TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3677-5p
miRNA Sequence: CAGUGGCCAGAGCCCUGCAGUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51159 ------
NM_000038chr51582 ------
NM_000046chr553040 2816 2262 670 642 --1739 12035
NM_000068chr1971049 501 289 275 216 98 61 --1302 1441
NM_000075chr12141 ------
NM_000081chr121631 1398 ------
NM_000084chrX136946 5581 5185 5025 4738 4471 2797 2724 2718 2393 2107 1628 390 ----16261
NM_000089chr7158 ------
NM_000092chr244535 4316 4055 3988 ------
NM_000104chr212158 --1373 --
NM_000108chr721676 226 11685 ----
NM_000109chrX21728 338 ------
NM_000111chr71319 1282 ----
NM_000125chr633023 2930 335 22628 1344 33313 3300 139 11053
NM_000129chr62965 299 ----11123
NM_000135chr164663 396 311 161 --1212 --
NM_000138chr1511741 12607 2965 281 11863
NM_000151chr17--21789 1339 ----
NM_000161chr1411398 2773 124 ----
NM_000163chr522291 2090 12302 ----
NM_000167chrX21743 119 ------
NM_000176chr543902 2986 2792 1222 --13265 --
NM_000183chr2159 ------
NM_000188chr101222 ------
NM_000194chrX186 ------
NM_000210chr242009 1645 628 179 ------
NM_000212chr1722478 1675 12300 2700 373 --
NM_000216chrX160 --11622 --
NM_000217chr1235330 3503 1861 1727 24591 2010 --
NM_000222chr431392 526 22 ------
NM_000232chr411257 ------
NM_000240chrX22241 89 ------
NM_000245chr762168 1552 1433 784 201 75 --1406 --
NM_000252chrX11431 ------
NM_000259chr15105905 4867 4697 4686 4662 4620 4224 2505 2302 1212 45734 3867 1479 548 ----
NM_000264chr921014 271 ------
NM_000267chr1722735 354 1332 ----
NM_000282chr13144 ------
NM_000289chr121251 --1393 --
NM_000297chr41762 ----11813
NM_000310chr1--11225 ----
NM_000314chr101641 --1635 --
NM_000318chr842062 733 721 114 12690 --12550
NM_000321chr133229 170 97 11620 ----
NM_000332chr635619 5505 1042 --24573 1669 --
NM_000333chr321136 331 --1445 --
NM_000334chr173742 681 139 --2626 403 --
NM_000337chr5106205 6020 5531 4447 2089 1842 1610 1335 795 609 26339 1138 11975 12156
NM_000340chr3------11199
NM_000345chr41681 ------
NM_000361chr201205 --1704 --
NM_000362chr2253209 2852 2762 2572 537 13229 ----
NM_000405chr511382 1383 ----
NM_000408chr22758 194 ----13107
NM_000430chr1753401 2649 1359 495 248 --12670 --
NM_000444chrX1310 --1252 --
NM_000451chrX31956 418 104 ------
NM_000461chr324260 1213 11549 ----
NM_000462chr151463 ------
NM_000480chr111592 --1462 --
NM_000489chrX42955 2771 2471 711 ------
NM_000495chrX1710 2397 116 ----
NM_000503chr821621 1356 ------
NM_000522chr721315 426 --1392 --
NM_000523chr22340 38 ------
NM_000531chrX1141 1318 ----
NM_000539chr321304 564 ----11424
NM_000546chr17163 ------
NM_000555chrX46471 5492 3094 1108 26718 2923 57219 6749 2451 1596 186 --
NM_000572chr11780 ------
NM_000594chr61710 ------
NM_000595chr6----1108 --
NM_000599chr244115 1846 1766 86 --12871 --
NM_000609chr105901 552 480 284 211 ----1244
NM_000610chr1132002 987 89 11904 12268 11885
NM_000618chr1256354 6005 2341 1253 374 --16383 --
NM_000618chr1256354 6005 2341 1253 374 --16383 --
NM_000621chr1311427 1498 1941 --
NM_000633chr1885163 3799 3258 1991 1497 1410 1313 943 15218 11998 --
NM_000668chr41277 --1393 --
NM_000681chr101252 1853 2933 220 --
NM_000682chr22677 49 --1381 --
NM_000684chr101936 ------
NM_000689chr9--159 ----
NM_000720chr31451 ------
NM_000724chr1022029 271 ------
NM_000739chr72632 91 1659 ----
NM_000756chr83352 311 94 ------
NM_000792chr14994 941 382 167 ------
NM_000793chr1474644 4420 3492 3240 772 473 370 14511 24275 1250 --
NM_000800chr511605 ------
NM_000807chr41210 ------
NM_000811chr52525 309 ------
NM_000813chr555085 5034 3898 2259 1556 14871 --12010
NM_000814chr1543378 1351 627 508 13750 13671 --
NM_000817chr2----193 --
NM_000818chr101212 --1197 --
NM_000824chr42352 119 ------
NM_000826chr4--1447 ----
NM_000827chr542174 1609 791 303 ------
NM_000828chrX32014 1890 329 11981 ----
NM_000829chr1111771 11672 21683 877 --
NM_000831chr194112 4063 3833 2508 1618 1302 751 668 368 --26080 5002 --
NM_000838chr61380 32399 1085 140 ----
NM_000841chr63585 221 70 ------
NM_000844chr31201 ------
NM_000855chr11156 ------
NM_000870chr52479 294 --1361 --
NM_000873chr17122 --138 --
NM_000875chr15106441 6050 6020 5563 4493 1571 1211 895 741 545 --26247 4774 --
NM_000877chr252924 1207 1118 682 127 --1469 --
NM_000891chr1743573 3356 2298 113 13177 ----
NM_000899chr121510 ------
NM_000912chr822676 2313 12373 ----
NM_000919chr51202 ------
NM_000926chr1177808 6254 3054 2743 2362 1176 815 38961 7477 3187 ----
NM_000935chr311167 ------
NM_000944chr41506 11978 --11905
NM_000945chr23802 784 717 ------
NM_000950chrX21162 597 --12455 --
NM_000963chr121725 802 1167 ----
NM_000964chr171381 ------
NM_000965chr31216 1887 ----
NM_000966chr122693 324 ------
NM_000981chr17--156 ----
NM_001001323chr1213141 22298 2026 ----
NM_001001331chr311951 1975 ----
NM_001001389chr1132002 987 89 11904 12268 11885
NM_001001390chr1132002 987 89 11904 12268 11885
NM_001001391chr1132002 987 89 11904 12268 11885
NM_001001392chr1132048 1033 135 11950 12314 11931
NM_001001395chr1232270 722 259 1592 12459 --
NM_001001396chr143813 1432 653 544 --1187 --
NM_001001433chr2062897 2575 2240 2137 1079 975 --1962 --
NM_001001436chr162798 105 ------
NM_001001481chr822606 399 23490 1193 12735 --
NM_001001484chr1052316 2116 1996 1811 776 ------
NM_001001485chr3133 ------
NM_001001522chr111127 ------
NM_001001549chr721117 646 --1291 --
NM_001001550chr721117 646 --1291 --
NM_001001555chr721117 646 --1291 --
NM_001001557chr82526 230 ------
NM_001001664chr221532 1188 ------
NM_001001669chr562378 2090 742 357 275 252 12220 ----
NM_001001787chr11338 ------
NM_001001870chr171787 ------
NM_001001890chr2174162 3954 3681 2695 1569 112 37 11555 11047 --
NM_001001924chr821824 1755 ------
NM_001001925chr821824 1755 ------
NM_001001931chr821824 1755 ------
NM_001001974chr1021573 697 1874 ----
NM_001001994chrX1552 ------
NM_001001995chrX1214 ------
NM_001001996chrX1552 ------
NM_001002032chr17190 ------
NM_001002295chr1041050 457 214 143 ------
NM_001002814chr853777 2814 1251 1180 219 13013 ----
NM_001002843chr151116 ------
NM_001002860chr1443429 2855 1158 1003 13240 14079 --
NM_001002909chr17--174 11790 --
NM_001002914chr1731112 1014 980 ------
NM_001002919chr21213 ------
NM_001003652chr18108713 6348 5854 5716 5380 3468 3363 2971 1311 1215 17233 ----
NM_001003712chr12--13408 23948 3813 --
NM_001003786chr173674 75 47 ------
NM_001003787chr173674 75 47 ------
NM_001003788chr173674 75 47 ------
NM_001003790chr81297 ------
NM_001003791chr81297 ------
NM_001003792chr31434 ------
NM_001003793chr31434 ------
NM_001003794chr333016 2087 898 1759 12423 --
NM_001003810chr4--1597 ----
NM_001003845chr2------1567
NM_001004023chr11193 ------
NM_001004304chr1262940 2659 2291 1146 867 855 ------
NM_001004360chr22339 115 ------
NM_001004419chr1224464 775 13499 14285 --
NM_001005271chr171108 ------
NM_001005273chr171108 ------
NM_001005291chr173472 194 41 ------
NM_001005335chr19161 ------
NM_001005353chr131250 490 198 ------
NM_001005353chr131250 490 198 ------
NM_001005375chrY11440 ------
NM_001005404chr1732877 453 43 11459 14379 --
NM_001005417chr11264 ------
NM_001005463chr1042337 2278 691 314 --1804 --
NM_001005473chr516556 --14095 --
NM_001005476chr22703 510 ------
NM_001005505chr31285 --11688 --
NM_001005739chr21759 ------
NM_001005743chr14--1850 1385 --
NM_001005744chr14--1850 1385 --
NM_001005745chr14--1850 1385 --
NM_001005782chr22961 250 ------
NM_001005920chr163409 328 29 ------
NM_001006600chr53748 730 247 ------
NM_001006617chr921050 574 ------
NM_001006619chr921050 574 ------
NM_001006620chr921050 574 ------
NM_001006621chr921050 574 ------
NM_001006624chr141983 1872 1749 675 ------
NM_001006626chr72632 91 1659 ----
NM_001006627chr72632 91 1659 ----
NM_001006628chr72632 91 1659 ----
NM_001006629chr72632 91 1659 ----
NM_001006630chr72632 91 1659 ----
NM_001006631chr72632 91 1659 ----
NM_001006632chr72632 91 1659 ----
NM_001006634chr162669 172 ------
NM_001006935chrX128 ------
NM_001006936chrX128 ------
NM_001006937chrX128 ------
NM_001006944chr112618 582 --1669 --
NM_001006946chr241594 1287 101 34 --21738 445 --
NM_001007023chr1474644 4420 3492 3240 772 473 370 14511 24275 1250 --
NM_001007067chr83957 811 286 ------
NM_001007068chr83957 811 286 ------
NM_001007069chr83957 811 286 ------
NM_001007070chr83957 811 286 ------
NM_001007156chr1521878 322 1254 ----
NM_001007237chr131906 1777 30 1224 12472 --
NM_001007257chr121019 443 ------
NM_001007267chr22786 127 ------
NM_001007271chr106802 741 707 195 153 45 ------
NM_001007277chr111437 1862 3937 120 110 --
NM_001007544chr1170 ------
NM_001007553chr111023 ------
NM_001008222chrX21216 507 --1332 --
NM_001008239chr1853538 2796 2778 879 175 --13493 --
NM_001008388chr42884 149 ------
NM_001008392chr362618 1054 822 790 132 115 --11173 --
NM_001008407chr72438 396 ------
NM_001008408chr755665 5439 1791 1119 611 14338 32174 905 109 --
NM_001008541chr1022167 729 ------
NM_001008541chr1022167 729 ------
NM_001008564chr1322162 675 ------
NM_001008567chr92241 44 --1273 --
NM_001008707chr142319 133 --21537 68 --
NM_001008711chr821707 1365 --2138 29 --
NM_001008728chr1131 ------
NM_001008738chr522459 2087 --11789 --
NM_001008777chr17261 35 ------
NM_001008801chr1931744 1435 1336 --11388 --
NM_001008938chr11----1409 --
NM_001009554chr453861 1635 866 516 127 181 ----
NM_001009554chr453861 1635 866 516 127 181 ----
NM_001009571chr711223 ------
NM_001009880chr2284149 3550 3366 3225 3046 2975 1446 296 --1131 --
NM_001009881chr11460 ------
NM_001009882chr11460 ------
NM_001009899chr345889 4803 4282 378 12126 12001 --
NM_001009993chr254221 4008 3517 2957 2869 ------
NM_001010854chr143739 128 29 ------
NM_001010867chr1116374 6136 5887 5544 4605 4534 2431 2215 1206 1158 1134 1574 ----
NM_001010888chrX43632 919 697 221 ----11089
NM_001010924chr101886 ------
NM_001010934chr7----31022 768 23 --
NM_001010942chr1231285 1016 246 1148 ----
NM_001011537chr332088 1925 415 ------
NM_001011657chrX2413 113 ------
NM_001011666chr756273 5697 4542 1732 1608 --25149 1322 --
NM_001011708chr232389 2310 1067 --12368 --
NM_001011718chr202803 82 ------
NM_001012270chr1741633 1607 659 567 --1709 --
NM_001012271chr1741736 1710 762 670 --1812 --
NM_001012398chr161720 ------
NM_001012420chr1522927 108 ------
NM_001012423chr1522927 108 ------
NM_001012642chr1561817 1401 793 748 379 360 --12032 --
NM_001012755chrX61843 1115 1016 935 895 455 11539 ----
NM_001012977chrX21083 260 --11007 --
NM_001013031chr1031168 553 523 --12718 --
NM_001013620chr1257661 6034 5452 3109 400 26355 5947 23386 2452 --
NM_001013624chr1721043 40 ------
NM_001013659chr1984566 4476 4405 4080 3691 1677 1016 139 14782 ----
NM_001013690chr1221993 72 ------
NM_001013693chr152939 2262 1930 844 773 --22348 136 --
NM_001013693chr152939 2262 1930 844 773 --22348 136 --
NM_001014283chr1311704 ------
NM_001014434chr11159 ------
NM_001014435chr161136 ----2469 27
NM_001014442chr13161 ------
NM_001014794chr111191 ------
NM_001014795chr111191 ------
NM_001014796chr12144 78 ------
NM_001014796chr12144 78 ------
NM_001014797chr10167501 7219 7080 6817 6694 6651 5397 5333 5223 2973 2937 2278 2145 1673 1366 537 ----17089
NM_001014812chr151144 ------
NM_001015045chr43517 511 454 12056 ----
NM_001015877chrX22766 405 11987 ----
NM_001015880chr1011486 --11049 --
NM_001015881chrX4874 423 250 149 133 ----
NM_001015882chr91255 ------
NM_001015887chr321626 1345 ----1153
NM_001017371chr211342 ------
NM_001017392chr1931336 1265 1059 --1363 --
NM_001017395chr322361 710 --1547 --
NM_001017415chr11100 ------
NM_001017416chr11100 ------
NM_001017977chr11354 ------
NM_001017999chr12601 490 ------
NM_001017999chr12601 490 ------
NM_001018000chr12601 490 ------
NM_001018000chr12601 490 ------
NM_001018001chr12601 490 ------
NM_001018004chr151200 ------
NM_001018006chr151200 ------
NM_001018007chr151200 ------
NM_001018020chr151200 ------
NM_001018050chr2283476 3270 3197 1131 1110 568 529 309 ------
NM_001018052chr2283476 3270 3197 1131 1110 568 529 309 ------
NM_001018054chr11987 --1273 --
NM_001018064chr93493 87 78 ------
NM_001018065chr985324 5200 4922 4297 1486 221 128 34 --23883 2344 --
NM_001018066chr985324 5200 4922 4297 1486 221 128 34 --23883 2344 --
NM_001018067chr143955 3720 3685 1922 --24038 949 --
NM_001018068chr143955 3720 3685 1922 --24038 949 --
NM_001018069chr143955 3720 3685 1922 --24038 949 --
NM_001018074chr543902 2986 2792 1222 --13265 --
NM_001018075chr543902 2986 2792 1222 --13265 --
NM_001018076chr543902 2986 2792 1222 --13265 --
NM_001018077chr543902 2986 2792 1222 --13265 --
NM_001018676chr81162 --1342 --
NM_001018677chr81162 --1342 --
NM_001020825chr531377 461 267 ------
NM_001023567chr1522319 108 1520 ----
NM_001024094chr543902 2986 2792 1222 --13265 --
NM_001024226chr12339 107 ------
NM_001024227chr12339 107 ------
NM_001024228chr12339 107 ------
NM_001024401chr1662612 2342 2316 345 255 173 --11839 --
NM_001024455chrX81850 930 476 456 307 258 196 21 --11062 --
NM_001024463chr153443 326 183 1346 ----
NM_001024680chr231796 1725 356 ------
NM_001024808chr1262575 2389 2267 2042 1018 159 12196 ----
NM_001024809chr171381 ------
NM_001024847chr331850 621 24 --1114 --
NM_001024948chr113244 ------
NM_001024959chr33656 189 72 --2695 666 --
NM_001024960chr33656 189 72 --2695 666 --
NM_001025076chr1035135 4957 2114 21933 1702 2562 401 --
NM_001025077chr1056493 6315 5109 1356 237 --31920 1759 198 --
NM_001025079chr343780 3640 619 498 ------
NM_001025081chr1831505 621 147 --1379 --
NM_001025090chr1831505 621 147 --1379 --
NM_001025092chr1831505 621 147 --1379 --
NM_001025101chr1831505 621 147 --1379 --
NM_001025105chr51965 ------
NM_001025107chr132057 1007 278 --12479 --
NM_001025107chr132057 1007 278 --12479 --
NM_001025108chr233797 888 72 ----1998
NM_001025266chr364611 4556 4262 3815 1237 391 --21520 558 --
NM_001025366chr621751 265 11436 ----
NM_001025366chr621751 265 11436 ----
NM_001025367chr621751 265 11436 ----
NM_001025367chr621751 265 11436 ----
NM_001025368chr621751 265 11436 ----
NM_001025368chr621751 265 11436 ----
NM_001025369chr621767 281 11452 ----
NM_001025369chr621767 281 11452 ----
NM_001025370chr621751 265 11436 ----
NM_001025370chr621751 265 11436 ----
NM_001025389chr111592 --1462 --
NM_001025390chr111592 --1462 --
NM_001025579chr17----2370 235 --
NM_001025580chrX31620 812 24 13189 ----
NM_001025596chr11--1528 ----
NM_001025616chr431539 192 88 ------
NM_001025780chr921193 22 ------
NM_001029851chr52570 306 1817 ----
NM_001029852chr52570 306 1817 ----
NM_001029853chr52570 306 1817 ----
NM_001029854chr52570 306 1817 ----
NM_001029858chr6142 --21090 691 --
NM_001029859chr1162385 2111 1787 407 270 202 12356 ----
NM_001029976chr82130 80 --162 --
NM_001029989chr154947 876 352 310 ------
NM_001030001chr14125 ------
NM_001030007chr1633179 850 780 --1220 --
NM_001030019chr7122 ------
NM_001030055chr1423490 502 --1494 --
NM_001030272chr111136 ------
NM_001030273chr111136 ------
NM_001031679chr1283124 2683 2201 1021 914 843 245 158 ------
NM_001031685chr11214 ------
NM_001031690chr743112 1061 695 45 ------
NM_001031695chr2234357 1454 1239 1994 12029 --
NM_001031711chr531439 1142 718 1554 11549 --
NM_001031717chr33198 124 64 1999 1135 --
NM_001031732chr463240 3033 2572 1215 743 530 ----12834
NM_001031740chr171652 1581 1236 674 431 300 56 --1221 --
NM_001031812chr51581 ----11858
NM_001032280chr631259 139 106 ------
NM_001032282chr82184 173 11174 ----
NM_001032296chr1362410 2369 2093 883 548 110 --12681 --
NM_001032363chr142243 2172 1568 88 --1772 --
NM_001032363chr142243 2172 1568 88 --1772 --
NM_001032380chr1031932 1364 412 ------
NM_001032394chr632821 2804 2012 --21925 1890 --
NM_001032395chr632688 2671 1879 --21792 1757 --
NM_001033044chr11745 11557 ----
NM_001033045chr253297 3226 1384 589 518 11586 14409 --
NM_001033047chr42923 524 --11634 --
NM_001033049chr2122030 1579 --3895 834 432 12070
NM_001033056chr11745 11557 ----
NM_001033057chr3----1702 --
NM_001033059chr61229 ------
NM_001033087chr2052785 2453 1042 367 292 ------
NM_001033112chr5192 ------
NM_001033117chr364457 4449 3030 3006 1706 305 13417 21627 1553 --
NM_001033507chr111536 --21654 65 --
NM_001033551chr17103965 3750 3451 3240 3010 1217 1111 898 739 175 --33896 2898 72 --
NM_001033561chr172792 22 ------
NM_001033723chr852715 717 377 58 39 ------
NM_001033756chr621685 199 11370 ----
NM_001033756chr621685 199 11370 ----
NM_001033953chr11126 ------
NM_001034172chr18126 ------
NM_001034845chr41458 ------
NM_001034850chr511371 --11074 --
NM_001034852chr142625 264 1602 ----
NM_001034954chr1063130 2892 1212 624 252 239 11129 1758 --
NM_001034955chr1063130 2892 1212 624 252 239 11129 1758 --
NM_001034956chr1063130 2892 1212 624 252 239 11129 1758 --
NM_001034957chr1063130 2892 1212 624 252 239 11129 1758 --
NM_001035chr11407 --11089 --
NM_001035003chr441252 956 348 199 ------
NM_001035004chr441252 956 348 199 ------
NM_001035254chr922035 435 --1765 --
NM_001035511chr11309 ----1368
NM_001035512chr11416 ----1475
NM_001035513chr11416 ----1475
NM_001037132chr7----12080 --
NM_001037133chr7----12080 --
NM_001037164chr7----11568 --
NM_001037172chr32951 497 ------
NM_001037225chr112111 45 ------
NM_001037339chr131221 661 107 11512 ----
NM_001037340chr131221 661 107 11512 ----
NM_001037341chr131221 661 107 11512 ----
NM_001037341chr131221 661 107 11512 ----
NM_001037553chr21124970 4889 4842 4816 4479 4343 3825 3633 1956 1127 1114 824 ------
NM_001037582chr441740 1326 1305 610 ------
NM_001037872chr2----1655 --
NM_001037954chr1183364 2924 2905 2836 2504 1359 745 141 11222 140 --
NM_001038702chr53991 954 170 12035 ----
NM_001038707chr132160 1976 180 ------
NM_001038707chr132160 1976 180 ------
NM_001039348chr211049 ------
NM_001039349chr211049 ------
NM_001039459chr7----1222 --
NM_001039538chr212889 13029 22818 804 --
NM_001039547chr3118084 7615 7544 7421 7283 6995 2979 2292 2221 1475 1077 36416 3092 2764 25719 2486 --
NM_001039590chrX1490 ------
NM_001039591chrX1490 ------
NM_001039618chr1134848 3638 1400 --11170 --
NM_001039715chr14994 941 382 167 ------
NM_001039716chr141058 1005 446 231 ------
NM_001039762chr1022072 189 12233 ----
NM_001039770chr352403 1767 1588 240 126 ------
NM_001039840chrX44552 1700 1553 726 21049 260 1371 --
NM_001039916chr121929 --1327 --
NM_001039917chr121929 --1327 --
NM_001039918chr121929 --1327 --
NM_001039919chr121929 --1327 --
NM_001039920chr121929 --1327 --
NM_001039937chr1324114 725 --122 --
NM_001039960chr1251724 1650 1582 369 282 ------
NM_001040001chr621828 196 ------
NM_001040057chr74603 165 150 139 ------
NM_001040100chr31834 --1411 --
NM_001040101chr431297 448 32 ------
NM_001040110chr731191 584 527 ------
NM_001040135chr72168 73 ------
NM_001040142chr212263 11639 1263 --
NM_001040143chr212263 11639 1263 --
NM_001040152chr744290 3396 1254 499 1436 21300 1239 --
NM_001040153chr131781 ------
NM_001040159chr4--1262 ----
NM_001040172chr52479 294 --1361 --
NM_001040173chr52479 294 --1361 --
NM_001040181chr3131 ------
NM_001040182chr3131 ------
NM_001040183chr3131 ------
NM_001040199chr3131 ------
NM_001040200chr3131 ------
NM_001040214chr61615 --2452 334 --
NM_001040272chr941544 1531 917 35 ----12123
NM_001040284chr1645308 5074 1569 995 ------
NM_001040402chr431264 841 30 11178 11135 --
NM_001040439chr1641292 1275 1033 430 1979 ----
NM_001040441chr165248 5177 3703 1871 1800 946 --1154 --
NM_001040446chr541727 1102 711 619 --1985 --
NM_001040653chr352258 1932 1830 935 886 --134 12150
NM_001040661chr72775 316 ----11098
NM_001040665chr754612 3056 1819 1215 1120 23532 49 ----
NM_001040697chr11198 ------
NM_001040709chr122201 2180 --12220 --
NM_001040712chr923302 2270 12764 ----
NM_001040876chr431220 185 29 ------
NM_001042404chr11533 ------
NM_001042425chr631259 139 106 ------
NM_001042453chrX------11360
NM_001042476chr1632008 763 183 --11741 --
NM_001042481chr1421838 1015 ------
NM_001042492chr1722735 354 1332 ----
NM_001042493chr61386 2621 176 ----
NM_001042498chrX11003 --1135 --
NM_001042506chrX1260 --11007 --
NM_001042510chr81117 ------
NM_001042511chr81117 ------
NM_001042517chr134982 784 349 302 ------
NM_001042537chrX21773 1634 ------
NM_001042543chr411155 ------
NM_001042555chr1221770 1155 1828 1727 --
NM_001042576chr201416 1482 ----
NM_001042599chr246974 5238 2503 310 ----1789
NM_001042601chr3--22787 263 1715 --
NM_001042604chr334831 3268 3170 ------
NM_001042632chr2021885 200 --1680 --
NM_001042633chr2021885 200 --1680 --
NM_001042669chr431539 192 88 ------
NM_001042683chr61595 ------
NM_001042692chr22566 544 ------
NM_001042728chr122693 324 ------
NM_001042749chrX21269 770 --11262 --
NM_001042750chrX21269 770 --11262 --
NM_001042751chrX21269 770 --11262 --
NM_001044722chr51581 ----11858
NM_001044723chr51581 ----11858
NM_001046chr521951 261 ------
NM_001071775chr1311714 ------
NM_001076778chr342342 2121 1562 485 --125 --
NM_001077628chr12544 119 --1525 --
NM_001083620chr4--1446 ----
NM_001092chr1732285 2230 608 ------
NM_001095chr121636 ------
NM_001096chr172620 123 --1605 --
NM_001106chr358874 8568 7986 7586 1832 12845 49218 3540 2955 725 --
NM_001111chr132057 1007 278 --12479 --
NM_001113490chrX12230 ------
NM_001117chr181469 1129 ----
NM_001122631chr11----1507 --
NM_001122679chr51159 ------
NM_001123chr102222 96 ------
NM_001126chr111035 ------
NM_001128chr1633179 850 780 --1220 --
NM_001146chr811663 11634 ----
NM_001148chr44887 856 760 428 ------
NM_001152chrX2216 167 ------
NM_001167chrX74459 4388 4258 4187 2256 1231 569 16181 15345 --
NM_001172chr143723 686 561 ------
NM_001173chr1423490 502 --1494 --
NM_001174chrX52272 1844 878 704 521 --1238 --
NM_001177chr1231929 1923 728 --12206 --
NM_001178chr111136 ------
NM_001186chr2162359 2063 905 697 675 489 ------
NM_001191chr202504 73 --1515 --
NM_001198chr641844 1826 876 193 --2864 472 --
NM_001204chr287084 6547 5084 4991 1055 887 764 528 37626 7603 5650 12810 --
NM_001206chr91119 11083 ----
NM_001219chr72528 79 1574 ----
NM_001241chr242102 1642 755 206 ------
NM_001241chr242102 1642 755 206 ------
NM_001256chr172132 112 ------
NM_001259chr775870 5849 4418 2064 1477 1287 290 ------
NM_001260chr132238 85 ------
NM_001265chr131229 ------
NM_001270chr51462 --1789 --
NM_001271chr1533168 3058 189 ------
NM_001283chr71538 ------
NM_001290chr41341 ------
NM_001292chr154964 931 454 137 ------
NM_001304chr1723521 236 ------
NM_001310chr1222310 546 --12284 --
NM_001343chr511441 11551 ----
NM_001351chr311658 11165 ----
NM_001356chrX42390 667 155 21 ------
NM_001361chr164661 583 296 149 ------
NM_001396chr2121053 713 --11009 --
NM_001406chr1741567 704 644 204 --11445 --
NM_001407chr321285 631 ------
NM_001408chr141374 1279 1212 180 ------
NM_001416chr173443 328 128 ------
NM_001419chr1964219 4046 3061 754 600 581 12951 23916 3381 --
NM_001420chr1953125 2394 1051 939 785 ------
NM_001427chr721372 448 ------
NM_001428chr13300 39 28 ------
NM_001430chr21142 ------
NM_001432chr443673 3011 1340 661 ------
NM_001438chr132355 1082 822 22708 876 ----
NM_001440chr8102455 2445 2342 2333 2155 1745 879 535 370 272 --12565 --
NM_001448chrX31391 1385 607 11563 1129 --
NM_001449chrX1308 ------
NM_001456chrX4203 111 99 90 ------
NM_001460chr143586 1155 778 80 1233 ----
NM_001461chr11209 ------
NM_001482chr15--1660 --1290
NM_001498chr63935 886 43 ------
NM_001527chr654824 4814 3412 3229 3000 11010 ----
NM_001530chr142751 99 ------
NM_001533chr19161 ------
NM_001542chr131906 1777 30 1224 12472 --
NM_001546chr621425 26 11139 ----
NM_001552chr1731083 910 40 ------
NM_001584chr113244 238 50 ------
NM_001616chr2----1736 --
NM_001634chr61229 ------
NM_001650chr1843673 2966 1550 535 11347 ----
NM_001655chr11194 ------
NM_001656chr5--12029 ----
NM_001658chr12339 107 ------
NM_001663chr1442253 1771 852 89 ------
NM_001664chr32760 738 ------
NM_001670chr222566 65 ------
NM_001677chr12976 31 ------
NM_001678chr1741283 469 248 182 --11260 --
NM_001682chr1212855 12012 ----
NM_001683chr311951 1975 ----
NM_001684chr143530 1149 370 261 ------
NM_001699chr1941840 1763 697 53 ------
NM_001703chr11211 ------
NM_001704chr6------1377
NM_001730chr131481 ------
NM_001730chr131481 ------
NM_001742chr721388 337 ------
NM_001743chr21526 ------
NM_001754chr2174162 3954 3681 2695 1569 112 37 11555 11047 --
NM_001755chr1632271 1720 1408 ------
NM_001759chr1234128 777 418 14751 14875 --
NM_001760chr62741 689 --148 130
NM_001769chr12--1108 ----
NM_001777chr343780 3640 619 498 ------
NM_001796chr16----157 --
NM_001806chr192889 351 --11941 --
NM_001829chr4--1686 ----
NM_001830chrX62665 2623 1407 954 879 242 ------
NM_001831chr821097 921 ------
NM_001842chr91218 ------
NM_001844chr12172 ------
NM_001845chr13139 --11095 --
NM_001854chr111547 ------
NM_001862chr2165 ------
NM_001878chr12119 43 --1132 --
NM_001892chr51965 ------
NM_001895chr201965 11094 1863 --
NM_001918chr1108946 8604 8347 6673 2595 1961 1791 1041 464 144 38082 6558 2033 15913 --
NM_001923chr11189 ------
NM_001927chr24544 203 185 139 ------
NM_001935chr2122 1397 ----
NM_001937chr12892 824 --1326 --
NM_001938chr111330 ------
NM_001939chrX73811 3703 3690 3509 2548 1079 1042 12903 32475 1099 296 --
NM_001945chr551374 1147 1133 887 465 ------
NM_001949chr63830 683 371 ------
NM_001950chr163664 537 147 1309 ----
NM_001951chr81433 ------
NM_001955chr611016 ------
NM_001977chr41675 ------
NM_001980chr1232069 510 22 11446 11689 --
NM_001981chr11856 ------
NM_001992chr552206 1933 1862 828 247 ----1892
NM_001993chr12184 22 ------
NM_001995chr42513 374 ------
NM_002006chr432153 1821 1062 11374 --14835
NM_002010chr13----1213 --
NM_002015chr1343102 2185 968 243 12202 ----
NM_002017chr1121088 924 ------
NM_002024chrX1161 ------
NM_002025chrX48935 8584 2876 588 13186 167 18809
NM_002027chr81162 --1342 --
NM_002028chr1421162 349 11035 11259 --
NM_002040chr2112844 ------
NM_002051chr1041050 457 214 143 ------
NM_002063chrX21161 904 ------
NM_002065chr11745 11557 ----
NM_002070chr37889 872 789 709 232 107 30 ------
NM_002071chr182566 141 ------
NM_002072chr92964 777 ------
NM_002074chr121230 239 ------
NM_002077chr931801 370 203 --11527 --
NM_002086chr1751581 866 796 314 120 --1472 --
NM_002093chr3171 ------
NM_002114chr61165 ------
NM_002126chr1733072 2856 225 --13214 12990
NM_002129chr41435 ------
NM_002130chr51688 --1273 --
NM_002135chr121435 ------
NM_002136chr121472 ------
NM_002137chr71175 ----1812
NM_002138chr4--1597 ----
NM_002139chrX1424 --1558 --
NM_002140chr9----1358 --
NM_002146chr1721328 368 ------
NM_002158chr243419 3374 2962 1165 1773 ----
NM_002165chr201284 --1125 --
NM_002193chr221624 1498 --1387 --
NM_002196chr201866 ------
NM_002196chr201866 ------
NM_002199chr4----1234 --
NM_002202chr51922 ------
NM_002203chr534158 2807 2753 23754 1469 ----
NM_002204chr172996 277 ------
NM_002205chr121789 ------
NM_002207chr32177 164 ------
NM_002210chr213463 12875 ----
NM_002214chr755260 2285 1880 1546 764 1375 1905 --
NM_002222chr31150 ------
NM_002227chr121227 119 --11282 --
NM_002232chr111221 ------
NM_002241chr153093 2988 2072 598 540 11204 1446 --
NM_002245chr13579 121 105 ------
NM_002247chr1022313 42 ------
NM_002250chr192221 68 --129 --
NM_002254chr242182 2011 1555 77 --1258 --
NM_002264chr384983 4381 4035 1916 1456 1254 582 42 14255 ----
NM_002265chr172434 241 ------
NM_002267chr1341986 1638 148 58 2699 170 ----
NM_002268chr331443 303 296 ------
NM_002270chr555584 3503 2027 686 178 24339 3566 ----
NM_002271chr131522 --1117 --
NM_002285chr233797 888 72 ----1998
NM_002293chr152353 2255 2021 1749 56 12512 --1422
NM_002296chr121385 49 ------
NM_002314chr721024 317 --11016 --
NM_002332chr123674 543 498 ------
NM_002345chr12--1592 ----
NM_002351chrX21274 111 1370 ----
NM_002356chr61426 22238 476 ----
NM_002359chr17103481 2812 2721 1579 1567 1434 1235 681 402 264 --13336 140
NM_002360chr772591 2563 2469 2205 2069 935 77 ------
NM_002372chr5----197 --
NM_002373chr151879 --160 --
NM_002374chr212889 13029 22818 804 --
NM_002380chr81367 ------
NM_002383chr162840 283 ------
NM_002385chr1831505 621 147 --1379 --
NM_002387chr555086 4988 3793 547 169 13700 21959 55 --
NM_002397chr542115 1762 1703 484 --1456 --
NM_002401chr1752261 737 680 631 149 ------
NM_002419chr111372 ------
NM_002427chr1121143 796 ------
NM_002430chr22------1105
NM_002444chrX21748 1691 21600 95 1710 --
NM_002479chr12694 48 159 ----
NM_002480chr1221441 70 --1921 --
NM_002481chr1116047 4917 4879 3172 2803 2287 2216 1693 646 432 318 26055 2464 21146 782 --
NM_002487chr151696 ------
NM_002499chr1562301 1976 1896 1756 1516 165 1941 ----
NM_002501chr1954084 3779 2963 1087 171 --11242 --
NM_002508chr1------1102
NM_002509chr201333 ------
NM_002515chr1431426 648 271 12022 21343 1297 --
NM_002519chr1111297 ------
NM_002522chr1743290 2772 1281 1050 --23336 1061 --
NM_002523chr751020 483 426 160 61 1847 ----
NM_002524chr13797 128 37 ------
NM_002527chr122280 229 ------
NM_002536chrX41562 1457 1163 181 --2596 246 --
NM_002543chr12172 --1458 --
NM_002553chr7167 --1450 --
NM_002564chr111941 ------
NM_002569chr1551366 613 430 338 156 --11174 --
NM_002576chr111931 --1205 --
NM_002581chr955645 1976 1349 842 276 ------
NM_002583chr121556 ------
NM_002588chr541426 1345 1104 124 --21312 1156 --
NM_002590chr131545 --137 --
NM_002594chr2032190 915 566 --11551 --
NM_002595chr1211895 1224 ----
NM_002599chr113982 295 33 --11048 --
NM_002600chr131221 661 107 11512 ----
NM_002601chr21346 ------
NM_002607chr731067 922 406 --11113 --
NM_002613chr1685180 4518 4040 2149 1777 1365 490 62 13576 24312 1287 --
NM_002628chr3158 1809 ----
NM_002629chr102664 158 ------
NM_002632chr144824 727 588 551 ------
NM_002633chr11495 ------
NM_002641chrX21899 230 1608 --11600
NM_002651chr12723 357 ----1855
NM_002655chr834461 924 691 23716 270 ----
NM_002657chr2043688 3453 2773 792 13830 21323 460 --
NM_002660chr201363 1158 11150 --
NM_002687chr14128 ----11042
NM_002693chr151116 ------
NM_002698chr1932415 766 72 --22662 1165 --
NM_002699chr12978 474 ------
NM_002703chr4163 --1276 --
NM_002709chr2188 22375 1161 ----
NM_002710chr12--1804 ----
NM_002716chr1153675 2976 1342 1323 1252 13171 ----
NM_002717chr82204 125 ------
NM_002718chr322583 584 ------
NM_002719chr1431539 1529 557 12310 ----
NM_002731chr122224 356 ------
NM_002734chr171403 --198 --
NM_002737chr1795824 5300 5159 5015 4635 2139 2001 1659 88 1849 16533 --
NM_002738chr1621146 735 ------
NM_002739chr192720 666 ------
NM_002740chr32761 40 ------
NM_002742chr14--188 ----
NM_002745chr2253082 1263 945 716 406 2624 284 1736 1438
NM_002747chr1831791 1486 75 ------
NM_002752chr51492 ------
NM_002816chr171284 ------
NM_002819chr194471 406 260 64 ------
NM_002827chr2051814 1449 1175 230 95 ------
NM_002833chr151331 1186 ----
NM_002834chr1221638 1337 --1925 11320
NM_002835chr7152 ------
NM_002837chr1223614 365 --14403 --
NM_002839chr923302 2270 12764 ----
NM_002841chr31144 --1522 --
NM_002843chr1122534 2523 --22872 240 --
NM_002848chr1221230 493 ------
NM_002855chr1143388 3095 2327 1276 12987 22938 1224 11270
NM_002867chr1------1216
NM_002868chr1232003 1793 191 ------
NM_002869chr111542 ------
NM_002885chr12957 44 ------
NM_002892chr1411732 ------
NM_002895chr201815 ------
NM_002901chr111405 ------
NM_002911chr1951470 1395 1330 681 242 --11562 --
NM_002924chr1139 ------
NM_002940chr431220 185 29 ------
NM_002945chr173702 312 248 ------
NM_002956chr121444 1265 ----
NM_002965chr1563 57 42 36 30 171 ----
NM_002971chr3134 ------
NM_002977chr213230 1127 ----
NM_002996chr1631976 1834 455 --11709 --
NM_002997chr241594 1287 101 34 --21738 445 --
NM_002998chr822165 107 --1795 --
NM_003001chr11416 ----1475
NM_003010chr172749 342 21991 1648 11982 --
NM_003011chr941514 1443 1082 686 ------
NM_003012chr82263 82 1310 1216 --
NM_003022chrX--2926 317 ----
NM_003026chr941095 359 308 99 ------
NM_003035chr11104 ------
NM_003043chr383270 2843 2657 2646 1690 1636 1624 899 13826 ----
NM_003045chr1341683 1140 330 196 14706 1243 1226
NM_003060chr541286 995 208 163 ------
NM_003069chrX1105 --128 --
NM_003071chr311933 ------
NM_003072chr192420 315 ------
NM_003099chr15106492 6344 5987 4935 4672 2134 2106 1457 1275 392 11224 ----
NM_003101chr121301 30 --2361 146 --
NM_003106chr31781 ------
NM_003107chr622516 1607 ------
NM_003108chr276817 6793 6717 2822 2351 2318 2012 ------
NM_003111chr211342 ------
NM_003112chr7--13108 ----
NM_003113chr21872 1198 ----
NM_003118chr522036 243 11711 ----
NM_003128chr242575 2337 1774 915 --12590 --
NM_003137chr651652 1390 1383 541 185 ------
NM_003140chrY123 ------
NM_003150chr172758 423 --12280 --
NM_003155chr82467 330 12568 11062 --
NM_003156chr111239 ------
NM_003161chr1711213 ------
NM_003164chr112169 73 ------
NM_003174chr10132 ------
NM_003178chr342130 1962 1944 1620 --1794 --
NM_003179chrX21334 1024 ------
NM_003186chr111127 ------
NM_003189chr132612 2357 299 --1432 --
NM_003199chr1835499 4575 583 ----14505
NM_003200chr1931838 792 257 --21700 66 --
NM_003202chr551754 1564 752 669 240 ------
NM_003204chr1741574 735 674 652 ------
NM_003206chr61422 ------
NM_003211chr122694 284 ------
NM_003214chr621258 166 --1328 --
NM_003216chr2283284 2425 1283 1188 1179 797 675 137 --32803 1268 787 --
NM_003220chr631259 139 106 ------
NM_003223chr163823 577 169 ------
NM_003236chr263167 2942 2818 2297 850 372 --12739 --
NM_003239chr141329 ------
NM_003242chr331850 621 24 --1114 --
NM_003246chr1551769 1599 760 750 336 ------
NM_003253chr2111802 ------
NM_003255chr1722262 858 ------
NM_003257chr1521047 276 ------
NM_003262chr323761 404 23739 198 13651 --
NM_003269chr61290 ------
NM_003274chr213413 236 26 --1349 --
NM_003281chr184567 4057 3326 1992 1820 861 697 668 --11016 --
NM_003286chr201341 ------
NM_003290chr191884 --1306 --
NM_003298chr344279 2224 906 110 15954 --11978
NM_003304chr31119 ------
NM_003319chr21691 ------
NM_003320chr1173809 3484 1203 892 463 330 173 --11481 --
NM_003325chr223537 53 41 --1552 --
NM_003329chr9130 ------
NM_003334chrX1147 ------
NM_003336chrX130 ------
NM_003337chr531575 1504 440 --1673 --
NM_003340chr411360 ------
NM_003342chr1733120 2373 1254 ------
NM_003350chr81755 ------
NM_003352chr22961 250 ------
NM_003360chr4--178 ----
NM_003368chr11100 ------
NM_003371chr93793 593 47 ------
NM_003375chr10--1405 ----
NM_003376chr621751 265 11436 ----
NM_003376chr621751 265 11436 ----
NM_003390chr1131141 1007 218 ------
NM_003392chr343878 3554 1073 962 13670 ----
NM_003394chr12----189 --
NM_003403chr141701 ------
NM_003404chr203554 191 35 ------
NM_003405chr221119 ------
NM_003406chr831847 1549 1530 ------
NM_003410chrX22727 2086 ------
NM_003412chr362326 2134 2085 1227 1126 266 ------
NM_003413chrX2114 102 ------
NM_003418chr31249 ------
NM_003430chr191125 11387 ----
NM_003439chr742870 2412 392 25 12792 ----
NM_003453chr13--1169 ----
NM_003458chr352963 2747 1081 811 682 --13768 --
NM_003463chr632913 2599 22 ------
NM_003468chr223964 1204 --177 11610
NM_003469chr2----1138 --
NM_003473chr10144 --1360 --
NM_003474chr1032141 738 135 --12131 --
NM_003478chr1122665 2246 13227 ----
NM_003482chr1222149 267 ------
NM_003483chr1222226 814 ------
NM_003489chr2133343 2270 642 ------
NM_003498chr1652669 2434 2217 1699 798 22621 301 31880 1782 895 --
NM_003505chr711614 --1558 --
NM_003507chr221314 744 ------
NM_003520chr6166 ------
NM_003524chr6142 ------
NM_003527chr6145 ------
NM_003531chr6146 ------
NM_003565chr1251618 1432 1365 1337 1175 ------
NM_003574chr1855736 4688 4536 3754 1655 --2668 190 --
NM_003576chr1362410 2369 2093 883 548 110 --12681 --
NM_003582chr11193 ------
NM_003583chr1263785 3367 3279 1117 1031 958 --1286 --
NM_003590chr2------13785
NM_003593chr172658 59 1120 ----
NM_003603chr441913 754 159 29 ------
NM_003607chr173506 1753 1742 1722 1681 862 44 --13617 --
NM_003612chr153633 480 100 ------
NM_003613chr153156 76 50 1283 1239 --
NM_003615chr333232 2541 2526 166 ----
NM_003620chr171388 ------
NM_003622chr1242341 2240 1948 906 ------
NM_003626chr1111093 ------
NM_003628chr22703 510 ------
NM_003629chr133165 2671 202 11355 ----
NM_003633chr522017 592 ------
NM_003644chr17104876 2626 2216 1692 1146 1105 964 552 457 258 --32115 315 104 --
NM_003655chr172701 30 1729 ----
NM_003663chr313406 ------
NM_003670chr32376 44 ------
NM_003671chr923164 1241 --1972 --
NM_003679chr152890 2395 2266 1224 788 11072 ----
NM_003690chr22573 540 ------
NM_003701chr131797 --1873 --
NM_003704chr4----1630 --
NM_003713chr12409 310 ------
NM_003714chr532443 633 361 --22964 298 --
NM_003718chr7----1466 --
NM_003719chr52570 306 1817 ----
NM_003735chr541426 1345 1104 124 --21312 1156 --
NM_003736chr541426 1345 1104 124 --21312 1156 --
NM_003737chr113414 112 101 ------
NM_003741chr31276 ------
NM_003743chr252175 1596 1546 381 102 ------
NM_003744chr14--1850 1385 --
NM_003749chr1321722 176 ------
NM_003750chr101201 ------
NM_003758chr15--2284 219 ----
NM_003758chr15--2284 219 ----
NM_003759chr463970 3682 856 396 246 24 ------
NM_003763chr2062897 2575 2240 2137 1079 975 --1962 --
NM_003766chr172458 138 ------
NM_003780chr11264 ------
NM_003787chr182360 201 ------
NM_003794chr3--178 ----
NM_003822chr142594 833 667 528 ------
NM_003831chr1811193 1192 ----
NM_003860chr111331 ------
NM_003872chr292775 2523 2354 2317 1051 793 663 595 279 ------
NM_003877chr121815 ------
NM_003885chr1712411 --1225 --
NM_003888chr1521189 201 11656 1145 --
NM_003893chr101473 ------
NM_003895chr2111452 11977 1819 --
NM_003899chr1362303 2243 2050 1606 923 895 ------
NM_003901chr10102622 2488 2397 2324 2024 2018 1735 1674 1103 833 ------
NM_003908chr2031144 1027 435 ------
NM_003913chr632990 1303 417 13602 11625 --
NM_003916chrX31199 1090 126 --156 --
NM_003927chr181917 ------
NM_003929chr131682 543 137 ----1523
NM_003941chr71197 ------
NM_003942chr112618 582 --1669 --
NM_003947chr321352 177 ------
NM_003949chr1761533 1485 809 700 628 497 ------
NM_003957chr114803 713 215 22 ------
NM_003972chr1021206 317 ------
NM_003983chr1644322 4294 1652 1200 12820 24128 3729 13469
NM_003988chr1061910 1809 1469 192 59 50 176 12308 --
NM_003994chr121510 ------
NM_004006chrX21728 338 ------
NM_004007chrX21728 338 ------
NM_004009chrX21728 338 ------
NM_004010chrX21728 338 ------
NM_004011chrX21728 338 ------
NM_004012chrX21728 338 ------
NM_004013chrX21728 338 ------
NM_004014chrX21728 338 ------
NM_004015chrX21728 338 ------
NM_004016chrX21642 252 ------
NM_004017chrX21728 338 ------
NM_004018chrX21642 252 ------
NM_004019chrX3392 173 160 ------
NM_004020chrX21728 338 ------
NM_004021chrX21642 252 ------
NM_004022chrX21642 252 ------
NM_004023chrX21642 252 ------
NM_004024chr141408 1396 432 44 --21424 606 --
NM_004028chr1843673 2966 1550 535 11347 ----
NM_004050chr1412428 ------
NM_004055chr1131607 1488 327 ------
NM_004077chr121355 1837 ----
NM_004080chr7148 ------
NM_004081chrY11440 ------
NM_004083chr12134 --163 --
NM_004089chrX4874 423 250 149 133 ----
NM_004093chr1332712 2513 605 --21022 293 --
NM_004096chr1031780 1336 787 --11866 --
NM_004103chr81124 --1262 --
NM_004104chr172565 122 --132 --
NM_004105chr211049 ------
NM_004113chr322024 1687 12060 ----
NM_004114chrX11013 1147 ----
NM_004116chr22404 66 ------
NM_004124chr1443238 2182 1062 572 13095 ----
NM_004136chr1552608 2569 2545 730 583 12620 1441 12488
NM_004171chr1137794 3094 2454 19464 --16646
NM_004176chr173472 194 41 ------
NM_004183chr112708 700 ------
NM_004186chr33910 681 647 ------
NM_004187chrX41002 389 303 112 ------
NM_004193chr103385 119 79 ------
NM_004200chr1112645 --23048 380 --
NM_004225chr831412 1371 257 ------
NM_004227chr762746 2672 2492 2057 793 457 12433 ----
NM_004236chr151561 ------
NM_004240chr192239 52 --1253 --
NM_004253chr9--1289 ----
NM_004255chr15144 ------
NM_004272chr531544 337 250 1507 ----
NM_004274chr142577 119 ----11180
NM_004277chr621410 219 ------
NM_004296chr1473729 1138 1077 870 532 520 385 1477 2886 104 --
NM_004301chr31386 ------
NM_004302chr1232845 2629 533 12517 1828 12336
NM_004308chr1121357 74 ------
NM_004309chr173894 348 256 --1934 --
NM_004311chr1022822 2046 2655 486 22850 968 --
NM_004316chr1221028 923 ------
NM_004319chr122374 2222 1267 21121 630 --
NM_004323chr942249 1740 593 249 12313 1111 --
NM_004329chr101564 ------
NM_004331chr822061 594 12698 ----
NM_004337chr841642 902 389 192 140 ----
NM_004342chr712189 ------
NM_004360chr1641901 776 744 377 ------
NM_004364chr192484 389 --1821 --
NM_004370chr63667 483 337 ------
NM_004379chr241680 1603 416 53 ------
NM_004380chr1612172 ------
NM_004384chr51581 ----11858
NM_004389chr2--1605 ----
NM_004392chr1322024 1029 ------
NM_004393chr321701 781 ------
NM_004397chr1123528 1666 14010 ----
NM_004405chr23959 226 162 ------
NM_004414chr21174 --1388 --
NM_004419chr101136 1206 ----
NM_004420chr111246 --52233 2123 2013 1856 812 --
NM_004422chr172486 450 --1129 --
NM_004429chrX31378 1197 539 ------
NM_004430chr882212 1829 1026 766 644 307 299 97 --12140 --
NM_004431chr11346 --183 --
NM_004432chr91557 ------
NM_004434chr142319 133 --21537 68 --
NM_004438chr232215 1322 1175 --12277 --
NM_004440chr61603 ------
NM_004441chr31996 ------
NM_004442chr171671 1640 1202 441 119 112 98 --11212 --
NM_004449chr211419 ------
NM_004450chr141257 ------
NM_004458chrX--12030 ----
NM_004459chr1711680 ------
NM_004463chrX1508 ------
NM_004469chrX168 ------
NM_004487chr31922 --1830 --
NM_004494chr13181 72 57 --1262 --
NM_004496chr141896 --11052 --
NM_004498chr151319 ------
NM_004499chr51208 ------
NM_004501chr133990 3581 1453 ------
NM_004504chr24749 445 384 43 ------
NM_004505chr1731498 576 79 --1760 --
NM_004506chr6----1251 --
NM_004515chr1161 ------
NM_004517chr111191 ------
NM_004520chr5----175 --
NM_004525chr211236 ----1534
NM_004529chr91547 ------
NM_004532chr3267 24 ------
NM_004537chr1221490 473 ------
NM_004569chr141668 ------
NM_004571chr2162488 2408 2304 2275 344 318 ------
NM_004575chr421223 1148 ------
NM_004580chr151468 ------
NM_004583chr173620 220 93 ------
NM_004586chrX44907 1828 1652 243 --11278 --
NM_004587chr201416 1482 ----
NM_004588chr1193560 3053 2625 1570 1361 981 895 729 616 11457 23262 336 --
NM_004598chr553114 3007 2615 2337 48 ------
NM_004602chr20--21534 1387 1209 --
NM_004603chr74909 436 296 278 --139 --
NM_004612chr933158 1082 654 1853 23205 1754 --
NM_004614chr1642298 2152 1521 436 ------
NM_004615chrX1734 ------
NM_004620chr11----1135 --
NM_004631chr11987 --1273 --
NM_004635chr32777 132 --2416 325 --
NM_004637chr31462 ------
NM_004646chr192953 442 ------
NM_004655chr1741165 1058 927 848 ------
NM_004656chr32945 145 ------
NM_004660chrY22258 663 ------
NM_004663chr1541523 1466 280 85 ------
NM_004670chr1011486 --11049 --
NM_004685chr1333007 2655 2226 ------
NM_004687chr1721467 285 ------
NM_004694chr17126 ------
NM_004703chr1742233 2225 2001 573 --2508 501 --
NM_004705chr112689 123 ------
NM_004709chrX21582 1231 ------
NM_004719chr1232736 2355 1010 ------
NM_004721chr31263 ------
NM_004723chr12866 178 --1153 --
NM_004726chrX55375 3740 1808 1219 577 --11272 --
NM_004730chr531819 1488 233 ------
NM_004732chr172284 263 ------
NM_004736chr131398 536 485 ------
NM_004737chr222896 51 ------
NM_004742chr331791 1469 1448 ------
NM_004759chr161864 1642 1628 790 509 161 11587 11763 --
NM_004760chr731729 766 422 2872 638 21989 809 --
NM_004761chr62285 139 ------
NM_004762chr1741580 1465 1315 201 ------
NM_004768chr111124 ------
NM_004774chr1732785 1091 361 ------
NM_004776chr2041141 921 773 184 --32929 2699 701 --
NM_004788chr1142509 1107 1040 943 ----12017
NM_004791chr13--1682 --146
NM_004796chr1411751 ------
NM_004798chr2033542 2953 792 --13096 --
NM_004801chr211049 ------
NM_004805chr231265 1171 264 --1900 11140
NM_004814chr12478 138 --130 --
NM_004815chr123967 186 --13662 --
NM_004822chr17123608 3577 3319 3298 2573 1316 1241 858 560 322 133 76 --23571 2751 --
NM_004827chr41684 1399 ----
NM_004831chr192854 389 ------
NM_004839chr151567 ------
NM_004840chrX51917 1547 720 389 376 ------
NM_004841chr12232 97 ------
NM_004842chr61342 --11236 --
NM_004845chrX73949 3863 3781 3441 518 379 246 ----13659
NM_004849chr631533 641 316 ------
NM_004850chr221748 1677 ------
NM_004857chr1454092 3360 803 470 188 ------
NM_004865chr61125 ------
NM_004879chr111315 1740 1815 --
NM_004886chr19124 1204 ----
NM_004898chr422309 2018 ------
NM_004904chr756273 5697 4542 1732 1608 --25149 1322 --
NM_004911chr72594 464 ------
NM_004921chr122317 257 ------
NM_004922chr101168 ------
NM_004925chr92809 603 --2192 69 --
NM_004926chr1421139 394 ----11760
NM_004929chr81357 11518 ----
NM_004947chr352567 1586 570 511 181 ------
NM_004948chr1821431 1362 ------
NM_004949chr1822159 2058 --12149 --
NM_004964chr11404 ------
NM_004965chr211671 ------
NM_004969chr10----178 --
NM_004973chr61227 ------
NM_004976chr1133982 2032 782 14091 1327 --
NM_004985chr1223179 2808 1781 2660 577 --
NM_004990chr12126 ------
NM_004992chrX118140 7413 7401 6844 6822 6583 6430 3404 2944 2720 783 17924 15665 --
NM_004992chrX118140 7413 7401 6844 6822 6583 6430 3404 2944 2720 783 17924 15665 --
NM_004995chr1451368 1352 1190 1173 1007 ------
NM_005010chr7----12080 --
NM_005011chr731191 584 527 ------
NM_005020chr71413 --1466 --
NM_005022chr17------193
NM_005028chr10----1157 --
NM_005032chrX----1101 1962
NM_005045chr72786 370 ------
NM_005056chr1221179 881 ------
NM_005057chr121311 430 11787 ----
NM_005063chr1043406 3376 3329 2476 ------
NM_005065chr1445125 4518 1166 93 15135 --11225
NM_005066chr11269 ------
NM_005095chr1----1389 --
NM_005096chrX41147 998 90 53 ------
NM_005098chr83188 169 58 ------
NM_005099chr121069 258 ------
NM_005103chr112281 253 --138 --
NM_005105chr121648 1583 --12131 --
NM_005114chr41545 ------
NM_005116chr2084001 2906 1819 692 582 300 238 28 ----1246
NM_005121chr1732822 2749 988 --23625 943 --
NM_005126chr322249 1714 ------
NM_005137chr2292334 2203 1725 1704 1028 443 330 324 121 11003 12143 --
NM_005147chr163841 353 187 ------
NM_005153chr16--1640 ----
NM_005156chr921893 1821 14530 ----
NM_005157chr921447 598 11770 1557 --
NM_005160chr2296718 6188 6133 4848 4448 4342 2244 1722 386 --25443 4299 --
NM_005168chr221700 1096 ------
NM_005180chr103516 484 324 165 ----
NM_005181chr81137 1565 1709 --
NM_005182chr161136 ----2469 27
NM_005187chr1651977 1427 490 155 146 ------
NM_005188chr1166839 6827 2710 1853 1813 661 25637 5340 35758 3252 819 --
NM_005189chr1782453 2384 2339 1922 1886 1665 698 515 ----11575
NM_005197chr1455583 4056 2049 608 572 11055 14226 --
NM_005206chr1721353 924 --2977 71 --
NM_005216chr13498 427 229 ------
NM_005219chr511620 --1104 --
NM_005229chrX3817 502 228 --2290 38 --
NM_005233chr332292 480 290 11620 --11818
NM_005235chr246974 5238 2503 310 ----1789
NM_005241chr3--1852 1112 --
NM_005242chr521272 1253 ------
NM_005245chr42204 154 ------
NM_005249chr142865 262 --1696 1686
NM_005254chr151283 ------
NM_005257chr18----2441 212 --
NM_005259chr22597 115 ------
NM_005261chr8----151 --
NM_005271chr102835 229 ------
NM_005277chr42524 57 ------
NM_005278chrX1552 ------
NM_005281chr13867 328 277 --1787 --
NM_005284chr61394 ------
NM_005308chr101427 ------
NM_005311chr721117 646 --1291 --
NM_005324chr1711832 ----11474
NM_005338chr763702 3612 3258 3112 1379 572 1118 1296 --
NM_005339chr423474 279 14041 1371 --
NM_005342chrX72149 2004 1974 1968 1019 730 181 --22450 1009 --
NM_005347chr91209 11576 ----
NM_005359chr1846407 5321 2363 881 --14792 --
NM_005374chr1752274 1906 582 401 239 --11899 --
NM_005375chr611088 ------
NM_005376chr11739 1837 ----
NM_005378chr2232 26 ------
NM_005386chr202635 346 ------
NM_005392chr92673 402 ------
NM_005399chr124362 1747 13539 21360 731 --
NM_005400chr223000 157 ------
NM_005402chr741846 1350 1317 65 11815 ----
NM_005426chr11214 ------
NM_005436chr1063393 3357 2989 2694 2551 1179 ------
NM_005456chr112733 572 --1130 --
NM_005458chr952269 1912 791 733 493 ------
NM_005465chr121749 244 --31970 1727 751 --
NM_005477chr1532382 680 619 --22478 182 --
NM_005477chr1532382 680 619 --22478 182 --
NM_005479chr1031308 345 286 --21425 1162 --
NM_005493chr61559 1846 ----
NM_005501chr173809 424 90 --1475 --
NM_005502chr922785 2264 --11134 --
NM_005504chr1266231 5484 1004 997 97 52 35433 1528 876 21063 1034 --
NM_005507chr111459 --1466 --
NM_005515chr72438 162 ------
NM_005517chr13541 471 297 1180 ----
NM_005520chr5--131 ----
NM_005525chr12322 124 ------
NM_005527chr6----1398 --
NM_005540chr111036 --195 --
NM_005544chr22805 298 ------
NM_005552chr14----1162 --
NM_005566chr11138 ------
NM_005569chr2221090 131 1411 11599 --
NM_005574chr111230 --1475 --
NM_005576chr151247 ------
NM_005584chr131514 1212 ----
NM_005585chr153429 42 36 ------
NM_005593chr121141 ------
NM_005595chr11122 ------
NM_005596chr956060 5113 2519 1722 570 15308 ----
NM_005603chr182446 30 ------
NM_005604chr612084 --1672 --
NM_005611chr1611297 ------
NM_005613chr122000 142 ------
NM_005614chr72830 425 ------
NM_005625chr83957 811 286 ------
NM_005626chr12391 90 ------
NM_005629chrX11339 ------
NM_005639chr1221812 1547 11417 ----
NM_005647chrX63231 3168 2624 2196 1058 137 ------
NM_005652chr161187 ------
NM_005655chr82184 173 11174 ----
NM_005665chr133232 1533 781 --1866 --
NM_005668chr524482 217 13657 11059 --
NM_005669chr512272 ------
NM_005670chr61373 ------
NM_005688chr3145 --21232 874 --
NM_005698chr12192 31 ------
NM_005707chr1521059 968 ------
NM_005717chr11844 ------
NM_005718chr33656 189 72 --2695 666 --
NM_005731chr2156 ------
NM_005734chr111319 ------
NM_005736chr1041465 1218 1153 507 --1615 --
NM_005737chr252635 698 564 293 274 ------
NM_005738chr7----11568 --
NM_005739chr15----12275 --
NM_005740chr222695 46 ------
NM_005746chr722252 2200 12232 ----
NM_005748chr1233098 911 29 --12137 --
NM_005751chr7----1360 --
NM_005759chr233670 3284 1010 14709 11405 --
NM_005765chrX1235 ------
NM_005767chr131212 ------
NM_005779chr563487 1338 1187 626 148 21 --13315 --
NM_005808chr362618 1054 822 790 132 115 --11173 --
NM_005826chr11115 ------
NM_005828chr17114203 4170 4061 3536 3195 3124 2015 1867 1834 1383 645 --34932 4233 963 --
NM_005834chrX128 ------
NM_005839chr11991 ------
NM_005840chrX52071 1580 1383 1251 364 26443 5031 27684 7651 --
NM_005852chr171108 ------
NM_005853chr161564 ------
NM_005859chr511307 ----11097
NM_005862chr31719 ------
NM_005869chr5164 ------
NM_005870chr1321214 1010 186 ----
NM_005877chr2241925 444 209 33 ------
NM_005880chr1611041 ------
NM_005885chr51313 ------
NM_005895chr1254085 3354 1172 291 29 23465 699 21130 1098 --
NM_005897chr131192 413 248 ------
NM_005898chr1132495 942 559 1856 1732 --
NM_005899chr1711371 ------
NM_005901chr18108713 6348 5854 5716 5380 3468 3363 2971 1311 1215 17233 ----
NM_005907chr6----11199 --
NM_005909chr521623 741 22786 153 11656 --
NM_005910chr1772703 1158 683 639 533 269 150 --31134 1067 975 --
NM_005911chr231323 127 42 ------
NM_005920chr143653 2772 1227 909 --11278 --
NM_005922chr62197 137 ------
NM_005933chr1152685 2296 888 750 46 --11939 --
NM_005938chrX21246 127 ------
NM_005940chr225686 185 170 73 45 ------
NM_005941chr843297 2731 1403 645 --24162 878 --
NM_005955chr154833 4548 4229 1638 258 --11618 --
NM_005957chr174821 4118 3698 1966 1743 1400 33 11073 11353 --
NM_005962chr1022167 729 ------
NM_005962chr1022167 729 ------
NM_005964chr171360 ------
NM_005996chr1241230 1073 611 246 ------
NM_006007chr944388 3930 3729 2738 --183 --
NM_006011chr1563731 3107 1224 1205 479 222 ------
NM_006016chr6--12100 ----
NM_006022chr1311050 1137 ----
NM_006023chr101173 ------
NM_006029chr14145 ------
NM_006030chr31285 --11688 --
NM_006032chr14--1215 ----
NM_006037chr274834 4666 3535 3328 3209 1962 1400 --13369 --
NM_006038chr2052039 1451 508 409 33 --11591 --
NM_006039chr171961 11077 ----
NM_006047chr2013468 --23347 396 --
NM_006051chr5187 ------
NM_006066chr1183 ------
NM_006067chr16------11014
NM_006079chr61175 ------
NM_006080chr721827 361 ------
NM_006085chr12257 186 ------
NM_006091chr1561596 1560 1329 1213 1178 615 ------
NM_006094chr812195 --12292 --
NM_006095chr423543 2963 34221 685 309 ----
NM_006106chr1122240 306 12435 12126 --
NM_006108chr1112335 --12325 --
NM_006116chr2241293 1194 1106 603 --21606 215 --
NM_006133chr1152355 666 448 331 271 --1749 --
NM_006135chr11346 ------
NM_006136chr71105 ------
NM_006139chr242409 1841 117 96 --1793 --
NM_006145chr1931100 991 716 ------
NM_006153chr3----1519 --
NM_006154chr151503 --196 --
NM_006156chr14184 --1185 --
NM_006160chr1731030 130 117 --11248 --
NM_006166chr1222425 2272 11919 ----
NM_006180chr93493 87 78 ------
NM_006182chr12144 78 ------
NM_006186chr221196 355 ------
NM_006190chr2154 --11030 --
NM_006194chr1411022 ------
NM_006202chr192552 515 ------
NM_006203chr565315 5106 3723 1737 660 85 11146 ----
NM_006212chr125349 4386 176 ----
NM_006216chr2--1636 ----
NM_006224chr1732438 2266 892 --185 --
NM_006228chr81366 --136 --
NM_006241chr322386 782 ----11609
NM_006243chr13858 221 176 ------
NM_006245chr63709 117 27 ------
NM_006246chr1411206 ------
NM_006252chr1107105 6422 5500 5471 5101 5030 2635 2217 1908 973 11001 16085 --
NM_006256chr11250 --11105 --
NM_006258chr102511 103 ------
NM_006264chr41183 ------
NM_006267chr221369 145 ------
NM_006275chr2022199 548 ----1516
NM_006281chr811127 ------
NM_006281chr811127 ------
NM_006302chr2139 ------
NM_006305chr151210 ------
NM_006306chrX65038 4490 3612 1262 747 239 ------
NM_006313chr121643 ------
NM_006320chr41372 ------
NM_006321chr32605 199 --1750 --
NM_006328chr111210 ------
NM_006336chr941003 588 565 22 --21049 281 --
NM_006350chr52267 25 ------
NM_006359chrX21773 1634 ------
NM_006371chr374438 4188 3991 3924 3886 1675 1646 --13985 --
NM_006372chr6--177 1490 --
NM_006373chr172575 68 --21257 1219 --
NM_006377chr921256 288 --1893 11202
NM_006379chr72609 325 ------
NM_006380chr1743266 3137 2785 1680 --12844 --
NM_006411chr62919 168 ------
NM_006416chr63693 624 309 ------
NM_006420chr2062384 2320 1018 953 340 53 ------
NM_006421chr8--1853 ----
NM_006434chr1063130 2892 1212 624 252 239 11129 1758 --
NM_006451chr5----1835 --
NM_006459chr1031841 797 239 --1504 --
NM_006464chr243503 3043 1771 571 13433 34511 4186 784 --
NM_006465chr1542023 1923 886 30 ----1412
NM_006469chr111432 ------
NM_006471chr182120 40 ------
NM_006474chr141983 1872 1749 675 ------
NM_006482chr1263785 3367 3279 1117 1031 958 --1286 --
NM_006489chr1431426 648 271 12022 21343 1297 --
NM_006494chr192608 277 --1856 --
NM_006504chr1022185 134 ----12553
NM_006517chrX41574 868 442 362 ------
NM_006520chrX21273 1249 130 ----
NM_006526chr202654 103 ------
NM_006534chr2062909 2857 1107 1030 585 315 ------
NM_006538chr254127 3334 3130 1060 1024 188 33573 1322 1152 13435
NM_006544chr1465398 5292 4874 1635 379 277 --11717 11179
NM_006546chr1766128 6093 5096 4553 4428 2339 ------
NM_006547chr721734 1473 1450 ----
NM_006548chr31624 21679 1625 ----
NM_006557chr931562 1555 1210 ------
NM_006559chr11456 ------
NM_006560chr11--1528 ----
NM_006561chr1035135 4957 2114 21933 1702 2562 401 --
NM_006572chr1733381 1004 796 ------
NM_006575chr141189 --1436 --
NM_006595chr1121735 1675 ------
NM_006599chr1667991 5445 3205 2949 2528 2368 --42221 1579 1216 944 --
NM_006602chr202571 39 ------
NM_006603chrX21269 770 --11262 --
NM_006609chr21285 --11832 --
NM_006614chr333011 346 26 ------
NM_006621chr1--1223 ----
NM_006624chr101495 12032 11406 --
NM_006625chr11847 1403 ----
NM_006625chr11847 1403 ----
NM_006625chr11847 1403 ----
NM_006626chr91429 1992 12076 --
NM_006628chr1531643 715 450 34405 2822 1799 --13304
NM_006629chr181485 12421 ----
NM_006646chr1332714 272 23 32085 230 186 1755 --
NM_006654chr1221770 1155 1828 1727 --
NM_006690chr2061880 948 868 617 494 310 1700 1822 --
NM_006691chr112384 146 21151 881 ----
NM_006698chr2041399 1203 1117 255 11029 ----
NM_006699chr12940 254 ------
NM_006700chr122296 60 --1135 --
NM_006703chr6----1459 --
NM_006711chr16160 ------
NM_006717chr91779 ------
NM_006721chr102222 96 ------
NM_006724chr62197 137 ------
NM_006726chr42851 798 ------
NM_006729chrX22227 511 25278 4419 15647 --
NM_006734chr621283 1151 ------
NM_006750chr16105975 5904 2466 2425 1574 919 832 721 628 597 1892 ----
NM_006751chr21358 ------
NM_006755chr111162 ------
NM_006761chr17179 1342 ----
NM_006762chr141225 1114 954 205 --1287 --
NM_006764chr3195 ------
NM_006769chr13655 579 122 ------
NM_006775chr632762 2225 2166 1540 ----
NM_006783chr131236 ------
NM_006788chr1841657 625 448 410 ----11329
NM_006795chr1141517 1462 1237 26 --21310 1263 --
NM_006802chr11448 ------
NM_006805chr52425 128 ------
NM_006807chr1721037 888 ------
NM_006811chr202863 347 ------
NM_006815chr12--2872 412 1904 --
NM_006826chr211242 ------
NM_006827chr1443307 2894 1335 810 12214 ----
NM_006832chr144930 435 224 34 ------
NM_006851chr1232247 2096 950 ------
NM_006852chr1721941 781 --1247 --
NM_006854chr721897 1834 11292 ----
NM_006874chr42896 844 ------
NM_006875chrX155 ------
NM_006885chr1612630 12924 ----
NM_006888chr1421336 665 ------
NM_006897chr121653 ------
NM_006899chr202261 105 ------
NM_006902chr1----130 --
NM_006908chr721230 492 11404 ----
NM_006910chr161380 ------
NM_006914chr911075 191 ----
NM_006920chr211442 12017 ----
NM_006924chr1723074 2881 ------
NM_006927chr1662012 1941 1627 716 554 463 --1283 --
NM_006931chr1261955 1865 1487 1365 857 106 --1259 --
NM_006939chr1431045 837 123 ------
NM_006940chr1231589 1497 1281 21769 1221 11354 --
NM_006946chr112521 143 ------
NM_006948chr21--1938 ----
NM_006950chrX----1235 --
NM_006951chr102754 33 ------
NM_006958chr82130 80 --162 --
NM_006981chr9--12544 1787 --
NM_006990chr142185 2036 921 381 --21856 1775 --
NM_006999chr541955 1384 122 61 ------
NM_007005chr911118 1447 ----
NM_007006chr1632843 1150 34 ------
NM_007007chr12--13815 14776 1283
NM_007011chr1596380 5550 5263 5253 4831 4607 4268 2166 1671 12052 ----
NM_007013chr82888 333 ------
NM_007023chr23808 233 61 289 71 ----
NM_007024chr3164 ------
NM_007033chr141452 1406 400 50 --1354 --
NM_007042chr322269 281 11924 ----
NM_007051chr12163 28 ------
NM_007052chrX2544 86 ------
NM_007061chr221225 --2451 366 --
NM_007067chr1751454 1034 377 296 120 ------
NM_007073chr694239 4154 3472 3456 2715 1582 1396 1042 668 --11239 --
NM_007106chr1331139 1061 785 --12417 --
NM_007107chr321663 302 21964 1735 --11931
NM_007125chrY1487 ------
NM_007135chr9--1161 ----
NM_007137chrX54533 4031 3774 805 613 15454 --13435
NM_007146chr1732918 2606 2060 --12495 --
NM_007150chrX1674 12032 ----
NM_007158chr111023 ------
NM_007159chr331548 1403 491 ------
NM_007167chr12833 346 ------
NM_007174chr121364 --11923 --
NM_007177chr342342 2121 1562 485 --125 --
NM_007192chr142875 110 --1136 --
NM_007195chr1821449 220 ------
NM_007214chr611323 ------
NM_007216chr112744 392 --1129 --
NM_007218chr82669 154 ------
NM_007219chr204825 806 643 108 ------
NM_007235chr122436 77 ------
NM_007246chr41685 ------
NM_007249chr1358435 6874 6064 342 273 23080 581 ----
NM_007275chr32364 99 ------
NM_007283chr333016 2087 898 1759 12423 --
NM_007284chr33327 149 23 --1365 --
NM_007285chr16161 ------
NM_007308chr41681 ------
NM_007313chr921447 598 11770 1557 --
NM_007325chrX32014 1890 329 11981 ----
NM_007347chr1543061 2513 1982 714 ------
NM_007350chr1231387 1276 769 --14403 --
NM_007353chr783019 2456 2170 1149 1111 801 554 198 ----11008
NM_007359chr1711390 --11324 --
NM_007363chrX1682 ------
NM_007373chr1031740 1275 151 147 ----
NM_012074chr1421132 1009 ------
NM_012081chr553534 2350 1267 912 816 12578 12701 --
NM_012082chr81184 ------
NM_012083chr1041161 888 294 247 --2879 34 --
NM_012095chr1063425 2253 2220 1135 699 545 1520 ----
NM_012096chr313019 11414 12989 --
NM_012098chr961312 1256 1126 143 64 55 --21228 33 --
NM_012104chr1143501 2750 243 64 12706 23159 2783 --
NM_012104chr1143501 2750 243 64 12706 23159 2783 --
NM_012120chr61930 1420 ----
NM_012129chr742258 993 820 564 ------
NM_012137chr152644 2622 578 549 99 1108 ----
NM_012141chr1324114 725 --122 --
NM_012154chr82681 545 ------
NM_012156chr2032942 2706 120 --22559 789 --
NM_012157chr31931 ------
NM_012158chr1311792 ------
NM_012193chr1154869 4317 4089 3873 3432 --23708 3586 --
NM_012197chr9----1140 --
NM_012202chr112368 351 ------
NM_012214chr245759 1427 610 591 15022 ----
NM_012218chr1952739 2456 2375 629 149 1225 ----
NM_012223chr221203 903 ------
NM_012234chr333697 2410 156 ------
NM_012238chr1011510 --11468 --
NM_012243chr1--1830 ----
NM_012244chr1431375 378 298 --122 --
NM_012248chr16138 ------
NM_012249chr252762 2530 1304 1274 506 ------
NM_012250chr1111323 ------
NM_012257chr71707 ------
NM_012264chr2232077 690 145 ------
NM_012264chr2232077 690 145 ------
NM_012266chr94924 842 293 126 1241 ----
NM_012279chr531485 1415 131 --11336 --
NM_012287chr334264 3519 265 23425 1699 23651 888 --
NM_012288chr6155274 5248 5063 2120 1895 1836 1524 1202 1113 899 884 718 606 518 237 --11090 --
NM_012294chr732546 532 200 13873 ----
NM_012296chr1173674 1547 1164 653 413 265 236 --33632 821 406 1534
NM_012297chr412240 ------
NM_012300chr542535 1584 61 53 ------
NM_012301chr721516 662 21957 1804 ----
NM_012302chr12310 29 ------
NM_012306chr1252531 2353 1354 195 156 --21129 123 --
NM_012308chr1132608 1643 1610 ------
NM_012309chr1183970 3875 3601 3194 1770 1467 1449 638 ------
NM_012316chr1105332 4851 4780 4007 2166 2082 1937 1451 833 678 --22032 1533 --
NM_012318chr4--11243 ----
NM_012322chr71289 ------
NM_012325chr2031517 1048 277 ------
NM_012330chr1041243 1174 523 288 1458 ----
NM_012382chr544325 3261 3210 2899 ------
NM_012383chr9148 ------
NM_012384chr2072408 1912 1525 652 402 106 80 21735 954 ----
NM_012395chr713404 ------
NM_012396chr11191 ----1694
NM_012398chr1952883 2774 2382 1883 884 --2803 612 --
NM_012399chr2221416 1270 ------
NM_012402chr1141378 1306 213 92 ------
NM_012405chr163102 2793 301 293 132 116 11337 33670 3259 75 --
NM_012408chr20192 ------
NM_012410chr162535 352 ------
NM_012412chr71690 ------
NM_012414chr1----1748 --
NM_012417chr17196 ------
NM_012419chr61432 --1112 --
NM_012428chr151311 ------
NM_012433chr2136 ------
NM_012465chr102620 267 --12331 --
NM_012470chr71176 ------
NM_012482chr12604 68 ------
NM_013230chrY41666 1582 1542 403 ------
NM_013233chr221370 924 ------
NM_013238chr13--1605 ----
NM_013261chr423579 605 --13132 --
NM_013262chr621239 153 ------
NM_013267chr122469 49 ------
NM_013269chr1224391 702 13426 14212 --
NM_013279chr1132083 1957 1454 ------
NM_013281chr20----1405 --
NM_013286chr383768 3632 3074 2536 1453 1280 1234 611 --23369 439 --
NM_013309chr1512248 --2687 361 --
NM_013312chr191108 ------
NM_013316chr71875 ------
NM_013336chr341951 1906 1433 619 ------
NM_013341chr232389 2310 1067 --12368 --
NM_013348chr191864 ------
NM_013354chr81896 ------
NM_013363chr3137 ------
NM_013372chr1512456 11103 12777 --
NM_013377chr121488 --1567 --
NM_013386chr131172 722 215 --1140 --
NM_013390chr911104 ------
NM_013392chr2----1399 --
NM_013396chr212433 352 ------
NM_013410chr131250 490 198 ------
NM_013423chrX31234 806 171 --177 --
NM_013427chrX31234 806 171 --177 --
NM_013433chr1961724 1587 816 464 420 201 ------
NM_013434chr2111947 1913 1782 1605 1453 645 612 463 309 163 27 --1681 --
NM_013434chr2111947 1913 1782 1605 1453 645 612 463 309 163 27 --1681 --
NM_013443chr921190 965 2863 61 ----
NM_013447chr1923033 2375 --1254 --
NM_013943chr163126 2176 1094 803 487 207 1578 167 --
NM_013989chr1474644 4420 3492 3240 772 473 370 14511 24275 1250 --
NM_013995chrX21933 490 ------
NM_014001chr1771129 1060 1008 588 339 227 77 ------
NM_014007chr92455 85 ------
NM_014016chr3------1417
NM_014023chr1051937 1151 817 797 83 --32951 2102 1926 --
NM_014030chr17295 47 --162 --
NM_014038chr7----1357 --
NM_014089chr1322162 675 ------
NM_014109chr811128 ------
NM_014112chr845110 4067 1414 540 --1398 --
NM_014117chr1632077 88 43 ------
NM_014139chr31113 --1194 --
NM_014142chr10--197 123 --
NM_014154chr31394 ------
NM_014155chr1157452 6979 6230 5175 1232 11865 11349 --
NM_014159chr32156 103 ------
NM_014160chr3--11350 ----
NM_014181chr222910 1925 1180 ----
NM_014182chr121260 ------
NM_014191chr1231063 967 807 ------
NM_014225chr19196 --1283 --
NM_014233chr1711487 --11970 --
NM_014235chrX41683 1122 580 39 --2618 281 --
NM_014240chr353913 3546 3414 2976 1406 --1840 13540
NM_014243chr442010 1845 811 655 ------
NM_014268chr183226 202 146 1407 ----
NM_014271chrX1693 ------
NM_014280chr11697 ------
NM_014283chr121018 391 11529 ----
NM_014292chr2231275 660 182 --11409 --
NM_014293chr2263647 1659 1588 432 379 39 --22613 747 --
NM_014294chr821265 382 11424 ----
NM_014296chr3--11009 1251 --
NM_014299chr1932234 1739 347 --12020 --
NM_014309chr2234347 1444 1229 1984 12019 --
NM_014313chr121277 86 ------
NM_014316chr1632008 763 183 --11741 --
NM_014317chr10------1294
NM_014325chr1272236 1588 1454 460 283 148 105 ------
NM_014332chrX1323 1389 ----
NM_014338chr222149 83 ------
NM_014345chr63849 355 21 ------
NM_014350chr51992 ------
NM_014352chr1141445 1140 434 375 ------
NM_014360chr143774 605 26 ------
NM_014368chr952000 1872 1425 732 57 ------
NM_014372chr1163 ------
NM_014382chr321588 477 ------
NM_014392chr431297 448 32 ------
NM_014405chr1732183 805 406 1331 ----
NM_014411chr742023 1943 1779 1721 ------
NM_014415chr3--1684 ----
NM_014423chr545116 4563 4535 4403 ------
NM_014426chr202755 185 --1677 --
NM_014456chr1041767 1671 1600 315 ------
NM_014470chr122692 116 ------
NM_014480chr191598 ------
NM_014488chr11151 ------
NM_014491chr71813 ------
NM_014505chr122335 104 ------
NM_014507chr2211117 ------
NM_014515chr121150 ------
NM_014517chr331670 241 174 ------
NM_014520chr172178 115 ------
NM_014570chr221110 ------
NM_014571chr162905 2435 2130 1156 555 502 --11184 --
NM_014573chr1741779 1662 1537 1200 ------
NM_014574chr1411544 ------
NM_014575chr31182 ------
NM_014577chr221250 ------
NM_014588chr203759 539 138 ------
NM_014603chr172339 198 ------
NM_014607chr23417 376 334 ------
NM_014612chr9--1400 ----
NM_014613chr542342 2299 698 406 ------
NM_014614chr231078 449 174 ------
NM_014615chr1653270 2638 2252 1124 861 --13501 --
NM_014616chr333468 3015 76 ----22971 305
NM_014618chr91397 ------
NM_014620chr12----1278 --
NM_014621chr21241 ------
NM_014630chr1552837 2560 1342 857 809 ------
NM_014647chr161112 ------
NM_014655chr131922 1450 786 ------
NM_014657chr203292 78 26 ------
NM_014659chr153443 326 183 1346 ----
NM_014660chr72458 146 ------
NM_014661chr1083884 3454 2986 2974 2821 1470 407 177 --43416 3401 994 842 --
NM_014663chr11187 --1879 --
NM_014665chr8143496 3058 2924 2222 1359 1338 1314 1142 1067 952 837 621 582 30 ------
NM_014667chr332432 2146 1507 --12053 --
NM_014670chr211387 ------
NM_014671chr741209 573 362 130 --3433 241 178 --
NM_014677chr811370 ------
NM_014686chr1932246 1679 1608 22237 1011 180 --
NM_014690chr743112 1061 695 45 ------
NM_014701chr1522263 539 152 ----
NM_014702chr653252 2868 2172 1181 298 23031 1300 ----
NM_014711chr1621518 547 11332 ----
NM_014712chr163517 497 404 ------
NM_014720chr1021331 200 ------
NM_014721chr686388 6282 6227 5884 5239 2554 2390 1618 27427 6051 15409 --
NM_014729chr81143 11549 ----
NM_014731chr2061642 1575 559 413 371 362 ------
NM_014732chr16174897 4506 4294 2259 1945 1681 1425 1356 1247 811 447 424 314 223 117 46 38 1879 11437 --
NM_014735chrX21887 1547 --11339 --
NM_014736chr154972 901 377 335 ------
NM_014737chr2093578 3136 2671 1193 1160 979 777 393 43 ------
NM_014743chr432837 948 906 ------
NM_014746chr221656 389 14223 13324 --
NM_014747chr194801 2196 1335 1030 596 575 535 497 235 --32014 367 124 --
NM_014751chr81605 ------
NM_014752chr112654 325 ------
NM_014755chr244020 3711 1464 1022 ------
NM_014756chr11----1409 --
NM_014757chr521587 779 --31615 888 603 --
NM_014758chr1152426 1799 648 95 52 --1488 --
NM_014761chr163801 472 120 ------
NM_014762chr152223 2003 1969 443 352 --12571 --
NM_014765chr122543 1896 1967 ----
NM_014767chr1043059 2776 1481 1314 ------
NM_014774chr133263 2899 348 1961 12816 --
NM_014776chr1233055 1266 516 --12403 --
NM_014779chr32382 58 ------
NM_014781chr821094 87 ------
NM_014783chr1531463 1236 335 ------
NM_014786chr1151097 915 449 324 182 ------
NM_014788chr962515 2434 2271 2194 2116 1079 22921 2675 ----
NM_014790chr5--1127 ----
NM_014797chr632809 2738 2417 ------
NM_014800chr7----1222 --
NM_014804chr17----21018 23 1419
NM_014810chr112521 --13536 --
NM_014812chr11533 ------
NM_014819chr5--1332 ----
NM_014820chr321962 279 ----11698
NM_014824chr112650 457 ------
NM_014826chr173506 1753 1742 1722 1681 862 44 --13617 --
NM_014827chr11211 ------
NM_014832chr131180 ----11726
NM_014836chr1031932 1364 412 ------
NM_014839chr132086 547 399 --129 --
NM_014841chr6----11141 --
NM_014848chr1532504 2427 853 11021 22476 2410 --
NM_014850chr364457 4449 3030 3006 1706 305 13417 21627 1553 --
NM_014859chr1771206 1088 979 570 551 438 114 ------
NM_014871chr121129 ------
NM_014873chr154753 3046 3019 3002 27 24550 1737 ----
NM_014876chr2271910 1739 1699 556 339 229 87 --21886 1711 --
NM_014877chr1787651 7578 6187 5574 3021 2404 933 657 16656 ----
NM_014883chr43517 511 454 12056 ----
NM_014884chr19155 ------
NM_014893chrY2410 107 ------
NM_014901chr531833 673 466 ------
NM_014903chr1252119 1840 1775 649 453 12471 ----
NM_014906chr1722851 991 2314 276 11084 --
NM_014909chr1483937 2522 2435 1581 1491 1232 1047 573 ------
NM_014912chr102307 283 --2516 331 1852
NM_014917chr1--171 1346 --
NM_014918chr1541489 1188 556 441 ------
NM_014920chr653268 3255 2680 2652 1292 23497 745 ----
NM_014923chr1331942 1849 132 11649 ----
NM_014924chr1462327 1273 1055 882 478 323 ------
NM_014926chr31205 ------
NM_014932chr321702 1696 ------
NM_014935chr183438 3357 3351 2979 2800 2716 1450 157 --1638 --
NM_014939chr1831371 1329 1061 1384 ----
NM_014945chr511947 ------
NM_014946chr232488 221 78 ------
NM_014947chr132469 2238 1197 --12607 --
NM_014949chr1--1653 ----
NM_014952chr154693 443 92 26 ------
NM_014962chr2032748 1154 643 11796 ----
NM_014970chr1--1269 ----
NM_014974chr1031541 474 105 ------
NM_014977chr144382 148 58 35 ------
NM_014982chr1434639 3830 178 22016 1547 11592 --
NM_014989chr621373 230 ------
NM_014990chr141886 ------
NM_014991chr42777 335 ------
NM_014994chr1582229 2145 1826 1749 1516 830 336 142 ------
NM_015000chr1233074 2749 2197 11068 ----
NM_015002chr121114 ------
NM_015008chr322361 710 --1547 --
NM_015011chr1321098 448 ------
NM_015015chr1991900 1854 1426 752 554 319 283 111 45 --1642 --
NM_015017chr12936 810 11063 11089 --
NM_015020chr1643494 3451 2643 207 3597 503 256 1178 --
NM_015023chr161668 1312 656 578 428 33 ----1624
NM_015026chr1234749 4241 973 --14713 --
NM_015032chr131162 2588 488 ----
NM_015035chr20105729 5607 5506 5435 5007 4480 4330 2465 606 464 25101 163 46046 4298 4144 642 --
NM_015039chr154228 3861 2990 1046 642 11482 ----
NM_015040chr21657 13287 13022 12400
NM_015042chr1594132 3081 3071 3000 1720 1225 1094 995 329 11274 34239 3806 1219 --
NM_015045chr1042278 411 372 138 ------
NM_015046chr932431 2257 1704 ------
NM_015049chr21207 12580 13089 --
NM_015051chr922658 753 22079 1232 ----
NM_015057chr13------1252
NM_015062chr10--1267 ----
NM_015064chr12113634 3569 3405 3061 2694 2682 2672 2566 2537 293 26 ------
NM_015068chr743142 1555 1549 106 11498 2152 91 --
NM_015069chr161129 --164 --
NM_015071chr575982 5223 4731 2569 1248 157 87 --31836 1304 74 --
NM_015073chr1921708 381 --1761 --
NM_015074chr114010 --14345 --
NM_015075chrX81878 1756 1468 716 559 449 440 232 --12164 --
NM_015076chr654429 4385 3993 3626 99 11471 ----
NM_015077chr17134574 4522 4461 4244 3907 1626 1426 1133 955 844 668 520 241 ----14681
NM_015079chr1523118 3095 --22324 632 --
NM_015080chr11----1891 --
NM_015082chr532445 806 708 ------
NM_015090chr166133 5787 5474 4638 3968 997 --11473 --
NM_015093chr61468 1333 ----
NM_015094chr22124528 4522 4515 3769 3660 3437 3118 1508 1329 350 280 256 --33736 1614 721 --
NM_015097chr352277 2266 2253 1683 431 ------
NM_015100chr121811 1741 ------
NM_015101chr131975 923 109 --21936 757 --
NM_015107chrX31625 745 732 --2758 597 --
NM_015115chr431264 841 30 11178 11135 --
NM_015125chr19196 ------
NM_015132chr732003 1855 1393 ------
NM_015133chr1641292 1275 1033 430 1979 ----
NM_015136chr31131 ------
NM_015138chr1552864 2826 2778 2339 2310 --1306 --
NM_015144chr1673802 3622 3405 3250 2622 1175 246 --1619 --
NM_015149chr122083 653 --2598 384 --
NM_015153chr6------1602
NM_015155chr1073191 2991 2460 2263 620 491 84 ------
NM_015156chr1464043 3932 3455 3193 2989 190 --11397 --
NM_015170chr81663 1165 ----
NM_015176chr11646 ------
NM_015186chr92432 396 ------
NM_015187chr41257 ------
NM_015192chr2022612 719 --32759 2286 37 --
NM_015194chr1741970 1882 524 34 ------
NM_015200chr411600 ------
NM_015205chr13164305 4247 4241 4165 4150 1906 1879 869 817 777 548 468 304 271 44 21 --2644 416 --
NM_015206chr1522584 990 --2787 528 --
NM_015209chr12601 490 ------
NM_015213chr113701 275 239 ------
NM_015215chr11327 ------
NM_015216chr511531 ------
NM_015225chr952138 2093 1197 741 117 12889 ----
NM_015236chr4----1479 --
NM_015250chr92131 26 ------
NM_015252chr2--1852 ----
NM_015254chr832487 2130 1036 --1856 --
NM_015264chr2284149 3550 3366 3225 3046 2975 1446 296 --1131 --
NM_015265chr2----12174 11664
NM_015267chr1251402 829 719 590 192 1463 ----
NM_015269chr11460 ------
NM_015270chr1242230 1960 584 186 --1876 --
NM_015272chr1611760 ------
NM_015278chr623082 1218 --11022 --
NM_015282chr232151 1134 895 1330 ----
NM_015284chr171963 1599 1369 722 497 205 29 ------
NM_015288chr5133768 3718 3509 3385 3319 3066 2616 2609 891 721 335 114 72 --21289 1044 1222
NM_015294chr171930 ------
NM_015299chr1463767 3029 2806 1237 481 135 ------
NM_015310chr877301 7219 7163 5921 5489 2570 1206 22296 1220 ----
NM_015315chr542823 2583 2193 1170 ------
NM_015317chr252580 2216 2164 2137 778 --1935 --
NM_015326chr132944 2454 2261 --2370 280 12611
NM_015328chr732742 2111 206 --32380 1144 1034 --
NM_015331chr1185 ------
NM_015336chr1242593 1987 1842 190 ------
NM_015344chr821984 1965 --153 --
NM_015346chr1431680 1165 376 ------
NM_015347chr1222385 351 ------
NM_015349chr622832 424 ------
NM_015353chr1722744 94 11125 ----
NM_015358chr211147 ------
NM_015361chr22736 243 ------
NM_015365chrX31620 812 24 13189 ----
NM_015375chr194651 4285 3818 3616 1974 1903 1270 931 60 --13335 --
NM_015385chr1063130 2892 1212 624 252 239 11129 1758 --
NM_015387chr21360 ------
NM_015388chr61112 ------
NM_015396chr32303 234 ------
NM_015397chr92774 494 --11582 --
NM_015435chr811277 ------
NM_015436chr433241 271 205 ------
NM_015442chr3--1221 156 --
NM_015443chr171362 --11110 --
NM_015455chr523922 1457 --180 --
NM_015457chr1121114 62 ------
NM_015460chr32307 120 ------
NM_015463chr2123 ------
NM_015464chr7181 ------
NM_015477chr152171 127 ------
NM_015488chr241610 579 562 48 --1618 --
NM_015497chr1521150 33 ------
NM_015503chr161207 --1611 --
NM_015508chr311417 ------
NM_015509chr1221169 162 ------
NM_015516chr1151346 1202 463 413 23 ------
NM_015520chr31384 ------
NM_015541chr34998 955 404 89 ------
NM_015550chr712630 ----13115
NM_015554chr1562924 2473 919 785 326 291 ------
NM_015557chr152511 877 682 618 64 --12958 12290
NM_015564chr532496 2275 2249 13261 ----
NM_015567chr131296 --21271 999 --
NM_015568chr2024019 2901 --1942 13467
NM_015569chr134810 2976 1585 1452 11150 --
NM_015577chr53394 79 73 ------
NM_015578chr1911304 --11282 --
NM_015584chr1761248 1064 340 330 97 35 --1491 --
NM_015601chr10--1901 --1771
NM_015609chr121990 312 12515 1320 --
NM_015630chr21976 ------
NM_015640chr143955 3720 3685 1922 --24038 949 --
NM_015642chr31288 ------
NM_015646chr1231285 1016 246 1148 ----
NM_015649chr19----123 --
NM_015657chr22792 197 ------
NM_015680chr2----1625 --
NM_015686chrX42288 1861 896 497 --2946 732 --
NM_015691chrX42896 2156 882 642 11172 11845 --
NM_015695chr631688 1432 1414 --11331 --
NM_015713chr843605 3296 2782 207 --13356 --
NM_015833chr2122030 1579 --3895 834 432 12070
NM_015840chr132057 1007 278 --12479 --
NM_015841chr132057 1007 278 --12479 --
NM_015859chr141134 ------
NM_015866chr121019 443 ------
NM_015879chr18108402 8237 8202 7600 7288 3256 3248 1276 865 110 13321 35256 1341 880 15771
NM_015886chr834397 2125 1686 11471 14376 --
NM_015891chr651795 1434 1331 1260 763 ------
NM_015898chr1921965 1755 --1659 --
NM_015906chr124258 371 1531 ----
NM_015910chr22566 544 ------
NM_015912chr812114 1314 11745 --
NM_015955chr21527 ------
NM_015963chr2----139 --
NM_015976chr11324 ------
NM_015980chr531347 1032 285 ------
NM_015981chr562667 2598 2303 1044 194 127 ------
NM_015982chr171370 ------
NM_015995chr15165366 5228 4896 4841 4545 4190 4115 4033 4006 2034 1807 1740 1699 1303 792 26 1851 23771 1827 --
NM_016019chr721004 764 1856 ----
NM_016022chr11936 --1917 --
NM_016023chr821514 86 1130 ----
NM_016025chr164420 252 236 107 ------
NM_016032chrX21216 507 --1332 --
NM_016037chr11881 ------
NM_016041chr171332 ------
NM_016059chr63973 809 319 ------
NM_016072chr12----11672 --
NM_016076chr132874 925 713 ------
NM_016083chr623201 275 11452 ----
NM_016084chr171146 ------
NM_016096chr81117 ------
NM_016107chr521162 552 ------
NM_016120chrX1904 ------
NM_016125chr17289 23 ------
NM_016126chr1160 ------
NM_016131chr212137 --1752 --
NM_016147chr113999 881 76 --165 --
NM_016152chr31216 1887 ----
NM_016172chr92394 31 ------
NM_016201chr372354 2105 1896 286 68 58 31 --1610 --
NM_016206chr379006 8714 7669 7126 6007 2652 1643 27935 7767 --13046
NM_016217chr622911 930 1135 ----
NM_016224chr631567 682 624 ------
NM_016227chr121018 391 11529 ----
NM_016231chr171419 --11687 --
NM_016235chr161103 --11248 --
NM_016248chr1323534 3525 ------
NM_016255chr662999 2847 1224 521 107 56 --13179 --
NM_016257chr12992 45 --33160 3147 1249 --
NM_016260chr277526 7257 2980 2204 946 642 340 --26902 5348 --
NM_016269chr4----1161 --
NM_016272chr2231848 586 469 --2748 608 --
NM_016284chr161823 ------
NM_016287chr131476 608 501 ------
NM_016290chr5151 ------
NM_016297chr263618 3419 3385 2886 2579 2284 1103 1786 --
NM_016308chr121361 169 11467 --11509
NM_016311chr1--193 ----
NM_016315chr211768 --11672 1540
NM_016316chr2----1655 --
NM_016320chr1141109 1006 324 87 ------
NM_016322chr913167 ------
NM_016338chr511049 ------
NM_016339chr1721574 1215 ------
NM_016356chr632562 634 274 ----1173
NM_016357chr12152 ------
NM_016374chr1----150 --
NM_016374chr1----150 --
NM_016377chr61342 --11236 --
NM_016396chr152916 397 177 ----
NM_016422chr1121113 198 ------
NM_016424chr1721747 289 ------
NM_016433chr122581 39 1527 ----
NM_016436chr2022317 297 --1161 11897
NM_016441chr212153 ------
NM_016456chr11701 --176 --
NM_016463chr5142 ------
NM_016470chr20----181 --
NM_016480chr5192 ------
NM_016484chrX2571 70 ------
NM_016505chr11561 1719 ----
NM_016507chr17--1154 1115 --
NM_016513chr653268 3255 2680 2652 1292 23497 745 ----
NM_016516chr21759 ------
NM_016522chr1131309 1068 378 ------
NM_016530chr152570 69 ----11537
NM_016531chr413323 --1724 --
NM_016532chr1751189 851 787 422 192 --11026 --
NM_016538chr171133 ------
NM_016542chrX------11360
NM_016548chr931388 1170 486 21464 549 1617 --
NM_016569chr1241230 1073 611 246 ------
NM_016570chr121482 ------
NM_016588chr61350 --1665 --
NM_016598chr321459 1105 --124 --
NM_016603chr51611 1138 ----
NM_016604chr51139 ------
NM_016605chr542516 1890 1775 27 ----153
NM_016621chr1153779 3561 3363 3215 3187 1478 1795 --
NM_016623chr81222 ------
NM_016641chr1621616 444 11319 1129 --
NM_016644chr5--1448 ----
NM_016654chr151283 ------
NM_016733chr2221090 131 1411 11599 --
NM_016823chr1711223 --1847 --
NM_016829chr34316 272 242 62 ------
NM_016830chr12195 ------
NM_016834chr1772703 1158 683 639 533 269 150 --31134 1067 975 --
NM_016835chr1772703 1158 683 639 533 269 150 --31134 1067 975 --
NM_016841chr1772703 1158 683 639 533 269 150 --31134 1067 975 --
NM_016937chrX1304 ------
NM_016940chr213614 475 31 ------
NM_016950chr4--1262 ----
NM_016952chr1122646 2486 ----11039
NM_017415chr563784 3726 3252 1745 1056 557 --21663 749 --
NM_017423chr421671 666 ------
NM_017447chr212961 449 --1534 --
NM_017449chr171671 1640 1202 441 119 112 98 --11212 --
NM_017452chr20--21534 1387 1209 --
NM_017453chr20--21534 1387 1209 --
NM_017454chr20--21534 1387 1209 --
NM_017455chr151311 ------
NM_017456chr1741580 1465 1315 201 ------
NM_017488chr231524 535 217 ------
NM_017519chr62946 46 --1275 --
NM_017522chr11987 --1273 --
NM_017548chr331706 1565 64 ------
NM_017550chr194796 367 326 52 --1250 --
NM_017559chr172216 200 ------
NM_017563chr395932 5861 5642 4710 4076 3893 1688 384 29 ------
NM_017572chr19162 ------
NM_017582chr11573 --11497 --
NM_017593chr4195 ----1400
NM_017594chr922224 952 ------
NM_017607chr192556 173 ------
NM_017610chr1522087 1906 ------
NM_017617chr941441 1185 448 348 --1493 --
NM_017623chr231834 710 107 ------
NM_017628chr413795 ------
NM_017629chr12501 182 ------
NM_017631chr4156 ------
NM_017633chr621386 34 --23790 1474 --
NM_017635chr111318 ------
NM_017636chr191329 --1131 --
NM_017637chr969484 6105 5947 1066 1035 139 13117 38022 6042 549 --
NM_017643chr171845 --183 --
NM_017645chr942513 768 396 255 --12008 --
NM_017646chr11480 ------
NM_017650chr765226 4918 2055 1442 807 305 11954 --13781
NM_017658chr1421664 586 12841 ----
NM_017661chr151116 ------
NM_017666chrX31838 1592 1403 22039 160 ----
NM_017672chr153504 382 60 ------
NM_017686chr1141 --1183 --
NM_017709chr133354 996 365 --23523 1419 14224
NM_017737chr111953 ------
NM_017738chr92408 185 ------
NM_017739chr11107 ------
NM_017740chr1631567 407 217 ------
NM_017741chr452307 2236 640 411 340 ------
NM_017742chr1821777 1767 --11926 --
NM_017744chr122170 951 12080 1262 --
NM_017754chr643550 1980 476 397 21758 98 34917 3255 314 --
NM_017770chr632959 2090 1004 ------
NM_017772chr61178 --166 --
NM_017778chr821352 1339 ------
NM_017798chr2011183 1199 ----
NM_017811chr943156 1022 889 75 ------
NM_017813chr824878 102 13962 ----
NM_017824chr1012655 ------
NM_017842chr124695 689 622 284 --1718 --
NM_017848chrX23119 2841 ------
NM_017849chr241143 1090 820 495 12426 ----
NM_017851chr1531091 1037 27 11247 ----
NM_017880chr2--1460 ----
NM_017893chr1011365 --161 --
NM_017907chr111352 1107 ----
NM_017910chr21256 ------
NM_017911chr2211522 --21346 970 --
NM_017913chr91433 ------
NM_017919chr954973 4882 4493 1848 1554 15230 1110 --
NM_017933chr22443 39 --1351 --
NM_017938chrX21721 461 ------
NM_017944chr1142803 2404 396 76 1336 1166 --
NM_017946chr721430 1359 --1525 --
NM_017954chr711223 ------
NM_017964chr22384 308 ------
NM_017982chr1170 ------
NM_018013chr652866 2090 1867 633 129 ------
NM_018014chr21168 ------
NM_018027chr1021292 141 1794 12279 --
NM_018043chr1111074 1195 ----
NM_018054chr162669 172 ------
NM_018061chr1--1341 ----
NM_018084chr232386 2322 432 ------
NM_018085chr178106 7460 6269 5310 2544 1761 175 36341 1970 371 ----
NM_018086chr221755 491 ------
NM_018092chr1611528 ------
NM_018098chr321148 1079 ------
NM_018107chr145854 799 339 140 48 ------
NM_018110chr164889 433 339 172 ------
NM_018120chr81188 ------
NM_018121chr1042902 350 164 123 --12312 --
NM_018126chr4--11541 ----
NM_018128chr1731305 479 222 ------
NM_018131chr101626 --1902 --
NM_018133chr33887 881 305 1404 1526 --
NM_018145chr15--136 ----
NM_018155chr343215 977 510 253 ------
NM_018157chr1211278 --12595 --
NM_018159chrX11629 ------
NM_018193chr151171 ------
NM_018195chr1142020 1738 1646 829 ------
NM_018200chr1572191 2021 1815 986 419 241 149 11048 1851 --
NM_018203chr11599 --188 --
NM_018206chr161505 ----1313
NM_018214chr621262 902 ------
NM_018224chr7----165 --
NM_018243chr443581 3086 2741 2488 ------
NM_018266chr311061 ------
NM_018293chr312919 ------
NM_018299chr822606 399 23490 1193 12735 --
NM_018302chr4--1795 12076 --
NM_018312chr1122130 92 ------
NM_018313chr342458 1947 529 58 --1134 --
NM_018320chr1111240 --2845 116 --
NM_018323chr431725 1670 1332 ------
NM_018330chr1021156 347 --1313 --
NM_018339chr911720 1293 ----
NM_018340chr1674669 1769 1699 1086 782 720 429 --34045 3621 671 --
NM_018357chr151376 ------
NM_018362chr1122808 2612 11197 ----
NM_018364chr133537 921 228 --11538 --
NM_018373chr1496368 6144 5112 2078 1871 1542 1523 1446 577 16342 11181 12460
NM_018374chr723904 559 1319 ----
NM_018375chr1461723 1676 1340 674 408 71 ------
NM_018387chr91411 ------
NM_018388chrX21138 980 ------
NM_018403chr343884 3292 2917 898 ------
NM_018406chr3267 24 ------
NM_018412chr72106 36 ------
NM_018416chr123475 143 35 ----12200
NM_018424chr921174 704 --21830 1276 --
NM_018439chr1811797 12498 ----
NM_018440chr8117694 7409 6487 5868 5760 5518 3324 3098 2634 423 374 37382 5648 5528 16630 17823
NM_018442chr11354 ------
NM_018445chr151197 ------
NM_018448chr121823 ------
NM_018452chr6_random13010 --12631 --
NM_018462chr32574 49 ------
NM_018469chr172102 63 --11369 --
NM_018471chr21176 ------
NM_018482chr81120 32463 2258 887 ----
NM_018489chr11121 1889 ----
NM_018490chr111113 ------
NM_018553chr1721425 135 ------
NM_018566chr175069 4660 4362 3171 2065 1627 1308 13586 ----
NM_018602chr1521703 1260 11196 ----
NM_018638chr1234829 2051 1405 34558 2076 873 11601 15053
NM_018640chr1232270 722 259 1592 12459 --
NM_018652chr152184 38 ------
NM_018660chr822813 47 ------
NM_018667chr1662440 1142 699 521 231 60 --12514 --
NM_018693chr21114 ------
NM_018695chr53748 730 247 ------
NM_018699chr41290 ------
NM_018703chr161380 ------
NM_018708chr1941406 583 428 339 --11062 --
NM_018710chr8158 ------
NM_018715chr151819 1643 1404 665 408 --1513 --
NM_018717chr441902 835 816 547 ------
NM_018718chr731828 740 171 ------
NM_018834chr541011 843 718 260 ------
NM_018890chr721230 492 11404 ----
NM_018898chr52420 25 --1404 --
NM_018899chr52420 25 --1404 --
NM_018900chr52420 25 --1404 --
NM_018901chr52420 25 --1404 --
NM_018902chr52420 25 --1404 --
NM_018903chr52420 25 --1404 --
NM_018904chr52420 25 --1404 --
NM_018905chr52420 25 --1404 --
NM_018906chr52420 25 --1404 --
NM_018907chr52420 25 --1404 --
NM_018908chr52420 25 --1404 --
NM_018909chr52420 25 --1404 --
NM_018910chr52420 25 --1404 --
NM_018911chr52420 25 --1404 --
NM_018912chr541426 1345 1104 124 --21312 1156 --
NM_018913chr541426 1345 1104 124 --21312 1156 --
NM_018914chr541426 1345 1104 124 --21312 1156 --
NM_018915chr541426 1345 1104 124 --21312 1156 --
NM_018916chr541426 1345 1104 124 --21312 1156 --
NM_018917chr541426 1345 1104 124 --21312 1156 --
NM_018918chr541426 1345 1104 124 --21312 1156 --
NM_018919chr541426 1345 1104 124 --21312 1156 --
NM_018920chr541426 1345 1104 124 --21312 1156 --
NM_018921chr541426 1345 1104 124 --21312 1156 --
NM_018922chr541426 1345 1104 124 --21312 1156 --
NM_018923chr541426 1345 1104 124 --21312 1156 --
NM_018924chr541426 1345 1104 124 --21312 1156 --
NM_018925chr541426 1345 1104 124 --21312 1156 --
NM_018926chr541426 1345 1104 124 --21312 1156 --
NM_018927chr541426 1345 1104 124 --21312 1156 --
NM_018928chr541426 1345 1104 124 --21312 1156 --
NM_018929chr541426 1345 1104 124 --21312 1156 --
NM_018945chr683683 2942 1215 1072 812 638 182 93 12579 ----
NM_018948chr111084 ------
NM_018959chr191215 ------
NM_018968chr2--1130 ----
NM_018970chr722555 2360 1315 13176 --
NM_018976chr1211807 ------
NM_018979chr1222372 2175 1933 ----
NM_018999chr1054241 4134 1608 911 807 --13900 21139 619
NM_019000chr511371 --11074 --
NM_019001chr334831 3268 3170 ------
NM_019004chr71708 ------
NM_019005chr7190 ------
NM_019024chr2178 --161 --
NM_019030chr5--1213 ----
NM_019046chr103985 768 697 ------
NM_019050chr431424 795 592 --1134 --
NM_019055chr112509 239 1631 ----
NM_019063chr222262 1442 ------
NM_019066chr15----149 --
NM_019071chr7--1635 ----
NM_019072chr553644 3555 3416 2848 454 --1743 --
NM_019084chr1022094 311 ------
NM_019091chr2----1420 --
NM_019096chr66698 428 373 127 76 62 ------
NM_019102chr7--1158 ----
NM_019102chr7--1158 ----
NM_019106chr2253151 2822 2585 2526 546 --43251 3072 2219 713 12718
NM_019114chr922479 2203 ------
NM_019116chr1643196 2402 2369 899 ------
NM_019555chr311695 ------
NM_019557chr1----1575 --
NM_019558chr21121 ------
NM_019593chr2022140 561 12608 ----
NM_019594chr931641 1161 545 --1133 --
NM_019610chr11432 --21507 567 --
NM_019613chr1731205 1070 88 --1240 --
NM_019842chr61402 ------
NM_019845chr21270 ------
NM_019848chrX1137 ------
NM_019860chr1011037 ------
NM_019885chr231087 591 215 ------
NM_019891chr11480 ------
NM_019895chr3131 ------
NM_020039chr121636 ------
NM_020122chr295655 5009 4935 4865 4380 3733 3659 711 106 ------
NM_020123chr1031383 1354 473 ------
NM_020132chr21124970 4889 4842 4816 4479 4343 3825 3633 1956 1127 1114 824 ------
NM_020134chr2--1759 ----
NM_020137chrX1177 --1344 --
NM_020139chr42282 137 --1627 --
NM_020148chr1832067 869 276 ------
NM_020150chr1011938 ------
NM_020151chr241366 1200 624 192 --1441 --
NM_020154chr151218 1253 ----
NM_020155chr111104 ------
NM_020159chr411069 1154 ----
NM_020177chr512398 23246 2086 ----
NM_020178chr17----11214 --
NM_020182chr2022971 1088 --1792 --
NM_020194chr22182 94 ------
NM_020199chr52368 294 11092 ----
NM_020204chr11159 ------
NM_020214chr151106 ------
NM_020239chr132160 1976 180 ------
NM_020240chr53991 954 170 12035 ----
NM_020246chr71296 --184 --
NM_020310chr1792462 1788 828 721 683 617 476 271 174 --12566 --
NM_020336chr2011149 1979 11057 --
NM_020337chr4156 12510 ----
NM_020338chr1072875 2763 2713 1224 912 694 21 ------
NM_020341chr2021429 500 --1207 --
NM_020342chr222295 995 ------
NM_020346chr1121562 351 ------
NM_020362chr11294 ------
NM_020381chr631954 1712 815 ------
NM_020384chrX21856 69 --1136 --
NM_020403chr1311322 ------
NM_020405chr1773349 3151 2880 1199 1128 866 37 --12905 --
NM_020416chr431770 1035 722 ------
NM_020420chrY11440 ------
NM_020425chr61386 2621 176 ----
NM_020429chr762726 1151 887 855 271 38 ------
NM_020432chr72323 75 ------
NM_020437chr221330 ------
NM_020438chr921252 1062 --11131 --
NM_020440chr143066 2998 1112 1029 --1866 --
NM_020443chr197005 6937 6368 6336 6106 4596 4537 4408 1867 11033 26439 2542 --
NM_020445chr72168 73 ------
NM_020449chrX1587 --1105 --
NM_020452chr131874 1593 58 ------
NM_020455chr632821 2804 2012 --21925 1890 --
NM_020456chr1332042 414 358 ------
NM_020457chr161603 --2525 63 --
NM_020463chr23954 936 418 ------
NM_020473chrX21899 230 1608 --11600
NM_020474chr18147 1135 ----
NM_020482chr6--148 ----
NM_020525chr122468 173 ------
NM_020530chr223882 251 117 1111 ----
NM_020546chr542672 1991 617 187 ------
NM_020640chr312290 --21718 210 --
NM_020644chr11----1692 --
NM_020647chr831847 1500 244 --1328 --
NM_020654chr32515 414 ------
NM_020673chr2066556 6502 6367 5629 2821 1162 --47371 5623 2766 908 15732
NM_020676chr31276 1829 ----
NM_020680chr11195 ------
NM_020689chr2051110 688 676 91 61 ------
NM_020692chr143868 714 100 11073 ----
NM_020699chr154475 4363 3848 1839 221 11388 ----
NM_020713chr2053130 1255 571 373 141 --22343 967 --
NM_020717chrX84851 4233 3912 3660 3450 1989 1873 430 24353 1717 13064 24256 777
NM_020718chr16126449 5973 5548 5424 5137 4719 4622 4573 2571 1437 803 197 ------
NM_020727chr2111257 --11182 --
NM_020728chr742779 2342 1139 1080 ------
NM_020732chr62946 46 --1275 --
NM_020734chr1233311 474 287 ------
NM_020740chr171387 ------
NM_020742chrX----12186 --
NM_020747chr51855 --1372 --
NM_020749chr821824 1755 ------
NM_020755chr61444 11523 --1243
NM_020766chrX23766 411 1531 13787 --
NM_020771chr621397 421 ------
NM_020772chr1726223 3240 25789 935 ----
NM_020774chr1845059 4643 1879 1732 ----1762
NM_020778chr15154517 3946 3719 3665 3412 3133 1999 1945 1672 1626 1449 971 518 300 213 13020 ----
NM_020783chr182935 907 --11767 --
NM_020791chr1721217 457 ------
NM_020794chr111593 ------
NM_020801chr511741 1363 ----
NM_020805chr1821721 456 1732 1485 --
NM_020807chr1651777 1537 1300 1126 174 ------
NM_020808chr11726 ------
NM_020810chr1463390 3320 3146 1403 1266 165 13029 ----
NM_020814chr231307 197 26 --11274 --
NM_020820chr2081463 1273 1000 605 342 332 165 27 --11089 --
NM_020830chr21104 1799 ----
NM_020841chr12--13408 23948 3813 --
NM_020844chr846418 2879 1423 830 --11462 --
NM_020845chr1272429 760 728 707 512 364 136 ------
NM_020850chr1672914 2871 2386 1250 1213 1162 805 --22788 677 --
NM_020854chr1821530 1415 --1992 --
NM_020858chr153966 270 169 1355 ----
NM_020865chr3143 ------
NM_020868chr22339 115 ------
NM_020871chrX22502 110 --11920 --
NM_020872chr31521 ------
NM_020896chr115883 756 277 146 107 ------
NM_020899chr1721734 1687 --12411 --
NM_020925chr1------11180
NM_020935chr224472 1285 14446 ----
NM_020940chr1012735 ------
NM_020946chr951507 1497 1415 1383 78 ------
NM_020947chr1641783 598 234 117 --22038 1925 --
NM_020948chr122731 1392 12340 ----
NM_020956chr1973918 3754 3622 3513 923 838 831 150 34240 3613 206 --
NM_020962chr1521799 1683 --12158 1305
NM_020972chr441103 763 104 61 --3413 364 98 --
NM_020977chr44887 856 760 428 ------
NM_020981chr21662 ------
NM_020983chr1242230 1960 584 186 --1876 --
NM_020988chr1641155 534 495 462 --1470 --
NM_020993chr1262575 2389 2267 2042 1018 159 12196 ----
NM_021005chr151244 ------
NM_021007chr212263 11639 1263 --
NM_021013chr17139 ------
NM_021020chr883543 3490 3480 3153 1198 486 336 104 --1936 --
NM_021032chr322024 1687 12060 ----
NM_021035chr204880 343 272 36 ------
NM_021064chr661317 1290 1256 526 498 68 1423 --1268
NM_021069chr441913 754 159 29 ------
NM_021079chr1742767 1285 1083 33 ------
NM_021081chr20125 ------
NM_021090chr2264918 4740 4503 3131 1389 1122 13152 11177 14853
NM_021097chr232036 1916 215 ------
NM_021109chrX2339 162 ------
NM_021109chrX2339 162 ------
NM_021120chrX62918 2637 1252 1008 292 99 ------
NM_021127chr1811356 ----1550
NM_021136chr141183 ------
NM_021140chrX1725 ------
NM_021145chr7--1286 ----
NM_021155chr1912156 ----11042
NM_021183chrX125 ------
NM_021188chr142522 129 ------
NM_021190chr11225 ------
NM_021194chr11111 ------
NM_021215chr2021692 1650 ------
NM_021218chr93986 915 278 155 ----
NM_021229chr121360 ------
NM_021238chr12--11820 1646 --
NM_021239chr141251 ------
NM_021242chrX4757 690 347 169 ------
NM_021253chr621147 933 ------
NM_021255chr1454091 3963 3447 3094 2883 158 12544 --
NM_021267chr19121252 1206 1023 900 875 526 302 228 162 109 72 53 11387 ----
NM_021619chr93938 239 214 --11181 --
NM_021622chr1021573 697 1874 ----
NM_021630chr81333 --1241 --
NM_021637chrX------1253
NM_021638chr4114208 4153 3727 3636 3596 3102 1618 1318 904 651 436 --43505 3348 1941 307 --
NM_021643chr221679 267 --1276 --
NM_021647chr453861 1635 866 516 127 181 ----
NM_021648chr642308 784 501 180 12756 ----
NM_021649chr511159 ------
NM_021738chr10132 ------
NM_021813chr685356 5234 4735 4102 3563 1978 1383 856 13794 11876 --
NM_021911chr555085 5034 3898 2259 1556 14871 --12010
NM_021912chr1543378 1351 627 508 13750 13671 --
NM_021913chr1941840 1763 697 53 ------
NM_021914chr141826 1176 ----
NM_021931chr2041063 414 343 283 ------
NM_021943chr691794 1782 773 726 518 495 480 289 213 --11488 --
NM_021947chr171495 ------
NM_021956chr61118 1381 ----
NM_021959chr6----2683 61 --
NM_021960chr142513 2193 1969 196 ------
NM_021961chr1177516 6323 5183 2840 2826 1270 132 ------
NM_021962chr1732285 2230 608 ------
NM_021964chr346668 5824 4567 701 11962 ----
NM_021967chr521009 78 ----1866
NM_021973chr41564 ----1483
NM_021976chr6186 ------
NM_021998chrX31460 443 49 1934 ----
NM_022037chr22276 40 ------
NM_022047chr63314 296 53 ------
NM_022048chr15116376 5885 5309 5129 4433 4339 1990 1488 866 186 68 22255 1270 16200 --
NM_022051chr1--1231 ----
NM_022060chr1441128 1060 996 42 ------
NM_022062chr1131469 1439 1371 --11553 --
NM_022068chr18----1225 --
NM_022073chr1421229 112 ------
NM_022075chr11608 --176 --
NM_022079chr10--1901 --1771
NM_022085chr621252 455 --3542 220 76 --
NM_022107chr6133 ------
NM_022129chr102562 304 --1951 --
NM_022133chr811740 ------
NM_022137chr142625 264 1602 ----
NM_022140chr541628 921 421 48 11506 ----
NM_022154chr421171 993 ------
NM_022166chr1694394 3907 2420 2384 2307 2226 1167 125 24 --12077 --
NM_022173chr22276 40 ------
NM_022336chr242264 2104 1942 1924 ------
NM_022351chr813499 ----12363
NM_022355chr16129 ------
NM_022361chr62392 128 ------
NM_022454chr81162 ------
NM_022459chr1366198 5514 4517 2345 1665 884 22317 800 1102 --
NM_022462chr1943749 3535 2903 1168 ------
NM_022465chr123313 306 113 ------
NM_022470chr331241 1170 243 ------
NM_022473chr1563914 3354 3222 1611 1511 536 --21146 71 --
NM_022474chr1452377 2074 1813 557 541 ------
NM_022476chr161720 ------
NM_022477chr20--11393 2481 114 --
NM_022482chr2082475 2262 2088 2052 1688 1585 474 212 --12351 --
NM_022483chr51682 --21891 1712 --
NM_022484chr731264 106 63 ------
NM_022494chr101172 ------
NM_022497chr393837 1221 1202 938 878 699 668 646 311 ----13030
NM_022557chr171199 ------
NM_022566chr152524 154 ------
NM_022572chr241610 579 562 48 --1618 --
NM_022574chr762086 1418 820 600 510 485 ------
NM_022640chr171197 ------
NM_022659chr81184 ------
NM_022719chr2252821 1373 1059 966 129 --1756 --
NM_022735chr1--1241 1451 --
NM_022751chr181223 ------
NM_022754chr531662 147 36 ------
NM_022757chr31992 ------
NM_022758chr672954 2616 2560 2235 1164 242 218 --1287 --
NM_022763chr352896 1239 1126 532 372 11211 ----
NM_022776chr321382 490 ------
NM_022787chr172224 1881 917 846 616 545 296 ------
NM_022821chr11371 ------
NM_022823chr21110 ------
NM_022824chr521562 335 ----1534
NM_022825chrX153 ------
NM_022826chr21853 ------
NM_022832chr41277 1641 ----
NM_022836chr141828 1776 529 427 ------
NM_022841chr152652 496 --11817 --
NM_022845chr1622225 1674 ------
NM_022893chr22957 863 12955 ----
NM_022894chr23486 317 60 ------
NM_022897chr52827 413 ------
NM_022898chr14104782 4276 3866 3739 3192 3116 3013 1583 1282 940 ------
NM_022912chr232641 2179 48 ------
NM_022918chr1111491 --1553 --
NM_022977chrX--12030 ----
NM_022978chr521009 78 ----1866
NM_023000chr1411732 ------
NM_023001chr1411732 ------
NM_023008chr193298 284 249 ------
NM_023009chr1----163 --
NM_023016chr211843 --12520 12322
NM_023035chr193316 155 79 ------
NM_023037chr131272 --1977 --
NM_023071chr123934 863 123 ------
NM_023076chr1652645 2541 2122 1120 75 --2793 359 --
NM_023079chr1721649 568 ------
NM_023929chr81331 ------
NM_023931chr1631541 256 227 11049 1384 --
NM_023940chr43968 928 215 ------
NM_024046chr32145 85 ------
NM_024052chr1741944 1909 1066 510 12924 12121 --
NM_024054chr72326 285 ------
NM_024068chr122412 101 ------
NM_024071chr14137 1488 ----
NM_024103chr1931299 94 51 1234 ----
NM_024117chr921050 574 ------
NM_024294chr672954 2616 2560 2235 1164 242 218 --1287 --
NM_024295chr871634 1300 680 632 495 337 23 ----11669
NM_024306chr164339 290 193 67 --1747 --
NM_024320chr173651 166 88 ------
NM_024328chr143502 210 147 ----1229
NM_024329chr161554 1278 1239 1111 410 201 ------
NM_024345chr954587 2416 1094 857 245 25742 5434 11327 --
NM_024423chr1834117 3729 338 --24146 2735 --
NM_024491chr31414 ------
NM_024501chr21203 ------
NM_024513chr363276 2790 2781 877 439 319 --23332 177 --
NM_024524chr3--11081 ----
NM_024525chr12498 204 ------
NM_024529chr121193 80 ------
NM_024539chrX1393 ------
NM_024541chr1021408 310 11749 ----
NM_024551chr121905 --31939 1818 73 --
NM_024551chr121905 --31939 1818 73 --
NM_024572chr2129 ------
NM_024574chr41330 ------
NM_024594chr521382 83 11860 ----
NM_024595chr131215 933 919 ------
NM_024596chr855053 4522 4300 1651 522 14145 1855 --
NM_024612chr1721129 968 --1860 --
NM_024613chr8--11304 ----
NM_024617chr91576 1678 133 --
NM_024631chr111635 1515 ----
NM_024636chr731969 456 248 12223 ----
NM_024639chr622123 1948 --12499 --
NM_024645chr81988 ------
NM_024657chrX1605 1252 ----
NM_024665chr343071 2980 2890 1527 21683 1183 ----
NM_024667chr1251425 1347 1074 526 478 --41622 1438 626 417 --
NM_024670chr1031684 1607 428 --1172 --
NM_024674chr132920 2873 2498 1403 ----
NM_024686chr12462 22 ------
NM_024689chrX41647 1292 707 195 ------
NM_024692chr211436 ----1650
NM_024700chr12843 212 ------
NM_024704chr202318 139 --1734 --
NM_024713chr15--11085 ----
NM_024742chr1621451 187 --1661 --
NM_024745chr163931 861 71 ------
NM_024749chr121810 816 1772 ----
NM_024772chr11419 ------
NM_024785chr22565 517 --11437 --
NM_024798chr1542327 1969 817 423 ------
NM_024811chr1151598 1545 1370 581 83 --11258 11456
NM_024825chr19----1288 --
NM_024828chr91624 1284 1380 --
NM_024834chr102540 486 ------
NM_024837chr1521690 507 1738 1196 --
NM_024863chrX128 ------
NM_024911chr1--1197 ----
NM_024915chr83924 701 564 --1306 --
NM_024930chr552681 2478 2450 1955 1943 ------
NM_024933chr24703 594 491 102 --168 --
NM_024946chr1631342 572 231 --1618 11721
NM_024947chr388336 6656 3252 3073 2357 1700 763 253 ------
NM_024949chr444763 3890 681 534 14491 21976 1321 --
NM_024953chr1222268 503 ------
NM_024954chr102568 420 ------
NM_024979chr1351601 1384 1290 652 224 --1455 --
NM_024989chr265855 5216 2802 2747 1446 1171 22657 1073 ----
NM_024991chr1063130 2892 1212 624 252 239 11129 1758 --
NM_025054chr843138 2924 160 66 33815 3079 2942 ----
NM_025074chr432007 1245 1182 13107 ----
NM_025080chr111113 11107 ----
NM_025090chr172402 197 --1331 --
NM_025099chr172970 121 --1981 --
NM_025106chr161706 1369 635 480 72 64 ------
NM_025133chr2131 ------
NM_025134chr162893 579 12018 ----
NM_025140chr121553 ------
NM_025146chr3----11030 1897
NM_025147chr22957 938 ------
NM_025179chr154337 3436 3422 3025 841 --13645 --
NM_025182chr9----1326 --
NM_025191chr111311 ----12153
NM_025221chr441252 956 348 199 ------
NM_025222chr372772 2692 2492 2421 2123 429 240 ------
NM_025224chr2042041 1832 711 87 --2832 473 --
NM_025230chr1431793 1626 346 21705 247 ----
NM_025235chr101223 ------
NM_025236chr6--1244 135 --
NM_025246chr3153 ------
NM_025248chr1752586 2101 696 294 51 ------
NM_025250chr792889 2190 728 687 490 311 209 77 63 --4704 443 419 133 --
NM_025257chr62346 275 ------
NM_030576chr1732591 1963 1620 11646 ----
NM_030583chr81367 ------
NM_030594chr1531255 1075 77 ------
NM_030621chr141363 ------
NM_030623chr21132 ------
NM_030625chr1022600 460 ------
NM_030627chr533630 2677 177 ------
NM_030634chr182456 2229 2036 1815 1612 975 144 114 22011 734 ----
NM_030640chr12--1348 ----
NM_030647chr764902 4145 2512 1585 496 22 --25047 2467 --
NM_030648chr464523 4493 4326 4149 3931 1206 --22202 1895 --
NM_030650chr244247 4176 1086 908 ------
NM_030664chr1052316 2116 1996 1811 776 ------
NM_030667chr1221230 493 ------
NM_030668chr1221230 493 ------
NM_030669chr1221230 493 ------
NM_030670chr1242262 1525 169 106 ------
NM_030671chr1242262 1525 169 106 ------
NM_030756chr101122 ------
NM_030759chr102272 164 ------
NM_030761chr152687 2218 267 243 216 --1352 --
NM_030762chr1231385 709 323 ------
NM_030786chr121902 1281 ------
NM_030791chr141482 2565 529 ----
NM_030797chr22258 119 ------
NM_030802chr171356 ------
NM_030806chr199110 8413 8254 7448 7079 6214 3329 2152 1058 27290 33 ----
NM_030808chr17----2284 149 --
NM_030810chr621252 455 --3542 220 76 --
NM_030816chr153577 3026 2782 2349 189 ------
NM_030820chr61307 1406 ----
NM_030912chr10----1587 --
NM_030915chr222371 676 ------
NM_030918chr1105424 5246 5167 4383 3393 3338 2113 812 793 123 ------
NM_030927chr1031177 1150 1040 --11419 --
NM_030937chr151424 1084 959 346 27 ------
NM_030962chr111306 ------
NM_030964chr553434 2707 998 677 595 --11337 --
NM_031157chr121472 ------
NM_031216chr18--2830 718 ----
NM_031243chr71175 ----1812
NM_031262chr9----1301 --
NM_031263chr9----1358 --
NM_031266chr51208 ------
NM_031267chr7----1466 --
NM_031268chr1685180 4518 4040 2149 1777 1365 490 62 13576 24312 1287 --
NM_031271chr831464 607 323 ------
NM_031283chr21643 ------
NM_031291chr4167 ------
NM_031296chr432741 1066 164 ------
NM_031297chr9122 1153 ----
NM_031305chr431539 192 88 ------
NM_031306chr12858 359 ------
NM_031369chr4--1597 ----
NM_031370chr4--1597 ----
NM_031371chr1----150 --
NM_031371chr1----150 --
NM_031411chr52420 25 --1404 --
NM_031417chr1941880 829 75 55 --1436 --
NM_031438chr51579 ------
NM_031439chr821770 1201 ------
NM_031445chr252569 2254 843 323 39 ------
NM_031449chr732237 1542 1474 11360 ----
NM_031453chr1032316 1934 672 1570 ----
NM_031459chr131018 493 465 ------
NM_031461chr832158 844 742 2449 323 ----
NM_031473chr121939 1431 ----
NM_031476chr1662759 2701 2348 2336 698 642 ------
NM_031483chr2022393 619 ------
NM_031844chr133990 3581 1453 ------
NM_031845chr212889 13029 22818 804 --
NM_031847chr212889 13029 22818 804 --
NM_031849chr52420 25 --1404 --
NM_031857chr52420 25 --1404 --
NM_031858chr1711371 ------
NM_031860chr52420 25 --1404 --
NM_031862chr1711371 ------
NM_031886chr19102522 2108 2037 1624 897 805 784 712 619 425 1837 ----
NM_031890chr2252463 2373 2328 1860 932 --2874 387 --
NM_031892chrX1733 --1757 --
NM_031936chr11257 ------
NM_031954chr1252890 2812 1853 854 430 ------
NM_031990chr194471 406 260 64 ------
NM_031991chr194471 406 260 64 ------
NM_032012chr985024 3935 3824 1891 1824 1669 1598 435 13410 --12004
NM_032013chr20--11393 2481 114 --
NM_032015chr113712 639 116 1234 ----
NM_032017chr161473 1375 352 142 104 35 --1612 --
NM_032027chr11281 ------
NM_032037chr19122 ------
NM_032047chr341918 1890 585 34 --12254 --
NM_032052chr2211141 ------
NM_032088chr541426 1345 1104 124 --21312 1156 --
NM_032092chr541426 1345 1104 124 --21312 1156 --
NM_032102chr1132535 2255 2185 1370 ----
NM_032105chr1106180 5050 5012 2936 2420 2349 1826 779 565 451 26188 2597 21279 915 --
NM_032124chr181247 1298 ----
NM_032127chr11127 ------
NM_032139chr192869 301 ------
NM_032144chr211650 ------
NM_032145chr61111 ------
NM_032146chr31458 ----1174
NM_032153chr361829 1081 712 699 397 385 --1627 --
NM_032160chr1843044 1674 968 811 11197 ----
NM_032169chr32565 176 ------
NM_032174chr11537 11473 ----
NM_032189chr13144107 4049 4043 3967 3952 1708 1681 671 619 579 350 270 106 73 --32007 446 218 --
NM_032236chr11902 ------
NM_032256chr121709 ------
NM_032281chr1953125 2394 1051 939 785 ------
NM_032288chr332088 1925 415 ------
NM_032294chr1751755 1306 1253 222 24 ------
NM_032320chr112595 33 --180 --
NM_032327chr102426 320 --1420 --
NM_032352chr141519 --1962 --
NM_032364chr121400 ------
NM_032373chr1054339 4260 487 198 190 --1127 14385
NM_032374chr1451849 1778 1580 1495 169 ------
NM_032376chr173558 49 40 ------
NM_032380chr5143 ------
NM_032403chr541426 1345 1104 124 --21312 1156 --
NM_032439chr101111 ------
NM_032440chr10--12908 ----
NM_032441chrX2413 113 ------
NM_032444chr16156 ------
NM_032445chr1522006 263 ------
NM_032446chr552852 2719 1223 80 26 --12362 --
NM_032457chr473736 2584 2386 1545 400 128 101 13791 ----
NM_032458chrX23096 735 12317 ----
NM_032466chr821654 1463 ------
NM_032468chr821654 1463 ------
NM_032491chr121339 --1275 --
NM_032505chr332260 1952 812 --1954 --
NM_032511chr6140 ------
NM_032523chr22543 430 ------
NM_032536chr92668 121 ------
NM_032538chr6102815 2757 2473 2270 2215 1083 554 381 320 63 --11892 --
NM_032547chr411121 ------
NM_032557chr4130 ------
NM_032574chr2135 ------
NM_032575chr1621584 1560 --1684 --
NM_032582chr1721521 79 ------
NM_032603chr22777 644 162 ----
NM_032664chr811674 1184 ----
NM_032682chr343594 2463 2227 772 ------
NM_032689chr1941463 1235 1026 444 1391 11293 --
NM_032711chr17103481 2812 2721 1579 1567 1434 1235 681 402 264 --13336 140
NM_032737chr1952196 1001 195 187 44 ------
NM_032741chr62919 168 ------
NM_032784chr61697 177 ----
NM_032796chrX2814 590 1759 ----
NM_032800chr152721 1758 738 581 78 ------
NM_032804chr1072356 1875 1740 508 224 218 113 --1714 --
NM_032810chr1031329 964 553 ------
NM_032837chr17--22147 681 12065 --
NM_032839chr31527 1414 ----
NM_032842chr73665 287 76 ------
NM_032846chr1431366 1114 463 --1609 --
NM_032859chr1353215 3085 2961 2806 611 ------
NM_032870chr61495 ------
NM_032873chr1154240 3080 1335 1122 829 24137 540 21764 1180 --
NM_032875chr171330 ------
NM_032884chr12365 117 ------
NM_032892chr15153 ------
NM_032895chr171787 ------
NM_032898chr31465 --1394 --
NM_032932chr17125927 5908 5849 5427 5282 4903 4663 4036 1798 581 492 116 16061 24756 4726 --
NM_032947chr52135 95 ------
NM_032949chr131545 --137 --
NM_032961chr42292 90 ------
NM_032968chrX2924 820 ----11406
NM_032969chrX2924 820 ----11406
NM_032983chr742928 2289 2106 852 ------
NM_032995chr241649 1148 1082 274 --2144 72 --
NM_033012chr131797 --1873 --
NM_033020chr124258 371 1531 ----
NM_033023chr731043 898 382 --11089 --
NM_033036chr1151442 1425 1340 1249 224 ----11361
NM_033055chr1--1236 ----
NM_033081chr201440 11143 ----
NM_033082chr12163 ------
NM_033121chr122651 277 ------
NM_033129chr2041944 1486 1339 228 11550 22073 645 --
NM_033132chr1321871 764 ------
NM_033133chr1753696 1345 1156 442 277 12402 --13755
NM_033136chr511786 ------
NM_033137chr511786 ------
NM_033138chr712189 ------
NM_033139chr712189 ------
NM_033140chr712189 ------
NM_033141chr1462203 2132 1751 801 311 219 11413 31619 1557 157 11665
NM_033150chr12172 ------
NM_033157chr712189 ------
NM_033181chr623201 275 11452 ----
NM_033201chr165851 825 162 137 26 ------
NM_033224chr756279 5314 5243 1021 111 13005 --12585
NM_033227chr5--1559 ----
NM_033260chr61614 ------
NM_033274chr543584 508 92 64 --41306 985 927 631 12342
NM_033285chr833183 1435 1208 ------
NM_033290chrX63688 2438 2308 1472 1071 687 ----153
NM_033300chr11987 --1273 --
NM_033315chr1712004 ------
NM_033326chr1132022 2014 1791 ------
NM_033331chr923164 1241 --1972 --
NM_033337chr32791 264 ------
NM_033360chr1223300 2929 1902 2781 698 --
NM_033380chrX1710 2397 116 ----
NM_033381chrX1710 2397 116 ----
NM_033389chr17103757 3696 3619 3583 3467 1638 1571 1441 1199 975 --11952 --
NM_033394chr241160 288 130 100 ------
NM_033396chr111424 ------
NM_033420chr1941139 250 145 82 ------
NM_033421chr2041229 587 528 408 --124 --
NM_033425chr1183364 2924 2905 2836 2504 1359 745 141 11222 140 --
NM_033426chr1422956 2613 12273 ----
NM_033427chr71595 ------
NM_033430chr493853 3136 2688 2667 2569 740 641 206 112 ------
NM_033437chr493853 3136 2688 2667 2569 740 641 206 112 ------
NM_033449chr5----21673 366 --
NM_033495chrX1890 ------
NM_033496chr101222 ------
NM_033497chr101222 ------
NM_033498chr101222 ------
NM_033500chr101222 ------
NM_033504chr1------134
NM_033505chr266621 6271 5252 4366 2257 1984 14955 ----
NM_033515chr611367 ------
NM_033542chr202688 275 ------
NM_033546chr181153 ------
NM_033549chr51935 ------
NM_033551chr542823 2583 2193 1170 ------
NM_033624chr121114 ------
NM_033642chrX11013 1147 ----
NM_033644chr542535 1584 61 53 ------
NM_033645chr542535 1584 61 53 ------
NM_033656chr2155546 5056 2129 1251 638 --31269 564 531 --
NM_044472chr11581 ------
NM_052837chr12192 31 ------
NM_052840chr1531060 1045 577 --1151 --
NM_052855chr173179 112 69 ------
NM_052864chr44782 490 388 368 11787 1831 --
NM_052868chr1----1228 --
NM_052872chr6144 ------
NM_052874chr163643 538 166 ------
NM_052879chr12------13558
NM_052880chr2221106 992 ------
NM_052896chr121826 137 ------
NM_052897chr122226 164 ------
NM_052898chr8163 ------
NM_052899chr56965 868 754 270 208 200 ------
NM_052900chr82478 111 --11716 --
NM_052910chr132670 435 1679 ----
NM_052911chr18----184 --
NM_052918chr1031367 752 722 --12917 --
NM_052947chr182515 68 --126 --
NM_052953chr3--1229 ----
NM_053016chr9107531 7491 6923 6759 6216 5788 5482 5245 3159 2814 26299 6235 12069 --
NM_053024chr31380 11131 ----
NM_053025chr32493 374 ------
NM_053026chr32493 374 ------
NM_053027chr32493 374 ------
NM_053028chr32493 374 ------
NM_053031chr32493 374 ------
NM_053032chr32493 374 ------
NM_053042chr432905 2253 1020 --2595 518 --
NM_053043chr755665 5439 1791 1119 611 14338 32174 905 109 --
NM_053056chr1172822 2726 2328 1941 969 802 586 1829 11150 --
NM_053064chr1432078 462 255 ------
NM_054016chr13726 655 169 ------
NM_054016chr13726 655 169 ------
NM_054016chr13726 655 169 ------
NM_054027chr532177 381 364 --11554 --
NM_054033chr23533 195 66 ------
NM_054035chr17----1711 --
NM_057089chr71336 ------
NM_057169chr1233055 1266 516 --12403 --
NM_057170chr1233055 1266 516 --12403 --
NM_057175chr412564 11952 ----
NM_057749chr82340 132 ------
NM_058167chr141115 1009 201 30 --2317 209 --
NM_058172chr421800 1368 ------
NM_058175chr214739 684 301 172 --1796 --
NM_058179chr92273 71 1839 ----
NM_058191chr211852 ------
NM_058241chr242002 1542 655 106 ------
NM_058241chr242002 1542 655 106 ------
NM_080392chr1187 ------
NM_080415chr172925 919 --140 --
NM_080422chr181292 ------
NM_080423chr181292 ------
NM_080476chr201124 --1296 --
NM_080491chr1173674 1547 1164 653 413 265 236 --33632 821 406 1534
NM_080546chr912301 11514 ----
NM_080594chr16160 ------
NM_080596chr6149 ------
NM_080629chr111547 ------
NM_080630chr111547 ------
NM_080645chr63667 483 337 ------
NM_080669chr1764415 4078 3253 3221 1360 431 --23690 1146 --
NM_080676chr2052785 2453 1042 367 292 ------
NM_080677chr171115 ------
NM_080679chr62823 692 ------
NM_080680chr62823 692 ------
NM_080681chr62823 692 ------
NM_080683chr41183 ------
NM_080684chr41183 ------
NM_080685chr41183 ------
NM_080759chr1322024 1029 ------
NM_080760chr1322024 1029 ------
NM_080792chr2022040 1788 ------
NM_080867chr1455014 4521 3845 3111 73 23458 429 ----
NM_080874chr41594 1271 11795 --
NM_080927chr353256 2871 2472 2156 102 ----12547
NM_130391chr923302 2270 12764 ----
NM_130392chr923302 2270 12764 ----
NM_130393chr923302 2270 12764 ----
NM_130435chr1022185 134 ----12553
NM_130436chr2121053 713 --11009 --
NM_130439chr1022167 729 ------
NM_130439chr1022167 729 ------
NM_130442chr7----1222 --
NM_130446chr331392 691 106 --24179 168 --
NM_130459chr971621 1389 1364 1299 1224 359 54 ------
NM_130468chr151712 ------
NM_130766chr1751189 851 787 422 192 --11026 --
NM_130830chr363763 3279 2753 1609 644 220 12819 12644 --
NM_130838chr151463 ------
NM_130839chr151463 ------
NM_133171chr2071118 953 917 911 320 245 132 ------
NM_133172chr5187 ------
NM_133173chr5187 ------
NM_133174chr5187 ------
NM_133264chr1753744 3284 2837 832 733 --33373 3163 1531 13813
NM_133265chrX12230 ------
NM_133266chr111121 1742 ----
NM_133334chr495560 5547 5481 4964 4958 4910 4157 2332 2325 --35119 4795 188 --
NM_133370chr463240 3033 2572 1215 743 530 ----12834
NM_133372chr522459 2087 --11789 --
NM_133378chr21691 ------
NM_133432chr21691 ------
NM_133437chr21691 ------
NM_133452chr1931115 932 751 ------
NM_133468chr742436 2429 1766 248 21817 636 ----
NM_133476chr121929 --1327 --
NM_133499chrX----1305 --
NM_133507chr122368 157 ------
NM_133633chr2221065 799 ------
NM_133634chr2121561 1238 --2374 59 --
NM_133638chr521351 323 ----11428
NM_133642chr222896 51 ------
NM_134268chr1721044 856 ------
NM_134442chr241680 1603 416 53 ------
NM_138270chrX42955 2771 2471 711 ------
NM_138297chr3267 24 ------
NM_138316chr10--1100 ----
NM_138338chr2283476 3270 3197 1131 1110 568 529 309 ------
NM_138357chr1011498 ------
NM_138385chr431297 1007 539 --11159 --
NM_138423chr151719 --11597 --
NM_138426chr722413 468 ------
NM_138444chr1374901 4318 3035 1449 880 345 23 ------
NM_138448chr2--1136 ----
NM_138468chr2115369 5269 4449 3958 3888 2538 2354 2230 2065 1597 1526 11995 ----
NM_138473chr1223593 35 ------
NM_138479chr11236 --22044 1716 --
NM_138499chr102777 21 ------
NM_138559chr21158 ------
NM_138568chr192411 348 ------
NM_138576chr14104782 4276 3866 3739 3192 3116 3013 1583 1282 940 ------
NM_138578chr202504 73 --1515 --
NM_138619chr1771129 1060 1008 588 339 227 77 ------
NM_138621chr254127 3334 3130 1060 1024 188 33573 1322 1152 13435
NM_138633chr61342 --11236 --
NM_138638chr141826 1176 ----
NM_138713chr1667991 5445 3205 2949 2528 2368 --42221 1579 1216 944 --
NM_138714chr1667991 5445 3205 2949 2528 2368 --42221 1579 1216 944 --
NM_138727chr122170 951 12080 1262 --
NM_138728chr122170 951 12080 1262 --
NM_138732chr11----1891 --
NM_138734chr11----1891 --
NM_138735chr211049 ------
NM_138766chr51202 ------
NM_138771chr711486 --11076 --
NM_138773chr51863 ------
NM_138793chr174515 419 182 29 --1230 --
NM_138795chr141314 1130 559 276 ------
NM_138799chr262069 1998 1324 453 264 196 11552 ----
NM_138811chr7----11132 --
NM_138821chr51202 ------
NM_138822chr51202 ------
NM_138927chr213709 125 71 1907 ----
NM_138961chr11157 ------
NM_138969chr81290 --1473 --
NM_138970chr1411751 ------
NM_138971chr1143501 2750 243 64 12706 23159 2783 --
NM_138971chr1143501 2750 243 64 12706 23159 2783 --
NM_138972chr1143501 2750 243 64 12706 23159 2783 --
NM_138972chr1143501 2750 243 64 12706 23159 2783 --
NM_138973chr1143501 2750 243 64 12706 23159 2783 --
NM_138973chr1143501 2750 243 64 12706 23159 2783 --
NM_139014chr631801 887 455 ------
NM_139035chrX1105 --128 --
NM_139057chr1531806 184 81 32885 2613 149 22240 972 --
NM_139068chr51623 ------
NM_139069chr51623 ------
NM_139070chr51492 ------
NM_139076chr4185 ------
NM_139132chr1141109 1006 324 87 ------
NM_139136chr12----1327 --
NM_139168chr531761 646 148 ------
NM_139177chr172338 33 --1240 --
NM_139207chr1212164 11583 ----
NM_139211chr4141 ------
NM_139212chr4141 ------
NM_139244chr63613 244 101 ------
NM_139276chr172758 423 --12280 --
NM_139280chr1711112 --11351 --
NM_139283chr1222531 94 ------
NM_139323chr203554 191 35 ------
NM_144563chr21853 ------
NM_144563chr21853 ------
NM_144567chr121030 495 ------
NM_144571chr465321 2779 2123 1181 1125 87 1902 37033 4320 1315 --
NM_144578chr1455409 5300 4519 3424 2136 14548 15154 --
NM_144579chr232882 1855 1805 22376 1075 12610 --
NM_144582chr272399 2374 2190 2080 951 384 371 ------
NM_144583chr221298 1160 2641 362 ----
NM_144590chr1032598 2102 297 --185 --
NM_144595chr131781 ------
NM_144599chr1533738 951 810 11598 11324 --
NM_144600chr162517 504 ------
NM_144604chr16155 ------
NM_144610chr172130 59 ------
NM_144632chr231984 1891 556 11780 ----
NM_144635chr341019 881 870 252 --11099 --
NM_144653chr91103 ------
NM_144660chr10----1401 --
NM_144664chr1111925 ------
NM_144726chr521043 963 ------
NM_144778chr1322247 1010 ------
NM_144963chr822542 700 2307 76 ----
NM_144967chrX1811 ------
NM_144973chr1273249 2143 1859 1176 874 572 88 --13943 --
NM_145004chr8178 ------
NM_145055chr1853538 2796 2778 879 175 --13493 --
NM_145056chr191263 ------
NM_145113chr1421117 278 --11027 --
NM_145117chr1163104 2754 2578 1234 551 511 --11299 --
NM_145174chr2251196 1099 933 357 288 ------
NM_145175chr21211 ----11223
NM_145185chr1971960 585 375 252 111 70 46 ------
NM_145203chr131942 ------
NM_145205chr1131 ------
NM_145206chr1042854 2789 680 67 --12717 --
NM_145234chrX1948 ------
NM_145251chr1411298 ------
NM_145259chr244942 4488 1569 78 15324 --15618
NM_145279chr12667 26 ------
NM_145284chrX32012 558 549 21856 1757 ----
NM_145296chr191314 ------
NM_145307chr1044178 3273 1682 857 44216 3098 2830 1791 ----
NM_145313chr1011565 ------
NM_145320chr712630 ----13115
NM_145321chr712630 ----13115
NM_145322chr712630 ----13115
NM_145330chr2----161 --
NM_145341chr1041767 1671 1600 315 ------
NM_145350chr176550 436 387 284 233 227 ------
NM_145351chr1721875 1690 --2950 522 --
NM_145638chr115883 756 277 146 107 ------
NM_145690chr831847 1549 1530 ------
NM_145733chr223940 374 315 --21040 861 --
NM_145735chr1312691 --12367 --
NM_145739chr22543 430 ------
NM_145753chr311174 1677 ----
NM_145800chrX--199 ----
NM_145802chrX--148 ----
NM_145803chr11----1135 --
NM_145805chr15----172 --
NM_145808chr7174 ------
NM_145891chr162350 296 ------
NM_145892chr162350 296 ------
NM_145893chr162472 418 ------
NM_147147chr694239 4154 3472 3456 2715 1582 1396 1042 668 --11239 --
NM_147156chr101418 ------
NM_147161chr12749 455 ------
NM_147164chr91218 ------
NM_147171chr7----1360 --
NM_147175chrX143 12097 ----
NM_147181chr441252 956 348 199 ------
NM_147182chr441252 956 348 199 ------
NM_147183chr441252 956 348 199 ------
NM_147185chr7----1360 --
NM_147189chr831884 554 399 ------
NM_147190chr122687 162 --147 --
NM_147223chr262358 1779 1729 564 285 173 ------
NM_147233chr252175 1596 1546 381 102 ------
NM_147686chr6135 --1384 --
NM_148894chr4171 ------
NM_148898chr71813 ------
NM_148899chr71813 ------
NM_148955chr15106492 6344 5987 4935 4672 2134 2106 1457 1275 392 11224 ----
NM_148977chr10--1100 ----
NM_148978chr10--1100 ----
NM_152227chr202755 185 --1677 --
NM_152238chr11324 ------
NM_152240chr331241 1170 243 ------
NM_152243chr221225 --2451 366 --
NM_152267chr2222085 488 12371 1596 --
NM_152272chr841168 1029 520 289 1138 ----
NM_152280chr133425 1259 1224 --13163 --
NM_152282chr32951 497 ------
NM_152284chr82793 348 ----1825
NM_152317chr121166 --184 --
NM_152330chr1421838 1015 ------
NM_152341chr1641100 554 347 312 ------
NM_152344chr1731436 365 345 11083 ----
NM_152371chr141566 1542 657 351 21493 144 21720 449 --
NM_152375chr1112484 2362 1718 1679 1673 927 777 692 450 111 41 12289 177 --
NM_152380chr1--11665 1216 --
NM_152400chr421770 150 ----11517
NM_152410chr6----1136 --
NM_152422chr91224 --187 --
NM_152437chr1221979 1891 32395 905 47 ----
NM_152441chr121109 ------
NM_152447chr14142 ------
NM_152455chr1542287 996 709 128 ------
NM_152462chr172591 291 ------
NM_152470chr1873447 1276 1150 1076 976 91 56 --11019 --
NM_152493chr121408 1215 ------
NM_152496chr151308 1237 892 330 87 ------
NM_152519chr2----1753 --
NM_152523chr21469 ------
NM_152529chr253297 3226 1384 589 518 11586 14409 --
NM_152538chr321626 1345 ----1153
NM_152542chr43843 771 205 ------
NM_152553chr62416 179 --1474 --
NM_152557chr721377 32 1361 1513 --
NM_152588chr12--11353 --1132
NM_152594chr151701 ------
NM_152608chr132399 2060 581 ------
NM_152613chr2211256 ------
NM_152622chr551216 934 778 716 358 --11235 --
NM_152630chrX21486 1023 --11250 --
NM_152638chr121464 1427 1364 1133
NM_152641chr123661 652 493 ------
NM_152653chr32676 509 ------
NM_152660chr11992 --1331 --
NM_152667chr2031414 1259 1209 ------
NM_152678chr32944 283 22319 1797 1835 --
NM_152699chr313032 ----1118
NM_152707chr101117 1305 ----
NM_152723chr1131089 369 131 1168 ----
NM_152733chr6136066 5888 5797 5320 4947 4181 1923 1648 1528 1399 739 676 373 15765 26270 5481 --
NM_152739chr731005 192 143 --11013 --
NM_152740chr73208 125 98 ------
NM_152743chr7121 ------
NM_152745chr7180 ----11039
NM_152749chr731139 453 429 ------
NM_152753chr631983 1389 237 1407 22091 1776 --
NM_152756chr523855 1263 --14114 --
NM_152780chrX2965 256 174 1173 --
NM_152782chr7122 ------
NM_152787chrX32811 1401 416 --1791 --
NM_152789chr74603 165 150 139 ------
NM_152793chr794597 4273 4194 3863 3188 1406 857 689 248 1593 32078 819 58 --
NM_152826chr15106492 6344 5987 4935 4672 2134 2106 1457 1275 392 11224 ----
NM_152835chr122590 1050 ------
NM_152836chr811740 ------
NM_152837chr811740 ------
NM_152838chr2013468 --23347 396 --
NM_152862chr2156 ------
NM_152902chr122001 1632 ------
NM_152903chr1312417 --1764 11900
NM_152919chr1923033 2375 --1254 --
NM_152924chr1596380 5550 5263 5253 4831 4607 4268 2166 1671 12052 ----
NM_152988chr19101812 1779 1758 1683 1561 1438 1178 677 356 350 --11152 --
NM_152989chr1231589 1497 1281 21769 1221 11354 --
NM_152996chr111466 --2795 575 --
NM_152999chr754612 3056 1819 1215 1120 23532 49 ----
NM_153026chr12--142 ----
NM_153029chr1674038 4017 3576 3373 3013 913 728 1568 1905 --
NM_153035chr123162 400 1237 12607 1603
NM_153040chr15178 ------
NM_153050chr2264918 4740 4503 3131 1389 1122 13152 11177 14853
NM_153051chr2264918 4740 4503 3131 1389 1122 13152 11177 14853
NM_153188chr555584 3503 2027 686 178 24339 3566 ----
NM_153207chr122542 57 ------
NM_153212chr12210 50 ------
NM_153223chr511396 ------
NM_153234chr531009 805 185 22820 1895 12130 --
NM_153247chr72775 316 ----11098
NM_153260chr1531157 1086 404 ------
NM_153261chr1621443 218 ------
NM_153262chr11704 ------
NM_153267chr9--1671 1214 --
NM_153280chrX1147 ------
NM_153326chr1183 ------
NM_153335chr1721358 459 --1116 --
NM_153341chr11120 ------
NM_153343chr452279 1575 870 507 446 ------
NM_153354chr51669 1694 ----
NM_153365chr452735 2514 2495 2398 554 --12024 --
NM_153367chr1063540 3500 455 408 355 68 ------
NM_153371chr1352080 1810 1731 568 415 ------
NM_153453chr6----1977 --
NM_153498chr104808 650 146 74 --1737 --
NM_153499chr1242336 2115 503 85 --1305 --
NM_153500chr1242336 2115 503 85 --1305 --
NM_153607chr532694 480 211 --11164 --
NM_153616chr153966 270 169 1355 ----
NM_153617chr153966 270 169 1355 ----
NM_153618chr153966 270 169 1355 ----
NM_153619chr1551407 500 410 390 379 ------
NM_153620chr741560 1167 279 58 ------
NM_153633chr12----1278 --
NM_153634chr12--11604 ----
NM_153682chr21--157 ----
NM_153685chr123956 847 97 --1280 --
NM_153705chr1131644 774 37 1401 ----
NM_153706chr51178 ------
NM_153748chr12----1327 --
NM_153756chr141333 1282 415 279 --1305 --
NM_153757chr41325 ------
NM_153810chr1075030 4860 4219 3919 3222 943 838 ------
NM_153812chr132347 1502 116 --1647 --
NM_170610chr6151 ------
NM_170665chr1264268 3619 3454 3216 1695 522 11399 11783 --
NM_170679chr511071 1466 ----
NM_170692chr12232 97 ------
NM_170696chr1521189 201 11656 1145 --
NM_170697chr1521189 201 11656 1145 --
NM_170706chr154228 3861 2990 1046 642 11482 ----
NM_170720chr191864 ------
NM_170721chr1721241 922 ------
NM_170768chr11130 1550 ----
NM_170769chr6--1244 135 --
NM_170774chr2093578 3136 2671 1193 1160 979 777 393 43 ------
NM_171825chr562667 2598 2303 1044 194 127 ------
NM_171998chrX22274 369 --1935 --
NM_172016chr621147 933 ------
NM_172058chr821621 1356 ------
NM_172059chr821621 1356 ------
NM_172060chr821621 1356 ------
NM_172069chr222267 1994 ------
NM_172070chr231617 739 427 ------
NM_172071chr167236 5141 4556 2705 2628 1562 ------
NM_172127chr4161 ------
NM_172178chr12149 --1360 11027
NM_172206chr1751755 1306 1253 222 24 ------
NM_172226chr1242336 2115 503 85 --1305 --
NM_172375chr142843 185 1464 ----
NM_173054chr72786 370 ------
NM_173074chr2172 ------
NM_173076chr22792 197 ------
NM_173156chr121935 1605 ------
NM_173157chr121435 ------
NM_173171chr221196 355 ------
NM_173172chr241504 1031 222 49 ------
NM_173173chr221196 355 ------
NM_173174chr81124 --1262 --
NM_173175chr81124 --1262 --
NM_173176chr81124 --1262 --
NM_173198chr9--12544 1787 --
NM_173199chr92511 449 ------
NM_173200chr9--12544 1787 --
NM_173214chr1667991 5445 3205 2949 2528 2368 --42221 1579 1216 944 --
NM_173354chr2121573 1398 --1716 --
NM_173355chr23699 334 313 ------
NM_173359chr311276 --11427 --
NM_173463chr464190 3833 1323 445 345 54 1564 23950 1685 --
NM_173468chr456108 4853 4213 2282 2184 45460 3935 1672 1640 ----
NM_173469chr15----2311 250 --
NM_173471chr341034 784 718 709 ------
NM_173475chr1631415 1193 288 ------
NM_173477chr1741962 1794 1415 1361 ------
NM_173510chr2231905 649 159 ------
NM_173515chr6121 ----1906
NM_173519chr812082 ----2832 639
NM_173545chr211675 21383 460 ----
NM_173546chr31552 ------
NM_173552chr322117 956 --1426 --
NM_173563chr6----1275 --
NM_173587chr113195 74 51 ------
NM_173595chr1244499 4071 3602 1083 --11141 --
NM_173602chr1273561 3197 2386 1171 399 310 106 --130 12828
NM_173618chr161277 --1118 --
NM_173632chr1962199 1245 1089 407 323 223 12556 ----
NM_173642chr183281 2924 2853 2453 1944 995 883 664 27335 3418 26642 771 --
NM_173653chr31224 ------
NM_173666chr521149 1028 ------
NM_173683chr821622 1616 ------
NM_173808chr143162 1567 1551 1296 ------
NM_173814chr151159 ------
NM_173822chr2----198 --
NM_173825chr332854 1971 1900 ------
NM_173833chr831532 1295 80 ------
NM_173851chr823288 39 --13858 --
NM_173872chr4--1618 ----
NM_174856chr202261 105 ------
NM_174890chr103754 536 150 1714 ----
NM_174911chr893922 2900 1567 962 940 640 442 92 54 --1326 --
NM_174921chr431090 747 188 ------
NM_174929chr732237 1542 1474 11360 ----
NM_174938chr9183 ------
NM_175069chr91332 11032 ----
NM_175610chr1521047 276 ------
NM_175630chr2----194 --
NM_175736chr1297316 7068 5846 5392 5318 2121 1152 1146 239 1155 33069 1627 932 --
NM_175847chr194471 406 260 64 ------
NM_175854chr1331087 410 196 ------
NM_175856chr51622 ------
NM_175863chr62946 46 --1275 --
NM_175866chr11137 ------
NM_175898chr1541423 1368 498 411 ------
NM_175907chr1822690 1034 ------
NM_175931chr1651977 1427 490 155 146 ------
NM_176071chr111941 ------
NM_176072chr111941 ------
NM_176792chr1021385 261 ------
NM_177398chr111536 --21654 65 --
NM_177399chr111536 --21654 65 --
NM_177414chr12409 310 ------
NM_177424chr121280 438 ------
NM_177438chr141363 ------
NM_177559chr201965 11094 1863 --
NM_177560chr201965 11094 1863 --
NM_177937chr931388 1170 486 21464 549 1617 --
NM_177967chr13--1188 ----
NM_177968chr222136 182 ------
NM_177972chr1173809 3484 1203 892 463 330 173 --11481 --
NM_177974chr151719 --11597 --
NM_177976chr31458 ----1174
NM_177977chr1761533 1485 809 700 628 497 ------
NM_177989chr31386 ------
NM_177990chr2021429 500 --1207 --
NM_177995chr91224 --187 --
NM_177996chr2032942 2706 120 --22559 789 --
NM_178009chr132207 41 --1416 --
NM_178010chr1231589 1497 1281 21769 1221 11354 --
NM_178037chr12113634 3569 3405 3061 2694 2682 2672 2566 2537 293 26 ------
NM_178038chr12113634 3569 3405 3061 2694 2682 2672 2566 2537 293 26 ------
NM_178042chr31386 ------
NM_178126chr1741989 1499 206 26 1582 11820 --
NM_178151chrX46471 5492 3094 1108 26718 2923 57219 6749 2451 1596 186 --
NM_178152chrX46471 5492 3094 1108 26718 2923 57219 6749 2451 1596 186 --
NM_178153chrX46471 5492 3094 1108 26718 2923 57219 6749 2451 1596 186 --
NM_178175chrX----2170 76 --
NM_178190chr1--1274 ----
NM_178191chr121206 534 11615 ----
NM_178313chr2--22039 1977 ----
NM_178426chr1----11932 --
NM_178454chr12608 158 ------
NM_178502chr121199 ------
NM_178527chr11131 ------
NM_178539chr1231327 736 258 ------
NM_178565chr83637 359 60 11125 11112 --
NM_178582chr2031359 401 119 ------
NM_178585chr42777 335 ------
NM_178586chr1431539 1529 557 12310 ----
NM_178815chr1011853 ------
NM_178819chr8126 1275 ----
NM_178835chr41222 ------
NM_178860chr173940 785 677 ------
NM_180976chr63709 117 27 ------
NM_180977chr63709 117 27 ------
NM_181054chr143897 796 245 ------
NM_181332chrX----12186 --
NM_181349chr762726 1151 887 855 271 38 ------
NM_181353chr201541 ------
NM_181354chr821142 98 ------
NM_181357chr1431793 1626 346 21705 247 ----
NM_181358chr143390 3275 3058 34 22765 865 23519 3417 --
NM_181443chr2032748 1154 643 11796 ----
NM_181459chr21453 ------
NM_181492chr22----11222 --
NM_181504chr513359 --12738 --
NM_181507chr112744 392 --1129 --
NM_181508chr112744 392 --1129 --
NM_181523chr513359 --12738 --
NM_181524chr513359 --12738 --
NM_181656chr174368 321 101 44 ------
NM_181659chr2062909 2857 1107 1030 585 315 ------
NM_181659chr2062909 2857 1107 1030 585 315 ------
NM_181670chr12----2147 140 --
NM_181671chr17135 ------
NM_181689chr202635 346 ------
NM_181702chr8----151 --
NM_181704chr2121159 1080 135 ----
NM_181706chr11----11483 12126
NM_181712chr161744 1709 1627 1556 1283 82 ------
NM_181746chr11608 --176 --
NM_181755chr12322 124 ------
NM_181762chrX130 ------
NM_181777chrX130 ------
NM_181809chr183763 3214 2712 2659 1508 1331 536 194 --32680 842 413 --
NM_181825chr223263 147 104 --1735 --
NM_181836chr5133 ------
NM_181876chr431770 1035 722 ------
NM_181886chr411360 ------
NM_181887chr411360 ------
NM_181888chr411360 ------
NM_181889chr411360 ------
NM_181890chr411360 ------
NM_181891chr411360 ------
NM_181892chr411407 ------
NM_181893chr411360 ------
NM_181897chr322583 584 ------
NM_182484chr2121159 1080 135 ----
NM_182485chr41964 --11431 --
NM_182487chr984137 3837 3640 3146 2862 1293 651 133 --44256 1309 1098 462 --
NM_182511chr1811232 11368 ----
NM_182515chr19136455 5324 5129 4784 4713 4417 4239 4168 1999 1044 961 101 82 1693 ----
NM_182540chrX2348 318 --1300 --
NM_182548chr62837 691 ----1108
NM_182553chr11174 --1577 --
NM_182557chr1172100 2087 1821 1411 1373 743 228 --21865 1626 --
NM_182569chr17181 ------
NM_182580chr122221 779 12342 ----
NM_182594chr53423 352 110 1298 ----
NM_182641chr1711680 ------
NM_182643chr812195 --12292 --
NM_182645chr6----1977 --
NM_182646chr41964 --11431 --
NM_182647chr2041355 1122 637 211 --178 --
NM_182691chr711069 ------
NM_182692chr711069 ------
NM_182728chr1431375 378 298 --122 --
NM_182734chr2022859 966 --33006 2533 284 --
NM_182764chr2071118 953 917 911 320 245 132 ------
NM_182765chr1021889 596 --11513 --
NM_182767chr1211701 ------
NM_182789chr5----1835 --
NM_182811chr201363 1158 11150 --
NM_182830chr14----1740 --
NM_182894chr1441777 680 618 305 ------
NM_182898chr756273 5697 4542 1732 1608 --25149 1322 --
NM_182899chr756273 5697 4542 1732 1608 --25149 1322 --
NM_182907chr641844 1826 876 193 --2864 472 --
NM_182918chr211419 ------
NM_182920chr311069 128 ----
NM_182943chr311167 ------
NM_182948chr122224 356 ------
NM_182964chr1163104 2754 2578 1234 551 511 --11299 --
NM_182970chr2073829 3309 2883 1289 444 384 212 ------
NM_182972chr142627 2409 853 506 ------
NM_182978chr182566 141 ------
NM_183047chr20192 ------
NM_183048chr20192 ------
NM_183049chr42335 162 ------
NM_183234chr151468 ------
NM_183235chr151468 ------
NM_183236chr151468 ------
NM_183238chr1232770 1136 832 1140 ----
NM_183323chr5----1835 --
NM_183373chr65761 333 231 218 80 ------
NM_183416chr131855 1705 1664 ------
NM_183419chr811277 ------
NM_183422chr1311050 1137 ----
NM_183425chr2041248 364 194 136 --21341 1194 --
NM_194071chr764230 3810 1024 590 394 88 24331 3678 11241 --
NM_194247chr214482 ------
NM_194272chr151697 --11018 --
NM_194282chr432782 2704 540 12064 ----
NM_194285chr111328 --32565 742 291 --
NM_194286chr1245702 1880 1813 1074 12136 35956 773 741 --
NM_194291chr842950 2697 2417 2369 ------
NM_194314chr134543 4169 908 ------
NM_194315chr141115 1009 201 30 --2317 209 --
NM_194356chr1232192 633 145 11569 11812 --
NM_194434chr1855736 4688 4536 3754 1655 --2668 190 --
NM_194442chr121385 49 ------
NM_194449chr18----2918 780 --
NM_194452chr1111240 --2845 116 --
NM_194453chr1111240 --2845 116 --
NM_194457chr141115 1009 201 30 --2317 209 --
NM_194458chr141115 1009 201 30 --2317 209 --
NM_194463chrX1393 ------
NM_197939chr1731030 905 177 1853 ----
NM_197941chr582685 2591 2536 2514 2328 2268 1998 757 ------
NM_197956chr951583 421 343 241 96 --1674 --
NM_197968chr13--1169 ----
NM_198042chr82437 72 --1345 --
NM_198043chr102426 320 --1420 --
NM_198044chr102426 320 --1420 --
NM_198045chr102426 320 --1420 --
NM_198046chr102426 320 --1420 --
NM_198057chrX4874 423 250 149 133 ----
NM_198066chr1442689 2405 2204 46 ----12720
NM_198081chr612005 --12200 --
NM_198097chr7156 ------
NM_198098chr731757 1244 110 --11648 --
NM_198123chr82478 111 --11716 --
NM_198124chr82478 111 --11716 --
NM_198181chr1522425 93 12693 ----
NM_198225chr1031932 1364 412 ------
NM_198240chr121444 1265 ----
NM_198268chr143390 3275 3058 34 22765 865 23519 3417 --
NM_198269chr143390 3275 3058 34 22765 865 23519 3417 --
NM_198270chrX----11001 --
NM_198273chr532621 1273 32 ------
NM_198324chr121355 1837 ----
NM_198391chr20----1405 --
NM_198400chr151503 --196 --
NM_198404chr131798 1120 1730 --
NM_198467chr71462 ------
NM_198504chr33939 345 224 ------
NM_198507chr5--181 ----
NM_198513chr831692 1476 574 ------
NM_198516chr11136 ------
NM_198560chr353206 3163 2591 2555 68 ------
NM_198569chr632688 2671 1879 --21792 1757 --
NM_198581chr275951 5751 4813 2928 2318 1225 334 ------
NM_198595chr4114208 4153 3727 3636 3596 3102 1618 1318 904 651 436 --43505 3348 1941 307 --
NM_198597chr101168 ------
NM_198700chr11--1528 ----
NM_198793chr343776 3636 615 494 ------
NM_198794chr141189 --1436 --
NM_198829chr721230 492 11404 ----
NM_198830chr172620 123 --1605 --
NM_198859chr331879 1663 921 12060 44691 4673 3872 249 --
NM_198896chr111542 ------
NM_198900chr1297316 7068 5846 5392 5318 2121 1152 1146 239 1155 33069 1627 932 --
NM_198935chr2033115 593 450 --1604 --
NM_198963chr2128 --3510 189 168 --
NM_198993chr1741369 1184 1120 127 ------
NM_198995chr183378 148 96 ------
NM_199000chr711614 ----1856
NM_199044chr152788 2717 2449 2355 1250 1394 32873 1117 619 --
NM_199050chr2193396 3328 3287 3277 3262 1434 1229 462 440 ------
NM_199054chr1961936 1797 1493 751 329 31 ------
NM_199078chr231834 710 107 ------
NM_199131chr1043478 2360 1428 88 ------
NM_199132chr1931744 1435 1336 --11388 --
NM_199141chr191110 --2785 775 --
NM_199160chr941941 1813 1366 673 --1835 --
NM_199169chr2022971 1088 --1792 --
NM_199170chr2022971 1088 --1792 --
NM_199171chr2022971 1088 --1792 --
NM_199188chr12------13558
NM_199189chr541011 843 718 260 ------
NM_199190chr12------13558
NM_199229chr211370 ----11454
NM_199262chr1722105 675 ----1181
NM_199320chr422409 851 --2878 835 --
NM_199320chr422409 851 --2878 835 --
NM_199324chr433272 3139 860 13260 ----
NM_199330chr151567 ------
NM_199331chr151567 ------
NM_199332chr151567 ------
NM_199355chr161115 --11551 --
NM_199421chr1455014 4521 3845 3111 73 23458 429 ----
NM_199436chr232488 221 78 ------
NM_199453chr51164 ------
NM_199462chr194651 4285 3818 3616 1974 1903 1270 931 60 --13335 --
NM_199482chr21360 ------
NM_201266chr292775 2523 2354 2317 1051 793 663 595 279 ------
NM_201279chr292775 2523 2354 2317 1051 793 663 595 279 ------
NM_201403chr12667 26 ------
NM_201432chr17104876 2626 2216 1692 1146 1105 964 552 457 258 --32115 315 104 --
NM_201433chr17104876 2626 2216 1692 1146 1105 964 552 457 258 --32115 315 104 --
NM_201434chr173620 220 93 ------
NM_201436chr71690 ------
NM_201516chr71746 ------
NM_201517chr71690 ------
NM_201568chr121935 1605 ------
NM_201569chr121935 1605 ------
NM_201570chr1022029 271 ------
NM_201571chr1022029 271 ------
NM_201572chr1022029 271 ------
NM_201575chr162535 352 ------
NM_201590chr1022029 271 ------
NM_201591chr42524 57 ------
NM_201592chr42524 57 ------
NM_201593chr10