 336 ------
NM_005005chr8165 ------
NM_005010chr721871 321 1401 ----
NM_005011chr741849 1477 627 227 --11869 --
NM_005017chr3----140 --
NM_005028chr1042258 766 701 320 --11724 --
NM_005044chrX114517 4298 3570 3501 3244 3200 3188 1570 1271 900 820 ------
NM_005056chr12105178 5093 4425 4200 4050 3506 2044 1617 1576 732 ----14096
NM_005060chr1101141 987 939 900 887 414 222 88 61 31 1247 ----
NM_005063chr1063602 3424 2760 2425 653 369 1998 ----
NM_005065chr1485317 4834 4380 4231 2038 1993 1462 755 ------
NM_005066chr11767 --1705 1806
NM_005068chr641318 1238 1052 64 ------
NM_005070chr23252 181 60 ------
NM_005094chr97650 575 464 133 112 60 48 --1525 --
NM_005099chr151289 885 295 228 141 1389 183 --
NM_005102chr2129 ------
NM_005105chr11376 ----1831
NM_005109chr372271 2094 1615 868 533 366 252 ------
NM_005116chr2084142 4080 3918 3445 1694 1008 978 113 12795 13656 --
NM_005121chr1723322 1386 ------
NM_005124chr63790 168 158 ------
NM_005133chr111143 ------
NM_005135chr1573672 3457 2619 2451 170 145 55 --11189 --
NM_005137chr2272356 2212 2117 1925 794 724 90 --1901 --
NM_005139chr42289 51 ------
NM_005144chr861185 1124 1019 948 929 403 --1959 --
NM_005148chr174478 455 422 32 --1468 --
NM_005151chr1842440 2428 511 112 ----1206
NM_005154chr151239 ------
NM_005155chr67656 605 515 217 186 120 99 1109 ----
NM_005156chr944665 4180 3377 1789 24600 283 ----
NM_005180chr10----11629 --
NM_005184chr195983 333 206 197 151 11181 ----
NM_005187chr1681665 1620 1416 1388 812 213 114 56 --21409 1381 --
NM_005188chr11188004 7670 6735 6610 6590 6362 6258 5569 5560 5081 3313 3159 2626 2358 1845 1645 634 619 --13105 --
NM_005197chr1444584 1997 1698 455 --12403 --
NM_005201chr31360 --11090 --
NM_005202chr151903 1494 1435 635 551 1236 ----
NM_005219chr511325 --1309 11759
NM_005220chr1731402 570 278 ------
NM_005225chr204968 817 418 331 ----11172
NM_005229chrX21264 42 ------
NM_005231chr1131078 431 392 11363 ----
NM_005233chr321045 175 ------
NM_005235chr2127625 6791 5740 5335 5257 4954 1704 1124 864 694 602 42 36191 5770 898 27775 4841 --
NM_005238chr1143200 2872 1194 722 ------
NM_005245chr41166 ------
NM_005252chr141152 ------
NM_005264chr10----1205 --
NM_005273chr71245 ------
NM_005281chr17908 893 843 287 178 159 88 ------
NM_005311chr732548 2408 2215 --11988 --
NM_005312chr9132630 2592 2173 2019 1980 950 933 907 635 616 395 350 208 --1980 --
NM_005328chr8------1283
NM_005329chr1642244 2190 823 285 --1326 --
NM_005339chr433683 1035 747 11683 13644 --
NM_005342chrX62699 2657 2534 2015 915 93 1941 ----
NM_005359chr1876450 4904 4507 3993 2192 1844 1470 --25254 2377 --
NM_005374chr1782350 2344 1732 843 833 662 412 140 2294 102 ----
NM_005382chr8298 88 ------
NM_005392chr961635 551 385 230 91 51 ------
NM_005397chr753455 1618 1364 1068 41 --13255 --
NM_005398chr1031259 95 45 ----1920
NM_005400chr242657 2443 151 110 --1117 --
NM_005407chr1491523 1370 1364 1116 549 520 451 209 34 ------
NM_005430chr1251034 758 670 223 135 --1353 --
NM_005431chr752134 1978 1398 512 138 ------
NM_005438chr114563 431 250 118 ------
NM_005440chr17102766 2743 2559 2051 1099 1044 542 514 497 481 22947 340 ----
NM_005442chr32597 581 ------
NM_005450chr171222 ------
NM_005455chr171623 1589 1512 682 624 299 72 ------
NM_005456chr112716 650 --1692 --
NM_005461chr2061665 555 101 67 53 34 ------
NM_005474chr1771465 1362 1285 642 431 242 140 --1226 --
NM_005477chr15102258 2040 2010 876 824 801 658 455 406 256 12112 ----
NM_005477chr15102258 2040 2010 876 824 801 658 455 406 256 12112 ----
NM_005479chr102330 31 11599 1207 --
NM_005487chr2222090 640 1726 11926 --
NM_005493chr61583 ------
NM_005502chr953073 2181 2144 1140 418 ------
NM_005504chr1296593 6432 5872 4349 4118 2048 1069 698 492 11675 ----
NM_005506chr462723 2666 2636 2091 431 291 ----11140
NM_005512chr11122011 1769 1598 1582 1513 1348 819 810 670 477 449 432 11606 11534 --
NM_005554chr122111 26 ------
NM_005563chr14830 648 596 29 --1585 --
NM_005578chr384097 3486 3310 882 783 463 410 293 --1254 --
NM_005581chr194448 442 431 414 ------
NM_005587chr15151 --1230 --
NM_005596chr966124 6053 4887 4703 4027 2531 14640 13886 --
NM_005607chr81110 ------
NM_005613chr152173 1844 1668 202 86 --11927 12234
NM_005627chr63946 712 384 ------
NM_005630chr391867 1751 1524 1321 1285 390 289 130 28 ----11638
NM_005637chr1811731 ------
NM_005638chrX1690 ----11379
NM_005650chr223855 498 130 1262 11143 --
NM_005652chr161198 --1453 --
NM_005655chr841185 140 119 92 ------
NM_005659chr221473 --191 --
NM_005660chrX1205 ------
NM_005662chr81329 ------
NM_005665chr144016 3327 744 608 ------
NM_005668chr564339 3851 3040 996 770 758 ------
NM_005678chr1521000 683 --152 --
NM_005688chr34895 854 846 69 ------
NM_005704chr161032 1022 1011 765 232 105 1240 1181 --
NM_005707chr1511053 ------
NM_005711chr531038 53 33 1838 ----
NM_005722chr211697 ------
NM_005730chr12112382 2323 2316 1425 1164 1048 1037 920 402 277 96 --23361 3117 --
NM_005748chr1253411 2180 1103 1039 894 ------
NM_005768chr126662 624 546 522 281 76 ------
NM_005779chr53398 367 263 ------
NM_005789chr1772168 1746 1584 1522 686 521 186 ------
NM_005796chr162330 79 --1371 --
NM_005801chr172287 199 ------
NM_005803chr62120 112 ----132
NM_005808chr363050 2641 1415 1298 109 51 --23195 1125 --
NM_005811chr123397 77 63 ------
NM_005813chr22790 306 ------
NM_005817chr192220 214 --2757 30 --
NM_005819chr182831 2416 2351 1235 913 470 393 162 --2419 240 --
NM_005822chr642248 672 431 345 ------
NM_005826chr11551 ------
NM_005828chr1764921 3952 1748 956 164 57 --23643 620 --
NM_005832chr31993 ----1445
NM_005840chrX137609 7582 7158 6872 6297 6040 5694 2562 2133 2031 1901 1558 1388 15382 25142 66 16486
NM_005853chr161585 ------
NM_005860chr19111657 1621 1451 1397 1312 1272 1195 1130 403 257 42 ------
NM_005868chr762526 2261 575 552 236 206 --1332 --
NM_005883chr19162814 2623 2423 2376 2220 2056 1969 1091 800 612 599 562 232 169 124 100 190 22803 63 --
NM_005892chr174406 400 348 27 ------
NM_005895chr1233105 661 35 --12973 11202
NM_005897chr1----21116 158 --
NM_005898chr1111193 2306 134 12332 --
NM_005901chr18117646 7586 7500 7359 5478 2822 1675 749 273 208 75 2946 762 122 18189
NM_005902chr15114559 4279 3838 3630 3413 3265 3134 909 504 443 221 --33921 3421 1692 --
NM_005903chr594669 1573 1458 1221 1131 1056 437 291 235 ------
NM_005904chr183601 537 459 ------
NM_005905chr131344 ------
NM_005907chr631461 1205 610 --130 --
NM_005909chr523223 2833 11607 1761 --
NM_005910chr17113929 3782 3730 2953 2868 2686 2618 1238 1205 916 322 11291 34000 3952 3847 --
NM_005911chr241399 592 548 318 --1304 --
NM_005920chr183665 3598 1239 1214 1133 1123 990 74 ----12848
NM_005924chr7----123 --
NM_005933chr1182453 2201 1858 760 704 461 415 176 11972 21053 933 11932
NM_005935chr4105039 4683 3967 1814 1644 1359 653 556 215 57 --11541 --
NM_005941chr843509 2912 884 842 ------
NM_005955chr1105114 4362 4321 3883 2090 2039 1956 1323 1040 679 24247 3547 23758 478 11076
NM_005957chr1234815 4760 4052 3735 3725 3417 3353 3329 3096 1850 1825 1763 1656 1532 1338 1267 1046 925 877 860 778 492 186 13609 43557 1686 1256 733 13872
NM_005962chr1031753 710 596 --1812 --
NM_005962chr1031753 710 596 --1812 --
NM_005966chr222431 58 --194 --
NM_005967chr126564 526 520 459 296 69 --1135 --
NM_005969chr1131012 873 176 --11000 --
NM_005990chr562530 1037 396 250 165 40 --21011 529 1953
NM_005994chr174880 374 243 177 --1302 --
NM_006007chr983878 3511 2934 2899 2825 1768 284 191 ----13503
NM_006016chr6182 ------
NM_006030chr361592 500 384 361 166 70 1593 ----
NM_006036chr241970 283 181 132 11859 ----
NM_006037chr284366 3345 3281 1362 1024 831 208 88 ----14457
NM_006038chr2041961 663 369 25 ------
NM_006040chr1671247 1215 1155 1078 483 186 175 ------
NM_006054chr1171375 1369 1301 1198 1036 493 143 ------
NM_006058chr53183 102 25 1665 1264 --
NM_006062chr28901 893 328 180 162 112 96 31 ------
NM_006080chr732763 2011 465 --11877 --
NM_006090chr12643 146 --1182 --
NM_006091chr15121753 1642 1577 1564 1554 1277 673 637 519 506 482 174 21680 1540 1300 --
NM_006099chr12689 63 --1142 --
NM_006109chr141254 ------
NM_006113chr121797 1510 ------
NM_006133chr11122335 2324 2235 1734 1557 1547 884 349 320 293 204 117 22295 2171 12209 --
NM_006158chr831503 1117 57 --11315 1700
NM_006180chr941597 1563 1400 845 ------
NM_006185chr11126 --1496 --
NM_006191chr125933 794 621 333 171 --2723 39 --
NM_006197chr83709 249 142 ------
NM_006201chrX51022 889 811 449 311 ----1460
NM_006203chr545345 3457 2191 183 --15456 --
NM_006206chr422078 210 ------
NM_006211chr8347 31 24 ------
NM_006224chr1792273 2199 1986 1952 756 657 506 278 63 ------
NM_006228chr82431 87 --1283 --
NM_006238chr692025 1939 1791 1499 1395 741 722 639 116 1595 1451 --
NM_006239chr43502 200 80 ----136
NM_006243chr12826 83 ------
NM_006251chr553386 3189 3106 2943 606 1792 ----
NM_006258chr101131 ------
NM_006266chr91609 --1621 --
NM_006268chr1141127 486 255 183 --1929 --
NM_006275chr2032464 1710 596 ----12315
NM_006281chr8198 ------
NM_006281chr8198 ------
NM_006282chr20134739 4642 4336 4127 4036 3861 3147 1900 1418 927 689 31 25 11594 23369 68 14078
NM_006283chr884798 4592 4149 1622 902 875 618 247 13976 ----
NM_006288chr1151016 904 842 128 34 ------
NM_006289chr94432 416 290 138 --1338 --
NM_006298chr6133389 3293 3266 3108 2846 2735 1204 1104 1081 704 658 389 366 1587 ----
NM_006301chr125681 493 249 243 109 ------
NM_006306chrX115948 4820 4350 3693 1308 1220 1034 911 901 842 274 2947 490 ----
NM_006309chr3142 ------
NM_006321chr332122 532 114 ------
NM_006325chr123617 309 87 ------
NM_006330chr82155 67 11284 ----
NM_006352chr121653 1351 ------
NM_006359chrX21682 78 --1546 --
NM_006361chr1721940 196 1590 21657 1572 1312
NM_006369chr11391 ------
NM_006371chr3154798 4737 3738 3725 3200 1377 1289 962 923 824 779 597 576 194 131 --25068 3917 --
NM_006373chr1771406 1343 1300 1105 922 883 371 --1349 --
NM_006374chr21133 ----159
NM_006375chrX2196 180 ------
NM_006380chr1773553 1417 1125 986 970 146 130 ------
NM_006389chr11101266 1173 1167 951 549 542 458 253 224 22 --11364 --
NM_006390chr1231739 1393 1342 ------
NM_006393chr1023234 637 23397 3078 14267 --
NM_006411chr63274 36 26 1677 1189 --
NM_006420chr2053454 2704 1273 971 308 11024 11331 --
NM_006421chr821210 282 --1202 --
NM_006434chr1072644 2396 2359 2062 1015 362 344 1780 ----
NM_006440chr22196 ------
NM_006449chr232131 1925 1486 1546 ----
NM_006451chr52877 433 1178 ----
NM_006454chr492934 2846 2809 2786 2720 2405 2147 1951 121 ------
NM_006459chr1041876 1795 471 141 2636 26 ----
NM_006465chr1582189 1792 1763 896 744 586 351 75 --2439 152 --
NM_006482chr1233323 413 407 ----1719
NM_006489chr1471629 1376 788 757 701 609 47 --11581 --
NM_006497chr178704 692 667 548 524 154 144 128 ------
NM_006504chr1062696 2581 2283 1098 892 816 1211 12264 --
NM_006510chr66996 929 861 738 363 167 ------
NM_006516chr141306 525 173 42 --1505 --
NM_006517chrX112104 1900 1837 1767 1652 1446 926 746 717 707 151 2617 271 ----
NM_006521chrX91288 1255 1157 512 479 282 141 88 67 11302 21349 411 --
NM_006544chr1435192 4556 1251 ------
NM_006546chr17216522 5918 5906 5613 5351 5279 4728 4527 4314 4286 4189 4084 2026 1692 1358 1237 999 876 454 285 179 45799 5541 5070 1042 25551 4696 --
NM_006547chr732092 2077 84 1332 11584 --
NM_006549chr1252436 2425 2184 1819 188 ------
NM_006557chr931129 1085 681 --1454 --
NM_006558chr81317 ------
NM_006560chr111400 ------
NM_006561chr1095163 5139 4284 3838 2244 2204 2192 1330 216 15219 ----
NM_006565chr1641309 1074 831 304 ------
NM_006566chr1821237 372 ------
NM_006582chr1174 ------
NM_006589chr1----1488 --
NM_006591chr1161846 1336 682 570 338 328 ------
NM_006599chr1697866 5803 5733 5331 5144 5107 2589 2507 1045 17164 16261 --
NM_006609chr251939 918 463 445 39 1989 ----
NM_006624chr1021723 97 --11551 --
NM_006625chr11974 --1735 --
NM_006625chr11974 --1735 --
NM_006625chr11974 --1735 --
NM_006628chr1544022 4002 3803 3547 ------
NM_006633chr5----1608 --
NM_006650chr5173769 3654 3648 3501 3492 3413 3153 2993 2712 2639 2619 2568 954 918 892 865 842 1295 13548 --
NM_006653chr6254 32 ------
NM_006654chr1274171 3936 3555 3541 3506 3201 3155 11453 ----
NM_006670chr62489 77 ------
NM_006690chr20102269 2073 1911 1610 894 577 404 346 188 107 --2709 269 --
NM_006695chr173100 85 58 --1259 --
NM_006699chr13579 558 457 12468 ----
NM_006717chr943235 2290 2280 1233 ------
NM_006720chr1084565 4104 4042 3863 3597 3215 792 543 1741 1926 154
NM_006721chr10145 168 ----
NM_006722chr322022 1929 --23065 2889 --
NM_006736chr2101831 1676 1580 1530 1456 759 628 537 399 278 --11253 --
NM_006741chr1241065 1007 957 375 ------
NM_006749chr811150 --1146 --
NM_006750chr16106857 6738 5898 5842 3047 2697 2234 1752 1714 211 13189 11942 --
NM_006756chr81997 ------
NM_006759chr21281 ------
NM_006762chr121155 22 2477 222 --150
NM_006766chr832589 2438 1906 ------
NM_006769chr13584 202 64 --1116 --
NM_006772chr661421 1085 705 301 250 207 1269 51714 1320 503 445 313 --
NM_006802chr131153 1029 944 1279 1780 --
NM_006805chr541331 457 212 80 ------
NM_006815chr1231379 223 82 ------
NM_006819chr113351 344 34 1277 1105 --
NM_006826chr22945 56 --1975 --
NM_006827chr1463202 2784 2732 2597 1162 828 1560 ----
NM_006852chr1762653 2483 1988 727 220 140 ------
NM_006854chr721545 714 --11952 --
NM_006856chr1261151 1051 794 726 203 80 --1295 1213
NM_006857chr24876 235 165 38 ------
NM_006861chr1271951 1910 1882 1307 712 576 116 --21654 1594 --
NM_006870chr202523 156 ------
NM_006885chr1653514 3416 972 359 235 23446 159 ----
NM_006896chr74389 372 360 164 --11110 --
NM_006897chr12123 ------
NM_006902chr152477 903 708 569 471 --22494 1340 --
NM_006922chr221667 908 12602 ----
NM_006927chr1682095 2075 1632 1612 544 447 301 120 ------
NM_006930chr531994 1423 289 1645 --12022
NM_006931chr122135 70 --12091 --
NM_006941chr2281135 1038 898 885 844 743 199 185 --1175 --
NM_006943chr2062691 2497 2371 659 573 96 ------
NM_006947chr421466 391 1109 1690 1193
NM_006950chrX1177 ------
NM_006981chr912479 ------
NM_006990chr162541 2150 1574 514 502 190 11709 21925 861 --
NM_006996chr12631 393 ------
NM_007011chr15116616 6365 6198 6009 2401 712 306 209 174 78 25 --26043 2218 --
NM_007013chr81309 --1403 --
NM_007026chr173480 460 392 ------
NM_007038chr2166056 4742 4201 3832 3692 1471 ------
NM_007040chr193716 400 375 2726 171 ----
NM_007050chr20177780 7427 6711 6668 5897 5737 5606 5083 3241 2811 2798 2670 1866 1817 1411 564 199 --11844 --
NM_007064chr32561 491 11278 ----
NM_007067chr1741124 1072 310 198 --1325 --
NM_007075chrX1277 ------
NM_007096chr91234 ------
NM_007106chr132827 389 32729 2405 960 ----
NM_007114chr332997 1309 22 2813 283 ----
NM_007124chr6----193 --
NM_007146chr1732235 772 561 1384 11851 --
NM_007150chrX51955 1866 1421 1331 73 --11655 --
NM_007158chr1----1345 --
NM_007170chr12705 21 ----1657
NM_007174chr1251967 1768 1575 734 28 ------
NM_007185chr14375 205 66 41 ------
NM_007192chr1411031 --3752 197 27 --
NM_007197chr1211010 ------
NM_007203chr973229 2988 2960 2562 2427 480 179 1521 ----
NM_007213chrX5644 256 190 159 142 --1552 --
NM_007214chr62495 311 21262 1105 ----
NM_007219chr206847 812 696 306 275 242 --3958 300 121 --
NM_007232chr207885 811 367 353 267 241 106 ------
NM_007236chr154995 495 257 88 2987 200 ----
NM_007245chr167884 844 752 670 616 608 26 ------
NM_007249chr13167967 7946 7902 7611 7035 6904 6188 3264 2888 2823 2745 2600 807 405 397 174 11326 29137 525 11522
NM_007271chr63649 576 553 ----11329
NM_007283chr372765 1975 1957 1891 1062 403 233 1475 12924 --
NM_007286chr571739 750 684 588 294 236 96 --11308 --
NM_007294chr1721000 367 --1309 --
NM_007295chr1721000 367 --1309 --
NM_007296chr1721000 367 --1309 --
NM_007297chr1721000 367 --1309 --
NM_007298chr1721000 367 --1309 --
NM_007299chr1721000 367 --1309 --
NM_007300chr1721000 367 --1309 --
NM_007302chr1721000 367 --1309 --
NM_007303chr1721000 367 --1309 --
NM_007304chr1721000 367 --1309 --
NM_007305chr1721000 367 --1309 --
NM_007347chr1542476 2425 2339 27 --13047 --
NM_007350chr1273775 3672 3419 3220 2894 1736 108 ----13131
NM_007353chr772928 2583 2341 1114 1031 905 533 12637 21883 750 --
NM_007358chr1163 1679 ----
NM_007365chr182026 1977 1874 1716 1700 1600 167 97 --1683 --
NM_012081chr51623 --13091 --
NM_012089chr141219 1158 1136 289 ------
NM_012090chr1------150
NM_012095chr1063105 2949 2830 2290 978 945 --41348 939 588 581 --
NM_012098chr931327 971 219 ------
NM_012102chr132620 2003 389 12254 21619 864 --
NM_012104chr11113360 3034 2816 2370 1523 1431 1371 1244 946 703 684 ----11139
NM_012104chr11113360 3034 2816 2370 1523 1431 1371 1244 946 703 684 ----11139
NM_012120chr61906 ------
NM_012129chr752271 2119 989 558 43 ------
NM_012134chr1131741 1586 1487 1433 1270 1204 750 588 368 342 114 84 50 --11223 --
NM_012156chr2073364 3058 3040 2829 1328 1195 101 --12544 --
NM_012193chr11125221 5204 4496 4171 4156 3784 3701 3695 2104 2092 2049 129 12159 ----
NM_012199chr1113832 1827 1609 1412 1308 1099 941 658 229 208 50 --22873 1432 --
NM_012214chr235573 2425 1847 1156 16077 --
NM_012215chr1021734 1450 11301 ----
NM_012219chr3133039 2693 2614 2519 2507 2443 2380 2301 2111 649 569 399 254 12397 22494 2423 --
NM_012229chr1051490 1267 1153 1098 268 --1108 --
NM_012232chr1771875 1810 1664 851 596 467 26 --11573 --
NM_012234chr342746 846 753 400 12378 11119 --
NM_012236chr13723 369 362 1662 1731 --
NM_012238chr1011112 ------
NM_012249chr283327 3196 2751 2460 2276 2231 485 393 13274 ----
NM_012252chr764045 3670 3408 1644 629 463 ----14257
NM_012262chr174317 3807 1288 1278 833 777 69 14256 ----
NM_012281chr711764 --11949 --
NM_012282chrX2292 38 --1102 --
NM_012287chr374160 3593 1554 1347 555 416 346 ------
NM_012290chr2--1157 --11266
NM_012293chr222205 849 11695 11923 --
NM_012294chr731506 1215 194 33893 2862 933 11496 --
NM_012296chr11113434 3406 3379 3035 2796 2691 2653 878 429 89 56 12537 23300 3152 12460
NM_012297chr411681 ----1742
NM_012301chr762027 1647 1456 902 143 32 ------
NM_012306chr12113449 3149 3033 2332 2312 2301 982 976 707 531 361 --31240 950 217 --
NM_012308chr11112487 1907 1851 1815 1021 945 509 500 460 419 354 ----12587
NM_012309chr11104029 3211 1505 1385 1172 841 601 428 318 108 24141 1419 1549 --
NM_012311chr102600 594 ------
NM_012316chr1125326 5034 4885 4718 4190 3661 2255 2069 1902 1859 1429 1401 23826 842 ----
NM_012317chrX4708 594 219 185 ------
NM_012324chr226748 518 512 475 201 36 --1717 --
NM_012325chr2021575 1263 1556 ----
NM_012326chr26747 662 295 230 57 39 ------
NM_012329chr173544 394 172 ------
NM_012330chr1051635 1318 629 556 393 ------
NM_012334chr5154530 4236 3958 3940 3786 3524 3518 3405 3130 3054 1706 1589 917 810 66 ------
NM_012343chr51716 --1276 --
NM_012382chr553708 3281 3253 1785 1515 ------
NM_012384chr2092396 2128 2122 2091 2084 1995 974 413 209 --1550 --
NM_012398chr19172946 2893 2778 2653 2570 2536 2327 2206 1984 966 849 544 494 437 186 115 35 --32791 2697 447 --
NM_012402chr1131412 1300 54 --1482 --
NM_012417chr171570 ------
NM_012421chr12333 34 ------
NM_012446chr52217 21 ------
NM_012448chr1742479 2462 2216 434 ------
NM_012464chr452867 1174 294 201 173 12508 ----
NM_012471chrX41642 1260 327 155 1687 --11724
NM_012478chr174931 191 53 31 --1377 --
NM_012479chr752210 1788 340 219 62 ------
NM_013231chr1433734 3594 2966 11157 ----
NM_013249chr111127 2180 58 ----
NM_013255chr7148668 8659 7290 6707 6588 5757 5509 2762 2604 1472 1406 455 185 68 17549 ----
NM_013257chr842014 1857 870 704 --1102 --
NM_013261chr433765 3072 45 ------
NM_013262chr61449 ------
NM_013269chr1274331 4285 4231 4205 3518 553 57 11713 ----
NM_013279chr11102284 1796 1673 1667 1645 775 641 472 450 121 --11767 --
NM_013309chr1522350 140 1257 ----
NM_013312chr192232 32 ------
NM_013314chr10173 ------
NM_013316chr7141 ------
NM_013341chr252756 2304 1131 292 174 --12093 --
NM_013357chr81237 ------
NM_013368chr192125 32 --1549 --
NM_013372chr153229 54 44 11084 ----
NM_013381chr1211938 12226 --1702
NM_013392chr21411 ------
NM_013399chr162621 147 ------
NM_013411chr152564 2468 1989 1743 369 ------
NM_013433chr1961558 1450 735 622 467 144 --11421 --
NM_013438chr911705 ------
NM_013446chr71427 1935 11088 --
NM_013449chr12132923 2380 2264 2176 2091 1133 1124 1025 988 933 704 358 146 --12124 --
NM_013450chr221066 1053 ------
NM_013989chr1464929 4449 3787 3298 1080 1024 11495 64289 3602 1926 1463 225 90 1151
NM_014021chr133190 2957 2223 ------
NM_014023chr1041838 1092 453 251 ------
NM_014030chr1781155 1126 1045 863 436 390 373 366 1993 ----
NM_014034chr61973 ----11154
NM_014042chr112100 23 ------
NM_014048chr1694725 4312 3894 3886 3816 3674 1844 1054 401 ------
NM_014057chr931357 1293 437 --11518 --
NM_014089chr1352221 1472 1450 840 614 ------
NM_014106chr1522593 682 11164 1308 --
NM_014110chr131216 1192 920 --11186 --
NM_014112chr864807 4717 3758 2016 1363 1301 11169 ----
NM_014117chr1622576 750 --12254 --
NM_014155chr1155474 5417 2724 1395 1360 25574 1575 26587 1083 --
NM_014159chr32171 81 ------
NM_014181chr212435 1693 12639 12013
NM_014190chr4111244 681 567 534 504 314 284 199 187 176 149 --1495 --
NM_014221chrX----124 --
NM_014231chr1241771 277 120 100 --21812 708 --
NM_014232chr1761643 1179 546 444 426 304 11603 11237 --
NM_014232chr1761643 1179 546 444 426 304 11603 11237 --
NM_014233chr1762023 1719 1611 339 193 79 ------
NM_014246chr2262052 805 697 636 355 106 --12113 --
NM_014250chr2222090 640 1726 11926 --
NM_014251chr73821 813 335 --1804 --
NM_014263chr1041253 1234 198 89 ------
NM_014267chr112814 759 1788 ----
NM_014268chr183971 161 77 ------
NM_014271chrX3603 597 564 ------
NM_014284chr14932 370 335 201 ------
NM_014292chr22111603 1423 1389 1369 1282 750 597 586 463 258 160 ------
NM_014293chr22163755 3595 3473 3215 3141 1582 1528 1265 1050 821 772 666 632 398 127 107 --1836 --
NM_014299chr1962067 1896 1389 1353 664 104 --1394 --
NM_014309chr2285406 5340 4987 4932 4586 1186 1049 725 11377 ----
NM_014319chr1221690 300 --11484 1357
NM_014328chr13524 405 346 ------
NM_014331chr496463 6331 5906 5496 3064 2180 1618 1453 805 25077 2236 --1941
NM_014333chr1162737 2390 2255 1991 865 397 12722 141 --
NM_014338chr224899 366 193 103 --1718 --
NM_014342chr1151280 985 474 224 38 ------
NM_014360chr144867 612 223 148 --1113 --
NM_014368chr961861 1825 673 271 114 38 ------
NM_014372chr11260 --11640 --
NM_014376chr582270 1565 597 505 461 302 183 172 1198 1568 --
NM_014381chr1452616 2246 1321 1207 487 ------
NM_014382chr321316 165 ------
NM_014393chr851717 735 629 222 42 --1167 --
NM_014394chr101152 ------
NM_014399chr71683 1922 172 --
NM_014405chr17142036 1972 1946 1886 1714 1698 1631 1585 1493 727 530 273 244 26 ------
NM_014417chr194750 673 589 162 --1664 --
NM_014418chr1451868 1584 1530 295 69 11842 1313 --
NM_014423chr554784 4320 3870 1661 1405 11009 13831 11858
NM_014431chr1051599 1589 1332 587 38 ------
NM_014445chr31107 --1874 --
NM_014458chr131182 395 115 ------
NM_014470chr124627 538 330 261 --2560 304 --
NM_014488chr112482 244 ----1615
NM_014489chr115833 676 544 253 227 1183 ----
NM_014491chr72976 128 ----1373
NM_014494chr1642137 1937 920 447 ------
NM_014498chr31255 ------
NM_014502chr11----133 --
NM_014504chr751440 774 619 565 256 ------
NM_014507chr221795 --31201 1194 60 --
NM_014517chr341886 1801 1406 195 11239 ----
NM_014550chr222649 584 ------
NM_014554chr123673 300 294 1582 ----
NM_014563chrX32132 1399 364 ------
NM_014567chr164453 329 63 47 ------
NM_014571chr1102643 2616 2609 2582 2467 2302 1930 1172 871 25 --22628 904 --
NM_014574chr141420 11589 ----
NM_014592chr5----1278 --
NM_014601chr1961636 1543 1394 379 220 43 --1563 --
NM_014612chr921440 1223 ------
NM_014613chr582998 2212 2169 1912 813 671 394 320 --12224 --
NM_014615chr1642508 2337 399 144 13463 1302 --
NM_014616chr332870 2619 1176 1768 12810 --
NM_014630chr1593941 3436 2686 2507 1131 953 947 827 166 --2995 250 --
NM_014636chr9114235 3838 3393 3024 1196 1113 1005 924 846 444 144 12881 23071 1660 13691
NM_014646chr1852471 1246 1117 777 531 --21168 499 1602
NM_014661chr10113484 3361 2711 2667 2598 2538 2519 778 466 436 131 11400 1959 --
NM_014665chr8143325 3310 3276 3099 2908 2739 1049 999 890 766 654 246 224 172 --1675 1199
NM_014671chr711175 --2625 468 --
NM_014676chr13452 116 26 ------
NM_014677chr821121 172 --1557 --
NM_014683chr1751901 1771 1702 420 81 ------
NM_014686chr1982338 2298 2219 2188 1860 1602 989 162 --1119 --
NM_014690chr7112747 1934 1925 1919 1157 806 748 574 463 417 364 ------
NM_014701chr1513248 --1641 --
NM_014702chr653110 2743 844 206 42 23265 2728 ----
NM_014705chr71733 --1850 11832
NM_014712chr164152 132 106 31 --1470 --
NM_014720chr101107 ------
NM_014730chr12155231 5206 5052 4597 4224 3961 3839 2108 2035 1185 1129 591 292 186 170 11906 ----
NM_014730chr12155231 5206 5052 4597 4224 3961 3839 2108 2035 1185 1129 591 292 186 170 11906 ----
NM_014731chr2081623 1446 604 468 335 182 169 74 297 88 ----
NM_014732chr16195603 5578 5323 4676 4667 4284 4137 4131 3735 3600 1904 1782 1770 805 480 307 195 167 129 14634 ----
NM_014743chr463060 2619 1986 911 772 512 ------
NM_014746chr263225 2668 1135 920 755 180 --44044 956 814 110 12927
NM_014747chr1155288 5082 4922 4889 4879 4768 3727 3543 1708 1633 1273 1243 1151 1091 1044 13719 156 --
NM_014755chr273841 3551 3503 2838 2797 1551 1438 23052 51 ----
NM_014756chr11175 159 ----
NM_014757chr561813 1647 753 372 205 129 12309 22040 1829 --
NM_014758chr1161829 1644 1618 861 783 181 11813 1149 --
NM_014759chr841556 1259 577 436 --11118 --
NM_014764chr123488 478 253 ------
NM_014765chr132688 2111 724 ------
NM_014766chr783783 3515 3508 2389 1292 1196 777 629 12914 21466 887 12847
NM_014767chr10163586 3567 3264 3041 2853 2622 2584 2518 1385 1325 1085 1062 803 624 534 108 ------
NM_014772chr18153272 3243 2991 2956 2915 2600 2358 2261 1168 1085 1008 892 628 584 296 --23232 1388 --
NM_014774chr132988 2451 928 32647 2358 582 1833 --
NM_014781chr81514 ------
NM_014784chr12869 699 1402 2951 231 --
NM_014787chr132424 2051 1094 ------
NM_014795chr22546 505 ------
NM_014798chr1751628 1598 1350 403 175 --21636 758 --
NM_014800chr75725 396 353 228 207 --1811 --
NM_014803chr1032421 869 349 2835 565 ----
NM_014806chr92176 25 137 ----
NM_014810chr173632 2620 2343 1089 1048 881 273 ------
NM_014824chr1151905 1532 1440 1391 267 --1314 --
NM_014827chr12674 111 ------
NM_014830chr1293192 2881 2524 1398 1256 970 738 563 367 1209 23066 193 --
NM_014836chr1021844 1371 ------
NM_014844chr14103670 3657 3170 2808 1214 1100 908 404 306 90 --1471 --
NM_014847chr13366 136 130 --2154 28 --
NM_014849chr1101175 1165 971 929 841 817 347 227 166 113 --21219 271 --
NM_014850chr374105 3474 1715 1664 789 244 235 --1937 11739
NM_014853chr17101485 1367 1281 974 471 446 377 342 287 222 ------
NM_014858chr161091 949 930 364 320 202 --1843 --
NM_014871chr122590 52 ------
NM_014872chr962186 1787 1626 947 735 516 ------
NM_014876chr2292117 1985 1512 1440 766 683 433 348 29 ------
NM_014877chr17117499 6964 6849 6135 6122 6016 5546 2293 2052 1665 603 37132 4949 2081 ----
NM_014891chr781510 650 589 523 403 365 121 104 ------
NM_014897chr1763286 3260 3155 2575 925 42 ------
NM_014900chr21409 ------
NM_014901chr5112029 2020 1476 1469 1438 626 603 579 478 353 188 ------
NM_014903chr1262328 2010 1952 624 491 395 1524 2937 241 --
NM_014909chr14143739 3529 3221 3090 2890 2645 2581 2457 980 741 717 634 583 26 --13719 --
NM_014912chr1032561 1037 69 1589 ----
NM_014921chr1972953 2869 2582 2054 892 638 137 ------
NM_014923chr1321951 476 22010 950 ----
NM_014925chr124766 644 372 241 --1750 --
NM_014926chr32102 92 1751 ----
NM_014931chr196628 603 176 98 89 76 ------
NM_014934chr1343818 3313 3277 74 --13364 --
NM_014935chr1143313 1482 1358 1306 1246 964 926 515 502 488 313 287 125 45 ------
NM_014944chr151325 271 264 201 67 ------
NM_014945chr54546 419 404 280 12011 ----
NM_014947chr132399 1160 1025 --1220 --
NM_014952chr1541826 1768 312 164 ------
NM_014961chr421735 734 --11985 --
NM_014962chr2052827 2366 2182 953 31 ------
NM_014964chr1762379 2171 1881 381 153 119 --12223 1433
NM_014982chr1464924 4880 4763 4325 3550 186 --11990 --
NM_014988chr422027 1138 22670 2188 22407 2159 --
NM_014989chr61143 --1540 --
NM_014991chr433022 2361 61 22607 2174 ----
NM_014992chr141242 ------
NM_014994chr1572246 2032 1939 1461 625 192 36 --42331 2205 2168 295 --
NM_014999chr1231579 346 315 ------
NM_015000chr1242452 2265 2125 1083 12413 1487 --
NM_015002chr1252164 2037 1705 798 337 ------
NM_015008chr372961 2766 2273 1371 1208 1097 421 --12469 --
NM_015015chr1981420 1365 1270 663 620 294 172 56 ------
NM_015017chr12335 120 ------
NM_015020chr1633301 2881 386 13388 13644 13578
NM_015026chr1223351 846 ------
NM_015032chr1332368 793 686 21823 149 --11169
NM_015033chr9112554 2415 2143 1283 1204 1069 909 803 476 241 222 22701 564 22533 113 --
NM_015035chr20126688 6559 5799 5374 5064 4268 4149 2201 1781 1677 1290 98 --26364 4186 --
NM_015039chr1114132 3564 3262 3081 2964 2886 945 616 166 82 38 1129 ----
NM_015042chr15124264 4137 3324 3289 2948 2807 1163 1084 939 676 612 313 12711 12742 23695 3160
NM_015051chr932878 2355 1024 ------
NM_015052chr741362 852 496 282 ------
NM_015057chr131186 --1644 --
NM_015063chr1961312 1018 530 431 423 417 11256 ----
NM_015064chr1273664 3123 2990 2983 2720 1285 963 ------
NM_015068chr783890 2945 1362 1256 1106 864 596 333 33613 1073 954 ----
NM_015071chr596508 5115 4931 4566 1146 1082 1072 998 166 ------
NM_015074chr1144752 4004 3949 3337 3187 3175 3155 1681 1649 1349 1180 376 165 159 ----14371
NM_015075chrX162058 2040 1609 1552 859 641 550 480 472 427 421 390 322 279 110 92 --1402 12279
NM_015076chr674359 2935 2849 1426 1079 528 47 13916 34409 3604 1773 --
NM_015078chr351099 1010 509 382 33 ------
NM_015082chr582461 2264 1962 1852 1815 1587 811 60 12401 ----
NM_015087chr1322255 1834 11720 11023 --
NM_015090chr1135993 5922 5844 4827 4643 4505 4365 2507 1986 1597 1216 752 197 15381 ----
NM_015091chr141673 ----1313
NM_015092chr1663936 1677 1619 641 353 66 13823 ----
NM_015093chr621605 326 --1268 --
NM_015094chr22184641 4109 4026 3952 3463 3194 2984 1727 1663 1642 1520 1499 1402 845 788 379 222 204 --14270 --
NM_015103chr37860 409 296 255 189 77 58 --2666 331 --
NM_015107chrX71593 918 777 585 484 50 38 11498 1458 1417
NM_015113chr1782139 1910 1885 1769 1670 1605 229 69 ------
NM_015115chr443222 2810 2683 881 ------
NM_015129chrX41328 179 111 31 ------
NM_015137chr82556 486 22158 936 1798 --
NM_015138chr1572586 1824 941 814 795 213 51 --139 --
NM_015141chr31228 --12624 11940
NM_015143chr431287 1092 569 ----11117
NM_015144chr1683790 3659 3636 3592 3492 3364 2516 779 --21480 848 --
NM_015149chr152165 1847 1822 779 703 11545 ----
NM_015155chr1043111 1140 817 311 --11035 --
NM_015156chr1453215 765 305 205 178 --1149 --
NM_015171chr162422 55 ------
NM_015185chrX62511 2453 2351 1104 847 609 ------
NM_015187chr43795 712 309 ------
NM_015191chr1132280 643 182 --11021 --
NM_015192chr2021005 163 --2283 176 --
NM_015193chr891454 1422 1326 1180 1068 945 602 295 208 ------
NM_015194chr1781855 1468 1440 1412 708 227 124 54 --1309 1411
NM_015200chr43714 434 50 ------
NM_015219chr1772368 2102 1689 1678 800 663 617 --1314 --
NM_015221chr103973 620 452 --1387 --
NM_015225chr973161 2971 2365 2113 1246 754 212 13106 12332 --
NM_015250chr91446 ----1499
NM_015254chr8132745 2546 2520 2477 2450 2326 2147 628 598 541 489 362 202 ------
NM_015265chr221737 1674 --12059 --
NM_015270chr1271872 1713 884 855 717 695 679 12196 1625 --
NM_015272chr162411 330 1228 ----
NM_015275chr1211467 ------
NM_015278chr643255 2888 2359 75 ------
NM_015284chr1141778 1753 1644 1587 1523 1514 1403 784 657 648 568 442 162 97 ------
NM_015288chr5113832 3298 2993 2841 1209 1172 1120 845 95 52 21 --13790 --
NM_015299chr14133920 3795 3750 3722 3556 3437 3304 3045 3033 2778 2619 304 39 14011 --1806
NM_015305chr1461706 1471 1264 732 194 72 --1599 --
NM_015310chr8108150 7961 7035 6991 6618 5711 3004 2689 526 491 ------
NM_015313chr1174144 3329 3313 1789 1248 141 75 13246 ----
NM_015317chr242496 2488 2158 656 1404 ----
NM_015326chr192786 2538 2530 2301 2007 808 787 667 136 ------
NM_015328chr782736 2705 2554 2402 754 662 361 284 ------
NM_015335chr1232603 520 259 1441 ----
NM_015345chr6132719 2624 2058 1925 855 847 827 810 703 632 296 257 224 1970 1964 --
NM_015347chr1222844 2643 ----12157
NM_015349chr6102323 2278 2261 2049 2041 1227 697 652 247 30 ------
NM_015356chr8266 49 ------
NM_015358chr211283 --1967 --
NM_015365chrX63607 3314 1390 739 708 616 ------
NM_015375chr1104390 4279 4223 3835 3627 1767 1591 1174 798 542 1579 ----
NM_015378chr172859 2824 2308 1012 965 676 142 --32457 887 778 --
NM_015381chr2271873 1350 586 427 386 148 25 1475 1822 --
NM_015382chr141261 ------
NM_015385chr1072644 2396 2359 2062 1015 362 344 1780 ----
NM_015396chr321406 965 --169 --
NM_015401chr125419 395 388 287 75 ------
NM_015404chr97556 532 504 480 468 132 47 ------
NM_015431chr1153356 3226 3177 3126 3108 3084 3035 2946 2873 2713 2267 2261 1175 1082 92 23433 2242 13193 --
NM_015449chr11520 ------
NM_015455chr534072 2936 1081 ------
NM_015460chr32623 156 11327 1270 --
NM_015461chr18----1264 --
NM_015469chr91764 ------
NM_015470chr241214 827 270 136 --1412 --
NM_015477chr151102 ------
NM_015483chr72805 132 ------
NM_015484chr1------1727
NM_015493chr1971559 872 634 536 183 160 55 ------
NM_015497chr152847 729 --181 --
NM_015508chr331392 973 594 ------
NM_015509chr1221543 137 --2606 399 --
NM_015514chr141208 --1416 --
NM_015520chr352486 2151 1983 1832 264 --11868 --
NM_015526chr19131406 1321 1256 1234 1206 1200 1161 1131 502 467 374 241 192 1168 21094 148 --
NM_015542chr101461 ------
NM_015545chr76743 528 307 234 194 54 ------
NM_015550chr773605 2717 2702 2647 881 832 470 1648 ----
NM_015553chr664147 3623 3562 1256 176 123 1819 13295 --
NM_015557chr1103513 3498 3446 2743 2662 1379 937 799 500 208 --32581 1064 630 --
NM_015564chr543316 2889 2186 395 1305 13340 --
NM_015569chr131140 802 623 1463 11386 1255
NM_015575chr273389 2573 2523 2353 722 481 402 1807 11243 --
NM_015576chr382496 2262 1938 944 910 403 294 222 --1449 --
NM_015577chr561578 1437 1419 553 298 173 ------
NM_015602chr141266 722 418 30 ------
NM_015609chr1142667 2629 2506 2481 2468 2012 1845 1145 1134 751 720 428 230 165 1875 22708 1128 --
NM_015610chr782356 2344 2338 2181 1757 903 842 523 1156 ----
NM_015638chr204584 197 180 109 1206 1494 --
NM_015640chr154654 4076 1259 979 756 ------
NM_015678chr131375 --1638 --
NM_015686chrX182373 2251 2198 2078 2052 1966 1870 1731 1002 859 604 588 515 255 189 167 82 46 12523 ----
NM_015695chr641677 430 152 39 1540 2499 349 --
NM_015704chr22128 ------
NM_015719chr195554 291 267 210 37 --1676 --
NM_015726chr151526 655 509 78 71 ------
NM_015832chr181157 --169 --
NM_015844chr1821001 381 ------
NM_015845chr183779 280 159 ------
NM_015846chr1821001 381 ------
NM_015847chr1821001 381 ------
NM_015850chr852301 1940 1811 608 480 11934 ----
NM_015853chr11----1143 --
NM_015872chr181677 1472 1239 683 382 375 320 144 --11618 --
NM_015878chr832211 1650 310 ------
NM_015879chr18158198 7768 7475 6252 6237 5856 5835 5447 2612 2344 1390 524 477 471 46 37294 906 356 28584 2314 --
NM_015906chr134514 3379 794 --13344 13368
NM_015955chr2157 ------
NM_015963chr2147 ------
NM_015980chr561265 654 448 263 68 50 --1367 --
NM_015981chr5123014 2883 2229 2203 2193 2056 2018 1053 684 525 289 104 --12344 --
NM_015999chr1----1468 --
NM_016003chr782356 2344 2338 2181 1757 903 842 523 1156 ----
NM_016009chr173268 3232 3151 3116 3083 3072 268 13325 ----
NM_016022chr13783 746 67 --11068 --
NM_016037chr131016 892 444 ------
NM_016057chr1261173 961 804 492 397 128 ------
NM_016061chr231383 1195 237 ------
NM_016062chr16146 ------
NM_016068chr7132 --1146 --
NM_016072chr1212371 ------
NM_016073chr15----1760 --
NM_016076chr132860 1979 1221 12373 ----
NM_016083chr621271 182 12716 ----
NM_016107chr541061 282 268 239 ------
NM_016124chr121354 438 --1968 --
NM_016131chr251796 1775 954 811 39 1415 ----
NM_016132chr1533431 2363 633 ------
NM_016156chr1121588 465 22281 188 12101 --
NM_016162chr122800 269 1848 ----
NM_016169chr1072960 2826 2238 2080 1998 1120 597 --42273 1146 996 874 --
NM_016185chr173713 339 43 ------
NM_016201chr362331 896 702 579 142 126 --181 1852
NM_016203chr7123 --167 --
NM_016205chr4182 --1416 --
NM_016206chr388628 8256 7499 2646 2588 1597 213 173 --22273 2144 --
NM_016231chr17------1561
NM_016235chr1631260 1015 107 ------
NM_016242chr41145 ------
NM_016255chr673216 3192 3065 1295 1092 845 497 ------
NM_016257chr1123080 3049 2813 2177 690 473 441 413 365 278 220 150 1422 12154 --
NM_016260chr277036 5854 2917 2401 1852 568 28 25139 5079 --16136
NM_016271chr182745 335 ------
NM_016277chr621566 1244 ------
NM_016284chr162800 128 --1380 --
NM_016289chr211661 ----1577
NM_016291chr3143 ------
NM_016319chr12138 ------
NM_016322chr973192 3025 2996 849 551 385 25 --174 --
NM_016353chr83603 520 349 ------
NM_016376chr17124271 3276 3119 3027 2939 2918 1720 1108 1027 1009 282 153 12690 11134 --
NM_016396chr1542859 2519 2288 107 12174 ----
NM_016431chr226748 518 512 475 201 36 --1717 --
NM_016436chr2062423 2256 2078 2005 1877 786 --12044 --
NM_016441chr211622 ------
NM_016453chr3266 32 --1567 --
NM_016456chr13313 281 30 ------
NM_016485chr63853 556 168 12251 ----
NM_016506chr113246 121 73 148 ----
NM_016507chr17103117 3060 2417 2400 2343 2335 2198 2118 1089 599 ------
NM_016526chr1182536 2156 1934 1899 1701 1590 1546 239 12483 21651 358 --
NM_016530chr1573971 3176 3108 2918 748 317 78 11027 2608 161 --
NM_016531chr45953 900 329 67 21 13718 ----
NM_016542chrX2270 46 --191 --
NM_016563chr1541450 1160 591 330 ------
NM_016574chr112281 62 --1147 --
NM_016577chr352855 1091 527 513 26 24323 3947 13576 --
NM_016596chr125419 395 388 287 75 ------
NM_016598chr331110 916 538 1981 160 --
NM_016605chr582069 2048 2014 1934 1749 713 218 147 ----1980
NM_016621chr1134077 3102 1627 --1884 --
NM_016626chr181354 ------
NM_016827chr35696 206 133 126 63 ------
NM_016829chr35751 261 188 181 118 ------
NM_016830chr121133 --1174 --
NM_016834chr17113929 3782 3730 2953 2868 2686 2618 1238 1205 916 322 11291 34000 3952 3847 --
NM_016835chr17113929 3782 3730 2953 2868 2686 2618 1238 1205 916 322 11291 34000 3952 3847 --
NM_016841chr17113929 3782 3730 2953 2868 2686 2618 1238 1205 916 322 11291 34000 3952 3847 --
NM_016929chr664548 4142 3975 3665 3498 454 --33919 3407 119 --
NM_016936chr1651894 1863 1785 1350 162 --2451 208 --
NM_016937chrX2350 74 ------
NM_016938chr114428 404 306 137 ------
NM_016946chr173413 3337 3219 2205 1254 529 242 --1167 --
NM_016952chr11124055 3934 3835 3040 2818 2711 1237 1001 550 330 316 200 14023 1995 --
NM_017413chrX152294 2257 2188 1792 1648 1637 942 718 697 405 359 331 303 266 83 156 21877 1841 --
NM_017415chr5164565 4227 4211 3957 3807 3798 3616 3434 3177 2820 2780 1777 1232 1012 971 184 24395 3469 1456 14063
NM_017420chr1453704 2702 414 81 59 ------
NM_017423chr41108 12041 11808 1737
NM_017449chr151369 1177 477 53 39 ------
NM_017450chr1741200 553 292 230 --3217 184 125 --
NM_017451chr1761063 904 319 189 163 73 ------
NM_017452chr2061421 1304 1125 1061 520 445 ------
NM_017453chr2061421 1304 1125 1061 520 445 ------
NM_017454chr2061421 1304 1125 1061 520 445 ------
NM_017481chr112233 73 150 ----
NM_017519chr62475 313 --1123 --
NM_017522chr12975 487 --243 28 --
NM_017548chr31542 --1131 --
NM_017549chr731181 498 51 ------
NM_017551chr1062430 2203 986 824 419 312 --2664 435 --
NM_017563chr3145618 5313 3904 3873 2379 2281 2125 1925 1880 1804 1683 1120 701 154 11593 ----
NM_017580chr1032198 854 71 ------
NM_017582chr141578 504 310 102 ------
NM_017590chr22142394 2119 1848 1651 942 877 755 699 595 532 484 207 163 108 --1463 --
NM_017592chr19132431 1943 1133 1091 1060 989 895 845 823 808 693 441 266 ------
NM_017596chr1164549 4352 4192 3726 3402 3352 2973 1643 1630 1343 1131 1121 746 405 342 217 21289 381 34632 4322 949 --
NM_017610chr1531442 1383 40 ------
NM_017617chr961480 1031 1008 988 496 220 ------
NM_017629chr13763 48 39 ------
NM_017633chr653231 3138 2952 901 572 1338 1947 --
NM_017637chr9138320 7998 7952 6829 6183 3544 3353 3130 3108 1950 1729 1317 341 18953 37858 7141 2628 16514
NM_017640chr64579 309 301 142 ------
NM_017643chr1722660 494 11899 22417 2078 --
NM_017644chr385039 4892 4135 3775 3166 1285 1254 1070 ------
NM_017649chr1041283 1229 506 422 ------
NM_017658chr1413225 13864 24257 643 --
NM_017660chr19153016 2842 2590 2409 2114 2108 1370 1355 1236 722 707 662 524 478 113 --23027 2229 1202
NM_017672chr1511061 1184 ----
NM_017684chr1551644 1357 656 515 21 ----11888
NM_017707chr161004 979 366 328 303 38 --127 --
NM_017709chr142971 968 870 282 ------
NM_017724chr32291 42 ------
NM_017736chr1632594 2038 65 --1750 13044
NM_017737chr122106 331 ------
NM_017738chr94929 900 772 94 1988 11067 --
NM_017744chr131685 1565 850 --31708 873 349 1630
NM_017748chr171346 --1866 --
NM_017754chr6124825 4669 4651 4394 4340 3836 3820 3304 1094 1032 427 323 1439 14218 11123
NM_017762chr153724 334 276 ------
NM_017763chr1761085 996 191 185 54 37 --21025 391 --
NM_017772chr661626 1537 711 471 336 160 11359 1688 --
NM_017786chr82538 207 1721 137 --
NM_017790chr92226 142 ------
NM_017798chr2031122 1042 76 ------
NM_017811chr9103163 2902 2626 2179 2124 2079 970 666 640 285 11980 22234 541 --
NM_017845chr4143 --1255 --
NM_017848chrX54599 3760 3347 1111 766 11344 --14511
NM_017849chr293135 2388 2014 1217 1071 839 428 350 92 ------
NM_017851chr151991 --176 --
NM_017856chrX31350 1324 128 --1402 --
NM_017857chr116526 485 202 180 153 126 ----1108
NM_017860chr13767 612 265 ------
NM_017873chr9173036 2865 2675 2662 2323 2161 2125 2091 2040 1193 783 649 594 513 430 334 237 1937 22711 1082 --
NM_017893chr1041236 932 313 49 1106 ----
NM_017902chr10105635 4563 4323 3982 1779 1327 785 434 272 216 24808 3556 21161 412 15408
NM_017907chr113344 74 43 ------
NM_017921chr1722080 402 ----193
NM_017938chrX31435 280 274 --1405 --
NM_017944chr1163055 2759 2325 444 351 132 --12371 1901
NM_017946chr731464 1353 1161 1348 ----
NM_017966chr1141004 396 377 35 --1434 --
NM_017983chr172125 38 --1459 --
NM_017987chr101173 1715 11990 --
NM_017988chr121675 ------
NM_017999chr14157 --131 --
NM_018003chr1542419 1805 1696 67 --11641 --
NM_018014chr2------1240
NM_018027chr1092980 2791 2733 2253 1008 897 818 293 133 --12053 --
NM_018030chr181744 ------
NM_018045chr162637 2366 2036 1236 452 274 ------
NM_018054chr162572 122 ------
NM_018064chr6161 --1230 --
NM_018086chr251938 1579 1314 384 200 ------
NM_018092chr1621689 94 11406 ----
NM_018095chr113246 121 73 148 ----
NM_018107chr147859 833 753 327 258 178 82 --174 --
NM_018113chr121207 ------
NM_018121chr1043039 2557 2225 290 ------
NM_018126chr411185 ----11502
NM_018133chr32581 292 1220 ----
NM_018150chr14634 578 104 39 1320 ----
NM_018154chr192374 23 ------
NM_018156chr172859 2824 2308 1012 965 676 142 --32457 887 778 --
NM_018157chr1243275 794 552 59 1626 1503 1490
NM_018168chr143401 388 193 --21363 354 --
NM_018178chr161683 1670 664 584 259 58 2208 156 ----
NM_018180chr10134 ------
NM_018182chr1762208 2176 2141 789 356 96 ------
NM_018184chr321556 1357 1278 ----
NM_018191chr1332065 1521 1471 --1424 --
NM_018193chr151261 ------
NM_018198chr161395 1349 1320 1172 478 201 ------
NM_018200chr1591729 889 804 783 777 698 566 483 397 11950 ----
NM_018208chr151045 389 258 95 54 ------
NM_018227chr442526 2363 2063 992 22516 2437 ----
NM_018234chr232173 658 652 ------
NM_018241chr43744 410 58 ------
NM_018243chr462735 2680 1538 1200 430 364 23194 3137 22897 1230 --
NM_018247chr633097 2531 823 ------
NM_018263chr242510 2109 1722 832 ------
NM_018299chr863155 2193 918 687 301 292 1962 ----
NM_018302chr4----2477 160 --
NM_018315chr4----11352 --
NM_018320chr1141115 1109 496 391 --11261 --
NM_018323chr421446 88 ------
NM_018325chr911388 ----11506
NM_018327chr2031640 1312 60 ------
NM_018351chr12134186 4148 4077 3969 3896 3853 3799 3687 3373 3328 2899 1548 1381 11816 ----
NM_018354chr202173 35 ------
NM_018361chr852895 1587 1361 1260 390 11428 14079 --
NM_018362chr1133466 3281 752 21377 865 ----
NM_018364chr123815 2828 23639 3245 ----
NM_018374chr785067 4665 4158 3695 2080 2069 456 312 21931 277 22087 927 --
NM_018383chr261741 1328 462 224 216 209 ------
NM_018387chr92443 216 ------
NM_018400chr11144343 4004 3632 3551 3445 3384 3355 2991 856 396 323 193 92 56 13234 1102 --
NM_018403chr393283 3181 2856 2830 777 616 365 39 33 1414 1561 --
NM_018406chr32316 41 ------
NM_018416chr12132517 2283 2012 1989 1926 1868 1818 1037 966 953 446 427 90 --1184 --
NM_018424chr941517 452 443 71 ------
NM_018425chr10102470 2457 1899 1702 1690 885 592 585 480 331 --1221 --
NM_018440chr888213 7686 7111 6722 6414 6303 2030 965 48266 8224 7919 1453 ----
NM_018445chr151148 ------
NM_018460chr2----1114 --
NM_018482chr81683 --2620 455 --
NM_018486chrX1411 ------
NM_018489chr16651 452 433 422 309 221 ------
NM_018509chr1721526 1379 11457 ----
NM_018553chr1721835 29 --11821 11536
NM_018557chr211203 11120 11066 --
NM_018566chr154334 4185 3712 3332 3192 ------
NM_018590chr101245 ------
NM_018593chr61556 ------
NM_018638chr1255314 4511 4069 2214 369 12008 15493 --
NM_018640chr1262578 2413 2097 632 173 61 ------
NM_018644chr1172106 1794 1472 1424 814 280 208 ------
NM_018652chr1541027 916 647 166 ------
NM_018660chr862977 1947 1030 1014 891 161 ------
NM_018667chr1672474 1033 801 458 201 172 71 ------
NM_018685chr711057 --1246 --
NM_018689chr1542200 1940 724 403 ------
NM_018695chr512198 --1900 --
NM_018711chr1251553 1503 1252 446 62 ------
NM_018712chr1131057 594 445 21012 295 144 --
NM_018717chr452906 2611 431 385 165 --42409 2075 634 176 --
NM_018719chr711307 ------
NM_018841chr143424 2723 1362 985 1524 13930 --
NM_018912chr581267 1128 592 348 317 293 222 78 11656 ----
NM_018913chr581267 1128 592 348 317 293 222 78 11656 ----
NM_018914chr581267 1128 592 348 317 293 222 78 11656 ----
NM_018915chr581267 1128 592 348 317 293 222 78 11656 ----
NM_018916chr581267 1128 592 348 317 293 222 78 11656 ----
NM_018917chr581267 1128 592 348 317 293 222 78 11656 ----
NM_018918chr581267 1128 592 348 317 293 222 78 11656 ----
NM_018919chr581267 1128 592 348 317 293 222 78 11656 ----
NM_018920chr581267 1128 592 348 317 293 222 78 11656 ----
NM_018921chr581267 1128 592 348 317 293 222 78 11656 ----
NM_018922chr581267 1128 592 348 317 293 222 78 11656 ----
NM_018923chr581267 1128 592 348 317 293 222 78 11656 ----
NM_018924chr581267 1128 592 348 317 293 222 78 11656 ----
NM_018925chr581267 1128 592 348 317 293 222 78 11656 ----
NM_018926chr581267 1128 592 348 317 293 222 78 11656 ----
NM_018927chr581267 1128 592 348 317 293 222 78 11656 ----
NM_018928chr581267 1128 592 348 317 293 222 78 11656 ----
NM_018929chr581267 1128 592 348 317 293 222 78 11656 ----
NM_018945chr692881 2665 2637 1376 1303 1041 821 267 221 11015 ----
NM_018951chr72887 310 --1393 --
NM_018952chr173500 247 191 ------
NM_018957chr221121 ------
NM_018970chr763191 3008 2432 2009 641 235 ------
NM_018976chr1242518 2263 2218 1881 ------
NM_018979chr1222014 182 11662 12221 --
NM_018999chr1054842 3191 3178 1859 582 --11936 --
NM_019000chr5----21500 651 --
NM_019001chr334793 3467 1783 --1328 11631
NM_019008chr2283227 2846 2667 2435 2376 1511 232 83 ------
NM_019009chr1152410 1705 476 212 76 --1138 --
NM_019022chr1832048 1093 216 2400 152 ----
NM_019035chr43807 522 257 ------
NM_019036chr62496 416 ------
NM_019044chr294480 4216 3680 3424 3350 3072 1581 801 753 13153 21282 969 23398 3169
NM_019055chr112532 526 ------
NM_019083chr111247 --1126 --
NM_019102chr72415 121 ------
NM_019102chr72415 121 ------
NM_019106chr22163336 3157 3115 3032 2780 2660 2432 2376 2242 2200 1318 615 320 300 264 94 22811 768 11278 --
NM_019114chr922110 121 --11717 --
NM_019558chr21287 ------
NM_019596chr2162667 2639 2109 1160 744 533 --141 --
NM_019606chr74353 168 155 77 ------
NM_019609chr20122 ------
NM_019613chr174971 252 161 71 ----1316
NM_019849chr191144 ------
NM_019885chr282263 972 835 694 627 530 221 198 2765 110 1168 --
NM_019896chr2168 ------
NM_020039chr1291700 1624 1290 1214 717 544 412 266 178 ------
NM_020122chr2115649 5511 5434 4804 4619 4541 4011 3992 2213 1248 746 15790 15848 --
NM_020141chr122301 335 ------
NM_020142chr124556 216 154 79 ------
NM_020144chr732128 771 99 ----130
NM_020150chr1072146 2111 2054 1923 682 200 65 21852 869 ----
NM_020159chr4----1677 --
NM_020163chr382349 1936 1827 1464 799 784 599 246 1466 11532 12092
NM_020177chr533281 898 313 ------
NM_020178chr172998 273 --2869 111 --
NM_020182chr2083191 3178 2394 2287 2223 1213 1036 738 23127 2471 13448 --
NM_020200chr1021077 29 2479 448 ----
NM_020205chr152889 2426 734 563 79 13487 23382 290 --
NM_020211chr1581406 1210 1202 1114 512 250 108 50 --11073 --
NM_020228chr1152473 1645 781 598 37 ------
NM_020239chr181621 1570 1435 730 695 139 121 40 --12178 --
NM_020248chr172278 1667 975 661 496 131 95 --11824 12382
NM_020309chr1991090 993 796 749 703 398 250 103 41 ------
NM_020310chr17152734 2517 2505 2035 2011 1879 1847 1110 960 791 585 565 349 263 76 --1422 --
NM_020318chr13357 333 33 ------
NM_020337chr432840 1019 845 11186 12416 --
NM_020338chr10123134 2827 2575 2344 1291 1196 905 761 479 467 220 98 1633 21488 1412 --
NM_020342chr242215 1759 1683 232 ------
NM_020346chr1111649 ------
NM_020354chr102730 79 ------
NM_020360chr175594 478 442 217 93 --1125 --
NM_020381chr631969 1399 644 --11420 --
NM_020384chrX81710 1532 1286 1257 521 336 279 250 ------
NM_020390chr363163 1699 1168 1031 951 102 ------
NM_020416chr410855 806 764 705 641 456 443 434 428 166 1916 137 --
NM_020418chr34228 213 145 95 ------
NM_020432chr741530 888 693 343 --11542 --
NM_020440chr122656 849 --12317 --
NM_020449chrX----1148 --
NM_020452chr171785 1462 1334 382 250 137 92 ------
NM_020456chr1351861 1743 1483 619 376 ------
NM_020466chr685018 4723 3555 1811 793 461 405 37 1689 ----
NM_020475chr8112193 2016 2006 1802 1776 1642 1543 843 506 474 375 --11634 --
NM_020476chr8112193 2016 2006 1802 1776 1642 1543 843 506 474 375 --11634 --
NM_020477chr8112193 2016 2006 1802 1776 1642 1543 843 506 474 375 --11634 --
NM_020478chr8112256 2079 2069 1865 1839 1705 1606 906 569 537 438 --11697 --
NM_020480chr8112193 2016 2006 1802 1776 1642 1543 843 506 474 375 --11634 --
NM_020525chr122114 68 ------
NM_020526chr131804 1397 96 21444 1140 31849 1524 1336 --
NM_020645chr113642 145 130 --1652 --
NM_020647chr81332 11881 22032 301 --
NM_020654chr331322 1012 386 ------
NM_020655chr1691334 1043 1015 974 925 907 386 380 270 --11190 --
NM_020689chr2011100 --1260 --
NM_020699chr1165307 4858 4797 4738 3902 3763 3756 3589 3431 3418 1861 1571 1453 1050 872 525 11753 34746 1001 26 --
NM_020702chr92527 197 11639 ----
NM_020704chr732299 612 44 ----12215
NM_020708chr2062461 2385 1581 989 975 180 1557 ----
NM_020713chr20133096 3053 2858 2825 2802 2164 1966 1157 1065 464 260 95 27 --12040 --
NM_020724chr44670 568 184 63 ----12549
NM_020727chr2133557 2959 283 --23000 1270 --
NM_020728chr742773 2713 2261 1154 12040 12078 --
NM_020732chr62475 313 --1123 --
NM_020739chr1531560 820 402 --11040 --
NM_020742chrX6948 909 323 162 123 35 11867 11808 --
NM_020748chr1741892 1614 1409 366 11621 ----
NM_020755chr631286 96 26 ------
NM_020760chr231338 460 304 ------
NM_020766chrX33976 1469 1153 --13218 --
NM_020772chr1767947 5993 3086 2539 2204 916 --12725 --
NM_020774chr1846055 4740 4214 2399 --1902 --
NM_020775chr11183 ------
NM_020791chr1721418 515 1435 1562 --
NM_020792chr321887 96 12135 12813 --
NM_020794chr12365 349 1421 ----
NM_020795chr1781911 1756 1614 1294 1245 413 317 234 ------
NM_020796chr542633 2545 1157 316 12250 ----
NM_020801chr51188 ------
NM_020804chr6202538 2522 2500 2297 2284 2243 2104 1999 1932 1687 1018 971 920 723 590 512 489 346 332 214 --1377 --
NM_020805chr183597 498 322 1652 ----
NM_020806chr143577 568 525 ------
NM_020807chr1681763 1622 1589 1387 441 345 252 104 1378 ----
NM_020821chr1551644 1357 656 515 21 ----11888
NM_020826chr1173336 3019 2959 2457 742 677 78 ----12756
NM_020830chr262717 2036 497 249 72 43 12592 ----
NM_020836chr147722 640 250 203 102 69 54 ------
NM_020839chr33233 180 53 11173 ----
NM_020845chr12212456 2448 2363 2350 2272 2248 1994 1729 987 977 701 667 580 403 388 353 223 164 111 57 30 --1520 --
NM_020850chr16153101 3041 2846 2840 2834 2511 2472 2394 2197 2042 1319 1244 1023 906 43 169 ----
NM_020861chr651321 1225 1162 147 85 ------
NM_020868chr221709 83 ------
NM_020871chrX21632 721 ------
NM_020872chr321713 376 --1666 --
NM_020888chr12668 69 --2714 253 --
NM_020899chr1742369 778 234 173 42014 1618 886 624 1751 --
NM_020918chr1043167 2738 1081 151 12729 ----
NM_020919chr211101 1914 11029 --
NM_020922chrX51813 699 468 345 105 ------
NM_020927chr1671728 1554 1475 541 304 176 77 ----1749
NM_020935chr284028 3717 3514 1823 1743 1646 732 691 --21061 165 --
NM_020939chr6151385 1360 1133 1065 1049 1006 963 553 543 470 429 402 383 170 67 --1394 --
NM_020940chr101702 ------
NM_020943chr21171 ------
NM_020946chr941617 666 346 309 --21681 1583 --
NM_020948chr133015 2716 1134 --12493 --
NM_020951chr1921746 1573 ------
NM_020952chr92556 44 --1342 --
NM_020956chr19204549 4463 4413 4262 4209 4193 4134 3864 3771 1416 1373 1281 1063 1039 716 556 367 306 296 92 ------
NM_020958chr14136 ------
NM_020962chr156958 872 852 445 381 342 1174 11884 --
NM_020964chr18103913 3903 3884 3774 3618 3480 1183 643 423 300 --24007 807 --
NM_020972chr44871 446 253 22 ------
NM_020977chr452129 1933 1837 434 324 ------
NM_020983chr1271872 1713 884 855 717 695 679 12196 1625 --
NM_020993chr12112654 2515 2257 2184 1980 1060 1048 850 634 547 75 --12508 --
NM_021020chr8183142 2826 2819 2638 2551 2539 2415 2321 2252 2203 1292 1238 1230 1148 875 553 547 174 23060 2532 22239 457 --
NM_021038chr333391 2717 2699 12603 ----
NM_021061chr864296 3561 1096 1069 868 751 11137 ----
NM_021069chr4----1358 --
NM_021079chr1792335 2209 2167 2072 1183 1177 728 536 238 ------
NM_021088chr262051 1632 1451 1400 445 283 ------
NM_021090chr2264031 3788 964 884 715 705 11916 --11055
NM_021097chr282575 2496 2432 2059 1160 891 868 169 --2944 830 --
NM_021120chrX42988 2310 427 80 12569 23090 2857 --
NM_021132chr1041286 1260 268 38 ------
NM_021147chr5161 ------
NM_021148chr732295 946 431 11668 ----
NM_021149chr16173 ------
NM_021151chr71267 ------
NM_021155chr19132962 2934 2907 2600 2380 2268 2107 2097 1130 688 682 477 42 12407 1114 --
NM_021159chr43315 54 29 11331 1423 11107
NM_021161chr141533 ------
NM_021165chr13852 685 243 ------
NM_021167chr772658 2489 1048 787 567 427 58 ------
NM_021198chr271481 1450 599 488 230 194 147 --1202 --
NM_021202chr2092647 2553 2461 947 414 334 277 256 150 1212 ----
NM_021222chr161205 943 441 390 285 101 1891 11114 --
NM_021238chr122661 190 ------
NM_021245chr10280 45 ----1208
NM_021249chr1431631 1557 208 --11386 --
NM_021255chr1493797 3621 3595 3026 2685 2595 2586 1210 733 12701 13114 13534
NM_021267chr19101256 1059 418 391 361 202 140 62 34 21 --1894 --
NM_021627chr331024 286 64 ------
NM_021629chr384360 4063 3459 3295 3158 1989 1823 26 --13523 --
NM_021633chr12533 160 --11030 1332
NM_021637chrX4963 910 865 136 ------
NM_021638chr4104927 3582 3074 1651 1378 415 119 96 58 26 --13420 --
NM_021705chr641435 1273 1246 397 11315 ----
NM_021738chr10125 ------
NM_021784chr201188 ------
NM_021809chr2042351 2081 2073 31 --22436 1675 --
NM_021813chr6114963 4094 1833 1804 1777 1469 1448 500 342 299 39 --24126 1292 --
NM_021831chr2136 1277 1288 --
NM_021911chr574818 4564 2106 1960 1477 816 364 11092 1257 --
NM_021912chr1563955 3550 2724 2672 1667 1189 --11379 --
NM_021913chr1941774 1262 482 136 11611 ----
NM_021923chr461463 1419 1214 1110 1096 1055 ----11505
NM_021931chr204919 804 69 50 ------
NM_021940chr61226 --11182 --
NM_021943chr651401 748 671 543 456 11817 ----
NM_021945chr673018 2658 2512 1252 811 101 26 11151 13590 --
NM_021947chr1741068 471 331 274 11338 ----
NM_021948chr11245 ------
NM_021949chrX82387 2181 1877 1150 498 273 164 45 ------
NM_021954chr134909 653 125 100 --21284 596 --
NM_021959chr67747 404 378 357 245 190 41 ------
NM_021961chr1176618 5473 4554 2026 1916 125 73 12928 22760 2136 --
NM_021962chr1772036 2028 2018 1674 1628 195 189 1224 22544 535 --
NM_021963chrX136 ------
NM_021964chr335054 4954 4776 15664 14228 11646
NM_021967chr541327 1013 467 300 1970 1259 --
NM_021984chrX61516 1447 1167 475 434 428 --1122 --
NM_021987chrX61516 1447 1167 475 434 428 --1122 --
NM_021990chrX61516 1447 1167 475 434 428 --1122 --
NM_021991chr175712 626 609 511 28 ------
NM_022037chr21708 ------
NM_022041chr1642515 1761 678 538 ------
NM_022048chr15145220 4530 4242 4230 4224 2511 1785 1691 1646 1633 1376 1177 276 218 15645 35545 4364 2275 --
NM_022054chr142842 154 ------
NM_022059chr174711 649 367 197 ------
NM_022060chr1471268 1175 1011 989 556 445 428 1451 1870 1929
NM_022064chr31162 --163 --
NM_022067chr142574 315 --131 --
NM_022100chr13649 608 502 1223 ----
NM_022114chr1114760 3574 3516 3097 3067 1751 1611 1602 701 669 74 11355 24340 3422 --
NM_022121chr61896 ------
NM_022129chr103510 410 112 ------
NM_022131chr341456 1275 1098 253 ------
NM_022133chr831322 310 24 ------
NM_022166chr16235791 5641 5515 5173 5062 5038 5031 4634 4590 4411 4304 3915 2277 2105 1969 1947 1902 1817 1770 1761 1698 1415 651 --24519 1514 --
NM_022170chr741452 1277 1176 240 --1626 --
NM_022171chr321158 484 31297 1094 355 21148 1130 --
NM_022173chr21708 ------
NM_022351chr823454 478 --1502 --
NM_022450chr163235 69 33 --196 --
NM_022458chr752872 2838 2278 867 374 --169 --
NM_022461chr3------1202
NM_022465chr1272481 2247 1052 860 623 499 386 1556 ----
NM_022470chr341164 1108 922 269 ----1951
NM_022477chr2021342 1207 2244 56 11488 --
NM_022497chr373537 3204 2888 2554 1125 613 592 1856 12665 --
NM_022574chr7112024 1937 1497 1488 1430 1381 1372 856 692 566 68 --1455 --
NM_022652chr1231105 775 95 --1180 --
NM_022659chr81155 ------
NM_022716chr152321 747 552 413 315 --22338 1184 --
NM_022719chr2293228 2868 2840 2471 1462 1277 746 302 280 --12529 --
NM_022730chr23781 321 217 ------
NM_022735chr121505 508 --1353 --
NM_022737chr1961266 1147 1141 994 886 29 --259 50 11155
NM_022745chr162705 2621 2475 1882 1046 504 22852 2392 2157 121 --
NM_022758chr672572 2318 1985 1222 1129 903 571 12865 23187 2012 --
NM_022763chr352935 2506 1267 1257 514 ------
NM_022766chr2222095 2047 12080 22632 622 --
NM_022778chr161308 1215 595 550 322 278 11424 1453 --
NM_022780chr24608 566 560 120 --11709 11693
NM_022781chr933052 670 40 --21066 800 --
NM_022802chr1021056 392 --11605 --
NM_022817chr231428 689 312 ------
NM_022821chr13316 201 38 ------
NM_022823chr22469 338 ------
NM_022832chr442408 2257 1730 1032 ------
NM_022836chr141800 1401 1134 433 11834 ----
NM_022841chr151162 --1238 --
NM_022845chr1632178 1762 811 1866 1471 --
NM_022875chr5----180 --
NM_022877chr5----180 --
NM_022893chr2281 66 --1110 --
NM_022897chr53754 709 132 ------
NM_022898chr1473985 3560 3546 3371 2981 1141 22 --14461 --
NM_022912chr241908 384 175 38 12963 ----
NM_022914chr16128 ------
NM_022917chr951182 222 176 156 103 11223 ----
NM_022970chr101474 --11164 11281
NM_022978chr541327 1013 467 300 1970 1259 --
NM_023008chr195749 692 243 207 26 ------
NM_023015chr13703 668 595 ------
NM_023068chr2071578 1497 1180 1074 581 272 146 --11525 --
NM_023076chr1692825 2800 2548 2359 2175 1114 1060 153 43 --12599 --
NM_023079chr1741796 1352 519 40 11290 ----
NM_023105chr852301 1940 1811 608 480 11934 ----
NM_023106chr852301 1940 1811 608 480 11934 ----
NM_023110chr852301 1940 1811 608 480 11934 ----
NM_023111chr852301 1940 1811 608 480 11934 ----
NM_023923chr153774 2787 2515 1332 834 ------
NM_023925chr123331 296 77 ------
NM_023929chr852589 2469 1937 663 506 ------
NM_024007chr552969 1047 950 365 74 12326 ----
NM_024046chr371066 814 391 374 343 215 109 ------
NM_024050chr193515 503 480 1141 ----
NM_024052chr1782709 830 739 556 536 448 391 321 ------
NM_024055chr52652 210 --1130 --
NM_024077chr92573 325 ------
NM_024085chr27943 826 771 749 283 172 104 --1224 --
NM_024090chr44645 561 240 211 11284 2747 733 --
NM_024099chr112303 287 ------
NM_024293chr21316 --2646 290 --
NM_024294chr672572 2318 1985 1222 1129 903 571 12865 23187 2012 --
NM_024297chr174429 381 164 59 ------
NM_024301chr1951032 1013 965 491 319 ------
NM_024306chr163938 814 77 --1367 --
NM_024325chr2051235 1063 981 914 324 --161 --
NM_024345chr975849 5687 5578 4940 4621 4568 1396 --13942 --
NM_024416chr931357 1293 437 --11518 --
NM_024423chr1823815 1400 --24198 747 --
NM_024424chr11132 ------
NM_024425chr11132 ------
NM_024426chr11132 ------
NM_024429chr7123 --167 --
NM_024430chr1831411 1294 421 --1215 --
NM_024482chr1174 ------
NM_024490chr151456 ------
NM_024496chr142526 29 ------
NM_024511chr442337 2204 697 428 1745 ----
NM_024519chr16187 ------
NM_024524chr332713 608 543 1957 ----
NM_024525chr12571 448 ------
NM_024529chr11240 --1784 --
NM_024541chr1051468 1378 1338 668 344 ------
NM_024551chr1252379 1582 719 635 97 --12257 --
NM_024551chr1252379 1582 719 635 97 --12257 --
NM_024554chr141478 1385 330 178 --1499 --
NM_024567chr8----1537 --
NM_024590chr421329 622 11274 11893 --
NM_024595chr151081 905 773 221 92 ------
NM_024602chr17896 857 698 336 202 185 113 1682 ----
NM_024607chr873411 3389 3067 2823 1113 476 382 --1115 --
NM_024613chr82729 136 ------
NM_024624chr221539 613 ------
NM_024627chr22144492 4484 4318 4002 3751 3670 3262 1778 1185 977 808 492 462 34 2348 117 --168
NM_024639chr63748 451 164 ------
NM_024674chr1143168 3110 3063 2958 2537 2200 2037 913 826 767 642 503 351 270 1468 21016 585 --
NM_024689chrX71749 1323 539 461 355 234 146 ------
NM_024770chr286039 5620 5085 4346 1497 891 806 401 ------
NM_024787chr84346 230 217 72 --144 --
NM_024792chr17287 28 1786 1168 --
NM_024807chr671762 1621 1475 364 354 167 45 --21842 490 --
NM_024811chr1151811 1635 394 151 87 1285 ----
NM_024828chr91131 11324 ----
NM_024866chr22193431 3419 3374 3325 3318 3231 3225 3127 3059 3012 2974 2946 2934 2501 2267 832 812 569 53 --176 --
NM_024871chr331237 198 56 ------
NM_024875chr1041640 1634 705 69 --21249 332 11832
NM_024884chr1474521 4236 2856 1171 1035 708 653 ------
NM_024887chr192105 2051 1915 1710 1568 1321 745 718 51 --11761 --
NM_024896chr951840 720 384 63 43 ------
NM_024909chr651550 1511 494 479 27 11420 11445 --
NM_024911chr11301 136 1103 --
NM_024920chr42992 306 11175 1402 --
NM_024922chr16101607 1595 1521 1471 1446 1340 1317 690 322 60 --11537 --
NM_024939chr1631019 551 144 11072 1151 --
NM_024946chr1641649 645 555 291 --11538 --
NM_024947chr358970 7413 3058 2246 400 17995 12863 17088
NM_024948chr101684 ------
NM_024949chr443084 3065 1617 850 --14348 13515
NM_024953chr1242176 647 280 204 2359 109 ----
NM_024969chr21309 ------
NM_024971chr92556 44 --1342 --
NM_024979chr1391317 1302 1294 1273 616 476 278 238 78 11563 ----
NM_024989chr277543 6853 3045 2290 1882 1628 1574 36199 6182 6152 22893 1840 --
NM_024991chr1072644 2396 2359 2062 1015 362 344 1780 ----
NM_025057chr1441067 338 326 272 --1528 11324
NM_025074chr452352 2194 928 402 159 --12055 --
NM_025115chr82395 42 1147 ----
NM_025133chr211004 ----1978
NM_025138chr132383 181 ------
NM_025146chr312098 --12032 --
NM_025151chr831590 1553 55 ------
NM_025160chr184024 3792 3379 3366 3312 2735 1261 236 11158 13509 23755 647
NM_025179chr1114659 4498 4260 3953 3913 3299 1866 1658 474 121 95 --11515 21537 990
NM_025182chr95946 917 724 194 179 --152 --
NM_025187chr1641295 1227 986 398 --21106 315 --
NM_025191chr133124 922 788 12811 1198 --
NM_025235chr1042248 1879 1477 776 ------
NM_025238chr151994 --11518 --
NM_025248chr17123027 3021 2970 2755 2734 2248 2153 2083 1993 678 549 23 --13040 --
NM_030569chr1072496 1237 992 740 264 74 48 12035 12472 --
NM_030576chr17172603 2500 2470 1743 1708 1628 1024 827 712 682 662 634 560 400 352 301 150 ------
NM_030621chr1452925 2593 1514 916 412 --23437 1551 --
NM_030627chr561667 1631 1456 986 830 32 13217 11508 --
NM_030629chr1621569 89 ----11734
NM_030634chr132103 329 236 12188 ----
NM_030647chr776045 4702 1745 904 812 798 724 --14433 11093
NM_030648chr455319 4320 3713 2215 1510 --23421 570 --
NM_030650chr274282 3888 3698 3689 3672 3562 744 ------
NM_030660chr1451362 1355 1348 529 336 ------
NM_030661chr761658 1445 1244 1079 588 131 --11286 --
NM_030664chr1012345 22001 1831 1205 --
NM_030670chr1241503 504 272 156 ----11459
NM_030671chr1241503 504 272 156 ----11459
NM_030755chr1422885 2552 21051 420 ----
NM_030758chr2271379 1126 1099 917 391 268 251 --1944 --
NM_030761chr1162655 2649 2572 2510 2463 2453 2226 2145 1901 1841 1037 956 811 672 650 132 --12699 --
NM_030762chr1211395 11729 ----
NM_030786chr141789 1728 1469 662 ------
NM_030789chr203319 300 103 ------
NM_030792chr116654 577 554 197 124 104 ------
NM_030799chr542043 1972 642 558 ------
NM_030805chr241096 833 527 162 ------
NM_030806chr1179253 8650 8394 8366 8327 7482 7175 6438 6404 6252 3017 1945 1637 1490 1430 787 439 23547 1884 56234 3465 3393 3261 137 18206
NM_030808chr173690 167 62 --189 1321
NM_030809chr1282326 1755 1743 710 428 381 191 101 2833 562 ----
NM_030815chr202774 549 ------
NM_030816chr122629 2285 13508 ----
NM_030884chr3121666 1580 1564 725 696 659 634 483 332 193 83 36 --22335 387 --
NM_030885chr31748 --1219 12052
NM_030912chr107964 649 618 375 332 123 111 ------
NM_030914chr95950 773 634 369 363 ------
NM_030915chr24847 691 681 64 ------
NM_030918chr1134983 4620 4548 4439 4426 4143 3912 2058 1936 1404 943 852 192 14044 1876 23856 1109
NM_030920chr11215 --11423 --
NM_030927chr1071262 1221 1099 1016 506 454 69 --1114 --
NM_030957chr195616 565 533 402 79 ------
NM_030962chr1111590 --1199 --
NM_030963chr6--1568 122 --
NM_030964chr583492 3347 3276 2312 1269 1111 1065 509 ------
NM_030980chr14475 273 90 81 1234 1196 --
NM_031205chr124382 372 335 70 ------
NM_031273chrX2210 82 ------
NM_031284chr151875 1144 1386 1659
NM_031289chr1231013 807 283 ------
NM_031305chr41682 11946 --1184
NM_031306chr11852 ------
NM_031309chr861973 769 609 284 145 135 42267 2153 791 695 ----
NM_031314chr1451379 161 138 123 32 --1174 --
NM_031407chrX1133 --1143 --
NM_031417chr19112311 2205 2099 1849 1824 1127 746 522 287 175 145 12219 11114 --
NM_031426chr992701 2467 2392 1026 694 528 520 479 338 137 ----
NM_031427chr1485827 5709 4240 3614 1686 1631 1325 895 25213 1798 1272 --
NM_031435chr1222227 642 11250 ----
NM_031438chr54651 520 510 193 ------
NM_031442chrX32366 660 322 --1667 --
NM_031444chr2282182 1920 885 764 758 139 119 38 ------
NM_031445chr272404 1227 664 514 255 33 24 --32580 2497 2162 --
NM_031477chr163286 243 29 ----1254
NM_031483chr2043542 2368 2262 1288 --11366 12217
NM_031844chr13483 442 352 23995 2657 ----
NM_031890chr2292641 2536 2241 2086 2054 2010 1071 881 300 --21097 394 --
NM_031892chrX2104 63 ------
NM_031899chr351171 504 389 338 119 11439 ----
NM_031922chr61426 ----1129
NM_031938chr112326 153 --1655 --
NM_031940chr832034 638 237 --11639 --
NM_031946chr7138 --1403 --
NM_031964chr17354 46 32 ------
NM_031992chr741452 1277 1176 240 --1626 --
NM_032013chr2021342 1207 2244 56 11488 --
NM_032017chr191557 1518 1454 1444 850 585 531 419 48 --11525 --
NM_032021chr1141148 910 488 299 ------
NM_032028chr52608 95 ----1662
NM_032041chr852514 2431 1916 513 192 --22639 2005 --
NM_032047chr322188 671 1940 ----
NM_032088chr581267 1128 592 348 317 293 222 78 11656 ----
NM_032092chr581267 1128 592 348 317 293 222 78 11656 ----
NM_032145chr611493 1486 ----
NM_032156chr123331 296 77 ------
NM_032174chr171312 1091 552 497 233 217 54 ------
NM_032199chr1063515 3392 3331 3267 313 123 1901 ----
NM_032208chr273136 2900 2706 2259 1412 1238 405 11097 --11281
NM_032221chr2041966 1633 496 284 284 51 ----
NM_032228chr1132361 656 248 12715 ----
NM_032229chr1321027 205 1350 ----
NM_032236chr12896 148 ------
NM_032242chr3112968 2929 2705 2571 1261 1255 1248 946 788 653 146 --12378 --
NM_032246chr1521217 123 ------
NM_032268chr1652796 1130 641 479 53 12129 ----
NM_032271chr1671519 1305 355 256 243 230 146 --3564 151 100 --
NM_032281chr1972691 1144 1127 862 372 129 109 --1216 --
NM_032283chr191742 1445 1252 651 568 442 207 128 70 ------
NM_032288chr331953 613 268 ------
NM_032289chr581830 1733 1701 1692 571 515 353 93 --1247 --
NM_032294chr174289 131 113 68 --11515 --
NM_032325chr1161860 1508 1372 590 452 238 ------
NM_032376chr17----1661 --
NM_032379chr112605 281 ------
NM_032403chr581267 1128 592 348 317 293 222 78 11656 ----
NM_032408chr721279 1024 --11234 --
NM_032410chr811127 --1929 --
NM_032420chr58670 616 238 186 160 137 114 73 --1604 --
NM_032430chr191144 ------
NM_032431chr114340 184 169 21 ------
NM_032434chr231227 1122 602 --2371 351 --
NM_032440chr1022332 1058 --1872 --
NM_032445chr1542297 902 215 98 ------
NM_032452chr1441265 1052 334 230 ------
NM_032458chrX21345 950 ------
NM_032466chr8157 ------
NM_032468chr8157 ------
NM_032486chr1642350 2256 1947 942 ------
NM_032520chr162162 43 ------
NM_032538chr6152581 2571 2454 2095 2037 2026 649 535 510 488 303 284 204 170 120 --2662 388 --
NM_032552chr991787 1694 1671 1649 1640 1450 790 775 470 --1139 --
NM_032569chr1651280 759 471 315 108 ----1623
NM_032575chr1692026 1728 1689 1550 1442 1335 1285 566 112 --21962 1292 --
NM_032581chr721714 261 124 ----
NM_032595chr1781362 1271 1227 550 537 477 110 44 11580 1235 --
NM_032622chr41265 ------
NM_032632chr1432031 1501 1435 --11445 --
NM_032638chr321029 391 ------
NM_032682chr352375 853 657 171 90 ------
NM_032711chr1794181 3809 3659 3066 1623 1503 442 375 242 --13302 --
NM_032741chr63274 36 26 1677 1189 --
NM_032786chr123525 213 82 ------
NM_032789chr81129 ------
NM_032801chr1162547 2235 2174 2104 1859 1791 ------
NM_032809chr991483 1420 1051 623 304 297 272 114 107 ------
NM_032810chr1011074 --11514 --
NM_032817chr1072496 1237 992 740 264 74 48 12035 12472 --
NM_032836chr196925 730 658 356 177 87 --1403 --
NM_032866chr1573166 2522 2421 2381 1233 763 318 --1630 --
NM_032870chr61418 ------
NM_032871chr1191874 1362 715 654 409 264 256 213 160 --2676 366 11595
NM_032883chr205319 313 307 288 244 ------
NM_032900chr1063303 3274 3197 1454 999 381 ------
NM_032943chr112605 281 ------
NM_032973chrY32807 2629 733 ------
NM_032983chr7143238 2897 2702 2675 2611 2491 2473 2237 2117 2086 828 569 336 330 11135 ----
NM_032991chr421326 1319 11025 ----
NM_033008chr34228 213 145 95 ------
NM_033009chr34228 213 145 95 ------
NM_033010chr34228 213 145 95 ------
NM_033014chr931357 1293 437 --11518 --
NM_033016chr2271382 1361 1259 1238 486 248 64 ------
NM_033018chrX51022 889 811 449 311 ----1460
NM_033020chr134514 3379 794 --13344 13368
NM_033025chr195980 921 911 773 646 ------
NM_033027chr34888 734 398 27 ------
NM_033030chr211484 ------
NM_033036chr114374 145 83 70 1422 1355 --
NM_033044chr1------150
NM_033058chr83936 244 34 ------
NM_033089chr2071215 1137 1125 511 430 391 156 ----1334
NM_033102chr151097 480 404 47 37 --2277 71 --
NM_033102chr151097 480 404 47 37 --2277 71 --
NM_033121chr1241358 1139 539 75 --1215 --
NM_033129chr20122006 1810 1780 1432 741 735 617 470 460 307 88 48 --11654 --
NM_033132chr131149 1752 1128 --
NM_033133chr17163632 3148 2656 2392 1516 1447 1331 1045 950 916 814 646 625 383 325 297 23737 3722 13563 --
NM_033138chr732241 1855 1795 11705 ----
NM_033139chr732241 1855 1795 11705 ----
NM_033140chr732241 1855 1795 11705 ----
NM_033143chr464372 4090 3718 2902 1246 52 --34105 1433 252 --
NM_033157chr732241 1855 1795 11705 ----
NM_033181chr621271 182 12716 ----
NM_033211chr522032 577 --11923 --
NM_033221chr952009 1866 877 472 362 --1984 --
NM_033224chr7117133 6842 6706 6442 5417 5237 5182 4923 1546 464 434 27562 5977 26167 5067 --
NM_033225chr852866 974 776 444 304 12295 1884 --
NM_033255chr132165 89 --152 --
NM_033274chr563028 2208 788 410 301 239 23004 2214 ----
NM_033281chr51900 1333 --1809
NM_033284chrY1152 ------
NM_033290chrX53051 2606 1148 426 415 1931 13543 --
NM_033300chr12975 487 --243 28 --
NM_033315chr1752081 1683 867 615 200 --11933 --
NM_033326chr1141951 1823 1543 93 11632 11996 --
NM_033360chr121478 --1233 --
NM_033375chr1741301 1133 933 247 ----11163
NM_033389chr17164817 4640 4273 4066 3826 3742 3404 3374 3346 3165 3024 1614 1584 1433 1019 1005 --14258 --
NM_033396chr114387 365 97 87 ------
NM_033401chr161149 ------
NM_033419chr17121468 1443 1358 1219 1166 1017 619 590 568 507 311 24 ------
NM_033420chr1981101 978 971 931 915 260 140 90 --2847 187 --
NM_033421chr2061707 1254 780 601 504 45 --11439 --
NM_033425chr1172939 2830 2346 2176 976 417 393 12187 ----
NM_033429chr1533077 1998 374 ------
NM_033448chr122220 21 1112 285 27 --
NM_033449chr592137 1847 1505 1427 1366 239 187 153 43 --22154 335 --
NM_033505chr2126580 6278 5646 5286 5118 4310 2430 2285 2097 1663 790 60 ------
NM_033512chr852433 2300 1140 950 775 1161 11871 --
NM_033540chr331114 1034 831 ------
NM_033624chr1252164 2037 1705 798 337 ------
NM_033631chr1123751 3482 3219 2848 1433 1377 1127 1053 999 992 434 65 1461 43513 2766 944 737 --
NM_033632chr4----11352 --
NM_033637chr1062659 1197 812 657 527 315 33283 3012 22 1971 --
NM_033656chr2175889 4911 1960 1490 1375 1042 954 ------
NM_044472chr1142 ------
NM_048368chr182246 115 ------
NM_052818chr1352068 1647 1462 384 89 ------
NM_052845chr1293218 3143 2887 2404 2366 1076 980 127 36 22815 2330 22915 2448 --
NM_052855chr17184 ------
NM_052874chr166691 657 181 123 90 79 ------
NM_052879chr1232873 870 40 ----11537
NM_052886chr812127 ----11732
NM_052896chr162240 1625 932 542 493 40 ------
NM_052898chr821639 239 ------
NM_052904chr61945 --179 --
NM_052910chr1361902 1816 1736 1425 545 314 --1415 --
NM_052918chr1063527 2669 2620 2593 934 909 12776 ----
NM_052932chr11----146 --
NM_052934chr171918 1810 1466 729 600 511 416 --12260 --
NM_052978chr1451789 1618 1396 1203 294 --11389 --
NM_053001chr81163 ------
NM_053023chr112784 166 22013 663 22614 421 12606
NM_053056chr1162848 2721 2321 2221 810 56 --11949 --
NM_053064chr1472499 1204 786 619 606 518 296 12802 ----
NM_053279chr852535 701 570 245 135 12072 ----
NM_054025chr1172106 1794 1472 1424 814 280 208 ------
NM_054035chr177805 782 749 646 612 359 38 183 1795 --
NM_057159chr941290 1183 213 201 11263 ----
NM_057175chr411035 --12354 --
NM_057749chr82934 106 ----11135
NM_058170chr11435 ----1383
NM_058238chr224762 378 202 126 ------
NM_058240chr1481417 1347 1283 1274 664 401 264 123 1276 1646 --
NM_058241chr21303 ------
NM_058241chr21303 ------
NM_078467chr681388 1131 1122 486 383 264 127 44 --11004 --
NM_078473chr832034 638 237 --11639 --
NM_078487chr952753 2591 2347 778 89 --13247 --
NM_080422chr181118 ------
NM_080423chr181118 ------
NM_080491chr11113434 3406 3379 3035 2796 2691 2653 878 429 89 56 12537 23300 3152 12460
NM_080597chr181744 ------
NM_080599chr101461 ------
NM_080607chr205827 793 708 351 172 --1103 --
NM_080616chr20372 48 30 1512 ----
NM_080617chr201752 11023 ----
NM_080621chr2071188 1156 1121 979 381 229 77 ------
NM_080645chr671809 1649 1528 1341 815 522 285 ------
NM_080669chr17124880 4123 3610 3107 1707 1589 1107 1058 834 805 394 163 34319 4215 918 ----
NM_080717chr1261492 991 974 634 315 249 --1349 --
NM_080738chr132058 664 363 --11628 --
NM_080759chr1321063 172 11899 ----
NM_080760chr1321063 172 11899 ----
NM_080764chr2231286 546 405 156 ----
NM_080792chr2041496 710 588 51 --22252 1602 --
NM_080865chr33567 221 211 ------
NM_080867chr1463808 1851 1554 1119 460 123 ------
NM_080872chr873813 1354 1336 1074 910 795 374 ------
NM_080928chr71246 --1846 --
NM_130385chr11133167 3153 2968 2714 2664 2240 1164 945 898 519 491 484 106 13086 12569 --
NM_130387chr321238 457 1834 ----
NM_130391chr9----13035 --
NM_130392chr9----13035 --
NM_130393chr9----13035 --
NM_130435chr1062696 2581 2283 1098 892 816 1211 12264 --
NM_130438chr2162369 999 820 534 249 106 --1963 --
NM_130439chr1031753 710 596 --1812 --
NM_130439chr1031753 710 596 --1812 --
NM_130442chr75725 396 353 228 207 --1811 --
NM_130446chr394068 3511 2838 1680 1222 1108 257 75 52 --2630 554 --
NM_130470chr113824 665 26 ------
NM_130471chr113824 665 26 ------
NM_130472chr113824 665 26 ------
NM_130473chr113824 665 26 ------
NM_130476chr113824 665 26 ------
NM_130797chr771567 1461 1301 1103 633 313 198 ------
NM_130798chr152978 588 1269 ----
NM_130799chr116634 608 520 499 192 102 ------
NM_130800chr116634 608 520 499 192 102 ------
NM_130801chr116634 608 520 499 192 102 ------
NM_130802chr116634 608 520 499 192 102 ------
NM_130803chr116634 608 520 499 192 102 ------
NM_130804chr116634 608 520 499 192 102 ------
NM_130838chr1521176 110 ------
NM_130839chr1521176 110 ------
NM_130846chr121717 --1918 --
NM_133170chr20177780 7427 6711 6668 5897 5737 5606 5083 3241 2811 2798 2670 1866 1817 1411 564 199 --11844 --
NM_133177chr161032 1022 1011 765 232 105 1240 1181 --
NM_133178chr161032 1022 1011 765 232 105 1240 1181 --
NM_133264chr17133723 3398 3227 2711 2527 2381 1443 1286 1046 1012 944 156 125 12546 43623 3241 2951 2608 --
NM_133265chrX33590 1262 595 13151 ----
NM_133330chr492990 2563 2529 2067 2059 1991 1028 654 236 --23021 932 11011
NM_133331chr492990 2563 2529 2067 2059 1991 1028 654 236 --23021 932 11011
NM_133335chr492990 2563 2529 2067 2059 1991 1028 654 236 --23021 932 11011
NM_133369chr56855 790 377 329 222 178 ------
NM_133378chr24757 405 384 355 ------
NM_133379chr2122 ------
NM_133432chr24757 405 384 355 ------
NM_133437chr24757 405 384 355 ------
NM_133445chr963720 3665 3196 3017 1091 615 --11160 --
NM_133452chr1951032 818 272 247 151 --2317 188 --
NM_133468chr732127 1712 528 --1959 --
NM_133476chr123481 418 335 1304 1109 --
NM_133478chr252519 2085 1844 890 835 ------
NM_133507chr123837 601 197 --1621 --
NM_133509chr142432 255 ------
NM_133635chr2141083 593 145 127 --2604 487 --
NM_133645chr6------1588
NM_133646chr245590 4640 4360 557 ------
NM_133647chr1573672 3457 2619 2451 170 145 55 --11189 --
NM_134268chr1781135 1129 1117 1111 1027 869 842 815 --2330 78 --
NM_134325chr151453 1345 264 135 46 --11795 --
NM_134424chr1221251 369 ----11006
NM_138270chrX53380 3138 3104 3070 2333 --12905 --
NM_138297chr32316 41 ------
NM_138317chr141533 ------
NM_138318chr141533 ------
NM_138338chr22103340 3314 3109 2815 2372 2314 2191 1076 862 148 --22656 2511 --
NM_138350chr171398 1232 1175 1071 951 525 511 ------
NM_138370chr22694 487 --1673 --
NM_138373chr1941883 1348 1322 395 --1653 --
NM_138411chr191117 ------
NM_138426chr73644 493 27 --12039 --
NM_138440chr165519 421 202 168 93 ------
NM_138444chr1373228 3021 582 288 266 106 77 --11741 --
NM_138453chr5126 ------
NM_138457chr6203242 3193 3182 3140 2898 2792 2654 2519 2491 2402 1191 1095 974 859 744 720 691 632 544 94 --161 --
NM_138459chr62493 335 1114 ----
NM_138468chr295312 5202 4923 4711 4291 2163 1520 1464 736 --11805 --
NM_138471chr114498 460 443 382 ------
NM_138473chr1284802 4745 4564 4377 4318 4303 3701 539 24650 4497 14288 --
NM_138477chr152595 56 --1318 --
NM_138479chr161979 1827 1412 755 560 486 --11743 --
NM_138558chr131216 1192 920 --11186 --
NM_138559chr2------1230
NM_138565chr1131078 431 392 11363 ----
NM_138576chr1473985 3560 3546 3371 2981 1141 22 --14461 --
NM_138578chr2071163 1132 935 425 296 213 48 --11047 --
NM_138713chr1697866 5803 5733 5331 5144 5107 2589 2507 1045 17164 16261 --
NM_138714chr1697866 5803 5733 5331 5144 5107 2589 2507 1045 17164 16261 --
NM_138717chr67656 605 515 217 186 120 99 1109 ----
NM_138727chr131685 1565 850 --31708 873 349 1630
NM_138728chr131685 1565 850 --31708 873 349 1630
NM_138731chr1454277 3608 2829 2591 1632 ------
NM_138782chr51824 ------
NM_138793chr1751789 1496 599 364 172 --1358 1142
NM_138795chr141436 1291 1113 193 --1238 --
NM_138799chr251937 1808 1383 1377 176 ------
NM_138927chr213143 112 39 ------
NM_138931chr33958 679 86 ------
NM_138970chr1442008 976 302 218 ------
NM_138971chr11113360 3034 2816 2370 1523 1431 1371 1244 946 703 684 ----11139
NM_138971chr11113360 3034 2816 2370 1523 1431 1371 1244 946 703 684 ----11139
NM_138972chr11113360 3034 2816 2370 1523 1431 1371 1244 946 703 684 ----11139
NM_138972chr11113360 3034 2816 2370 1523 1431 1371 1244 946 703 684 ----11139
NM_138973chr11113360 3034 2816 2370 1523 1431 1371 1244 946 703 684 ----11139
NM_138973chr11113360 3034 2816 2370 1523 1431 1371 1244 946 703 684 ----11139
NM_138994chr161149 ------
NM_139012chr642165 859 242 109 --11931 --
NM_139014chr642245 939 322 189 --12011 --
NM_139015chr1221561 1303 ------
NM_139045chr91219 ------
NM_139062chr171374 ------
NM_139067chr121252 ------
NM_139068chr53263 229 77 ------
NM_139069chr53263 229 77 ------
NM_139070chr52132 98 ------
NM_139071chr1291409 1171 1050 564 554 319 223 211 180 ----168
NM_139072chr21616 ------
NM_139278chr881165 1095 886 485 479 395 279 153 --11328 --
NM_139283chr121884 ------
NM_139312chr1041253 1234 198 89 ------
NM_139321chr20163833 3715 3697 3659 3152 3070 3062 2953 2649 2613 1618 1530 1264 1070 736 173 ------
NM_139323chr201127 11546 ----
NM_144568chr142558 438 ------
NM_144571chr414301 ------
NM_144574chr141253 ------
NM_144578chr1455501 3634 3624 2211 451 12166 23479 3415 --
NM_144590chr1042455 2118 2092 520 --12399 --
NM_144600chr164467 332 129 67 ------
NM_144610chr17153 ------
NM_144628chr2062998 2982 2713 2621 2073 330 42881 2585 763 359 22660 526 12736
NM_144633chr331282 407 156 --1323 --
NM_144664chr1112262 ------
NM_144667chr121984 ------
NM_144704chr22186 ------
NM_144732chr193716 400 375 2726 171 ----
NM_144973chr1274909 3393 3313 1893 1738 1382 1319 --1115 --
NM_145008chr113346 113 90 ------
NM_145055chr1853284 2394 427 415 48 13007 ----
NM_145112chr1441087 1049 185 42 --11159 --
NM_145113chr1461359 1321 457 314 238 45 --11431 --
NM_145166chr3152917 2626 2321 2059 2004 1987 1903 1078 782 467 437 422 181 149 110 ------
NM_145174chr221282 ------
NM_145206chr1083209 2940 2859 2330 936 460 288 98 2844 714 22167 495 --
NM_145251chr14------11277
NM_145259chr275376 2416 2324 1398 1041 938 802 25049 1658 22797 559 15252
NM_145263chr43756 491 84 ------
NM_145274chr172816 729 ------
NM_145284chrX3930 752 282 12428 ----
NM_145305chrX11099 ----167
NM_145307chr1024280 297 ------
NM_145313chr1061228 1068 1036 1028 472 88 ----1520
NM_145320chr773605 2717 2702 2647 881 832 470 1648 ----
NM_145321chr773605 2717 2702 2647 881 832 470 1648 ----
NM_145322chr773605 2717 2702 2647 881 832 470 1648 ----
NM_145349chr1731863 339 172 ----11659
NM_145686chr272746 2591 969 849 316 181 126 12533 22445 646 --
NM_145687chr272746 2591 969 849 316 181 126 12533 22445 646 --
NM_145690chr851625 1567 460 141 72 --128 --
NM_145698chr1032124 1781 1411 11717 ----
NM_145714chr165349 309 135 81 73 ------
NM_145733chr2281125 946 904 821 449 221 165 31 ------
NM_145735chr1331006 267 132 11022 11044 --
NM_145793chr10----1205 --
NM_145804chr1161185 939 363 235 169 156 ------
NM_145808chr731217 388 49 12190 11047 --
NM_145861chr132058 664 363 --11628 --
NM_145888chr19121828 1660 1649 1454 1358 1329 1244 661 595 378 189 171 --168 --
NM_145893chr1611662 11331 --1118
NM_145912chr22214618 4529 3597 3563 2973 2918 1802 1605 1433 1385 1305 1268 1191 1040 865 812 197 178 167 155 109 --34402 1121 332 --
NM_146388chr1981129 1008 860 838 393 247 196 45 11065 ----
NM_147150chr973229 2988 2960 2562 2427 480 179 1521 ----
NM_147156chr102397 53 ------
NM_147161chr171170 973 348 298 240 109 39 ------
NM_147192chr1111715 1330 563 431 424 410 322 291 245 204 90 1143 ----
NM_147202chr9102181 2127 1969 1796 469 410 404 373 283 101 --1618 --
NM_147223chr282384 2193 1832 1712 1633 1514 662 572 ------
NM_147233chr272201 2010 1649 1529 1450 479 389 ------
NM_148174chr832211 1650 310 ------
NM_148415chr166372 332 158 104 96 32 ------
NM_148416chr165349 309 135 81 73 ------
NM_148898chr72976 128 ----1373
NM_148899chr72976 128 ----1373
NM_148918chr174651 609 595 89 --1616 --
NM_148921chr1762379 2171 1881 381 153 119 --12223 1433
NM_148960chr181990 1824 1651 1538 550 453 419 90 ------
NM_152222chr1191874 1362 715 654 409 264 256 213 160 --2676 366 11595
NM_152233chr1431631 1557 208 --11386 --
NM_152237chr22121780 1601 1524 1229 702 692 484 465 458 433 145 139 --1363 --
NM_152240chr341164 1108 922 269 ----1951
NM_152247chr224951 674 120 25 ------
NM_152253chr22194337 4060 3506 3411 3079 2949 2713 1471 1338 1016 902 759 603 482 422 382 273 112 51 --23316 1070 --
NM_152261chr12125 ------
NM_152262chr194703 579 330 248 183 ----
NM_152263chr1136062 5672 5537 5486 4994 4171 4115 3729 1232 1067 950 196 64 ------
NM_152271chr811056 ------
NM_152280chr172897 2796 2771 2478 826 809 92 32416 581 147 12585 --
NM_152283chr51172 1728 ----
NM_152305chr382174 1925 1833 1615 1502 685 477 297 --1367 --
NM_152352chr1832537 1200 936 ------
NM_152371chr181816 1607 1336 740 546 409 259 51 --1347 --
NM_152380chr141310 1258 1252 44 ------
NM_152387chr2----1182 --
NM_152409chr522652 1004 --11279 --
NM_152410chr6----1152 --
NM_152414chr8----11447 --
NM_152424chrX114607 4219 3824 3690 3153 3139 2868 1669 1267 1241 607 ------
NM_152470chr18123953 3273 3147 2890 2588 1395 1086 922 857 561 210 28 --11440 --
NM_152519chr252108 1714 539 476 75 --12046 --
NM_152529chr274201 3331 3220 2720 1378 455 108 21610 704 13547 --
NM_152536chr32416 141 ------
NM_152538chr321442 497 150 1183 --
NM_152546chr51120 ------
NM_152554chr63456 176 128 --1443 --
NM_152556chr712055 --1661 --
NM_152557chr751440 1201 1160 1130 622 --21064 50 --
NM_152588chr1241556 1533 447 30 11604 ----
NM_152594chr1522334 1630 --12328 --
NM_152598chr172330 304 ------
NM_152622chr523324 263 --12690 --
NM_152624chr555065 1746 1419 1236 28 --1344 --
NM_152629chr983171 2982 2508 1606 1389 755 414 260 ------
NM_152641chr1232342 1876 124 ------
NM_152682chr411161 1400 11686 --
NM_152694chrX1313 ------
NM_152699chr332937 2795 1170 1232 33369 1077 1036 --
NM_152716chr1171436 1417 1407 1401 1165 370 284 1481 --1401
NM_152733chr6216420 6031 5752 5553 5538 5375 4849 4761 4689 4682 4387 4213 4158 4019 2581 2173 1791 1598 1581 1088 1074 1418 25117 5062 --
NM_152734chr685333 4994 3864 3609 3319 1963 751 575 15108 25082 2058 --
NM_152754chr753709 894 481 315 95 ------
NM_152756chr563477 2728 1437 768 586 69 ------
NM_152769chr197878 788 655 648 369 124 101 ------
NM_152787chrX51550 1495 1452 456 444 ----12504
NM_152789chr7----11286 --
NM_152835chr131806 1007 143 12437 22032 974 1734
NM_152836chr831322 310 24 ------
NM_152837chr831322 310 24 ------
NM_152860chr1271456 1367 1054 1031 994 325 91 ------
NM_152896chr92546 241 ------
NM_152902chr122019 695 ------
NM_152903chr1342531 2004 1837 632 ------
NM_152924chr15116616 6365 6198 6009 2401 712 306 209 174 78 25 --26043 2218 --
NM_153013chr542235 1984 1768 1738 --12111 11612
NM_153029chr16113967 3840 3610 3320 3143 3096 2658 1629 1623 1455 665 --33459 2548 439 --
NM_153035chr14590 329 157 117 12207 ----
NM_153038chr24580 564 540 510 ------
NM_153047chr64153 55 44 32 ------
NM_153048chr64153 55 44 32 ------
NM_153050chr2264031 3788 964 884 715 705 11916 --11055
NM_153051chr2264031 3788 964 884 715 705 11916 --11055
NM_153188chr545517 1783 1513 26 14045 --15075
NM_153228chr17162 ------
NM_153255chr62945 157 ------
NM_153264chr33245 139 120 ------
NM_153266chr114860 835 688 628 ------
NM_153273chr342780 2388 2179 764 --12135 --
NM_153347chr1162246 1061 992 870 354 259 --22329 669 22749 705
NM_153350chr16121667 1461 1451 1299 1258 1241 696 611 503 437 222 187 ------
NM_153367chr1083799 3786 3460 1185 953 943 745 560 12475 11434 --
NM_153371chr134768 713 473 298 ------
NM_153487chr6124765 4593 4478 4461 4273 4069 3682 1917 1631 1601 814 560 1933 24714 3725 --
NM_153499chr1252534 2523 2282 1917 286 ------
NM_153500chr1252534 2523 2282 1917 286 ------
NM_153613chr15261 55 --168 --
NM_153619chr1581260 1244 1206 878 773 751 471 464 12704 ----
NM_153620chr731419 407 401 ------
NM_153631chr761658 1445 1244 1079 588 131 --11286 --
NM_153632chr761658 1445 1244 1079 588 131 --11286 --
NM_153634chr1211378 ------
NM_153649chr131644 1507 502 1424 1702 --
NM_153675chr201188 ------
NM_153686chr442287 882 522 251 11693 ----
NM_153687chr121457 --185 --
NM_153712chr293208 3182 1359 915 593 535 367 335 48 --21352 350 --
NM_153715chr72887 310 --1393 --
NM_153756chr151888 1869 1438 194 125 --1775 --
NM_153809chr93420 394 46 ------
NM_153825chr421606 170 ------
NM_153831chr81110 ------
NM_170675chr151314 ------
NM_170676chr151314 ------
NM_170679chr521299 140 ----11327
NM_170706chr1114132 3564 3262 3081 2964 2886 945 616 166 82 38 1129 ----
NM_170709chr842014 1857 870 704 --1102 --
NM_170719chr132383 181 ------
NM_170721chr1751224 1159 834 173 86 11166 ----
NM_170731chr1152668 2386 2073 1902 782 ------
NM_170732chr1152668 2386 2073 1902 782 ------
NM_170733chr1152668 2386 2073 1902 782 ------
NM_170734chr1152668 2386 2073 1902 782 ------
NM_170735chr1152668 2386 2073 1902 782 ------
NM_170750chrX146 ------
NM_170751chr63446 386 62 ------
NM_170752chr63446 386 62 ------
NM_171825chr5123014 2883 2229 2203 2193 2056 2018 1053 684 525 289 104 --12344 --
NM_171998chrX31814 308 98 1698 3976 683 254 --
NM_172058chr831305 613 64 ------
NM_172059chr831305 613 64 ------
NM_172060chr831305 613 64 ------
NM_172071chr1107369 7051 6771 5961 2810 2307 2124 1676 1305 725 36001 1261 455 27338 2873 --
NM_172097chr151254 ------
NM_172127chr411506 --11807 --
NM_172128chr411462 --11763 --
NM_172159chr32681 253 ------
NM_172160chr32681 253 ------
NM_172169chr1081782 1776 1648 1634 1624 792 627 401 ------
NM_172170chr1081782 1776 1648 1634 1624 792 627 401 ------
NM_172171chr1081782 1776 1648 1634 1624 792 627 401 ------
NM_172173chr1081782 1776 1648 1634 1624 792 627 401 ------
NM_172200chr104554 194 128 95 ------
NM_172206chr174289 131 113 68 --11515 --
NM_172208chr681053 1015 944 845 406 368 294 199 ------
NM_172216chr1252436 2425 2184 1819 188 ------
NM_172219chr174760 175 97 21 ----164
NM_172220chr174760 175 97 21 ----164
NM_172225chr1111715 1330 563 431 424 410 322 291 245 204 90 1143 ----
NM_172226chr1252534 2523 2282 1917 286 ------
NM_172230chr114340 184 169 21 ------
NM_172375chr143760 249 207 --1821 --
NM_173039chr11--170 1246 --
NM_173075chr41304 11697 11852 --
NM_173156chr151950 1596 1503 726 292 --22013 553 21693 35
NM_173163chr16128 ------
NM_173198chr912479 ------
NM_173200chr912479 ------
NM_173214chr1697866 5803 5733 5331 5144 5107 2589 2507 1045 17164 16261 --
NM_173354chr2131868 1594 76 ------
NM_173359chr321466 541 ------
NM_173465chr54836 683 393 144 --11011 --
NM_173471chr32822 93 ------
NM_173473chr1032306 1008 711 ------
NM_173476chr16142204 2055 1879 1858 1579 909 873 862 829 676 646 595 314 44 22301 1565 2881 373 --
NM_173477chr17101828 1649 1587 1560 1513 1473 1309 555 535 292 ------
NM_173480chr192118 58 ------
NM_173491chr511434 ------
NM_173495chrX52357 991 938 752 469 ------
NM_173500chr151354 --1545 --
NM_173511chr263946 1514 1005 168 153 102 22944 1293 ----
NM_173515chr6286 40 --1898 --
NM_173519chr831446 820 514 ------
NM_173531chr1943566 3423 2550 2465 13550 --12966
NM_173546chr32580 570 --1239 --
NM_173576chr103310 279 59 ------
NM_173582chr1145369 3897 1509 1398 --26085 5710 --
NM_173595chr12235131 4989 4969 4775 4692 4493 3807 3725 3566 3252 2131 2066 1781 1737 1077 1034 931 720 645 587 440 291 248 33620 2025 673 ----
NM_173602chr1283395 3303 3164 3147 3011 2464 945 912 ----13109
NM_173607chr14--12144 11785 --
NM_173609chr151219 ------
NM_173642chr1199175 8482 7748 6684 6233 3223 3056 2847 2679 2553 2416 2369 2208 2145 1403 737 551 487 112 12386 38512 7026 6149 --
NM_173653chr341164 999 494 374 ------
NM_173667chr54920 802 226 218 11946 ----
NM_173676chr64740 658 211 167 ------
NM_173681chr7152113 2060 2033 1889 1831 1634 1526 740 448 324 306 246 226 155 52 11461 1807 --
NM_173808chr142752 1776 1722 803 24303 1656 ----
NM_173809chr1031491 1414 1340 --11115 --
NM_173822chr24665 597 470 360 --1305 --
NM_173825chr352732 2521 2119 1091 401 ----11205
NM_173833chr861501 1384 517 429 303 107 21217 1171 ----
NM_173854chr1102170 2115 2089 1805 1772 1693 1595 528 347 25 ------
NM_173872chr43323 293 248 ------
NM_174890chr101704 ------
NM_174911chr863356 2812 2686 2529 1113 736 1967 1105 --
NM_174916chr1552082 1931 1924 1713 630 --1112 --
NM_174934chr11163489 3328 3215 2836 2787 2494 1447 1426 1272 1065 1003 969 760 592 583 68 --32557 2300 843 --
NM_175038chr12127 --193 --
NM_175061chr731759 1471 1463 ------
NM_175063chr1961137 1131 357 340 227 35 --1348 --
NM_175575chr1751277 1042 1027 902 296 --11227 --
NM_175610chr1511275 ------
NM_175634chr841013 893 332 60 ------
NM_175635chr841013 893 332 60 ------
NM_175636chr841013 893 332 60 ------
NM_175733chr1191853 1833 1713 1491 863 631 543 522 510 ------
NM_175736chr12217674 6673 6480 6062 5590 5266 5255 4920 3138 3049 2935 2775 2425 2225 2155 1709 1590 1236 1123 501 120 26241 5727 12452 --
NM_175744chr14408 326 147 103 --188 --
NM_175767chr521680 481 ------
NM_175861chr1245919 2229 2060 346 125 ----
NM_175863chr62475 313 --1123 --
NM_175875chr197680 604 575 451 230 188 75 ------
NM_175876chr131130 437 348 12081 11120 1683
NM_175898chr1561284 1067 334 324 148 110 --2646 454 --
NM_175900chr1651559 714 677 92 44 ------
NM_175907chr1872742 2297 1842 1111 1050 835 209 --2913 800 --
NM_175931chr1681665 1620 1416 1388 812 213 114 56 --21409 1381 --
NM_176792chr1031131 953 217 ------
NM_176801chr4111244 681 567 534 504 314 284 199 187 176 149 --1495 --
NM_176863chr1772168 1746 1584 1522 686 521 186 ------
NM_176871chr8133355 3345 2974 2939 2728 2616 2495 2449 840 707 699 453 426 ------
NM_177398chr141889 1741 1441 614 135 11695 1626
NM_177399chr141889 1741 1441 614 135 11695 1626
NM_177401chr1961472 1159 708 418 326 68 --1384 --
NM_177402chr14973 876 296 229 --1931 --
NM_177414chr141214 1178 1110 446 ------
NM_177438chr1452925 2593 1514 916 412 --23437 1551 --
NM_177559chr2061163 1101 392 365 327 298 ----1809
NM_177560chr2061163 1101 392 365 327 298 ----1809
NM_177968chr22260 145 ------
NM_177972chr1143332 2785 2709 547 ------
NM_177983chr2----1323 --
NM_177996chr2073364 3058 3040 2829 1328 1195 101 --12544 --
NM_177999chr9193599 3428 3238 3225 2886 2724 2688 2654 2603 2440 2364 2294 1346 1212 1157 1076 993 897 800 --23274 2254 --
NM_178014chr63995 854 323 ------
NM_178026chr203414 163 101 --1426 --
NM_178037chr1273664 3123 2990 2983 2720 1285 963 ------
NM_178038chr1273664 3123 2990 2983 2720 1285 963 ------
NM_178120chr271214 459 447 430 282 141 126 ------
NM_178126chr173545 246 51 12236 11478 --
NM_178151chrX65822 5151 5026 2283 2014 503 27598 2693 --16800
NM_178152chrX65822 5151 5026 2283 2014 503 27598 2693 --16800
NM_178153chrX65822 5151 5026 2283 2014 503 27598 2693 --16800
NM_178154chr142635 587 2288 205 ----
NM_178155chr142635 587 2288 205 ----
NM_178156chr142635 587 2288 205 ----
NM_178157chr142635 587 2288 205 ----
NM_178426chr122126 699 1513 ----
NM_178427chr122026 599 1413 ----
NM_178439chr22186 102 ------
NM_178509chr1783612 3602 3084 1480 792 660 553 391 23205 717 ----
NM_178539chr1221742 333 ------
NM_178554chr3133606 3479 3070 2530 2504 2281 1348 1270 1240 898 885 136 128 13106 ----
NM_178557chr481714 1486 667 621 496 419 395 383 ------
NM_178562chr74858 617 202 171 1725 --146
NM_178565chr821653 535 ------
NM_178581chr203319 300 103 ------
NM_178585chr433022 2361 61 22607 2174 ----
NM_178586chr1441708 1640 144 115 ------
NM_178812chr8----1310 --
NM_178842chr1541579 277 71 23 --1500 --
NM_180989chr1312338 --1316 --
NM_181077chr1521755 579 --11777 --
NM_181302chr141253 ------
NM_181308chr141253 ------
NM_181332chrX6948 909 323 162 123 35 11867 11808 --
NM_181336chr681317 1216 1205 1092 1082 1021 456 38 --11286 --
NM_181351chr1142859 2810 2422 928 1504 ----
NM_181358chr143499 2958 1699 1415 --1211 --
NM_181361chr31993 ----1445
NM_181443chr2052827 2366 2182 953 31 ------
NM_181458chr221430 125 ------
NM_181459chr221196 394 ------
NM_181460chr221243 441 ------
NM_181481chr1895817 5585 4930 4808 2666 2525 2346 1129 972 --36163 5828 4856 --
NM_181482chr1895817 5585 4930 4808 2666 2525 2346 1129 972 --36163 5828 4856 --
NM_181483chr1895817 5585 4930 4808 2666 2525 2346 1129 972 --36163 5828 4856 --
NM_181486chr1261492 991 974 634 315 249 --1349 --
NM_181491chr973021 2777 2708 2601 2582 616 545 --33053 785 605 --
NM_181521chr16117119 7073 6660 5595 5209 1684 1653 1204 1075 470 426 ------
NM_181528chr202355 28 ------
NM_181671chr173881 215 199 --1141 --
NM_181672chrX2653 42 2678 31 ----
NM_181673chrX2653 42 2678 31 ----
NM_181698chr101495 ------
NM_181701chr932089 573 484 --2368 56 --
NM_181705chr564950 4089 3923 1598 1543 970 --15704 --
NM_181782chr621417 82 --198 --
NM_181784chr252031 1863 833 615 27 ------
NM_181809chr1153689 3319 3177 2991 2821 2742 2487 1412 1212 1146 1023 658 349 312 235 13448 11626 13660
NM_181836chr51944 --22576 449 --
NM_181838chr51361 --1105 --
NM_181873chr12150 34 ------
NM_181876chr410855 806 764 705 641 456 443 434 428 166 1916 137 --
NM_181886chr441088 140 104 94 ------
NM_181887chr441088 140 104 94 ------
NM_181888chr441088 140 104 94 ------
NM_181889chr441088 140 104 94 ------
NM_181890chr441088 140 104 94 ------
NM_181891chr441088 140 104 94 ------
NM_181892chr441135 187 151 141 ------
NM_181893chr441088 140 104 94 ------
NM_182314chrX2196 180 ------
NM_182470chr153217 144 35 ------
NM_182471chr153217 144 35 ------
NM_182472chr41129 ------
NM_182488chr13----136 --
NM_182492chr221254 ------
NM_182493chr1694884 4592 4321 3412 2136 1944 1223 801 449 ------
NM_182507chr1261591 1506 957 938 662 623 --1229 1209
NM_182509chr1441528 1507 1079 313 --11426 --
NM_182526chr14122980 2761 2681 2473 2192 2021 1978 1248 754 662 613 113 22350 2141 32330 2317 78 1121
NM_182527chr22111864 1788 1664 1571 1538 1434 668 655 600 225 51 ------
NM_182553chr114502 494 440 84 ------
NM_182557chr11102077 1905 1725 1605 1517 1455 873 734 705 434 ------
NM_182565chr172725 511 ----1551
NM_182685chr12553 143 1812 ----
NM_182697chr711678 --1531 --
NM_182706chr8266 49 ------
NM_182762chr785874 5223 5051 4754 2141 2085 1805 569 ------
NM_182789chr52877 433 1178 ----
NM_182830chr1431942 630 599 12002 ----
NM_182848chr1331280 1171 67 182 --11328
NM_182854chr161338 ------
NM_182898chr776257 5775 4205 1827 1303 639 614 1494 25168 4552 16032
NM_182899chr776257 5775 4205 1827 1303 639 614 1494 25168 4552 16032
NM_182915chr232173 658 652 ------
NM_182920chr321421 1379 ------
NM_182936chr1481417 1347 1283 1274 664 401 264 123 1276 1646 --
NM_182948chr142566 2505 1167 919 --21174 315 --
NM_182970chr20204188 4169 3930 3899 3789 3613 3559 3154 3144 3086 1708 1659 1424 1399 1351 1060 1054 1001 453 390 11537 33400 3054 706 --
NM_182972chr112563 172 ----
NM_182977chr51716 --1276 --
NM_182978chr183698 545 37 1651 2271 60 --
NM_183002chr1481417 1347 1283 1274 664 401 264 123 1276 1646 --
NM_183004chr1463465 2714 2577 1313 687 52 ------
NM_183058chr10139 ------
NM_183075chr41312 1323 ----
NM_183078chr663760 3131 2649 1108 283 157 11406 --12804
NM_183227chr621566 1244 ------
NM_183323chr52877 433 1178 ----
NM_183352chr3139 ------
NM_183373chr66864 124 117 93 74 28 ------
NM_183376chr1542613 1985 865 349 1781 ----
NM_183397chr20184995 4587 4552 4502 4311 4298 4284 4246 3598 3251 1817 1678 1573 1555 1352 500 314 142 14346 24969 268 --
NM_183425chr2051671 1244 316 217 85 --1495 --
NM_184231chr3266 32 --1567 --
NM_194247chr283639 3383 3357 3297 1473 906 577 89 13094 --13443
NM_194248chr27864 806 727 696 366 270 77 ------
NM_194259chr162459 374 ----189
NM_194260chr162459 374 ----189
NM_194261chr162459 374 ----189
NM_194278chr14103773 3588 3515 3394 2718 2538 931 924 782 651 23665 3202 ----
NM_194286chr12226238 5468 5251 5014 4864 4749 4428 4091 3989 2385 1936 1859 1720 1696 1634 1503 943 867 861 843 451 412 25342 1750 25569 5152 --
NM_194298chr1051728 1671 1454 337 290 ------
NM_194313chr941500 1444 164 143 11817 21268 522 --
NM_194314chr125261 3448 14745 11701 --
NM_194322chr27864 806 727 696 366 270 77 ------
NM_194328chr933052 670 40 --21066 800 --
NM_194329chr933052 670 40 --21066 800 --
NM_194330chr933052 670 40 --21066 800 --
NM_194332chr933052 670 40 --21066 800 --
NM_194356chr1252028 1774 1605 706 597 --12222 --
NM_194434chr1854859 4400 3685 1981 915 11750 2901 565 --
NM_194439chr431230 547 538 1503 ----
NM_194442chr111471 ------
NM_194449chr182832 700 --1909 --
NM_194452chr1141115 1109 496 391 --11261 --
NM_194453chr1141115 1109 496 391 --11261 --
NM_194454chr731765 1613 360 1496 ----
NM_194455chr731765 1613 360 1496 ----
NM_194456chr731765 1613 360 1496 ----
NM_197941chr542742 2530 2344 137 --12548 --
NM_197956chr962016 1714 1678 801 512 48 ------
NM_197966chr2221104 902 ------
NM_197967chr2221104 902 ------
NM_197970chr211484 ------
NM_198056chr391859 1815 1537 821 809 710 201 129 123 --31523 898 727 --
NM_198066chr1472653 2529 2448 2442 2248 1234 1193 32097 1895 97 ----
NM_198076chr151585 1467 707 543 366 21817 1786 ----
NM_198077chr13488 135 96 ------
NM_198128chr182745 335 ------
NM_198158chr322022 1929 --23065 2889 --
NM_198159chr322022 1929 --23065 2889 --
NM_198177chr322022 1929 --23065 2889 --
NM_198178chr322022 1929 --23065 2889 --
NM_198225chr1021844 1371 ------
NM_198236chr12869 699 1402 2951 231 --
NM_198264chr1----1488 --
NM_198268chr143499 2958 1699 1415 --1211 --
NM_198269chr143499 2958 1699 1415 --1211 --
NM_198270chrX11071 ------
NM_198277chr1181098 714 418 316 214 104 79 52 --122 1733
NM_198324chr1251272 1226 1063 871 477 --11143 --
NM_198334chr112203 166 ------
NM_198335chr112203 166 ------
NM_198390chr1621569 89 ----11734
NM_198392chr6102160 2135 1997 1626 1541 1453 781 422 214 172 ------
NM_198465chrX42374 2050 1984 666 11839 ----
NM_198468chr654160 2935 2823 1276 993 1442 13507 --
NM_198485chr382430 1805 1797 1611 1037 578 526 458 1188 ----
NM_198560chr3113703 3108 3080 2915 2903 2692 1114 518 436 135 72 1986 1556 --
NM_198581chr2107014 6521 6307 5714 5578 5368 5086 4952 2653 2288 11073 26970 4670 16148
NM_198595chr4104927 3582 3074 1651 1378 415 119 96 58 26 --13420 --
NM_198679chr9132630 2592 2173 2019 1980 950 933 907 635 616 395 350 208 --1980 --
NM_198686chr14112536 2527 2179 1677 1021 1007 871 774 596 589 253 --12344 --
NM_198700chr111400 ------
NM_198715chr146253 5983 5440 156 --15488 --
NM_198859chr384841 4327 3796 3577 3367 1819 1764 259 14450 ----
NM_198896chr1151716 1708 426 418 411 ------
NM_198900chr12217674 6673 6480 6062 5590 5266 5255 4920 3138 3049 2935 2775 2425 2225 2155 1709 1590 1236 1123 501 120 26241 5727 12452 --
NM_198904chr541832 730 430 375 --11514 --
NM_198968chr1343818 3313 3277 74 --13364 --
NM_198991chr182692 537 ------
NM_198993chr1761751 1578 1532 1507 1188 1168 192 ----
NM_199072chr74706 583 528 333 12479 ----
NM_199076chr1041283 1229 506 422 ------
NM_199129chr2081133 1052 1002 963 480 379 309 146 --1975 --
NM_199131chr1092910 2580 2366 2314 1262 1094 1024 655 585 11361 12917 --
NM_199169chr2083191 3178 2394 2287 2223 1213 1036 738 23127 2471 13448 --
NM_199170chr2083191 3178 2394 2287 2223 1213 1036 738 23127 2471 13448 --
NM_199171chr2083191 3178 2394 2287 2223 1213 1036 738 23127 2471 13448 --
NM_199188chr1232873 870 40 ----11537
NM_199190chr1232873 870 40 ----11537
NM_199245chr1242177 683 526 506 --12218 --
NM_199246chr521010 101 1521 ----
NM_199262chr1752170 1660 873 338 245 ------
NM_199324chr413720 32743 242 136 12700 --
NM_199368chr204584 197 180 109 1206 1494 --
NM_199421chr1463808 1851 1554 1119 460 123 ------
NM_199437chr1152473 1645 781 598 37 ------
NM_199438chr1152473 1645 781 598 37 ------
NM_199439chr1152473 1645 781 598 37 ------
NM_199454chr1114760 3574 3516 3097 3067 1751 1611 1602 701 669 74 11355 24340 3422 --
NM_199462chr1104390 4279 4223 3835 3627 1767 1591 1174 798 542 1579 ----
NM_199478chrX2635 72 ------
NM_201278chr1121588 465 22281 188 12101 --
NM_201281chr1121588 465 22281 188 12101 --
NM_201378chr87784 775 742 636 287 275 209 ------
NM_201379chr87784 775 742 636 287 275 209 ------
NM_201380chr87784 775 742 636 287 275 209 ------
NM_201381chr87784 775 742 636 287 275 209 ------
NM_201382chr87784 775 742 636 287 275 209 ------
NM_201383chr87784 775 742 636 287 275 209 ------
NM_201384chr87784 775 742 636 287 275 209 ------
NM_201428chr1171375 1369 1301 1198 1036 493 143 ------
NM_201429chr1171375 1369 1301 1198 1036 493 143 ------
NM_201430chr1161301 1295 1227 1124 419 69 ------
NM_201432chr17156220 6137 5618 5495 4985 2479 2129 1486 1265 836 658 641 514 343 243 23993 173 1683 15953
NM_201433chr17156220 6137 5618 5495 4985 2479 2129 1486 1265 836 658 641 514 343 243 23993 173 1683 15953
NM_201437chr81997 ------
NM_201520chr1761805 1385 1275 489 322 79 ----1565
NM_201567chr331320 311 42 11291 ----
NM_201568chr151950 1596 1503 726 292 --22013 553 21693 35
NM_201569chr151950 1596 1503 726 292 --22013 553 21693 35
NM_201574chr23252 181 60 ------
NM_201624chr12335 120 ------
NM_201628chr1123351 3104 2943 2577 2359 1294 1257 1112 291 272 157 66 ----1804
NM_201632chr561201 1191 609 585 395 55 140 ----
NM_201634chr591300 1290 1242 708 684 494 154 108 69 1139 176 --
NM_201995chr112633 492 ----140
NM_201998chr113698 557 22 ----1105
NM_203303chrX2224 199 ------
NM_203304chr192211 172 ------
NM_203316chr112384 74 ------
NM_203327chr2084142 4080 3918 3445 1694 1008 978 113 12795 13656 --
NM_203342chr1103603 2939 2776 2421 1413 1272 1148 802 761 40 --12763 --
NM_203343chr1103603 2939 2776 2421 1413 1272 1148 802 761 40 --12763 --
NM_203344chr192125 32 --1549 --
NM_203349chr1531591 829 43 --1632 --
NM_203350chr161518 1484 1407 577 519 194 ------
NM_203351chr17122229 1972 1948 1884 1846 1799 1601 1010 533 289 224 185 ------
NM_203364chr11----11173 --
NM_203372chr2193 21087 101 ----
NM_203394chr1222374 1781 --12049 --
NM_203399chr14830 648 596 29 --1585 --
NM_203401chr14830 648 596 29 --1585 --
NM_203406chr522473 2424 ------
NM_203446chr2122586 631 ------
NM_203454chr121033 908 11317 ----
NM_203458chr152702 2480 2349 666 192 23857 1401 ----
NM_203504chr411681 ----1742
NM_203505chr411681 ----1742
NM_203506chr1762048 1919 1713 1453 790 739 11427 ----
NM_205768chr121653 1351 ------
NM_205833chrX1828 --157 --
NM_205848chr162306 2247 1971 779 753 505 --12410 --
NM_205860chr172545 737 577 507 426 235 101 12557 --1801
NM_205861chr192105 2051 1915 1710 1568 1321 745 718 51 --11761 --
NM_206594chr173524 1419 1204 1177 302 197 25 1164 ----
NM_206595chr173524 1419 1204 1177 302 197 25 1164 ----
NM_206853chr634052 1119 32 ------
NM_206855chr676278 4529 2258 311 303 286 280 ------
NM_206866chr2112760 12290 1743 --
NM_206873chr112286 25 ------
NM_206876chr212980 --1561 --
NM_206907chr553386 3189 3106 2943 606 1792 ----
NM_206909chr8108150 7961 7035 6991 6618 5711 3004 2689 526 491 ------
NM_206914chr123901 868 282 --1208 --
NM_206927chr112605 281 ------
NM_206928chr112605 281 ------
NM_206929chr112605 281 ------
NM_206930chr112605 281 ------
NM_206944chr92556 44 --1342 --
NM_206945chr92556 44 --1342 --
NM_206946chr92556 44 --1342 --
NM_206947chr92556 44 --1342 --
NM_206967chr16138 ------
NM_206996chr13349 296 88 132 ----
NM_207012chr1063105 2949 2830 2290 978 945 --41348 939 588 581 --
NM_207015chr31716 12049 ----
NM_207042chr13491 158 50 ------
NM_207043chr161958 1885 796 735 550 322 1871 11877 --
NM_207044chr161958 1885 796 735 550 322 1871 11877 --
NM_207045chr13491 158 50 ------
NM_207046chr13491 158 50 ------
NM_207047chr161958 1885 796 735 550 322 1871 11877 --
NM_207113chr741033 628 93 69 ------
NM_207170chr1------1727
NM_207291chr191419 --1548 --
NM_207292chr333391 2717 2699 12603 ----
NM_207293chr333391 2717 2699 12603 ----
NM_207294chr333391 2717 2699 12603 ----
NM_207295chr333391 2717 2699 12603 ----
NM_207296chr333391 2717 2699 12603 ----
NM_207297chr333416 2742 2724 12628 ----
NM_207303chr1033074 1537 825 ----1392
NM_207317chr52320 80 ------
NM_207343chr112472 209 ------
NM_207366chr731945 828 429 --130 --
NM_207371chr101981 ------
NM_207396chr15592 339 248 203 77 ------
NM_207406chr485280 5254 4860 4266 4112 2356 2260 1025 26514 2423 32159 2106 1913 15650
NM_207445chr152362 178 12111 ----
NM_207467chr121346 530 --11189 --
NM_207518chr1991306 1270 1232 1114 892 423 402 199 95 11243 ----
NM_212464chr1591954 1936 1709 1689 807 750 645 154 48 --11580 --
NM_212467chr1572531 2513 2286 2266 592 478 146 --32157 490 332 --
NM_212533chr9134 ------
NM_212551chr131019 755 344 ------
NM_212558chr944098 3901 2625 56 13814 ----
NM_213589chr274717 4141 2239 1796 1640 1036 929 ------
NM_213609chr3----11091 --
NM_213648chr561201 1191 609 585 395 55 140 ----
NM_213662chr17102297 1967 1865 1707 1513 939 846 790 595 90 ------