TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3677-3p
miRNA Sequence: CUCGUGGGCUCUGGCCACGGCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX46253 6086 1689 207 1930 11136 --
NM_000208chr1944479 3093 1830 627 --189 --
NM_000222chr422084 58 2529 233 11998 --
NM_000248chr332269 2262 1930 ----11058
NM_000332chr646157 856 511 183 14898 16001 --
NM_000536chr11------1528
NM_000599chr263596 3165 2999 1379 1231 833 --23407 3250 --
NM_000633chr1854498 2037 1315 1205 667 185 ----
NM_000719chr1286472 6148 5259 5111 4524 4347 2115 311 1924 ----
NM_000814chr152671 224 --11303 13958
NM_000875chr1565879 5516 2721 2093 944 137 21441 1179 --11863
NM_001001924chr821777 775 --11358 --
NM_001001925chr821777 775 --11358 --
NM_001001931chr821777 775 --11358 --
NM_001003407chr1042027 1003 927 149 --24567 1435 --
NM_001003408chr1042027 1003 927 149 --24567 1435 --
NM_001003712chr1221588 1451 23712 1076 13594 --
NM_001004304chr1242953 2550 733 90 ----22641 803
NM_001005463chr1012437 ----11052
NM_001005473chr535049 4036 340 34878 1254 25 ----
NM_001005502chr1255196 5106 4966 729 111 ------
NM_001008408chr755695 5421 2502 1782 149 --25786 1283 --
NM_001009554chr4--14293 --1859
NM_001009554chr4--14293 --1859
NM_001010867chr176398 4381 2133 1079 621 585 167 14700 ----
NM_001010888chrX44123 2844 1437 281 ------
NM_001010986chrX21003 515 ----1269
NM_001012614chr4--1583 --1246
NM_001012755chrX54855 4620 4519 1011 630 11001 ----
NM_001014283chr1331437 629 522 2805 116 11374 --
NM_001014797chr1087610 7296 7068 5225 5020 2170 1675 967 --36252 2330 44 --
NM_001017995chr5104457 4047 3401 2965 1224 699 417 140 88 53 ------
NM_001024647chr1223029 141 25513 2253 --17699
NM_001024808chr1262323 2301 2263 1909 1092 1013 ------
NM_001024956chr1165527 5201 1835 1640 688 356 --15052 --
NM_001025076chr1045256 4297 1612 1325 25974 2143 14351 --
NM_001025077chr1046614 5655 2970 2683 17332 25709 57 --
NM_001025266chr341409 578 440 35 1748 ----
NM_001029858chr623214 1343 ----13069
NM_001033117chr354765 1605 168 74 47 ----1191
NM_001033578chr82612 470 --11470 --
NM_001033602chr1352451 2405 2232 1771 1679 --1785 --
NM_001034954chr1022751 2361 --1671 --
NM_001034955chr1022751 2361 --1671 --
NM_001034956chr1022751 2361 --1671 --
NM_001034957chr1022751 2361 --1671 --
NM_001039840chrX35668 4599 835 12127 ----
NM_001040151chr1123385 57 13468 --13244
NM_001040152chr721961 126 2266 164 1274 --
NM_001040153chr132348 209 ------
NM_001040402chr4--1441 --13225
NM_001042555chr1233937 3805 591 11337 ----
NM_001042599chr236792 4842 397 16568 --15743
NM_001042681chr132563 946 381 --1399 --
NM_001042682chr132563 946 381 --1399 --
NM_001042682chr132563 946 381 --1399 --
NM_001094chr176652 643 567 540 345 317 ------
NM_001099678chr334751 1041 182 ------
NM_001100108chr167559 6784 5844 5473 5428 145 --15926 --
NM_001116chr1652808 1168 577 469 380 12327 32088 1131 388 --
NM_001167chrX46029 5758 5626 2543 ----14426
NM_001174chrX52337 1814 786 727 583 --3656 616 532 1839
NM_001204chr234884 4840 1972 --11191 --
NM_001278chr101278 ----177
NM_001328chr4--1583 --1246
NM_001412chrX1344 ----12883
NM_001420chr1952978 2882 995 820 131 --22375 779 21240 113
NM_001616chr232835 836 603 ----12851
NM_001626chr1952560 1293 1278 1027 912 ------
NM_001874chr1255196 5106 4966 729 111 ------
NM_002035chr1843188 3143 865 665 ------
NM_002313chr1042027 1003 927 149 --24567 1435 --
NM_002334chr1141992 1806 1493 203 1230 ----
NM_002384chr182786 145 --2126 106 --
NM_002387chr5274 31 --13454 --
NM_002522chr1752694 2549 2436 1254 1190 ------
NM_002588chr561729 1631 1598 593 349 244 ------
NM_002595chr1211445 ----1418
NM_002645chr1123136 955 --1999 --
NM_002657chr2063509 3455 2775 1553 1018 855 ----178
NM_002837chr1214441 --12993 1462
NM_002855chr1162882 2697 1412 841 213 166 ------
NM_002959chr134293 4094 3211 --14323 14178
NM_003099chr1524036 2227 1356 35419 2084 130 --
NM_003106chr32208 196 2863 345 ----
NM_003161chr1732398 1429 959 --13164 --
NM_003189chr123360 2197 --12821 12856
NM_003194chr6------1377
NM_003200chr1952039 1922 1592 1540 274 ----11468
NM_003221chr623944 298 ----13566
NM_003236chr241353 1064 524 220 11094 ----
NM_003369chr1132261 1987 906 12733 ----
NM_003406chr83775 461 142 ------
NM_003629chr142978 2944 2786 63 --22557 2499 1446
NM_003644chr1785677 4638 2638 1751 1453 916 244 67 --1685 --
NM_003735chr561729 1631 1598 593 349 244 ------
NM_003736chr561729 1631 1598 593 349 244 ------
NM_003966chr556643 4865 2479 1076 69 --160 --
NM_004229chrX------12008
NM_004273chr1064821 4600 1574 1090 826 92 ------
NM_004321chr263489 3463 3261 2298 1164 135 13274 22259 106 --
NM_004342chr72233 140 11772 ----
NM_004393chr32805 708 2847 325 21511 823 --
NM_004580chr1531851 618 39 ----1134
NM_004586chrX44632 4508 1498 675 15388 ----
NM_004598chr533246 2504 2066 12761 ----
NM_004719chr1232809 787 565 1458 --12280
NM_004745chr896583 6499 5991 5118 4617 4584 4482 126 117 22639 171 26677 2769 1675
NM_004845chrX53353 3249 3114 1014 664 1562 ----
NM_004911chr73599 68 53 1174 ----
NM_004976chr1173974 3770 3180 1969 1463 1256 1108 ------
NM_004992chrX96922 6797 6625 5950 3383 3111 2691 2167 347 12184 26184 2884 11158
NM_004992chrX96922 6797 6625 5950 3383 3111 2691 2167 347 12184 26184 2884 11158
NM_005063chr1043071 2719 931 611 23716 3580 ----
NM_005065chr1421883 872 15002 ----
NM_005116chr2054195 4143 4033 3506 433 11126 ----
NM_005188chr1148322 7074 1258 237 --16952 --
NM_005235chr236792 4842 397 16568 --15743
NM_005358chr13------1278
NM_005399chr143509 3385 2910 1588 11269 ----
NM_005730chr1233389 2882 921 21343 266 12245 --
NM_005789chr1711592 ----21967 1425
NM_005868chr721712 333 ----12264
NM_005910chr1743807 2630 964 535 23503 1391 34002 3954 1129 --
NM_005933chr112761 212 --12053 12435
NM_005955chr123759 1769 ----14324
NM_006037chr264111 3582 3276 3268 814 140 ------
NM_006080chr732807 2383 160 1664 ----
NM_006166chr1242622 2560 1797 1786 ------
NM_006282chr2054208 1556 1453 973 405 ------
NM_006306chrX35885 5431 4334 45649 5415 5382 3820 15665 14325
NM_006361chr1781941 1658 1635 1357 1324 298 276 197 ------
NM_006434chr1022751 2361 --1671 --
NM_006538chr253773 3554 1103 1019 402 ----12945
NM_006546chr1795128 5098 4907 1536 1359 1089 1032 1012 675 11240 ----
NM_006561chr1045256 4297 1612 1325 25974 2143 14351 --
NM_006599chr1622479 65 13208 --11048
NM_006654chr1233937 3805 591 11337 ----
NM_006720chr1042027 1003 927 149 --24567 1435 --
NM_006722chr332269 2262 1930 ----11058
NM_006769chr13585 467 65 1205 ----
NM_006918chr1165527 5201 1835 1640 688 356 --15052 --
NM_006924chr1724080 32 24436 1138 ----
NM_006931chr1251723 1333 579 137 127 ------
NM_007030chr564980 4549 3561 3338 1664 504 --13174 --
NM_007033chr172153 1728 713 583 274 223 24 ------
NM_007050chr2097544 7328 7273 6669 5738 3242 1984 1442 145 27783 2504 36886 2699 2538 --
NM_007249chr1378651 8103 7968 7036 6166 2824 1054 26407 2309 1113 --
NM_012089chr1------11222
NM_012102chr132563 946 381 --1399 --
NM_012158chr13------1156
NM_012161chr4------1811
NM_012214chr266376 5322 4238 3988 1320 1275 1916 12019 12428
NM_012218chr1952963 2673 2390 1989 120 --12102 --
NM_012219chr362694 2572 2290 2112 2100 255 1374 12802 12383
NM_012288chr665023 4915 1919 1186 1060 292 --25235 5187 --
NM_012334chr534636 4303 4091 --13942 --
NM_012384chr2091799 1683 1515 975 898 414 404 211 151 ------
NM_012420chr1021546 336 ------
NM_012479chr721771 1693 --2124 64 --
NM_013257chr82612 470 --11470 --
NM_013450chr221166 1016 ------
NM_014048chr1635099 1096 820 --11056 --
NM_014056chr321715 709 ------
NM_014231chr1252054 1967 1465 709 378 11497 --1338
NM_014488chr113483 246 53 1723 1570 --
NM_014747chr154136 3612 1309 268 57 --14924 --
NM_014751chr822178 812 1342 1772 --
NM_014757chr551971 1648 871 754 94 ------
NM_014779chr33809 325 309 ------
NM_014838chr2262029 814 792 560 520 150 --31774 1136 86 --
NM_014850chr354765 1605 168 74 47 ----1191
NM_014868chr122276 61 ----1659
NM_014901chr552328 2030 1549 1477 460 1231 ----
NM_014934chr1353819 3242 2613 1507 76 13623 ----
NM_014945chr53420 144 110 ----1474
NM_015052chr741022 1004 409 111 ------
NM_015064chr1253416 2639 2539 425 121 --1966 --
NM_015071chr541073 714 168 45 ----16079
NM_015094chr2274041 3092 2909 1442 352 248 52 ------
NM_015115chr4--1441 --13225
NM_015191chr1142547 2164 1751 1022 ------
NM_015205chr13144222 4172 3948 1930 1578 1567 1321 1313 1268 1244 1157 1136 556 497 1107 ----
NM_015233chr1352451 2405 2232 1771 1679 --1785 --
NM_015252chr2------1804
NM_015310chr853172 2928 1919 1733 1072 ------
NM_015385chr1022751 2361 --1671 --
NM_015564chr522206 401 11142 ----
NM_015844chr182786 145 --2126 106 --
NM_015846chr182786 145 --2126 106 --
NM_015847chr182786 145 --2126 106 --
NM_015855chr115882 556 277 168 154 ----1745
NM_015906chr113486 13532 --1797
NM_015995chr1544904 4479 704 270 1103 13566 14520
NM_016083chr631562 300 132 13982 1579 --
NM_016356chr61498 12767 --1121
NM_016834chr1743807 2630 964 535 23503 1391 34002 3954 1129 --
NM_016835chr1743807 2630 964 535 23503 1391 34002 3954 1129 --
NM_016841chr1743807 2630 964 535 23503 1391 34002 3954 1129 --
NM_017420chr1432887 2672 2539 --12704 --
NM_017637chr933545 3354 47 18742 1397 --
NM_017643chr1712583 ----1818
NM_017754chr674799 4395 4341 3305 1874 1829 460 ------
NM_017813chr845420 5028 1377 1311 --1697 --
NM_017849chr263078 2200 2015 888 543 248 12155 ----
NM_017873chr952858 2464 1985 659 238 ----12239
NM_018243chr443520 3467 432 395 21618 197 ----
NM_018400chr1123385 57 13468 --13244
NM_018566chr124420 3264 24400 3186 ----
NM_018689chr1542216 1022 710 404 12652 12002 --
NM_018712chr1141447 1384 549 80 ------
NM_018912chr561729 1631 1598 593 349 244 ------
NM_018913chr561729 1631 1598 593 349 244 ------
NM_018914chr561729 1631 1598 593 349 244 ------
NM_018915chr561729 1631 1598 593 349 244 ------
NM_018916chr561729 1631 1598 593 349 244 ------
NM_018917chr561729 1631 1598 593 349 244 ------
NM_018918chr561729 1631 1598 593 349 244 ------
NM_018919chr561729 1631 1598 593 349 244 ------
NM_018920chr561729 1631 1598 593 349 244 ------
NM_018921chr561729 1631 1598 593 349 244 ------
NM_018922chr561729 1631 1598 593 349 244 ------
NM_018923chr561729 1631 1598 593 349 244 ------
NM_018924chr561729 1631 1598 593 349 244 ------
NM_018925chr561729 1631 1598 593 349 244 ------
NM_018926chr561729 1631 1598 593 349 244 ------
NM_018927chr561729 1631 1598 593 349 244 ------
NM_018928chr561729 1631 1598 593 349 244 ------
NM_018929chr561729 1631 1598 593 349 244 ------
NM_018945chr662791 1377 1042 822 783 77 --22568 248 --
NM_018962chr21146 ----11291
NM_018977chrX11031 ----1271
NM_019027chr421688 196 ------
NM_020127chr131655 1530 506 ------
NM_020148chr183469 417 33 12813 1349 --
NM_020150chr101202 ----22149 2058
NM_020211chr1551491 1454 622 201 51 --173 --
NM_020338chr1063736 3185 2297 247 215 112 ------
NM_020416chr462038 1040 998 856 429 66 ------
NM_020429chr752418 2311 2039 908 301 --13139 --
NM_020443chr175432 4965 2211 2155 2140 1882 929 12640 ----
NM_020749chr821777 775 --11358 --
NM_020761chr1791891 1828 1556 1292 795 409 264 257 29 --11286 --
NM_020796chr532946 2546 2087 ----1163
NM_020813chr1951077 623 408 367 352 ----22199 264
NM_020830chr22176 64 ----22720 252
NM_020841chr1221588 1451 23712 1076 13594 --
NM_020850chr1643017 2888 2695 2381 --12199 --
NM_020872chr311715 ----1669
NM_020993chr1262323 2301 2263 1909 1092 1013 ------
NM_021120chrX22859 81 ----13194
NM_021155chr1952776 2109 1859 955 479 --1691 --
NM_021180chr13786 197 61 --128 --
NM_021638chr463273 1652 840 528 358 121 ------
NM_021647chr4--14293 --1859
NM_021912chr152671 224 --11303 13958
NM_021961chr1136860 6448 5586 --17324 --
NM_021964chr31868 25676 1336 ----
NM_022114chr154341 3451 1098 1003 349 23798 51 13518 11614
NM_022166chr16124871 4610 4565 4209 4092 2106 1416 1276 922 881 652 483 1929 ----
NM_022456chr1223029 141 25513 2253 --17699
NM_022458chr742854 868 70 55 1149 ----
NM_022648chr254187 3329 3134 1430 668 ----163
NM_022748chr752384 2069 639 329 280 12624 22212 119 --
NM_022781chr912186 1803 --11069
NM_022824chr511690 ----1692
NM_024052chr1752565 2071 1201 1100 111 ------
NM_024408chr12428 364 ----1558
NM_024557chr11------11302
NM_024563chr531781 641 283 ------
NM_024607chr852824 1011 481 246 107 ------
NM_024761chr964763 1897 1637 1139 1071 269 ------
NM_024942chr1031281 1262 1178 11304 1217 --
NM_024947chr322207 255 --11935 --
NM_024989chr222207 1841 25646 533 16700 --
NM_024991chr1022751 2361 --1671 --
NM_025057chr1411068 1480 --1341
NM_025179chr141381 1347 1057 153 --14661 14263
NM_025219chr2021833 136 11912 --1166
NM_031439chr83737 479 191 --1440 --
NM_032088chr561729 1631 1598 593 349 244 ------
NM_032092chr561729 1631 1598 593 349 244 ------
NM_032242chr373080 2867 2837 2706 2211 1117 573 --12971 --
NM_032281chr1952978 2882 995 820 131 --22375 779 21240 113
NM_032403chr561729 1631 1598 593 349 244 ------
NM_033020chr113486 13532 --1797
NM_033138chr72233 140 11772 ----
NM_033139chr72233 140 11772 ----
NM_033140chr72233 140 11772 ----
NM_033157chr72233 140 11772 ----
NM_033181chr631562 300 132 13982 1579 --
NM_033224chr725104 2185 1555 ----
NM_033225chr832885 1944 403 ----1447
NM_033389chr1731785 1020 1006 ------
NM_033535chr4------1811
NM_033631chr143027 1378 1000 946 ----169
NM_053016chr957280 5952 2929 983 53 --11089 --
NM_053043chr755695 5421 2502 1782 149 --25786 1283 --
NM_053064chr1431074 1051 86 ----11942
NM_080867chr1423870 3520 --11964 --
NM_133170chr2097544 7328 7273 6669 5738 3242 1984 1442 145 27783 2504 36886 2699 2538 --
NM_138415chr2251471 1402 1329 513 311 --11492 130
NM_138621chr253773 3554 1103 1019 402 ----12945
NM_138713chr1622479 65 13208 --11048
NM_138714chr1622479 65 13208 --11048
NM_138775chr112763 89 1197 ----
NM_144579chr242433 566 303 70 ------
NM_144595chr132348 209 ------
NM_145313chr1051508 1311 1120 1037 256 ------
NM_145690chr83775 461 142 ------
NM_148955chr1524036 2227 1356 35419 2084 130 --
NM_152280chr133450 3427 2336 --1373 12481
NM_152287chr1642263 1905 720 493 1952 22415 451 --
NM_152424chrX43910 3825 3404 267 --13692 --
NM_152754chr7196 ----1897
NM_152787chrX--13694 --1154
NM_152826chr1524036 2227 1356 35419 2084 130 --
NM_153029chr1673321 2745 2653 1624 1457 657 559 23336 451 34121 3969 3842 --
NM_153619chr1531261 752 405 1382 1523 --
NM_170709chr82612 470 --11470 --
NM_171998chrX3684 256 234 21006 372 1962 --
NM_173214chr1622479 65 13208 --11048
NM_173468chr433858 1353 1064 16111 --12351
NM_173476chr1671930 1880 1848 1621 437 374 198 ------
NM_175623chr1223029 141 25513 2253 --17699
NM_175624chr1223124 236 25608 2348 --17794
NM_175625chr1223124 236 25608 2348 --17794
NM_175709chr2252446 2261 907 695 180 --12045 --
NM_175736chr1297809 6878 5268 5256 4746 2776 2123 1074 384 ------
NM_176863chr1711592 ----21967 1425
NM_178037chr1253416 2639 2539 425 121 --1966 --
NM_178038chr1253416 2639 2539 425 121 --1966 --
NM_178526chr196767 694 573 415 159 60 11931 ----
NM_180989chr13------1914
NM_181349chr752418 2311 2039 908 301 --13139 --
NM_181491chr983136 3108 2583 2142 1271 606 592 227 1575 ----
NM_181521chr1645725 5326 1039 187 1787 11206 --
NM_181784chr222168 616 ----1984
NM_181876chr462038 1040 998 856 429 66 ------
NM_182503chr655024 4472 4154 1010 441 ----15139
NM_182920chr331276 1071 1017 --1974 --
NM_183234chr1531851 618 39 ----1134
NM_183235chr1531851 618 39 ----1134
NM_183236chr1531851 618 39 ----1134
NM_183377chr176652 643 567 540 345 317 ------
NM_194247chr233154 949 590 ------
NM_194286chr1286239 6017 4735 2009 1681 1648 893 452 --1797 --
NM_194328chr912186 1803 --11069
NM_194329chr912186 1803 --11069
NM_194330chr912186 1803 --11069
NM_194332chr912186 1803 --11069
NM_198158chr332269 2262 1930 ----11058
NM_198159chr332269 2262 1930 ----11058
NM_198173chr13786 197 61 --128 --
NM_198174chr13786 197 61 --128 --
NM_198177chr332269 2262 1930 ----11058
NM_198178chr332269 2262 1930 ----11058
NM_198320chr1255196 5106 4966 729 111 ------
NM_198595chr463273 1652 840 528 358 121 ------
NM_198900chr1297809 6878 5268 5256 4746 2776 2123 1074 384 ------
NM_198968chr1353819 3242 2613 1507 76 13623 ----
NM_199421chr1423870 3520 --11964 --
NM_199454chr154341 3451 1098 1003 349 23798 51 13518 11614
NM_201432chr1785677 4638 2638 1751 1453 916 244 67 --1685 --
NM_201433chr1785677 4638 2638 1751 1453 916 244 67 --1685 --
NM_203327chr2054195 4143 4033 3506 433 11126 ----
NM_206909chr853172 2928 1919 1733 1072 ------
NM_207406chr455976 5628 5562 1773 364 --12503 --
NM_212464chr1521335 260 --2801 174 --
NM_212467chr1521912 944 --1148 1344