TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3678-3p
miRNA Sequence: CUGCAGAGUUUGUACGGACCGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000014chr12127 ------
NM_000024chr51133 --1218 --
NM_000029chr12406 40 1469 ----
NM_000037chr862467 2376 2278 765 724 79 --11715 1162
NM_000038chr521410 518 --11743 --
NM_000044chrX2346 58 --287 74 --
NM_000051chr1162777 1374 933 867 705 194 12827 12298 12960
NM_000052chrX93208 2830 2115 1338 1086 1037 909 809 735 12534 ----
NM_000055chr31318 ------
NM_000067chr8--2592 232 ----
NM_000068chr1911497 ------
NM_000074chrX2635 343 ------
NM_000081chr141848 1363 1326 140 21831 728 1535 --
NM_000084chrX216922 6713 6165 5565 5557 5373 5358 5279 5251 5158 4928 4809 2714 2178 1796 1746 1636 1499 1428 783 446 36735 2233 732 16277 --
NM_000088chr1741241 1156 361 323 --21320 150 --
NM_000089chr74684 311 107 54 ------
NM_000090chr22762 321 ------
NM_000091chr221885 215 12864 11959 --
NM_000093chr942241 2132 529 257 ------
NM_000097chr35994 984 784 489 75 --1119 --
NM_000109chrX2571 520 11794 ----
NM_000110chr11933 ------
NM_000112chr564209 3703 3551 773 519 88 14747 ----
NM_000125chr6104221 4184 3814 3770 3661 2890 2705 1568 685 321 11652 13954 --
NM_000138chr1522080 371 22642 356 ----
NM_000141chr1041319 1195 1054 301 ----11364
NM_000142chr421427 368 --1375 --
NM_000163chr552094 2086 1537 838 763 11468 ----
NM_000165chr631382 1274 500 1631 ----
NM_000166chrX3602 576 88 ------
NM_000168chr763300 2394 2292 1312 734 91 1706 12588 --
NM_000170chr93514 209 133 1455 --1126
NM_000172chr3----1109 --
NM_000173chr172441 123 ------
NM_000183chr21142 1338 ----
NM_000188chr10----1227 --
NM_000194chrX2183 108 ------
NM_000208chr1964740 4612 4519 3720 3031 1371 13012 13558 11757
NM_000214chr2051629 1583 1570 418 309 --1436 --
NM_000217chr1294658 3648 3596 2078 1585 1273 981 717 630 --11565 22097 436
NM_000222chr451653 1340 1314 739 314 --11909 --
NM_000228chr1145 ------
NM_000245chr731946 549 88 ------
NM_000248chr352988 2699 2413 2079 1102 1563 ----
NM_000251chr2--2211 50 ----
NM_000259chr1576045 5133 4816 4800 4457 4022 2208 24930 1589 21450 410 --
NM_000264chr973174 2731 2294 2125 1257 1025 457 1695 ----
NM_000266chrX----2189 124 --
NM_000276chrX51784 1405 542 416 259 22153 1488 22070 452 1601
NM_000278chr1061693 1670 1654 1648 1615 515 ----11571
NM_000280chr111386 ------
NM_000282chr132215 48 ------
NM_000293chr163624 324 24 ------
NM_000297chr441874 1677 810 133 11591 ----
NM_000301chr61170 --1214 --
NM_000310chr161150 1116 821 522 476 170 ------
NM_000314chr1083138 2751 2549 2257 1226 1218 713 440 1741 1416 --
NM_000315chr11130 ------
NM_000319chr122940 252 1355 ----
NM_000321chr1321553 345 1509 ----
NM_000329chr11216 2131 62 ----
NM_000332chr6107156 6810 5202 4756 4644 2439 1534 734 446 436 15430 24632 1273 16907
NM_000337chr596511 5711 4725 4238 2105 1801 1380 839 690 --22260 209 --
NM_000340chr32541 271 ------
NM_000346chr1771796 1483 1472 714 695 418 362 21831 763 11582 --
NM_000351chrX53295 3145 1495 421 195 22920 776 1760 --
NM_000361chr2052061 1995 1503 1353 63 22024 1560 1431 --
NM_000362chr2283142 2958 2902 2591 2464 1014 574 405 ------
NM_000367chr642061 1927 1512 453 1865 ----
NM_000368chr984883 4457 4411 3974 3735 3565 1603 370 23298 1014 ----
NM_000378chr1121255 184 ------
NM_000397chrX42411 1980 1880 903 12419 ----
NM_000408chr273439 2893 2714 2670 1389 1136 255 22832 2620 12380 --
NM_000411chr2142576 2022 1236 259 ----12959
NM_000414chr51234 176 ----
NM_000427chr12182 158 1225 ----
NM_000430chr1763758 2533 2524 1143 355 80 42771 2463 1128 473 ----
NM_000434chr6364 43 29 ------
NM_000435chr192720 68 ------
NM_000439chr572438 1854 1795 729 643 406 229 21634 374 ----
NM_000445chr82821 366 --2893 27 1953
NM_000448chr111859 133 12019 11018
NM_000449chr141129 476 217 46 --2120 68 --
NM_000461chr394500 3622 3279 3112 3043 1636 1460 915 505 24445 3977 ----
NM_000465chr2137 ------
NM_000474chr7--1680 1263 --
NM_000480chr1141648 1391 345 95 ------
NM_000484chr212786 745 ------
NM_000486chr1242915 1220 1209 1024 --23236 3080 --
NM_000489chrX42742 2436 707 538 22812 1280 ----
NM_000503chr851237 609 465 143 37 --21780 1294 --
NM_000525chr1141484 1319 1026 376 --11305 --
NM_000527chr1942345 2165 875 491 12245 ----
NM_000530chr131081 714 275 1761 ----
NM_000533chrX31240 91 85 --11247 --
NM_000538chr131437 --1581 --
NM_000555chrX167827 7334 6794 6662 5895 5544 5530 5350 4939 2645 1852 1705 971 844 347 67 37863 2562 1436 ----
NM_000572chr12885 181 ------
NM_000573chr152149 1970 747 477 214 12351 ----
NM_000594chr62727 629 1751 ----
NM_000597chr21307 ------
NM_000609chr10103153 2535 2490 2129 857 650 636 457 135 127 22902 2216 12393 --
NM_000610chr1142219 1033 679 553 12486 --11015
NM_000612chr1153683 3544 3481 2964 22 ------
NM_000615chr1192884 2688 2396 2371 2217 1865 910 704 649 --13002 1495
NM_000617chr1242239 1789 1676 23 ------
NM_000618chr12125162 4167 4084 2565 2158 2061 1614 1265 888 423 183 51 11287 157 --
NM_000618chr12125162 4167 4084 2565 2158 2061 1614 1265 888 423 183 51 11287 157 --
NM_000624chr14172 2873 794 1557 --
NM_000627chr2----137 --
NM_000633chr1894639 3861 3400 1764 1742 1710 1566 847 501 25092 4843 1585 14145
NM_000635chr1921667 294 --1365 --
NM_000641chr1951580 1561 1544 595 278 ------
NM_000651chr152149 1970 747 477 214 12351 ----
NM_000660chr193256 244 225 ------
NM_000665chr7----1150 --
NM_000668chr431191 417 273 11019 ----
NM_000675chr222567 258 ------
NM_000678chr201127 --1660 --
NM_000684chr103942 828 813 ------
NM_000693chr151345 31686 1302 395 ----
NM_000701chr1----145 --
NM_000719chr12146631 6369 4659 4215 2007 1998 1883 1848 1809 1345 389 378 360 192 --22335 1375 --
NM_000721chr142244 294 228 220 ----1197
NM_000724chr1021828 420 1583 ----
NM_000725chr121242 ------
NM_000726chr221072 1021 ------
NM_000739chr7187 1173 ----
NM_000756chr8270 30 1381 ----
NM_000788chr4--11166 --11141
NM_000789chr171225 ------
NM_000792chr11965 --1721 --
NM_000793chr1444770 4338 4053 283 1640 --14060
NM_000800chr5----1162 --
NM_000801chr2041019 968 180 165 1393 ----
NM_000806chr521259 93 --136 --
NM_000810chr151116 ------
NM_000811chr51219 1125 ----
NM_000813chr595237 4904 4830 4333 4325 4201 1739 595 166 24482 426 ----
NM_000814chr1582799 1677 1617 1258 1204 1013 264 58 33329 2620 601 ----
NM_000817chr221095 998 1914 ----
NM_000818chr101189 ------
NM_000826chr432445 2058 439 11679 ----
NM_000827chr552599 2086 1713 981 402 ------
NM_000828chrX42117 1976 686 230 ------
NM_000829chr1142227 1781 847 90 ------
NM_000831chr1135896 5761 5596 5107 4626 4513 4393 4291 4024 1634 1020 964 316 14197 15629 --
NM_000833chr1631286 480 147 11067 ----
NM_000840chr71479 ------
NM_000844chr32407 380 1841 1401 --
NM_000860chr461574 1504 1492 1280 664 274 ----11081
NM_000861chr342231 1972 911 632 --21978 1737 1225
NM_000868chrX51918 964 505 468 351 22516 1728 --1133
NM_000870chr53428 387 250 ------
NM_000872chr103547 536 45 --21143 263 --
NM_000875chr15167084 7033 5935 5745 5066 4899 4668 2802 2113 1736 1345 1255 1188 1132 343 303 25483 1044 24634 155 --
NM_000876chr611010 ------
NM_000877chr233004 2410 2259 32905 2821 1070 ----
NM_000883chr72475 97 --1656 --
NM_000883chr72475 97 --1656 --
NM_000891chr1773432 3298 2441 1076 847 739 370 12525 ----
NM_000899chr1244199 3373 1636 335 1848 --1424
NM_000901chr472319 2262 1004 689 566 404 26 12039 --12539
NM_000908chr54520 232 142 29 ------
NM_000922chr1131052 296 151 ------
NM_000926chr11189289 8806 8216 7933 7109 6591 6258 5825 3367 3050 2411 2073 1962 1436 1357 1346 1300 316 32724 2417 1118 17137 --
NM_000933chr2031187 687 421 31711 1678 472 ----
NM_000938chr4--1143 ----
NM_000944chr4--1907 ----
NM_000945chr292032 1779 1623 1580 1526 780 688 113 85 21327 618 ----
NM_000950chrX43339 3239 1007 910 1445 ----
NM_000956chr1411078 ------
NM_000958chr51485 ------
NM_000961chr20113672 3322 2867 2817 1521 1254 1091 867 669 331 36 ------
NM_000962chr963034 2672 2045 2027 875 367 12706 ----
NM_000964chr1731300 308 53 ------
NM_000965chr321212 353 ------
NM_000966chr1241030 343 159 97 11087 ----
NM_000983chr151310 1194 1046 415 177 --183 11225
NM_001001132chr213940 579 393 1409 1309 11265
NM_001001323chr1242824 2163 681 459 12771 22138 2125 --
NM_001001330chr10--2199 158 ----
NM_001001331chr352741 2375 2239 726 564 11088 12608 --
NM_001001344chrX82557 2370 2192 1714 969 889 724 657 1155 1513 1588
NM_001001389chr1142219 1033 679 553 12486 --11015
NM_001001390chr1142219 1033 679 553 12486 --11015
NM_001001391chr1142219 1033 679 553 12486 --11015
NM_001001392chr1142265 1079 725 599 12532 --11061
NM_001001394chr23482 452 91 ------
NM_001001396chr1104314 4276 4169 3913 3684 3233 3140 1073 1052 816 24242 2720 ----
NM_001001419chr565211 4171 3707 1978 1569 850 2690 476 ----
NM_001001420chr565211 4171 3707 1978 1569 850 2690 476 ----
NM_001001433chr2032949 2651 714 --1133 --
NM_001001438chr211366 ------
NM_001001481chr821275 886 1979 --12550
NM_001001484chr1032264 1822 1524 2662 466 ----
NM_001001522chr111123 ------
NM_001001549chr7112770 2759 2577 2482 2377 2043 1147 757 552 400 93 --22610 211 --
NM_001001550chr7112770 2759 2577 2482 2377 2043 1147 757 552 400 93 --22610 211 --
NM_001001555chr7112770 2759 2577 2482 2377 2043 1147 757 552 400 93 --22610 211 --
NM_001001557chr83761 696 679 ------
NM_001001560chr223736 616 525 ------
NM_001001664chr264105 3888 3793 2611 1272 773 33952 1562 373 ----
NM_001001665chr222781 793 12722 --1478
NM_001001669chr532185 1739 224 --12128 --
NM_001001701chr462285 2140 1684 1625 522 156 1760 11478 --
NM_001001713chr211338 --1274 --
NM_001001790chr92360 121 ----167
NM_001001791chr1021213 1067 --11581 1166
NM_001001852chr222260 189 ------
NM_001001890chr2163204 3104 1381 1194 1076 529 14274 ----
NM_001001924chr851772 756 611 467 52 --1686 --
NM_001001925chr851772 756 611 467 52 --1686 --
NM_001001931chr851772 756 611 467 52 --1686 --
NM_001001933chr11127 1459 ----
NM_001001971chr102928 62 11131 11240 --
NM_001001974chr1052064 1820 1737 563 32 12027 --11957
NM_001001994chrX--187 135 1455
NM_001001995chrX2759 630 --167 --
NM_001001996chrX--187 135 1455
NM_001002006chr23281 229 112 ------
NM_001002026chr33797 431 166 ----11702
NM_001002032chr172502 64 ------
NM_001002243chr21756 ------
NM_001002257chr263187 2547 1392 1255 136 82 13568 12999 --
NM_001002259chr122247 71 ------
NM_001002295chr10169 ----1149
NM_001002811chr121617 625 ------
NM_001002812chr121617 625 ------
NM_001002812chr121617 625 ------
NM_001002838chrX51868 616 388 189 172 ------
NM_001002843chr1521268 247 21301 974 ----
NM_001002860chr1454312 4193 3461 389 297 --21686 320 --
NM_001002909chr1762113 2019 1829 1548 337 324 1352 1276 --
NM_001002919chr23380 166 114 ------
NM_001003407chr1094180 4024 1627 1228 1145 965 864 733 564 23749 96 25098 4342 31455 1078 801
NM_001003408chr1094180 4024 1627 1228 1145 965 864 733 564 23749 96 25098 4342 31455 1078 801
NM_001003652chr18238615 8543 8052 6764 6289 6262 6135 5679 5466 3095 2810 2637 2445 2255 2236 1832 1509 1447 1431 1088 550 457 369 11167 11405 --
NM_001003665chr143076 2702 963 93 ----11245
NM_001003674chr18187036 6117 5622 5292 4825 2316 2201 1948 1884 1746 1724 1713 1634 1169 1091 895 789 637 26967 5152 65948 4712 4549 2028 1962 345 12765
NM_001003675chr18187036 6117 5622 5292 4825 2316 2201 1948 1884 1746 1724 1713 1634 1169 1091 895 789 637 26967 5152 65948 4712 4549 2028 1962 345 12765
NM_001003681chr2261971 1766 1550 1451 859 177 ------
NM_001003688chr431029 846 116 ------
NM_001003694chr3156 --187 --
NM_001003698chr6--11285 ----
NM_001003699chr6--11285 ----
NM_001003712chr1224006 3648 34037 1048 515 ----
NM_001003792chr351126 993 952 81 33 ------
NM_001003793chr351126 993 952 81 33 ------
NM_001003800chr953454 2440 1477 1312 614 13472 2992 482 13107
NM_001003809chr18164 ------
NM_001003810chr4----1697 --
NM_001003845chr21226 ----2515 40
NM_001003891chr221128 ------
NM_001003940chr1593737 3589 3387 2941 2514 1364 1094 935 181 13354 13342 --
NM_001003942chr1593737 3589 3387 2941 2514 1364 1094 935 181 13354 13342 --
NM_001003943chr1593741 3593 3391 2945 2518 1368 1098 939 185 13358 13346 --
NM_001004065chr983324 3288 3211 3034 1501 941 865 752 --13882 --
NM_001004067chr16--1340 1421 --
NM_001004106chr54712 671 245 69 ------
NM_001004127chr13----1912 --
NM_001004196chr341208 1095 944 333 ------
NM_001004304chr1283029 3023 2890 2281 2150 2114 1256 1246 ----1177
NM_001004317chr684433 3865 3542 3390 2934 2747 1779 1619 11487 13180 --
NM_001004342chr1136044 5015 4966 4906 3955 3780 2045 1993 1987 1820 1608 1170 754 24340 1729 35095 2302 1754 --
NM_001004354chr92911 48 --1345 --
NM_001004356chr431122 1086 1076 ----11474
NM_001004358chr431122 1086 1076 ----11474
NM_001004360chr21253 21455 307 1352 --
NM_001004419chr12104554 4481 4064 4049 3883 3278 3265 1628 1277 830 11484 24437 1820 14258
NM_001004439chr153452 397 291 --1115 --
NM_001004441chr511369 11608 ----
NM_001004720chr21733 ----1108
NM_001004722chr21902 ----1277
NM_001005158chr31391 --1128 --
NM_001005159chr31391 --1128 --
NM_001005209chr23735 694 40 --126 1530
NM_001005266chr151570 ------
NM_001005267chr151570 ------
NM_001005268chr151570 ------
NM_001005269chr151570 ------
NM_001005271chr1751129 1049 1023 370 131 --1142 --
NM_001005273chr1751129 1049 1023 370 131 --1142 --
NM_001005335chr19--182 ----
NM_001005353chr11179 --1224 --
NM_001005353chr11179 --1224 --
NM_001005354chr12142 ------
NM_001005360chr191580 --1815 --
NM_001005361chr191580 --1815 --
NM_001005362chr191580 --1815 --
NM_001005366chr122837 667 --1652 --
NM_001005375chrY1202 21658 349 21855 524 --
NM_001005377chr19249 21 ------
NM_001005386chr242006 1557 700 104 ----1462
NM_001005404chr1794383 4214 3764 1701 1311 752 229 188 180 21641 796 33392 3364 3244 --
NM_001005463chr1032566 1861 411 22134 753 22108 2094 --
NM_001005473chr576564 6429 5645 5501 4359 549 366 44598 2489 1411 68 ----
NM_001005474chr32197 65 --11473 1511
NM_001005476chr21230 ------
NM_001005505chr341701 380 314 146 ------
NM_001005609chrX42927 854 563 22 ----13833
NM_001005732chr21--1152 135 --
NM_001005733chr21--1152 135 --
NM_001005739chr21774 --2354 328 --
NM_001005746chr221072 1021 ------
NM_001005747chr221072 1021 ------
NM_001005751chr101149 --1481 --
NM_001005782chr21733 ------
NM_001005849chr17134 ------
NM_001005861chr32755 655 ------
NM_001005862chr17166 1597 ----
NM_001005909chr3137 ------
NM_001005910chr33561 484 430 --124 --
NM_001005911chr33561 484 430 --124 --
NM_001006115chr352759 2627 1924 1042 800 ------
NM_001006118chrY174 148 ----
NM_001006120chrY174 148 ----
NM_001006600chr512241 11661 ----
NM_001006610chr161921 1991 ----
NM_001006612chrX2181 138 ------
NM_001006613chrX2181 138 ------
NM_001006614chrX2181 138 ------
NM_001006617chr911369 --21237 1066 --
NM_001006618chr9197 ------
NM_001006619chr911369 --21237 1066 --
NM_001006620chr911369 --21237 1066 --
NM_001006621chr911369 --21237 1066 --
NM_001006626chr7187 1173 ----
NM_001006627chr7187 1173 ----
NM_001006628chr7187 1173 ----
NM_001006629chr7187 1173 ----
NM_001006630chr7187 1173 ----
NM_001006631chr7187 1173 ----
NM_001006632chr7187 1173 ----
NM_001006634chr162564 145 --176 --
NM_001006636chr22702 101 ------
NM_001006657chr273218 2169 2111 1206 1022 891 135 --1939 --
NM_001006681chrX1120 ------
NM_001006682chrX1120 ------
NM_001006683chrX1120 ------
NM_001006684chrX1205 1508 ----
NM_001006946chr271824 1426 1377 1308 515 189 174 11340 ----
NM_001007023chr1444770 4338 4053 283 1640 --14060
NM_001007024chr17174156 4098 3194 3093 1723 1509 1490 1311 1260 1000 960 923 884 804 764 180 142 --13601 14106
NM_001007025chr17174156 4098 3194 3093 1723 1509 1490 1311 1260 1000 960 923 884 804 764 180 142 --13601 14106
NM_001007027chr111227 ------
NM_001007067chr8163 ------
NM_001007068chr8163 ------
NM_001007069chr8163 ------
NM_001007070chr8163 ------
NM_001007072chr15292 27 ------
NM_001007075chr42888 714 11092 ----
NM_001007097chr954341 3398 1277 1204 955 15003 14028 21586 895
NM_001007098chr14822 769 358 62 ------
NM_001007102chr671566 1544 1195 1184 623 475 34 11275 11504 1532
NM_001007156chr1521874 766 11546 ----
NM_001007157chr7133 197 ----
NM_001007214chr11407 ----11203
NM_001007226chr1741350 427 316 105 1589 ----
NM_001007227chr1741350 427 316 105 1589 ----
NM_001007228chr1741350 427 316 105 1589 ----
NM_001007229chr1741350 427 316 105 1589 ----
NM_001007230chr1741350 427 316 105 1589 ----
NM_001007237chr172699 2193 1862 1823 985 478 59 --12739 --
NM_001007245chr7------1188
NM_001007246chr2121261 176 --1123 --
NM_001007257chr111232 ------
NM_001007271chr104978 745 49 41 ------
NM_001007277chr113364 224 61 --1239 --
NM_001007466chr695218 5090 4708 4230 3760 3291 1688 1058 844 24414 3736 2784 58 --
NM_001007467chr22------1111
NM_001007526chrY174 148 ----
NM_001007553chr13408 355 302 ------
NM_001007595chr153283 224 28 ------
NM_001007794chr1137 ------
NM_001008220chr553815 2692 2635 1088 114 --23677 2536 --
NM_001008222chrX21255 869 ------
NM_001008225chr73595 587 63 ------
NM_001008239chr1883818 3015 2756 2366 1381 560 370 294 --41486 1268 932 26 1689
NM_001008270chr7136 --121 --
NM_001008272chr31244 1127 ----
NM_001008273chr31244 1127 ----
NM_001008392chr393460 3329 3225 2949 2874 2714 2625 1050 827 33563 3121 709 13393 --
NM_001008405chr71672 ------
NM_001008407chr741650 1642 1199 696 1509 1254 --
NM_001008408chr7206042 5945 5843 5764 5669 5496 5310 5273 5163 5008 4644 3991 3934 1666 1524 1174 922 870 633 600 25120 4529 36081 5856 534 --
NM_001008495chr882085 2079 2030 1391 560 423 311 240 ------
NM_001008528chr1761824 1779 598 316 225 84 1627 1170 --
NM_001008529chr171929 --11313 --
NM_001008541chr1032011 1778 829 ----1580
NM_001008541chr1032011 1778 829 ----1580
NM_001008564chr1342142 1955 1857 1508 11966 ----
NM_001008566chr221136 1147 ----
NM_001008660chr1121246 519 --11282 --
NM_001008701chr1932849 2311 660 ------
NM_001008711chr851712 1087 679 348 59 11112 ----
NM_001008726chr1441656 1645 1593 565 ------
NM_001008738chr542887 2833 2269 133 1452 12131 --
NM_001008777chr171226 1433 ----
NM_001008783chr62306 250 ------
NM_001008938chr115474 419 392 177 167 ------
NM_001009185chr51649 ------
NM_001009552chr82549 539 1103 ----
NM_001009554chr4104768 3945 3810 3687 1863 1720 1291 734 423 267 33046 1789 1536 ----
NM_001009554chr4104768 3945 3810 3687 1863 1720 1291 734 423 267 33046 1789 1536 ----
NM_001009555chr431651 1594 76 11395 ----
NM_001009566chr161349 1200 1139 179 44 29 ------
NM_001009567chr102638 130 ------
NM_001009571chr71273 1329 11684 --
NM_001009880chr22104903 4866 4776 4021 3081 1907 1458 1354 1219 561 34656 1068 91 34205 1607 264 --
NM_001009881chr11610 ------
NM_001009882chr11610 ------
NM_001009899chr3206552 5841 5296 5074 4840 4696 4502 4139 2416 2057 1900 1780 1361 1180 1171 1013 911 816 769 108 --16544 --
NM_001009909chr1133680 2462 1187 11154 ----
NM_001009923chr205791 677 644 582 93 1262 1294 --
NM_001009955chr11571 ------
NM_001009955chr11571 ------
NM_001009959chr242511 2470 1971 459 12083 ----
NM_001009993chr293269 2961 2882 1724 1656 1319 941 792 180 11295 24390 3751 --
NM_001010853chr643144 1044 591 541 1182 ----
NM_001010857chr11109 ------
NM_001010861chr142776 2574 2554 634 --22162 976 11722
NM_001010862chrX71175 977 829 765 136 103 45 --1589 1400
NM_001010867chr1155766 4639 4387 2277 2064 2048 2014 1718 1228 748 711 636 422 357 62 11065 26057 1910 --
NM_001010888chrX74097 4033 3763 1300 1203 479 445 43584 3389 3213 3091 31213 1017 291 --
NM_001010908chr101151 ------
NM_001010927chr61570 1207 ----
NM_001010942chr1241031 821 225 160 1877 ----
NM_001010971chr13965 938 678 ------
NM_001010986chrX31597 1009 774 ----12291
NM_001010989chr163550 532 366 ------
NM_001010990chr163550 532 366 ------
NM_001011513chr453329 2858 1638 818 799 1374 11601 --
NM_001011515chr43950 782 81 ------
NM_001011516chr43950 782 81 ------
NM_001011537chr31343 22027 1731 12222 --
NM_001011538chr411080 ------
NM_001011553chr74962 930 192 88 ------
NM_001011645chrX2346 58 --287 74 --
NM_001011663chr10297 45 ------
NM_001011666chr7136012 4830 4754 4736 4649 4440 4270 4237 4113 2409 1173 320 281 ------
NM_001011708chr282614 2533 2086 2076 1176 1063 446 208 ------
NM_001011713chr1451579 1437 1385 1165 1154 1266 281 50 1656
NM_001011722chr11437 ------
NM_001011722chr11437 ------
NM_001011724chr131271 ------
NM_001011725chr131271 ------
NM_001011885chr1521652 1143 --21626 365 --
NM_001012267chr931592 1347 85 ------
NM_001012338chr15132 ------
NM_001012393chr11104121 3662 3459 1804 1498 1313 636 600 323 286 1686 --11438
NM_001012398chr162853 716 ------
NM_001012418chr6124223 3881 3662 3655 3419 3410 2857 1552 1419 877 523 168 --11676 22707 1066
NM_001012420chr1572465 2059 1165 1111 418 314 179 12100 ----
NM_001012423chr1572465 2059 1165 1111 418 314 179 12100 ----
NM_001012478chr192587 466 ------
NM_001012512chr181118 158 ----
NM_001012514chr25974 909 803 404 197 ------
NM_001012516chr25974 909 803 404 197 ------
NM_001012643chr192512 74 ------
NM_001012732chr4--11253 --1907
NM_001012751chr101653 21949 610 ----
NM_001012755chrX54896 4648 4169 1485 1168 --15052 --
NM_001012761chr542268 2131 503 216 ----12617
NM_001012968chrX32689 973 179 3436 254 206 ----
NM_001012977chrX31354 942 502 ------
NM_001012979chrX1162 ------
NM_001012989chrX2583 42 1656 ----
NM_001012990chrX1316 ------
NM_001013031chr1093324 3028 2623 2426 547 538 506 455 314 ------
NM_001013399chr6--1139 ----
NM_001013406chr751405 1366 1179 549 446 ------
NM_001013415chr42600 361 1461 --1260
NM_001013437chr182378 172 ------
NM_001013438chr33894 708 672 ------
NM_001013439chr32740 554 ------
NM_001013635chr123456 338 191 --1484 --
NM_001013642chr131094 1005 878 ----1981
NM_001013693chr142234 1833 926 390 ------
NM_001013693chr142234 1833 926 390 ------
NM_001013699chr12--141 ----
NM_001013839chr1722221 874 12541 22624 2053 --
NM_001013843chr155760 657 336 323 297 ------
NM_001014336chr122234 79 ------
NM_001014431chr143356 293 68 ------
NM_001014432chr143356 293 68 ------
NM_001014435chr163440 431 242 ------
NM_001014443chr1------1241
NM_001014445chr175997 910 740 709 46 --2326 257 --
NM_001014764chr17--1116 ----
NM_001014797chr10178149 7918 7410 7023 5947 5602 5082 2843 2135 1882 1798 1429 1208 938 821 777 693 18158 ----
NM_001014812chr15------1467
NM_001014839chr1----1911 --
NM_001014841chr1----1911 --
NM_001015045chr492465 2377 2343 2082 1759 1002 703 390 118 ------
NM_001015048chr1483151 2692 2645 2138 1197 577 208 35 12630 ----
NM_001015049chr1483151 2692 2645 2138 1197 577 208 35 12630 ----
NM_001015055chr22253 117 ------
NM_001015056chr22253 117 ------
NM_001015056chr22253 117 ------
NM_001015877chrX42795 1982 319 215 --1903 12512
NM_001015880chr1031653 672 427 ------
NM_001015881chrX31278 1164 462 ------
NM_001015885chr203351 271 46 --158 --
NM_001017368chr1762820 2496 2384 2186 797 471 1744 11966 12097
NM_001017369chr411088 ------
NM_001017395chr333421 2627 1015 ------
NM_001017402chr1145 ------
NM_001017405chr43900 734 671 ------
NM_001017415chr13669 659 602 ------
NM_001017416chr13669 659 602 ------
NM_001017420chr821366 1247 ------
NM_001017424chr1----21284 558 --
NM_001017425chr1----21284 558 --
NM_001017523chr1251898 1752 1248 1180 173 21631 1590 ----
NM_001017923chr141435 11072 ----
NM_001017926chr811702 1196 --11549
NM_001017928chr3--1224 ----
NM_001017969chr91640 1425 ----
NM_001017977chr11358 ------
NM_001017979chr4----198 --
NM_001017999chr171771 1710 898 807 640 458 250 ----1204
NM_001017999chr171771 1710 898 807 640 458 250 ----1204
NM_001018000chr171771 1710 898 807 640 458 250 ----1204
NM_001018000chr171771 1710 898 807 640 458 250 ----1204
NM_001018001chr171771 1710 898 807 640 458 250 ----1204
NM_001018038chr91174 ----123
NM_001018050chr2262490 2368 2219 1123 1114 731 ------
NM_001018052chr2262490 2368 2219 1123 1114 731 ------
NM_001018056chr91125 2546 226 ----
NM_001018064chr951923 1804 822 498 330 11700 21343 348 --
NM_001018065chr9105320 4060 3894 2151 1647 1522 1386 1380 1284 1070 34643 1175 98 --15691
NM_001018066chr9105320 4060 3894 2151 1647 1522 1386 1380 1284 1070 34643 1175 98 --15691
NM_001018067chr185188 4695 4513 4072 3999 1695 1368 59 23411 931 25170 446 --
NM_001018068chr185188 4695 4513 4072 3999 1695 1368 59 23411 931 25170 446 --
NM_001018069chr185188 4695 4513 4072 3999 1695 1368 59 23411 931 25170 446 --
NM_001018072chr1251898 1752 1248 1180 173 21631 1590 ----
NM_001018090chr1552786 2716 691 469 312 1227 --11874
NM_001018091chr1552896 2826 801 579 422 1337 --11984
NM_001018102chr1552786 2716 691 469 312 1227 --11874
NM_001018108chr1551767 1430 775 132 120 11969 ----
NM_001018111chr783854 3645 2786 2521 1407 641 397 301 ------
NM_001020658chr111442 21565 429 ----
NM_001020658chr111442 21565 429 ----
NM_001023567chr152418 179 --1314 --
NM_001023587chr3----11067 --
NM_001024218chr142798 110 1816 ----
NM_001024226chr12917 38 ------
NM_001024227chr12917 38 ------
NM_001024228chr12917 38 ------
NM_001024372chr852071 2015 1455 914 893 ----21689 370
NM_001024380chr832028 585 306 2963 815 22339 886 --
NM_001024381chr832028 585 306 2963 815 22339 886 --
NM_001024401chr1662502 2293 2271 2087 950 466 ------
NM_001024455chrX41892 926 245 44 --32676 1015 708 --
NM_001024460chr621114 244 ------
NM_001024463chr152987 851 ------
NM_001024647chr12106916 6862 6236 5763 4934 2835 1276 1185 546 507 35522 2381 119 27449 807 25865 555
NM_001024649chr582921 1826 1126 918 681 459 312 208 ------
NM_001024666chrX159 1632 ----
NM_001024668chr123861 740 724 1918 ----
NM_001024680chr241526 1295 1120 161 1292 --11354
NM_001024808chr1262021 1032 606 260 182 71 --11968 1482
NM_001024809chr1731300 308 53 ------
NM_001024847chr352286 1908 1721 934 270 1583 31672 1589 523 --
NM_001024855chr331907 1188 157 1550 --11495
NM_001024937chr171665 ------
NM_001024947chr52813 171 ------
NM_001024948chr153490 3149 2577 329 272 --22977 2268 --
NM_001024959chr33800 554 273 ------
NM_001024960chr33800 554 273 ------
NM_001025076chr10116111 5888 5858 5203 4906 4844 4838 4805 4009 2474 205 1514 24983 3965 --
NM_001025077chr10147469 7246 7216 6561 6264 6202 6196 6163 5367 5060 4997 1563 1313 951 11872 26341 5323 --
NM_001025079chr3103902 3788 3744 3440 3060 2726 2621 1312 753 430 13895 12548 13542
NM_001025105chr51577 2519 472 11394 2988 200
NM_001025108chr294119 4027 3959 3597 3142 1670 1640 838 143 --12752 --
NM_001025109chr13931 464 331 --2964 54 --
NM_001025205chr32398 104 --2468 119 --
NM_001025232chr121134 ------
NM_001025234chr11294 24 ------
NM_001025235chr11294 24 ------
NM_001025236chr11294 24 ------
NM_001025237chr11294 24 ------
NM_001025238chr11294 24 ------
NM_001025239chr11294 24 ------
NM_001025252chr832729 2101 1159 13193 1395 --
NM_001025253chr832729 2101 1159 13193 1395 --
NM_001025266chr364788 3796 1663 1091 905 598 24840 4248 --13048
NM_001025356chr1242403 1152 1120 1100 12426 1737 --
NM_001025389chr1141648 1391 345 95 ------
NM_001025390chr1141648 1391 345 95 ------
NM_001025579chr172751 420 --1263 --
NM_001025580chrX53049 1261 564 286 229 34247 1375 763 23198 37 --
NM_001025595chr44576 469 296 268 ------
NM_001025596chr111473 ------
NM_001025603chr141129 476 217 46 --2120 68 --
NM_001025616chr421914 1519 1155 ----
NM_001025780chr941516 996 553 314 190 ----
NM_001029835chr71330 ------
NM_001029858chr6103341 3052 2123 2106 1225 943 835 719 541 452 12422 21095 64 --
NM_001029859chr1151985 1869 719 552 108 1365 21535 332 1700
NM_001029863chr652145 1987 1131 999 981 1876 ----
NM_001029875chr552345 2161 2028 1092 844 11896 1531 --
NM_001029882chr12213 116 1485 ----
NM_001029882chr12213 116 1485 ----
NM_001030002chr173351 149 141 ------
NM_001030006chr1732627 2538 2418 --1676 --
NM_001030007chr1663981 3158 2746 1452 1008 413 21556 1141 3992 374 225 --
NM_001030055chr1454141 4013 1451 1153 561 1756 ----
NM_001030059chr102127 83 ------
NM_001030287chr141021 351 209 170 11145 ----
NM_001031677chr51215 ------
NM_001031679chr1233057 2584 291 1173 43160 2646 432 362 --
NM_001031684chr241518 1481 1326 935 172 ----
NM_001031685chr13654 341 43 ------
NM_001031690chr752021 1118 987 443 393 12395 ----
NM_001031695chr2264758 3853 3722 3626 295 201 21406 466 15425 24897 4085
NM_001031696chr191310 ------
NM_001031702chr32821 749 --195 --
NM_001031711chr541435 1362 576 157 ------
NM_001031723chr4--150 ----
NM_001031732chr453209 3039 2966 2503 1153 11081 ----
NM_001031738chr21442 ------
NM_001031743chr6--1162 ----
NM_001031746chr1051419 1390 1012 281 84 ------
NM_001031804chr1654376 3348 3247 1721 1161 11644 ----
NM_001031812chr552244 1944 1767 502 233 1384 174 --
NM_001032221chr961800 1659 1419 647 587 83 --21790 1118 --
NM_001032279chr112387 296 ------
NM_001032280chr631596 1245 308 --2686 210 --
NM_001032282chr811291 ------
NM_001032283chr121410 ------
NM_001032284chr121410 ------
NM_001032289chrX2846 102 ------
NM_001032293chr171547 ------
NM_001032296chr13102874 2780 2450 2299 2267 1021 951 894 631 513 --12142 --
NM_001032380chr101447 ----11312
NM_001032393chrX1205 1500 ----
NM_001032999chr20165286 4707 4540 4119 3791 3509 3431 3287 3240 1445 1395 959 889 870 181 165 --24102 204 --
NM_001033044chr131788 1204 333 ------
NM_001033045chr263740 3670 1305 871 816 679 33686 972 124 --14007
NM_001033049chr2151969 1703 924 742 237 11603 12255 --
NM_001033056chr131788 1204 333 ------
NM_001033057chr372070 1887 1834 1826 1404 1391 798 ----11432
NM_001033059chr652047 1750 1434 594 225 11716 ----
NM_001033081chr121403 81 11764 1375 --
NM_001033082chr121403 81 11764 1375 --
NM_001033085chr2142 ------
NM_001033087chr2092918 2862 2610 2161 1012 813 785 281 164 --12897 --
NM_001033117chr3114854 4590 4375 4243 3929 3889 3237 1733 1421 569 402 --13045 --
NM_001033506chr11155 ------
NM_001033518chr752320 1940 1875 442 372 22888 2623 21138 292 --
NM_001033519chr752320 1940 1875 442 372 22888 2623 21138 292 --
NM_001033520chr752320 1940 1875 442 372 22888 2623 21138 292 --
NM_001033557chr211372 --21303 1245 --
NM_001033561chr172909 199 --1126 --
NM_001033564chr61447 1549 ----
NM_001033566chr17170 ------
NM_001033568chr17170 ------
NM_001033602chr1352421 2190 1878 989 771 12741 22473 1893 --
NM_001033659chr1711601 ------
NM_001033723chr862560 2540 2510 2304 1858 304 ------
NM_001033925chr102581 172 ------
NM_001033952chr111246 ------
NM_001034837chr52293 138 ------
NM_001034838chr52293 138 ------
NM_001034841chr1695486 3835 3819 1764 1393 1259 983 379 284 24824 489 12057 --
NM_001034845chr411402 1124 ----
NM_001034852chr1451461 1325 840 417 129 ------
NM_001034853chrX--21075 965 ----
NM_001035chr12139 67 11262 ----
NM_001035003chr43407 236 180 11271 --11283
NM_001035004chr43407 236 180 11271 --11283
NM_001035254chr962510 2398 1831 1705 964 897 --2687 96 --
NM_001035260chr1021573 432 ------
NM_001035267chr121202 ------
NM_001035511chr152004 1761 1726 257 248 ------
NM_001035512chr152111 1868 1833 364 355 ------
NM_001035513chr152111 1868 1833 364 355 ------
NM_001037132chr731781 876 108 12087 1285 --
NM_001037133chr731781 876 108 12087 1285 --
NM_001037164chr731405 524 149 ----1367
NM_001037172chr351339 1214 529 510 303 1451 ----
NM_001037174chr221837 607 --1617 --
NM_001037290chr11------1729
NM_001037317chr142776 2574 2554 634 --22162 976 11722
NM_001037324chr31174 ------
NM_001037331chr181798 1162 ----
NM_001037334chr1852381 902 428 412 147 ----11868
NM_001037339chr131226 679 299 1587 ----
NM_001037340chr131226 679 299 1587 ----
NM_001037341chr131226 679 299 1587 ----
NM_001037341chr131226 679 299 1587 ----
NM_001037533chr13709 170 75 ----1225
NM_001037535chrX31049 526 78 ------
NM_001037536chrX31049 526 78 ------
NM_001037540chrX31049 526 78 ------
NM_001037582chr431331 541 236 ------
NM_001037633chr52292 140 --1316 --
NM_001037637chr52296 251 ------
NM_001037872chr2--164 ----
NM_001037954chr1122287 666 13542 1312 --
NM_001038493chr241060 963 630 579 11334 ----
NM_001038707chr161972 1869 830 574 420 23 ----11808
NM_001038707chr161972 1869 830 574 420 23 ----11808
NM_001039091chrX11339 ------
NM_001039111chr33412 368 317 ------
NM_001039350chr741262 716 552 390 ------
NM_001039366chr221140 1448 2118 85 --
NM_001039538chr252331 1065 797 260 249 43693 3659 985 196 23515 3412 11483
NM_001039547chr3108063 7223 7128 7033 6722 6168 5753 2646 1727 1276 34958 3038 1467 16388 --
NM_001039548chr11164 ------
NM_001039573chr171420 1435 ----
NM_001039574chr14999 884 360 116 ------
NM_001039577chr193960 3929 3902 3479 3445 1492 954 850 177 --31593 1504 398 --
NM_001039583chr221133 ------
NM_001039584chr221133 ------
NM_001039590chrX63818 3472 2561 1118 486 145 13723 11093 1360
NM_001039591chrX63818 3472 2561 1118 486 145 13723 11093 1360
NM_001039618chr1175711 5391 5043 4818 1467 1110 325 ------
NM_001039619chr14148 ------
NM_001039649chr131312 ------
NM_001039690chr1652135 1849 1717 423 405 ------
NM_001039709chr20165286 4707 4540 4119 3791 3509 3431 3287 3240 1445 1395 959 889 870 181 165 --24102 204 --
NM_001039715chr11965 --1721 --
NM_001039716chr111029 --1785 --
NM_001039762chr10--2454 298 21747 210 --
NM_001039772chr11--1511 --169
NM_001039802chr131154 930 24 1101 --1336
NM_001039840chrX144575 4326 3826 2063 1694 1678 1653 1061 817 507 444 198 161 86 34020 3700 674 34592 2379 574 1384
NM_001039845chr24673 628 458 180 --1590 --
NM_001039888chr11597 ------
NM_001039935chr51377 ------
NM_001039937chr13123315 3104 2843 2755 1094 1084 1036 1009 747 686 349 333 ------
NM_001040001chr621258 564 1831 ----
NM_001040056chr16----1189 --
NM_001040057chr7----1424 --
NM_001040101chr411601 1369 --1143
NM_001040110chr751625 1357 411 260 60 ------
NM_001040113chr162881 162 ------
NM_001040114chr162740 21 ------
NM_001040135chr7--183 ----
NM_001040142chr211724 ------
NM_001040143chr211724 ------
NM_001040144chr1652135 1849 1717 423 405 ------
NM_001040146chr1652135 1849 1717 423 405 ------
NM_001040151chr11114422 4381 4280 4133 4123 3036 1081 1031 520 364 221 --13874 --
NM_001040153chr133914 381 308 --1262 --
NM_001040157chr441934 768 428 140 ------
NM_001040158chr5--2552 452 ----
NM_001040167chr74979 401 225 183 1774 21213 351 11110
NM_001040172chr53428 387 250 ------
NM_001040173chr53428 387 250 ------
NM_001040181chr31423 ------
NM_001040182chr31423 ------
NM_001040183chr31423 ------
NM_001040195chr11665 --149 --
NM_001040199chr31423 ------
NM_001040200chr31423 ------
NM_001040202chr462139 1981 1863 1030 610 160 --12017 --
NM_001040214chr672383 2321 1630 719 420 413 370 11643 1349 --
NM_001040272chr911755 ------
NM_001040273chr1042099 2091 426 230 --12041 --
NM_001040284chr1655285 4434 1555 476 31 15945 21050 937 --
NM_001040402chr453096 2612 837 797 157 12983 1196 12903
NM_001040429chr1342780 2736 2425 555 12210 ----
NM_001040439chr162487 455 --21469 412 --
NM_001040441chr124242 2169 34898 2059 36 13971 --
NM_001040446chr572098 1808 1706 921 800 623 200 --1722 --
NM_001040450chr1532084 1765 994 ------
NM_001040453chr1532084 1765 994 ------
NM_001040455chr1171355 1263 1213 911 459 195 70 ----1313
NM_001040619chr171471 1185 659 620 238 87 50 11595 ----
NM_001040624chr872649 2452 2315 2168 2129 1892 287 --1914 11842
NM_001040625chr872649 2452 2315 2168 2129 1892 287 --1914 11842
NM_001040626chr872649 2452 2315 2168 2129 1892 287 --1914 11842
NM_001040627chr872649 2452 2315 2168 2129 1892 287 --1914 11842
NM_001040628chr872649 2452 2315 2168 2129 1892 287 --1914 11842
NM_001040629chr872649 2452 2315 2168 2129 1892 287 --1914 11842
NM_001040630chr872649 2452 2315 2168 2129 1892 287 --1914 11842
NM_001040653chr351928 1728 817 730 314 --1824 --
NM_001040665chr774657 4276 3556 2014 1964 829 242 1334 24284 1438 14893
NM_001040694chr1151150 1063 157 142 70 ----1261
NM_001040708chr811134 ------
NM_001040709chr161951 1899 1787 900 559 303 ----12311
NM_001040712chr9123572 3554 3387 3336 3152 2945 2714 2703 1444 1399 713 411 23078 673 13002 --
NM_001040715chr164843 828 248 79 11058 ----
NM_001040876chr43703 686 367 --1499 --
NM_001042353chr204533 397 390 364 ------
NM_001042355chr16125401 5245 4827 4492 3925 3295 2035 1988 1756 1451 194 140 1561 34784 3653 3605 --
NM_001042357chr1061497 1106 972 91 72 47 ------
NM_001042358chr1061497 1106 972 91 72 47 ------
NM_001042360chr1061497 1106 972 91 72 47 ------
NM_001042361chr1061528 1137 1003 122 103 78 ------
NM_001042363chr1061497 1106 972 91 72 47 ------
NM_001042364chr1061528 1137 1003 122 103 78 ------
NM_001042365chr1061528 1137 1003 122 103 78 ------
NM_001042383chr3103240 2941 2631 2364 1348 1086 946 930 673 228 --43307 3151 1040 172 --
NM_001042387chr1061528 1137 1003 122 103 78 ------
NM_001042389chr1061497 1106 972 91 72 47 ------
NM_001042390chr1061497 1106 972 91 72 47 ------
NM_001042392chr1061497 1106 972 91 72 47 ------
NM_001042393chr1061528 1137 1003 122 103 78 ------
NM_001042395chr1061497 1106 972 91 72 47 ------
NM_001042396chr1061528 1137 1003 122 103 78 ------
NM_001042397chr1061528 1137 1003 122 103 78 ------
NM_001042404chr141837 630 537 412 ------
NM_001042406chr61920 11084 ----
NM_001042412chr16125401 5245 4827 4492 3925 3295 2035 1988 1756 1451 194 140 1561 34784 3653 3605 --
NM_001042413chr973328 2646 1118 777 746 731 618 13355 1170 --
NM_001042424chr462603 1159 1139 1109 508 188 --22147 953 --
NM_001042425chr631596 1245 308 --2686 210 --
NM_001042430chr141177 ------
NM_001042440chr561910 817 667 648 345 32 11604 ----
NM_001042441chr561910 817 667 648 345 32 11604 ----
NM_001042442chr561910 817 667 648 345 32 11604 ----
NM_001042443chr561910 817 667 648 345 32 11604 ----
NM_001042444chr561910 817 667 648 345 32 11604 ----
NM_001042445chr561910 817 667 648 345 32 11604 ----
NM_001042446chr561910 817 667 648 345 32 11604 ----
NM_001042453chrX31553 1265 1249 11576 --1112
NM_001042459chr31230 141 ----
NM_001042472chr203550 413 35 ------
NM_001042473chr102646 160 --12049 --
NM_001042476chr1641991 1803 1796 1413 --2609 47 --
NM_001042481chr1462447 2330 2310 2236 883 865 --32505 1921 477 --
NM_001042486chr2021511 86 --1532 11535
NM_001042494chr1553345 2867 2589 180 110 --13849 --
NM_001042495chr1553345 2867 2589 180 110 --13849 --
NM_001042496chr1553345 2867 2589 180 110 --13849 --
NM_001042497chr1553345 2867 2589 180 110 --13849 --
NM_001042498chrX3983 239 64 ------
NM_001042506chrX31320 942 502 ------
NM_001042510chr821349 434 --11384 --
NM_001042511chr821349 434 --11384 --
NM_001042537chrX32078 916 38 --1206 --
NM_001042555chr12114056 3783 3679 3489 1287 1262 1199 968 602 556 26 24619 1023 14290 --
NM_001042599chr2147819 7770 6287 5757 5627 5244 4789 3152 2928 2617 1306 1084 966 416 --47435 5045 1429 227 15397
NM_001042601chr363079 2839 2337 862 741 140 ------
NM_001042603chr12174914 4128 3635 3519 3513 3502 3461 3455 3444 3403 3397 3386 3339 3328 1564 805 161 25353 1938 24959 151 14732
NM_001042604chr364225 3990 3742 3620 1571 1318 1238 11080 --
NM_001042632chr202991 498 ------
NM_001042633chr202991 498 ------
NM_001042669chr421914 1519 1155 ----
NM_001042681chr192430 2241 1886 884 840 800 793 771 513 1536 ----
NM_001042682chr192430 2241 1886 884 840 800 793 771 513 1536 ----
NM_001042682chr192430 2241 1886 884 840 800 793 771 513 1536 ----
NM_001042683chr631814 584 530 11847 ----
NM_001042728chr1241030 343 159 97 11087 ----
NM_001042749chrX3815 389 88 11958 ----
NM_001042750chrX3815 389 88 11958 ----
NM_001042751chrX3815 389 88 11958 ----
NM_001042762chr72796 111 --131 --
NM_001043318chr14104141 3752 3475 3442 3295 1385 1100 960 775 767 13838 23007 670 --
NM_001043351chr12511 169 11741 ----
NM_001044305chr641394 312 213 149 --11257 --
NM_001044385chr294004 3869 3812 2617 1531 832 782 766 622 ------
NM_001044722chr552244 1944 1767 502 233 1384 174 --
NM_001044723chr552244 1944 1767 502 233 1384 174 --
NM_001046chr542347 400 257 223 12169 ----
NM_001066chr192152 2097 1971 1406 531 428 387 285 206 ------
NM_001068chr3162 ------
NM_001077628chr11657 ------
NM_001078chr11238 --1606 --
NM_001079874chr141738 1667 605 465 21732 668 ----
NM_001080418chr11477 ------
NM_001083620chr432443 2056 438 11678 ----
NM_001095chr1251608 1300 1199 341 167 ------
NM_001096chr171243 2801 757 3846 794 729 --
NM_001099678chr376279 6101 5816 4657 1849 261 241 1306 12255 --
NM_001100108chr1138323 7666 7374 7322 6592 5985 5799 5233 5145 3330 1679 810 593 1771 37880 3197 1089 --
NM_001104548chr1--1165 ----
NM_001106chr3179569 8796 8750 8102 7774 7582 7167 6331 3910 3264 3173 2758 2032 1595 897 489 482 28457 8449 29667 3677 --
NM_001107chr141204 ------
NM_001109977chr43734 240 144 ------
NM_001112808chr11417 ------
NM_001113490chrX22482 1366 33597 2341 966 ----
NM_001116chr1663019 2911 2831 2771 1999 33 --12394 --
NM_001117chr1862191 2053 1904 824 636 602 ------
NM_001119chr45450 378 296 75 46 ------
NM_001121chr1031853 1508 232 ------
NM_001123chr101336 ----1642
NM_001124chr11----1693 1160
NM_001126chr11397 1878 ----
NM_001127chr222716 32 --1856 --
NM_001128chr1663981 3158 2746 1452 1008 413 21556 1141 3992 374 225 --
NM_001143chrY--1111 ----
NM_001146chr841880 1845 1578 590 ------
NM_001148chr431994 450 444 1141 ----
NM_001149chr10--2911 871 ----
NM_001153chr23878 598 146 ------
NM_001156chr103491 464 147 ------
NM_001163chr91799 --1956 --
NM_001167chrX126707 6536 6484 6417 6372 6126 5591 4997 4293 2296 1919 370 --12244 --
NM_001169chr161318 ----1416
NM_001173chr1454141 4013 1451 1153 561 1756 ----
NM_001174chrX11971 ------
NM_001177chr12--22227 567 --11752
NM_001186chr2132379 1106 1046 22962 2766 11057 --
NM_001187chr211499 ------
NM_001191chr2051251 1182 1128 347 44 ------
NM_001198chr682349 2251 1651 888 500 491 300 218 12043 --195
NM_001201chr493528 3392 3376 3192 2599 1440 1192 701 88 13636 1598 --
NM_001204chr275021 2284 1464 647 598 208 38 56908 6510 5833 2542 1583 11505 --
NM_001206chr942922 2112 1978 1106 22990 985 12127 --
NM_001207chr52296 251 ------
NM_001219chr71599 22261 2065 1746 --
NM_001222chr1061898 1673 1445 1321 1243 191 ------
NM_001232chr13266 142 85 --1871 --
NM_001241chr222250 513 --21912 1623 12414
NM_001241chr222250 513 --21912 1623 12414
NM_001253chr6--1239 ----
NM_001256chr1792862 2605 2417 2335 2214 2182 1898 1053 758 22964 459 167 --
NM_001257chr1641414 1388 373 161 11082 ----
NM_001259chr786099 5466 5122 2197 1650 1083 778 138 35234 5188 1272 21880 369 --
NM_001265chr133346 225 62 ------
NM_001267chr175490 444 352 103 40 ------
NM_001273chr123439 222 105 ------
NM_001275chr142359 51 ------
NM_001277chr1131085 819 70 ------
NM_001280chr191658 ------
NM_001282chr1732627 2538 2418 --1676 --
NM_001284chr51387 ------
NM_001286chr162913 2759 2212 746 566 354 --22713 2206 --
NM_001290chr42983 430 ------
NM_001293chr11129 1467 ----
NM_001298chr211315 1323 --2916 247
NM_001299chr191428 --1197 --
NM_001300chr102467 99 ------
NM_001304chr1751300 1116 567 317 142 13051 ----
NM_001308chr10138 ------
NM_001310chr122979 306 33005 1918 129 1518 1121
NM_001315chr61814 --12062 --
NM_001316chr20--1479 ----
NM_001331chr1192832 2722 2051 1874 1794 1126 1063 976 253 22456 675 22196 1133 --
NM_001332chr511529 --1455 --
NM_001343chr521702 96 11199 ----
NM_001345chr12----175 --
NM_001346chr342128 965 630 453 11833 21004 469 --
NM_001347chr451624 1574 1210 286 39 --11665 --
NM_001351chr321811 1566 1253 21834 426 --
NM_001356chrX11748 ------
NM_001364chr11123805 3592 3283 3275 3011 2964 2924 2889 1709 340 269 108 44164 584 558 409 ----
NM_001365chr172591 582 1765 1166 --
NM_001378chr22339 69 ------
NM_001380chr101749 1329 ----
NM_001385chr82381 280 ------
NM_001386chr862422 2097 1702 833 757 650 ------
NM_001389chr211432 --1578 --
NM_001391chr1811021 21146 1118 ----
NM_001395chrX1217 1199 1900 --
NM_001396chr2152413 1914 1013 905 373 ------
NM_001397chr132593 2279 1897 --32181 988 678 --
NM_001399chrX42927 854 563 22 ----13833
NM_001400chr131337 422 263 1868 ----
NM_001406chr1741267 1174 368 220 ------
NM_001407chr321715 487 ------
NM_001412chrX73386 3379 3144 2943 2891 797 455 ------
NM_001417chr1231892 703 156 11457 ----
NM_001418chr112297 145 ------
NM_001418chr112297 145 ------
NM_001419chr1964603 3203 3020 1946 1174 536 --1883 --
NM_001420chr1921925 179 12201 32595 2360 1196 --
NM_001423chr1241949 1427 722 549 ------
NM_001427chr731756 1299 444 ------
NM_001429chr221892 ------
NM_001430chr23559 364 31 21575 75 --11510
NM_001431chr621139 418 ------
NM_001432chr463637 3422 3193 1274 890 678 2713 353 --13645
NM_001438chr153305 3199 2305 530 280 33603 3476 1400 ----
NM_001447chr521199 531 ------
NM_001448chrX21724 81 ------
NM_001449chrX3503 266 66 ------
NM_001451chr1631239 522 333 ------
NM_001452chr62667 638 ------
NM_001453chr61226 ------
NM_001454chr171623 ------
NM_001458chr72684 627 ------
NM_001463chr22305 162 1265 ----
NM_001478chr12----1692 --
NM_001482chr152312 182 ------
NM_001491chr62981 570 11743 1302 --
NM_001493chrX3287 249 70 ------
NM_001494chr101753 ------
NM_001497chr992598 2502 1966 1861 1696 791 225 61 48 --22624 1085 1208
NM_001498chr611084 21321 547 11146 --
NM_001514chr12148 42 ------
NM_001518chr731005 918 380 ------
NM_001523chr19------1118
NM_001525chr11105 ------
NM_001527chr664136 4086 3936 3682 1592 409 21586 1477 --34592 613 516
NM_001530chr143839 755 437 ------
NM_001533chr19--182 ----
NM_001542chr172699 2193 1862 1823 985 478 59 --12739 --
NM_001546chr651483 1237 1195 1154 1025 --1192 1490
NM_001550chr7------1188
NM_001552chr172969 103 ------
NM_001554chr12482 216 ------
NM_001570chr321356 1174 1387 ----
NM_001584chr1131040 465 381 ------
NM_001587chrX51784 1405 542 416 259 22153 1488 22070 452 1601
NM_001604chr111386 ------
NM_001609chr1053473 3038 1087 299 289 23323 1324 ----
NM_001610chr111610 ------
NM_001613chr10123 ------
NM_001614chr171547 ------
NM_001614chr171547 ------
NM_001616chr232384 1166 876 13422 13357 --
NM_001620chr111269 1622 ----
NM_001621chr742723 1912 633 457 ------
NM_001621chr742723 1912 633 457 ------
NM_001634chr652047 1750 1434 594 225 11716 ----
NM_001635chr71882 11049 1322 --
NM_001650chr1862962 1544 1335 1072 889 793 13430 11206 13681
NM_001654chrX3457 446 84 ------
NM_001655chr1131740 1416 1358 --2731 134 --
NM_001656chr542035 1929 387 156 --150 --
NM_001658chr12917 38 ------
NM_001659chr1272556 2491 2200 2039 815 449 405 --1678 --
NM_001660chr31723 ------
NM_001661chr17144 1715 2536 192 --
NM_001662chr72156 127 ------
NM_001663chr1452681 2607 856 445 222 ------
NM_001664chr311017 --1226 --
NM_001665chr114488 384 200 190 ------
NM_001668chr141838 737 580 156 2888 74 ----
NM_001674chr141021 351 209 170 11145 ----
NM_001676chr131165 ------
NM_001677chr11137 1940 ----
NM_001678chr1761577 1481 679 656 643 418 --21781 1415 --
NM_001679chr31192 ------
NM_001681chr122258 22 ----1282
NM_001682chr1242538 1877 395 173 12485 21852 1839 --
NM_001683chr352741 2375 2239 726 564 11088 12608 --
NM_001684chr1124031 3993 3886 3630 3401 2950 2857 1581 1529 790 769 533 13959 ----
NM_001690chr332398 1618 89 1469 2484 362 --
NM_001693chr851105 1081 951 913 66 ------
NM_001695chr884091 3795 3253 2902 1273 851 146 98 31577 1039 214 ----
NM_001696chr221140 1448 2118 85 --
NM_001699chr1941453 1443 1235 163 21139 205 ----
NM_001701chr931583 1460 1323 11107 --21018 462
NM_001703chr11300 ------
NM_001704chr61557 ------
NM_001706chr32963 763 2701 328 ----
NM_001707chr74811 650 294 228 1333 ----
NM_001709chr1142552 1909 1866 217 1687 ----
NM_001714chr121221 ------
NM_001718chr651088 475 230 206 33 ------
NM_001730chr1311041 ------
NM_001730chr1311041 ------
NM_001731chr122368 322 --2668 344 --
NM_001735chr92345 32 ------
NM_001741chr111246 ------
NM_001742chr731831 1748 413 11289 --1525
NM_001743chr2--178 ----
NM_001746chr582921 1826 1126 918 681 459 312 208 ------
NM_001748chr11194 1263 --11088
NM_001750chr561910 817 667 648 345 32 11604 ----
NM_001753chr761562 1492 1428 1252 558 243 11715 ----
NM_001754chr2163204 3104 1381 1194 1076 529 14274 ----
NM_001755chr1641898 853 572 209 1882 1847 --
NM_001759chr1273862 3277 2074 1594 1482 547 111 --24385 3849 --
NM_001761chr163620 267 102 11770 --11191
NM_001769chr121127 ------
NM_001773chr131297 980 28 --21330 420 --
NM_001777chr3103902 3788 3744 3440 3060 2726 2621 1312 753 430 13895 12548 13542
NM_001786chr10--1186 ----
NM_001788chr74962 930 192 88 ------
NM_001791chr131154 930 24 1101 --1336
NM_001792chr1821109 799 --11116 --
NM_001794chr201238 ------
NM_001796chr16--142 ----
NM_001802chr161120 ------
NM_001826chr11154 ------
NM_001829chr41265 2154 142 ----
NM_001830chrX73988 3001 2879 1271 798 341 291 14064 11104 --
NM_001839chr12697 159 ------
NM_001842chr93468 110 87 ------
NM_001843chr12185 ------
NM_001844chr12----2390 85 --
NM_001845chr1351048 1023 920 549 446 1260 11393 --
NM_001855chr92301 226 ------
NM_001858chr644222 4111 3350 672 1764 24062 3503 --
NM_001859chr933870 3061 2933 ------
NM_001872chr134408 384 158 23 ------
NM_001881chr101383 ------
NM_001892chr51577 2519 472 11394 2988 200
NM_001893chr17153 ------
NM_001894chr2221088 158 ------
NM_001895chr201928 ------
NM_001901chr621048 798 1838 ----
NM_001902chr13403 174 158 ----186
NM_001904chr32672 59 1250 ----
NM_001913chr72625 272 --1840 --
NM_001918chr1139074 8952 8841 8790 7860 6969 6930 6721 6590 2663 2628 2210 1319 38354 7270 6154 1803 28099 998
NM_001920chr121773 ------
NM_001921chr4--11253 --1907
NM_001923chr11245 23 ----1599
NM_001924chr1----1172 --
NM_001933chr1441334 515 441 391 --21019 195 1298
NM_001935chr21247 --1296 --
NM_001936chr741262 716 552 390 ------
NM_001938chr151499 467 363 353 347 182 ----
NM_001939chrX43847 2918 1470 820 11034 ----
NM_001942chr1831915 1319 322 --11888 11831
NM_001944chr1842296 2024 1966 1665 ------
NM_001946chr123412 361 123 --3942 446 236 --
NM_001949chr652381 2154 2128 679 227 22847 895 --1981
NM_001950chr164734 668 494 248 ------
NM_001964chr53463 273 176 ------
NM_001967chr3--1237 ----
NM_001968chr41696 ----1275
NM_001969chr1453046 2806 2689 1477 368 22658 984 1517 --
NM_001977chr41586 ------
NM_001978chr811032 --1141 --
NM_001980chr1231991 1863 1716 151 ----
NM_001981chr1102311 1785 1596 917 866 860 546 401 361 312 22299 1687 ----
NM_001982chr1211080 ------
NM_001987chr1273870 2908 1596 1118 1054 644 623 33690 433 270 ----
NM_001992chr532157 659 325 1506 ----
NM_001995chr441519 1227 389 352 ------
NM_001999chr52552 50 1341 ----
NM_002006chr475544 4847 4094 1515 1169 972 589 15586 1560 --
NM_002007chr111171 ------
NM_002010chr131172 ------
NM_002015chr1373242 2728 1336 1241 1075 524 485 1702 11192 --
NM_002017chr1131312 1015 998 ------
NM_002023chr151622 1425 1219 400 180 --1123 --
NM_002024chrX41790 1375 809 184 11602 11687 --
NM_002025chrX139168 8513 7878 7621 7570 6087 3445 3373 2587 2407 2366 910 779 27349 139 49107 5824 2071 1699 39220 6260 921
NM_002026chr261053 903 378 223 113 40 ------
NM_002028chr1441287 1110 504 27 --11052 1469
NM_002031chr62647 621 ------
NM_002035chr18113408 2873 2701 1507 613 497 489 481 473 465 457 23835 2964 11268 --
NM_002037chr61357 ------
NM_002039chr41666 1792 ----
NM_002040chr2173039 2414 2297 766 669 402 222 1564 ----
NM_002045chr32365 152 ------
NM_002048chr91891 1416 ----
NM_002051chr10169 ----1149
NM_002052chr841517 1237 323 96 11089 11222 --
NM_002054chr21343 --1114 --
NM_002055chr1741472 137 77 26 ------
NM_002056chr24822 673 602 233 ------
NM_002063chrX1977 ------
NM_002065chr131788 1204 333 ------
NM_002069chr71254 --164 --
NM_002071chr181147 ------
NM_002072chr93797 122 90 ------
NM_002073chr2251188 1070 353 316 133 1157 11039 --
NM_002074chr131168 1146 198 11533 21647 1635 --
NM_002076chr1283200 3189 3178 3170 1008 615 188 74 --121 --
NM_002077chr951880 1512 786 428 281 21645 1438 ----
NM_002080chr1651015 926 818 701 50 ------
NM_002081chr251381 709 592 179 43 ------
NM_002082chr54675 634 208 32 ------
NM_002084chr51854 ------
NM_002091chr181118 158 ----
NM_002092chr4104746 4476 4182 2033 1824 1718 1584 1152 1027 52 34912 3540 1689 ----
NM_002094chr16184 1115 ----
NM_002103chr1951079 1065 851 95 40 --1291 --
NM_002105chr1121005 708 ------
NM_002106chr4187 ------
NM_002112chr15148 ------
NM_002126chr17133894 3766 3136 2906 2727 2624 1660 1252 717 708 390 351 215 13819 ----
NM_002128chr1322442 875 ----1384
NM_002129chr4----1145 --
NM_002130chr51175 11552 --1250
NM_002131chr661314 1068 952 825 381 63 ------
NM_002136chr121271 ------
NM_002137chr721973 1611 1644 --1691
NM_002138chr4----1697 --
NM_002140chr941081 175 150 134 1763 ----
NM_002143chr13744 698 572 ------
NM_002146chr171577 ------
NM_002147chr174874 728 249 77 ------
NM_002148chr2--1194 ----
NM_002149chr22591 60 ------
NM_002158chr233711 3086 278 1378 13400 1753
NM_002160chr91175 --1191 --
NM_002166chr22538 243 --135 --
NM_002167chr12487 51 1442 ----
NM_002182chr342591 2199 769 157 --1236 --
NM_002188chr53567 219 25 ------
NM_002192chr72627 500 1639 ----
NM_002193chr241462 1425 1264 540 ------
NM_002196chr203980 401 262 ------
NM_002196chr203980 401 262 ------
NM_002199chr41408 ------
NM_002205chr123983 930 893 --1282 --
NM_002214chr795731 5192 4838 4543 3687 2189 1245 949 652 1617 13468 14895
NM_002221chr192877 2644 2399 2201 1804 975 775 420 191 11988 22756 1173 --
NM_002222chr31268 ----11172
NM_002223chr1253218 2755 2713 670 324 11079 13653 11310
NM_002228chr151231 786 776 395 244 ------
NM_002229chr19----1373 --
NM_002230chr172851 124 --133 --
NM_002232chr111324 1182 ----
NM_002233chr111465 ------
NM_002239chr21251 ------
NM_002241chr182212 1901 1189 662 558 516 394 207 --1612 --
NM_002242chr222014 708 1369 ----
NM_002245chr12562 448 1129 ----
NM_002246chr23394 375 85 ------
NM_002247chr1022299 126 ----12120
NM_002252chr21174 ------
NM_002253chr41419 1358 ----
NM_002254chr282247 2040 1514 1462 664 657 206 151 --11801 --
NM_002264chr3124872 4595 4298 3707 3631 1852 1550 1325 1025 938 533 181 ------
NM_002265chr172485 430 ------
NM_002267chr1312105 --1153 --
NM_002268chr311800 --1735 --
NM_002270chr5135501 5350 4286 4117 4059 2206 1825 1507 1230 1205 1199 771 515 34306 1882 1299 31988 1935 72 12193
NM_002271chr1331910 1573 422 32392 1594 897 1381 --
NM_002274chr173245 114 33 1358 ----
NM_002276chr17124 ------
NM_002285chr294119 4027 3959 3597 3142 1670 1640 838 143 --12752 --
NM_002293chr152540 2153 1696 480 105 ------
NM_002294chrX180 --1445 --
NM_002296chr131595 232 106 154 ----
NM_002310chr586440 4095 2631 2224 2074 1621 1269 395 45356 1513 1502 709 15122 --
NM_002313chr1094180 4024 1627 1228 1145 965 864 733 564 23749 96 25098 4342 31455 1078 801
NM_002314chr741028 888 236 173 --1896 --
NM_002317chr5--1254 ----
NM_002319chr71426 --1268 --
NM_002334chr1131963 809 378 ----11945
NM_002336chr1294322 3628 3335 1979 1693 1639 901 700 673 24771 262 --14900
NM_002345chr123650 570 497 ------
NM_002349chr23548 85 27 --21033 272 --
NM_002350chr851184 770 502 244 176 ------
NM_002351chrX21672 430 ------
NM_002355chr1261363 1035 988 441 257 139 --2999 498 --
NM_002356chr662778 1955 1948 1137 311 259 1857 1320 --
NM_002359chr1783062 2899 1292 1123 891 486 75 30 11095 ----
NM_002360chr742393 2248 2163 330 ----12646
NM_002361chr191250 ------
NM_002373chr1521304 1228 ------
NM_002374chr252331 1065 797 260 249 43693 3659 985 196 23515 3412 11483
NM_002375chr362236 1858 1599 1446 817 303 ------
NM_002381chr25961 935 160 115 68 ------
NM_002382chr14----11219 --
NM_002387chr5125090 4933 4624 4412 3848 3759 1777 1405 1318 904 274 26 54634 3743 3615 997 352 14830 --
NM_002389chr121755 186 ----11508
NM_002397chr541708 882 649 129 1729 --1280
NM_002398chr2--2381 347 ----
NM_002399chr152279 44 ------
NM_002401chr1762341 1638 855 718 545 36 --12305 --
NM_002408chr143731 706 94 ------
NM_002409chr2232627 2306 662 --31211 874 558 23163 459
NM_002428chr1641341 1282 375 239 11420 --11294
NM_002430chr22122564 2412 2137 2000 1901 1784 1754 1603 896 781 261 86 ----1754
NM_002438chr102638 130 ------
NM_002442chr12--11738 ----
NM_002444chrX51763 1430 1363 247 232 1302 ----
NM_002445chr881657 1548 517 461 315 190 77 31 ------
NM_002449chr551020 926 483 168 97 1439 ----
NM_002460chr6103696 3606 3239 1247 1102 1087 953 783 416 78 --23679 400 13781
NM_002465chr12136 187 ----
NM_002466chr201110 ------
NM_002474chr162740 21 ------
NM_002478chr111486 ------
NM_002479chr13514 483 67 ------
NM_002480chr1211175 ------
NM_002482chr14719 672 564 208 ------
NM_002486chr932339 1925 245 ------
NM_002489chr71273 ------
NM_002492chr32354 68 ------
NM_002495chr5123 ------
NM_002499chr1562418 2394 2202 235 220 139 --11525 --
NM_002500chr221232 903 --1934 --
NM_002501chr1964108 3931 3894 3648 598 308 --33951 880 801 --
NM_002505chr62573 97 ------
NM_002509chr203769 288 205 ------
NM_002515chr1421266 220 --21963 75 --
NM_002518chr23993 818 364 ------
NM_002519chr111214 1240 11107 --
NM_002520chr51199 155 ----
NM_002522chr1783807 3569 2649 2448 2396 1546 806 747 1503 21505 209 --
NM_002524chr131039 284 250 ------
NM_002527chr121260 ----1235
NM_002530chr15132 ------
NM_002536chrX51348 485 267 156 50 --1231 --
NM_002537chr152950 432 --1956 --
NM_002541chr74863 753 207 133 --11029 --
NM_002545chr11104121 3662 3459 1804 1498 1313 636 600 323 286 1686 --11438
NM_002546chr81633 ------
NM_002547chrX94221 2904 2583 1604 1595 1067 926 705 280 23587 692 13335 --
NM_002553chr71331 --1416 --
NM_002556chr1162002 1971 1533 1412 664 307 1226 ----
NM_002563chr3130 1869 ----
NM_002569chr1521298 448 ------
NM_002572chr11----194 --
NM_002575chr183531 126 107 2446 23 ----
NM_002576chr111871 --11213 11053
NM_002577chr393344 3080 2967 2519 932 799 299 288 102 ------
NM_002578chrX159 ------
NM_002581chr965322 4891 4282 3731 669 476 1981 ----
NM_002586chr651042 994 633 309 147 ------
NM_002590chr131486 2371 159 ----
NM_002594chr2022286 51 --12086 12069
NM_002595chr1231846 490 219 ------
NM_002599chr1151163 1069 355 339 164 1855 2821 257 --
NM_002600chr131226 679 299 1587 ----
NM_002601chr21154 ------
NM_002603chr81148 ------
NM_002605chr1531102 155 115 ------
NM_002607chr711121 --1477 --
NM_002609chr531370 210 132 ------
NM_002613chr1694983 3747 3741 3667 3648 1356 1195 233 222 --11324 --
NM_002618chr22484 359 ------
NM_002622chr57343 285 202 189 136 88 67 1861 ----
NM_002623chr201203 ------
NM_002628chr32884 210 --1766 --
NM_002631chr1182 --1341 --
NM_002633chr11505 ------
NM_002636chr61184 --1538 --
NM_002641chrX41859 1735 1301 575 11757 ----
NM_002643chr2--140 ----
NM_002645chr1122161 325 --12431 12006
NM_002646chr13739 173 140 11845 ----
NM_002655chr864937 4491 3308 980 665 102 14990 --15113
NM_002656chr61845 1223 ----
NM_002657chr2083357 2884 2569 1341 1198 843 130 37 1936 12994 --
NM_002660chr2011162 ------
NM_002670chr341209 343 335 21 1473 ----
NM_002674chr122189 164 ------
NM_002687chr143344 298 168 --135 --
NM_002698chr1922534 2335 ------
NM_002699chr121083 273 ------
NM_002706chr21655 --3586 528 151 --
NM_002707chr22353 282 ------
NM_002709chr221253 198 12361 12571 --
NM_002710chr123980 394 220 1231 ----
NM_002714chr61722 ------
NM_002716chr1183216 3003 2840 867 800 607 523 398 --13535 22782 2321
NM_002717chr81164 ------
NM_002718chr352077 627 332 122 75 ------
NM_002719chr1482293 2257 2190 2012 795 741 508 54 ------
NM_002720chr162108 58 ------
NM_002721chr9297 34 ------
NM_002725chr164071 1781 1700 256 156 108 11326 13595 --
NM_002729chr101606 ------
NM_002730chr191288 ------
NM_002731chr162975 1271 1156 796 48 42 12582 1159 1990
NM_002734chr1751985 1726 1510 918 224 11403 ----
NM_002736chr732072 1737 1450 31602 746 575 1755 --
NM_002737chr17126635 6501 6154 5859 5818 5101 4622 2333 2143 1251 509 238 11227 16117 25667 1892
NM_002738chr1631135 433 322 11096 ----
NM_002740chr342797 2646 2517 2000 1946 ----
NM_002742chr142681 539 ----1293
NM_002745chr22114462 4449 4441 3760 3624 2950 2831 1829 1768 1335 477 14192 24036 721 --
NM_002747chr1831482 293 94 --11418 --
NM_002748chr1521209 198 ------
NM_002749chr172307 115 ------
NM_002752chr51105 ------
NM_002753chr42591 311 1720 ----
NM_002755chr152624 85 ------
NM_002765chrX11339 ------
NM_002767chr171357 1474 ----
NM_002775chr103216 207 162 ------
NM_002776chr1972005 1654 775 317 196 132 116 1384 ----
NM_002779chr102360 217 ------
NM_002786chr111203 ------
NM_002790chr11125 ------
NM_002805chr17140 ------
NM_002819chr1941481 1455 1110 552 ------
NM_002822chr1231558 689 480 1504 ----
NM_002823chr2--1188 ----
NM_002825chr71467 ------
NM_002827chr2061759 1292 556 374 139 44 ------
NM_002828chr18274 29 2840 255 ----
NM_002830chr21338 ------
NM_002834chr1284032 3550 3381 3303 1490 979 906 317 23925 3212 2741 580 --
NM_002835chr7----1517 --
NM_002837chr1263994 3694 3152 3079 2897 1717 54121 4070 3598 1390 203 11441 --
NM_002839chr9123572 3554 3387 3336 3152 2945 2714 2703 1444 1399 713 411 23078 673 13002 --
NM_002840chr141228 494 404 266 ------
NM_002841chr34472 224 185 178 --1699 --
NM_002843chr1173031 2283 1146 1036 925 685 211 --12548 --
NM_002845chr18----1110 --
NM_002846chr24454 65 47 37 ------
NM_002849chr1231036 713 280 1402 ----
NM_002850chr1931165 129 49 --1404 --
NM_002851chr72262 135 1175 ----
NM_002852chr31252 ------
NM_002854chr22136 ------
NM_002855chr11113659 3378 3169 3114 3067 2590 818 773 767 284 21 ----11170
NM_002857chr192562 2379 2235 1886 1692 554 229 164 118 --1421 --
NM_002858chr141245 1223 1124 1017 ------
NM_002859chr1251686 1248 1186 533 21 ----11798
NM_002861chr176536 159 126 53 44 38 --174 --
NM_002865chr81208 ------
NM_002867chr13303 253 144 --1165 --
NM_002868chr1262275 2258 2094 966 843 377 ----1722
NM_002869chr1121593 1402 ------
NM_002874chr952369 2317 2004 406 245 1265 ----
NM_002880chr33261 202 66 ------
NM_002886chr351958 1877 1040 862 587 --3227 103 31 --
NM_002890chr55971 204 151 77 23 ------
NM_002892chr1411344 ----11670
NM_002894chr182187 155 ------
NM_002896chr111101 ------
NM_002897chr21108 ------
NM_002902chr152567 504 ------
NM_002906chr1111613 12208 167 1808
NM_002912chr61371 ------
NM_002923chr11526 ------
NM_002924chr11496 ----1594
NM_002928chr11267 21607 92 11312 --
NM_002930chr18171 ------
NM_002938chr461997 734 552 529 297 210 1565 1583 --
NM_002940chr43703 686 367 --1499 --
NM_002941chr331607 520 320 ----1604
NM_002942chr33518 435 327 1880 1277 --
NM_002948chr371124 1025 904 841 367 205 94 ------
NM_002950chr3145 1112 ----
NM_002955chr6--11285 ----
NM_002956chr1231415 449 360 --1510 --
NM_002957chr9103767 3571 2733 1435 1382 1093 744 679 140 97 --2937 833 --
NM_002958chr32755 655 ------
NM_002959chr194417 3851 3478 1777 1136 431 354 118 112 13179 --1265
NM_002962chr1137 ------
NM_002968chr162424 242 11116 --1209
NM_002971chr341067 1054 384 182 11009 ----
NM_002977chr232646 1358 179 12981 22688 215 1431
NM_002996chr1641222 577 393 246 --21645 490 --
NM_002997chr271824 1426 1377 1308 515 189 174 11340 ----
NM_002998chr851704 1598 411 195 61 21405 628 ----
NM_003001chr152111 1868 1833 364 355 ------
NM_003002chr11251 45 ------
NM_003010chr1731986 1947 142 12301 ----
NM_003011chr951661 1649 1428 319 285 --1391 --
NM_003013chr43148 140 58 1719 ----
NM_003016chr1742005 1985 269 165 ------
NM_003017chr61570 ------
NM_003020chr152345 168 ------
NM_003022chrX3342 312 76 ------
NM_003026chr921106 1001 --1376 --
NM_003027chr15190 ------
NM_003028chr993793 3323 3238 2974 2928 2484 1204 1178 25 1264 1390 --
NM_003031chr161921 1991 ----
NM_003034chr12117967 7958 7057 6686 5727 5591 5448 912 780 761 96 25043 226 ----
NM_003036chr11259 ------
NM_003037chr12483 111 1603 ----
NM_003042chr31672 22015 1585 1401 --
NM_003043chr354277 4213 3803 1298 91 --23957 3201 --
NM_003048chr272701 2289 1763 1127 964 683 100 32757 1138 385 ----
NM_003051chr131713 730 566 11930 11938 11906
NM_003060chr531206 986 101 ------
NM_003068chr81918 1396 ----
NM_003070chr91767 --1777 --
NM_003071chr341759 1696 1503 489 ------
NM_003074chr31531 --1293 --
NM_003076chr1221152 207 ------
NM_003077chr173315 227 191 ------
NM_003081chr2021159 87 ------
NM_003099chr15106513 5874 5621 5592 4950 2408 2315 1919 1086 946 11647 ----
NM_003100chr51341 ------
NM_003101chr131563 1027 324 --11541 --
NM_003106chr31705 2910 398 2982 386 --
NM_003107chr692344 2101 2070 2023 1883 850 396 348 230 12611 1688 --
NM_003108chr2126902 6606 6455 6234 5997 5526 2431 1809 1553 1461 1063 487 17274 12003 14557
NM_003112chr742611 901 880 327 13209 12410 --
NM_003113chr21206 ------
NM_003128chr272434 2187 1963 1137 911 588 86 1665 ----
NM_003131chr621882 467 11860 ----
NM_003135chr5195 ------
NM_003137chr631493 508 223 ------
NM_003139chr112324 263 1175 1707 --
NM_003146chr11123 ------
NM_003149chr361658 469 352 53 39 24 11628 11166 --
NM_003150chr175870 573 393 139 57 1405 ----
NM_003151chr2163 ------
NM_003155chr862576 2518 1094 784 262 219 32165 178 156 ----
NM_003156chr1121221 320 ------
NM_003157chr31957 ------
NM_003161chr1743548 2310 1130 1070 1753 13482 --
NM_003162chr231093 750 106 1148 ----
NM_003164chr11126 ------
NM_003165chr961899 1758 1518 746 686 182 --21889 1217 --
NM_003171chr10--140 ----
NM_003173chrX4546 356 345 269 ------
NM_003174chr10----1739 --
NM_003178chr352090 1721 721 502 158 11657 21876 215 --
NM_003179chrX31290 270 119 ------
NM_003185chr2051254 497 323 303 37 1165 ----
NM_003186chr111123 ------
NM_003189chr1103267 3151 3074 2888 2577 2395 949 724 667 383 12792 33258 2813 1025 --
NM_003194chr6--1146 1567 --
NM_003199chr1885576 5134 4960 4616 4558 4522 3485 844 14647 --15298
NM_003201chr101147 --1870 --
NM_003204chr1741764 1338 1288 601 ------
NM_003211chr1231135 534 22 1296 ----
NM_003214chr631243 260 173 ------
NM_003216chr2273128 2359 2059 1037 545 228 49 --3689 578 378 12579
NM_003217chr1261996 1701 587 542 240 63 ------
NM_003220chr631596 1245 308 --2686 210 --
NM_003221chr674068 3624 3245 2660 1121 1005 840 21439 1257 ----
NM_003222chr2051196 1091 1052 840 145 1903 ----
NM_003223chr162604 289 ------
NM_003236chr283339 2886 2293 1175 932 393 329 158 13413 --12378
NM_003242chr352286 1908 1721 934 270 1583 31672 1589 523 --
NM_003244chr181100 ------
NM_003246chr1541868 1320 1275 301 11361 11645 --
NM_003250chr172420 61 ------
NM_003253chr2151502 620 592 226 55 ------
NM_003255chr17142491 2440 2076 1986 1867 1057 1043 956 910 720 465 379 216 136 --1483 --
NM_003257chr15----11096 --
NM_003262chr3104974 4440 3731 3479 3310 1591 1410 1334 1155 731 14896 ----
NM_003269chr62397 294 ------
NM_003271chr11294 24 ------
NM_003272chr12739 241 ------
NM_003274chr2132291 2076 859 12052 ----
NM_003275chr921511 574 --163 --
NM_003286chr201128 1392 ----
NM_003290chr191101 ------
NM_003291chr13--1773 ----
NM_003295chr13153 ------
NM_003297chr12140 ------
NM_003298chr3126120 5919 5821 5713 5428 4760 4518 2116 1263 1094 770 645 15912 15589 14303
NM_003304chr331370 420 207 11305 ----
NM_003305chr4----1283 --
NM_003309chr651789 635 298 118 49 --1393 --
NM_003314chr51454 ------
NM_003317chr142669 35 ------
NM_003320chr11144361 4169 3748 3497 3457 3440 2796 2721 2705 1429 1309 843 169 163 14443 23076 86 --
NM_003325chr221252 ------
NM_003326chr142115 1067 881 522 11846 --12095
NM_003336chrX--1965 11099 --
NM_003337chr53651 300 103 --1662 --
NM_003338chr1041344 562 380 256 ------
NM_003339chr531352 452 193 --11340 --
NM_003340chr4--11257 ----
NM_003341chr31664 1220 ----
NM_003342chr1783074 2696 2544 2274 2024 1326 987 564 13180 ----
NM_003344chr721499 1100 ------
NM_003345chr161486 171 ----
NM_003347chr2282335 2276 1947 1918 1904 1480 211 81 ------
NM_003348chr12267 42 21141 646 ----
NM_003352chr21733 ------
NM_003358chr91137 ------
NM_003359chr441293 1256 1237 183 ------
NM_003368chr13669 659 602 ------
NM_003369chr1162791 2345 2256 2248 693 40 1636 ----
NM_003370chr192262 236 ------
NM_003371chr952167 1900 1534 424 79 --1587 --
NM_003373chr1071943 691 566 541 358 323 198 --11286 --
NM_003374chr5140 ------
NM_003378chr72424 91 ------
NM_003379chr651012 1000 977 740 386 ----11161
NM_003380chr102298 92 ------
NM_003383chr91125 2546 226 ----
NM_003387chr252933 2676 1120 960 406 12338 12192 --
NM_003390chr1121089 206 180 ----
NM_003392chr393941 3143 3015 1714 1524 1143 644 543 155 ------
NM_003394chr122224 66 ------
NM_003400chr21210 ----133
NM_003403chr141755 ----1213
NM_003404chr2021882 1834 1737 140 --
NM_003405chr222129 102 ------
NM_003406chr821913 1598 --11822 --
NM_003409chr1831108 971 25 11365 ----
NM_003410chrX52872 2700 2383 2082 569 1830 12911 --
NM_003412chr353110 2603 2364 1066 756 1405 21251 461 --
NM_003413chrX1705 --21827 267 --
NM_003418chr31164 ------
NM_003423chr1932163 706 256 ------
NM_003432chr5------1550
NM_003436chr191826 1718 2848 203 --
NM_003452chr91899 ------
NM_003453chr132697 572 ------
NM_003455chr1121300 499 ------
NM_003457chr171547 ------
NM_003458chr3133972 3698 3551 3408 3247 3008 2480 1623 1208 1134 1020 839 554 --2283 97 --
NM_003463chr652610 2259 2197 1019 721 --1164 --
NM_003466chr21962 --32470 2309 1975 --
NM_003468chr274129 2649 1542 1306 775 681 304 14081 13495 11446
NM_003470chr1631652 708 604 --1160 1616
NM_003471chr3--2939 862 ----
NM_003472chr61435 --11338 --
NM_003474chr1041461 730 169 42 1845 ----
NM_003478chr1153277 2925 2916 972 122 ------
NM_003481chr12189 --195 --
NM_003482chr123542 524 230 ------
NM_003483chr1282925 2902 2734 2661 1910 1030 501 83 22718 1823 ----
NM_003488chr172789 34 --1776 1668
NM_003489chr2152632 1058 1030 229 63 11205 ----
NM_003498chr1672811 2104 969 649 591 518 32 --1122 --
NM_003505chr711640 ------
NM_003506chr82359 98 ------
NM_003507chr231587 1382 430 21566 96 1146 --
NM_003557chr141392 281 45 36 ----1477
NM_003558chr91266 ------
NM_003563chr1741350 427 316 105 1589 ----
NM_003565chr1261741 1317 1189 1160 243 56 ----11413
NM_003566chr1253415 3215 2773 1034 493 23179 2967 --21238 671
NM_003574chr1844575 3879 486 135 15806 --11152
NM_003576chr13102874 2780 2450 2299 2267 1021 951 894 631 513 --12142 --
NM_003581chr21733 ----1108
NM_003583chr1273575 3548 2689 1472 801 786 738 ----12910
NM_003586chr162488 239 ------
NM_003590chr253474 3083 2946 1573 395 13091 --12713
NM_003591chr102293 120 ------
NM_003592chr71451 1193 ----
NM_003593chr172686 196 --1497 --
NM_003595chr221136 1147 ----
NM_003603chr441882 675 435 21 1665 21981 1404 --
NM_003607chr174375 4282 4253 4104 3895 3885 3728 1662 ----
NM_003610chr203351 271 46 --158 --
NM_003612chr152487 35 --1505 --
NM_003613chr152508 27 --3719 652 253 --
NM_003615chr363631 2613 819 812 496 303 32893 735 254 ----
NM_003617chr163817 3754 3196 1713 1262 97 24998 1086 13395 14566
NM_003618chr21334 ------
NM_003621chr112455 23 ------
NM_003626chr1121237 850 ------
NM_003628chr21230 ------
NM_003629chr193129 3068 3037 1332 1268 1111 728 402 100 ------
NM_003632chr173300 291 102 ------
NM_003633chr552050 1721 1016 785 756 11625 22479 1976 --
NM_003636chr1101671 1516 1505 1333 596 478 411 265 98 51 --21392 718 --
NM_003637chr161529 1498 1130 998 578 228 ------
NM_003642chr2142 ------
NM_003645chr15--1219 ----
NM_003653chr17--1190 --1169
NM_003654chr113266 170 145 1792 ----
NM_003659chr21142 ------
NM_003660chr193657 520 133 ------
NM_003663chr363059 2961 2827 1144 990 686 1121 ----
NM_003664chr51196 ----1472
NM_003670chr33987 544 27 ------
NM_003671chr933308 2799 530 22572 463 33515 2693 1058 --
NM_003672chr12722 105 ------
NM_003673chr171411 ------
NM_003677chr121306 ------
NM_003679chr173151 2794 2450 735 685 110 39 --23315 143 --
NM_003684chr151082 946 455 420 98 --1238 --
NM_003690chr21519 ------
NM_003692chr9--1271 ----
NM_003704chr41218 ------
NM_003705chr23695 259 126 --1265 --
NM_003709chr2----1129 --
NM_003711chr51112 ------
NM_003713chr121133 457 11737 ----
NM_003714chr582594 2542 2423 2360 2088 2052 302 211 --12738 --
NM_003716chr31377 1912 ----
NM_003718chr71170 --1479 --
NM_003725chr121407 ------
NM_003743chr292247 1954 1617 1523 1508 1468 790 424 96 --1530 --
NM_003749chr1342401 2308 908 147 1939 ----
NM_003758chr152411 84 --11393 --
NM_003758chr152411 84 --11393 --
NM_003759chr431305 430 274 23273 980 ----
NM_003760chr11543 ------
NM_003762chr131312 993 446 1483 1944 --
NM_003763chr2032949 2651 714 --1133 --
NM_003766chr171528 157 ----
NM_003768chr111834 ----11748
NM_003774chr1233314 972 741 22215 2098 --12775
NM_003779chr12421 350 ------
NM_003783chr11306 21077 859 ----
NM_003787chr1831703 612 39 ------
NM_003791chr161222 1558 ----
NM_003794chr31761 --1977 --
NM_003799chr18103622 3384 1824 1510 1253 891 452 209 178 86 34125 3060 1129 1911 --
NM_003800chr652274 2128 1878 1662 817 ------
NM_003818chr202893 161 ------
NM_003819chr11197 ------
NM_003821chr8154 ------
NM_003822chr153027 829 538 517 23 ------
NM_003825chr152584 186 21330 577 ----
NM_003846chr12621 277 --1515 --
NM_003858chr141500 ----1618
NM_003861chr1442856 2663 2510 281 21833 734 11099 --
NM_003870chr1521978 281 --12108 --
NM_003872chr252908 1987 1103 571 244 --12005 --
NM_003876chr17177 ------
NM_003884chr321379 747 11785 ----
NM_003885chr1722504 1698 ------
NM_003887chr272047 1703 1661 1545 589 318 128 ------
NM_003888chr1561740 1461 1445 1258 1154 51 --161 1193
NM_003893chr10131 ------
NM_003895chr2142182 2059 1582 504 ------
NM_003899chr1342269 1895 794 235 2262 153 1125 --
NM_003900chr561403 1230 896 385 98 23 --181 --
NM_003901chr1062679 2581 2336 1829 897 593 --12493 12558
NM_003902chr1--1260 ----
NM_003907chr31330 ------
NM_003908chr202972 447 2256 23 ----
NM_003913chr644179 3736 1561 1242 12642 --23152 3121
NM_003924chr441230 1134 1116 342 ------
NM_003927chr181689 ------
NM_003930chr732035 1997 28 2235 38 12508 12561
NM_003932chr2241650 1539 1533 1352 ------
NM_003934chr91343 182 ----
NM_003939chr10103362 3106 1410 1387 1233 1168 821 693 379 173 1881 32518 560 299 --
NM_003941chr751696 924 648 507 368 2167 74 12344 --
NM_003947chr331313 840 132 2851 363 ----
NM_003948chr442650 2635 2624 427 21864 646 ----
NM_003949chr17101909 1863 1807 1769 1743 1375 1309 257 94 72 --31448 319 83 --
NM_003954chr171281 --11017 --
NM_003955chr1741452 1212 302 145 --11566 --
NM_003957chr114989 907 887 29 ------
NM_003958chr6113904 3880 3203 3109 2708 2671 1330 1077 932 658 247 --23948 2877 --
NM_003966chr5117611 7320 6870 6612 5050 5042 3043 2806 2603 1148 712 56749 6365 4856 2192 842 36674 2472 1824 26027 1789
NM_003968chr31677 ------
NM_003971chr17143 ------
NM_003972chr1031290 177 49 ------
NM_003980chr61274 2595 557 11023 --
NM_003983chr1654459 3995 3483 3455 69 ----11048
NM_003987chr1061693 1670 1654 1648 1615 515 ----11571
NM_003988chr1061770 1747 1731 1725 1692 592 ----11648
NM_003989chr1061629 1606 1590 1584 1551 451 ----11507
NM_003990chr1061629 1606 1590 1584 1551 451 ----11507
NM_003994chr1244199 3373 1636 335 1848 --1424
NM_003995chr93228 72 34 1219 ----
NM_003998chr42590 267 1506 ----
NM_004006chrX2571 520 11794 ----
NM_004007chrX2571 520 11794 ----
NM_004009chrX2571 520 11794 ----
NM_004010chrX2571 520 11794 ----
NM_004011chrX2571 520 11794 ----
NM_004012chrX2571 520 11794 ----
NM_004013chrX2571 520 11794 ----
NM_004014chrX2571 520 11794 ----
NM_004015chrX2571 520 11794 ----
NM_004016chrX2485 434 11708 ----
NM_004017chrX2571 520 11794 ----
NM_004018chrX2485 434 11708 ----
NM_004020chrX2571 520 11794 ----
NM_004021chrX2485 434 11708 ----
NM_004022chrX2485 434 11708 ----
NM_004023chrX2485 434 11708 ----
NM_004024chr161380 1094 568 529 87 50 11504 ----
NM_004028chr1862962 1544 1335 1072 889 793 13430 11206 13681
NM_004034chr103491 464 147 ------
NM_004037chr14832 667 110 104 --185 --
NM_004040chr21905 1432 31177 1169 862 --
NM_004050chr1441922 728 675 587 --1923 --
NM_004055chr11102163 1874 1464 1452 899 798 650 632 144 46 --21733 1588 --
NM_004061chr52435 207 ------
NM_004065chrX193 ------
NM_004067chr731087 978 576 ------
NM_004068chr32398 104 --2468 119 --
NM_004073chr11309 ------
NM_004075chr123580 574 489 --1429 --
NM_004077chr1251352 1148 411 376 349 ------
NM_004081chrY1202 21658 349 21855 524 --
NM_004087chr32128 59 11743 11427 --
NM_004089chrX31278 1164 462 ------
NM_004093chr1342730 2071 560 399 22942 697 32989 526 305 --
NM_004096chr1071979 1958 1662 1604 783 446 251 --1739 --
NM_004098chr101502 ------
NM_004099chr941974 1662 1524 702 11491 1369 --
NM_004100chr621765 1657 22692 829 1710 --
NM_004103chr82816 792 --1129 --
NM_004113chr331439 500 136 11887 11653 --
NM_004114chrX1911 ----129
NM_004115chr132141 122 ------
NM_004116chr24479 397 142 62 --1157 --
NM_004124chr1463517 3458 2367 2178 513 247 --11386 --
NM_004130chr32620 204 ------
NM_004132chr102196 173 1990 11069 --
NM_004133chr822390 540 1322 ----
NM_004134chr52613 107 ------
NM_004136chr1522298 352 12323 ----
NM_004156chr82549 539 1103 ----
NM_004157chr34918 805 566 199 ------
NM_004161chr221318 1232 140 1519 --
NM_004162chr32925 35 1939 ----
NM_004163chr182441 119 ------
NM_004170chr961480 1469 1392 1360 1348 160 1546 ----
NM_004171chr11179151 8976 8719 8553 8508 7071 6364 3858 3826 3742 3482 2835 2778 2478 1969 647 185 48195 7064 3839 3071 11293 18773
NM_004172chr51696 --11985 --
NM_004180chr21228 ------
NM_004181chr43346 119 22 1288 ----
NM_004188chr91477 ------
NM_004200chr1163125 2806 1240 954 809 232 12594 --13237
NM_004203chr161100 --121 --
NM_004225chr841273 932 537 65 --183 1967
NM_004229chrX41783 1575 1545 1521 ------
NM_004232chr1833726 3180 304 31405 763 572 ----
NM_004236chr151503 1464 ----
NM_004238chr21277 ------
NM_004253chr92952 162 ------
NM_004261chr111025 ------
NM_004263chr2111844 1699 1625 1232 1125 1116 488 420 337 223 182 11764 ----
NM_004272chr51485 --173 --
NM_004274chr1472817 2489 2114 2068 850 357 323 22398 2173 ----
NM_004277chr611634 164 ----
NM_004279chr73823 726 351 1674 ----
NM_004281chr101475 --1192 --
NM_004290chr54939 881 507 73 ----11075
NM_004293chr94619 589 573 47 12553 ----
NM_004297chr9--266 46 ----
NM_004301chr32275 109 ------
NM_004302chr12102939 2625 2543 2189 2167 832 813 636 105 93 ------
NM_004309chr173786 270 231 ------
NM_004311chr1041222 1193 692 386 21963 1917 42993 2827 1202 228 12068
NM_004317chr19176 ------
NM_004319chr162215 698 687 326 262 185 11074 12382 --
NM_004321chr243561 2667 1252 674 --11290 --
NM_004323chr9102550 2320 2302 2071 2041 1051 381 255 207 53 ------
NM_004326chr13829 777 279 --1328 --
NM_004329chr1031421 557 399 11017 ----
NM_004331chr822216 165 1254 ----
NM_004337chr831983 438 64 --11609 --
NM_004338chr18187036 6117 5622 5292 4825 2316 2201 1948 1884 1746 1724 1713 1634 1169 1091 895 789 637 26967 5152 65948 4712 4549 2028 1962 345 12765
NM_004342chr752134 1682 1626 411 70 11714 2275 205 --
NM_004343chr19177 ------
NM_004349chr811246 1925 ----
NM_004354chr42846 731 ------
NM_004356chr112436 110 --133 --
NM_004364chr1931186 1015 972 --1168 --
NM_004365chr51136 ------
NM_004367chr611732 ----21760 209
NM_004369chr21200 --168 --
NM_004370chr672003 1841 1560 1543 1512 467 98 12101 ----
NM_004371chr12574 545 --1116 --
NM_004378chr151210 ------
NM_004379chr261340 1270 689 638 242 159 ------
NM_004380chr1632421 2361 507 12522 ----
NM_004383chr151548 ------
NM_004384chr552244 1944 1767 502 233 1384 174 --
NM_004385chr51668 1723 ----
NM_004389chr23576 176 136 ----1234
NM_004392chr1362530 2031 1959 1019 635 363 12242 145 --
NM_004393chr382365 2275 1788 1726 1531 1504 1497 560 12374 32225 1686 367 --
NM_004395chr51702 1780 ----
NM_004397chr11114209 3853 3408 3386 3228 1706 1610 1585 1483 943 205 ----11392
NM_004407chr42945 241 1666 1254 --
NM_004411chr73585 139 60 ------
NM_004416chr123974 402 34 1417 ----
NM_004419chr101940 1950 ----
NM_004420chr1172403 1941 1901 1621 1571 1531 394 11672 32341 479 461 1324
NM_004422chr17----1372 --
NM_004426chr1251397 710 649 593 118 --180 --
NM_004427chr121024 478 11233 11117 --
NM_004428chr13803 697 651 ------
NM_004430chr842699 2332 1699 1096 --12072 --
NM_004431chr11846 ----1545
NM_004432chr942093 1889 1601 787 ------
NM_004436chr12528 91 ------
NM_004437chr1103484 3431 3239 2922 2518 2475 2281 609 311 29 12316 ----
NM_004438chr253305 1130 928 833 135 2818 258 11106 --
NM_004439chr4139 ------
NM_004440chr61574 31916 1558 500 11624 --
NM_004441chr31470 21099 945 ----
NM_004442chr131618 1066 49 ------
NM_004443chr32589 490 ------
NM_004448chr17166 1597 ----
NM_004449chr2121399 1393 --11287 --
NM_004454chr342285 1487 402 353 --12014 --
NM_004456chr7--1210 ----
NM_004457chr21321 ------
NM_004458chrX52657 1878 1037 356 181 11629 --11991
NM_004459chr1761901 1874 1441 1326 686 494 --1726 11420
NM_004464chr444299 3769 1492 1006 21383 852 1445 --
NM_004469chrX2363 53 --1203 --
NM_004474chr14975 926 899 384 --1297 --
NM_004480chr141267 ------
NM_004481chr182677 2458 2292 2112 1014 651 505 275 12521 ----
NM_004482chr2--2627 168 ----
NM_004487chr37977 970 926 452 405 279 224 ------
NM_004491chr19124354 3775 3044 1584 1385 783 771 528 460 366 325 267 --32897 1429 564 --
NM_004493chrX2117 34 ------
NM_004494chr12963 300 ------
NM_004496chr1431346 1157 852 --1865 --
NM_004500chr1411967 11590 ----
NM_004501chr164090 2993 1530 836 762 731 21044 265 31172 493 463 --
NM_004503chr12----2636 77 --
NM_004504chr252687 1896 901 599 565 --1859 --
NM_004514chr1782711 2663 2330 2257 1903 632 265 38 ------
NM_004516chr1931033 961 317 ------
NM_004519chr81208 ------
NM_004520chr51613 ------
NM_004523chr1031357 1069 224 1504 --11513
NM_004525chr231344 1282 43 --1214 --
NM_004529chr921174 343 ------
NM_004535chr2031768 1530 524 21101 332 ----
NM_004537chr1241435 1235 134 50 ------
NM_004540chr211778 ------
NM_004561chr1161819 1776 1757 527 195 184 ------
NM_004566chr1082555 2462 2186 1785 1625 810 551 37 ----12040
NM_004569chr141493 ------
NM_004571chr2153275 3091 767 138 38 32871 2788 839 --12740
NM_004575chr441491 523 294 64 ----1403
NM_004576chr51345 ------
NM_004583chr173728 244 186 ------
NM_004586chrX85037 4267 3582 1757 1384 1312 727 490 14844 11084 1826
NM_004588chr1183974 3220 3154 2891 2803 2597 1064 829 34029 3495 3011 --13458
NM_004593chr34898 861 227 168 1629 ----
NM_004598chr551002 872 823 171 31 ------
NM_004600chr131495 1264 621 1466 ----
NM_004602chr2031157 974 578 --11221 --
NM_004603chr74336 201 186 141 ------
NM_004612chr9134614 4533 4520 4098 4052 4036 3943 3525 3101 1273 927 309 118 11076 11585 --
NM_004615chrX4910 671 308 169 --1792 --
NM_004626chr113140 95 39 ------
NM_004630chr1141120 999 747 276 ------
NM_004634chr3156 --187 --
NM_004637chr321231 922 11333 ----
NM_004642chr126682 628 495 461 189 172 ------
NM_004643chr142730 584 --1574 --
NM_004651chrX2360 293 ----150
NM_004654chrY3989 144 66 2229 155 ----
NM_004655chr1721081 1042 --1529 --
NM_004656chr351149 1103 852 820 287 --123 1967
NM_004657chr21406 11532 1223 --
NM_004660chrY42319 1681 531 509 ------
NM_004663chr1521054 977 --11272 11547
NM_004670chr1031653 672 427 ------
NM_004684chr4143 --1271 --
NM_004687chr1771843 1521 743 684 485 478 471 11697 1844 --
NM_004689chr14------1378
NM_004690chr62523 115 ------
NM_004697chr92427 99 ----1390
NM_004703chr1752493 2324 1799 726 187 ----12473
NM_004705chr113727 236 92 ------
NM_004709chrX41550 1341 1143 242 ------
NM_004710chr177938 700 642 609 386 378 47 ------
NM_004713chr143755 534 243 ------
NM_004715chr182151 119 1654 ----
NM_004717chr711516 --1573 --
NM_004719chr1232486 180 166 22201 41 ----
NM_004723chr12827 816 ------
NM_004726chrX55122 4914 4571 2299 1862 43974 1425 845 256 --21090 663
NM_004729chrX92101 2018 1966 1845 1682 1605 541 518 56 1712 ----
NM_004730chr541759 1747 706 540 --22133 2115 --
NM_004733chr31157 ------
NM_004734chr1332687 725 406 1350 23082 995 11153
NM_004737chr2231272 460 186 ------
NM_004739chr111557 1622 ----
NM_004740chr17171 ------
NM_004741chr1031546 633 440 ------
NM_004742chr331867 1569 422 --21812 443 --
NM_004745chr896765 6449 4534 4411 2666 2111 1569 1242 195 14528 45642 5042 4433 1596 --
NM_004746chr18164 ------
NM_004747chr1061581 1192 1099 481 401 200 ------
NM_004748chr1533812 3648 2746 1567 ----
NM_004751chr151418 ----199
NM_004755chr143813 398 366 1455 ----
NM_004757chr42540 100 ------
NM_004758chr1741131 959 319 273 --11119 --
NM_004759chr1101844 1695 1407 775 571 422 402 361 293 113 1872 21823 456 --
NM_004760chr72966 389 1352 ----
NM_004762chr1762035 1525 494 285 98 27 ------
NM_004772chr521463 440 ------
NM_004774chr1762447 1999 1074 1055 866 441 ------
NM_004776chr2043225 2712 1193 893 13026 ----
NM_004785chr162326 318 ----1497
NM_004787chr42151 21 ------
NM_004788chr1172234 2044 1866 1856 1684 1675 266 --11989 --
NM_004789chr91287 --1378 --
NM_004796chr1422410 778 22151 404 ----
NM_004798chr2073413 3204 3102 2662 922 684 636 21407 762 3884 866 131 --
NM_004799chr1167 ------
NM_004801chr21250 ------
NM_004805chr21904 ----1244
NM_004817chr92284 184 ------
NM_004824chr621362 1069 11423 ----
NM_004831chr1931114 1044 898 1971 1161 --
NM_004834chr253357 3074 3048 910 343 12453 ----
NM_004839chr151456 195 ----
NM_004840chrX41820 1653 912 830 ----1368
NM_004842chr651546 1442 449 54 29 11089 1718 --
NM_004845chrX83940 3072 798 725 429 384 311 131 13903 14113 --
NM_004849chr621608 188 1261 1178 --
NM_004856chr151552 ------
NM_004857chr14124084 3844 3653 3420 3260 1830 1588 1512 1059 1044 1029 383 13326 14755 --
NM_004859chr1772736 2484 2340 2044 2024 1956 310 --1317 --
NM_004862chr1631485 412 85 31567 988 530 ----
NM_004863chr1475063 4932 3623 3350 1032 231 193 23854 267 ----
NM_004866chr553274 1951 1813 642 593 54589 3316 3246 1316 699 ----
NM_004867chrX1610 --1507 1528
NM_004869chr1831599 1558 1127 ----1321
NM_004871chr17174156 4098 3194 3093 1723 1509 1490 1311 1260 1000 960 923 884 804 764 180 142 --13601 14106
NM_004872chr11371 1396 ----
NM_004873chr1483151 2692 2645 2138 1197 577 208 35 12630 ----
NM_004874chr81501 ------
NM_004879chr112242 102 --1117 --
NM_004887chr5----21008 63 --
NM_004890chr171233 ------
NM_004893chr5--2552 452 ----
NM_004896chr1021488 347 ------
NM_004898chr462729 1998 1959 1952 1053 916 ------
NM_004902chr203738 722 220 2554 293 ----
NM_004904chr7136012 4830 4754 4736 4649 4440 4270 4237 4113 2409 1173 320 281 ------
NM_004905chr14779 244 218 180 --1275 --
NM_004906chr62644 195 ------
NM_004912chr751405 1366 1179 549 446 ------
NM_004915chr211162 1520 ----
NM_004921chr122560 373 11929 ----
NM_004922chr102700 172 ------
NM_004924chr194910 876 833 350 --2105 83 --
NM_004926chr1431836 730 452 ------
NM_004929chr811487 31056 341 96 ----
NM_004930chr12197 71 ------
NM_004932chr531309 534 93 --11616 --
NM_004937chr1751022 985 709 397 136 1348 1538 --
NM_004939chr2143 ------
NM_004945chr191580 --1815 --
NM_004947chr33524 431 339 21838 776 ----
NM_004952chr11958 ------
NM_004955chr63455 114 63 ------
NM_004956chr764445 3472 3400 3104 1110 529 31448 1127 51 21514 463 --
NM_004958chr12754 713 ------
NM_004964chr13495 475 85 ------
NM_004965chr211760 ------
NM_004968chr71616 ------
NM_004973chr631623 494 475 --21668 95 --
NM_004974chr11103 ------
NM_004975chr20183 ------
NM_004976chr1175100 3412 2036 1580 1520 1458 283 14934 11849 --
NM_004978chr131662 1547 426 --11263 --
NM_004979chrX21083 105 ------
NM_004981chr223398 291 42 ------
NM_004985chr1274195 4076 3892 3645 2752 1151 929 22732 1696 12967 --
NM_004992chrX167616 7183 6990 6615 6015 5762 5492 5169 3303 2533 1997 1803 1434 1362 1235 980 --1244 --
NM_004992chrX167616 7183 6990 6615 6015 5762 5492 5169 3303 2533 1997 1803 1434 1362 1235 980 --1244 --
NM_004993chr142570 311 1122 ----
NM_004995chr143247 131 42 --1312 --
NM_004996chr1621749 1465 --1674 --
NM_004998chr152886 642 ------
NM_005003chr16123 ------
NM_005006chr22966 942 1315 1170 --
NM_005010chr731781 876 108 12087 1285 --
NM_005011chr751625 1357 411 260 60 ------
NM_005016chr12133 1314 ----
NM_005017chr3160 --1226 --
NM_005020chr71457 1609 ----
NM_005022chr17----143 --
NM_005025chr3--154 ----
NM_005026chr151834 1501 796 746 574 12048 11336 11688
NM_005028chr1022273 2254 ------
NM_005044chrX84277 4247 4159 4075 3905 3623 2812 1686 14090 33639 3508 127 14018
NM_005045chr71866 ------
NM_005054chr241683 1623 166 142 11736 11336 --
NM_005056chr12185158 4372 3879 3763 3757 3746 3705 3699 3688 3647 3641 3630 3583 3572 1808 1049 405 137 25597 2182 25203 395 14976
NM_005057chr121879 35 --11907 --
NM_005058chrY174 148 ----
NM_005063chr10103077 2713 2370 1475 962 797 365 343 304 168 --23006 2993 13279
NM_005065chr1434988 1980 950 --1938 1767
NM_005067chr32975 633 ------
NM_005068chr631412 1374 452 ------
NM_005073chr13154 ------
NM_005076chr183704 3613 2954 2921 2687 972 867 168 --122 --
NM_005078chr153416 317 217 ------
NM_005079chr832729 2101 1159 13193 1395 --
NM_005080chr221303 1797 ----
NM_005087chr32740 554 ------
NM_005088chrX2886 113 ------
NM_005093chr20165286 4707 4540 4119 3791 3509 3431 3287 3240 1445 1395 959 889 870 181 165 --24102 204 --
NM_005094chr92718 505 ------
NM_005095chr151972 1914 1842 1651 1585 ------
NM_005096chrX31096 419 207 ----1804
NM_005097chr10----1225 --
NM_005099chr13509 246 137 ------
NM_005104chr6183 --1140 --
NM_005109chr362140 2115 1895 1015 977 54 ------
NM_005112chr44783 414 200 162 --1151 --
NM_005113chr14--156 --1422
NM_005116chr2084571 3960 3910 851 294 145 107 47 --11734 --
NM_005119chr121217 1181 ------
NM_005120chrX------1231
NM_005121chr1743058 2795 1536 1402 ------
NM_005124chr63684 415 398 ------
NM_005126chr352171 2029 1806 1590 471 1587 --1134
NM_005133chr112387 296 ------
NM_005135chr1553345 2867 2589 180 110 --13849 --
NM_005140chrX2831 769 ------
NM_005151chr1852381 902 428 412 147 ----11868
NM_005153chr162736 726 ----1114
NM_005156chr9115405 5279 4723 4648 3573 3441 1966 1612 1519 1153 510 ----14712
NM_005157chr991926 1913 1882 1625 568 561 461 220 176 --21958 124 --
NM_005159chr1542143 1692 876 736 --11909 1897
NM_005160chr22166838 6440 6406 5636 4385 2448 2337 2279 2029 1792 1344 884 534 407 216 177 25942 2309 35951 4516 1064 11499
NM_005163chr143356 293 68 ------
NM_005168chr221618 1241 ----21497 627
NM_005171chr1241169 1114 421 357 ------
NM_005178chr192126 93 ------
NM_005180chr1051544 1221 597 546 243 21466 273 1302 --
NM_005181chr81768 --1740 1221
NM_005182chr163440 431 242 ------
NM_005184chr192455 303 --11067 --
NM_005187chr1661489 1450 808 366 348 326 --12052 --
NM_005188chr11117318 6879 6653 6183 5811 3110 2658 2173 2082 1230 119 18329 27737 5763 11412
NM_005189chr1742388 2363 245 171 --1234 --
NM_005190chr6--1139 ----
NM_005194chr201528 ------
NM_005197chr14146089 5923 5914 4902 4523 4458 4254 4193 4022 3772 2162 1742 1717 1478 45737 5389 5357 1166 24146 1673 21623 1191
NM_005201chr331157 884 241 ------
NM_005204chr102294 58 ------
NM_005206chr1731297 1092 896 11208 11100 --
NM_005207chr2273402 2831 2682 2600 1164 119 38 ----13422
NM_005215chr181713 1698 145 --
NM_005220chr1721459 203 ------
NM_005221chr71132 ------
NM_005225chr2061072 1009 982 964 308 124 --150 --
NM_005230chr121115 ------
NM_005233chr311828 1415 ----
NM_005235chr2147819 7770 6287 5757 5627 5244 4789 3152 2928 2617 1306 1084 966 416 --47435 5045 1429 227 15397
NM_005238chr1163070 2294 1223 1202 1056 952 12412 --11157
NM_005241chr31201 11129 ----
NM_005242chr51154 11393 ----
NM_005243chr221123 ------
NM_005245chr42709 658 --174 --
NM_005249chr143258 113 46 ------
NM_005254chr15--21355 207 1435 --
NM_005256chr112331 172 ------
NM_005257chr1831159 1037 325 31249 1017 509 ----
NM_005259chr211417 ------
NM_005263chr131105 127 73 ------
NM_005269chr121140 ------
NM_005271chr1041025 491 288 49 --11019 --
NM_005273chr71367 ------
NM_005275chr6140 ------
NM_005276chr1251705 1166 683 506 496 --21527 1309 --
NM_005276chr1251705 1166 683 506 496 --21527 1309 --
NM_005277chr41347 1263 ----
NM_005278chrX--187 135 1455
NM_005296chrX1219 ------
NM_005310chr173351 149 141 ------
NM_005311chr7112770 2759 2577 2482 2377 2043 1147 757 552 400 93 --22610 211 --
NM_005318chr221896 151 ----
NM_005324chr1751907 1852 1337 1303 257 2325 41 ----
NM_005328chr84570 547 154 23 ------
NM_005329chr1652041 1882 797 256 173 ------
NM_005336chr231958 1824 1806 --11968 --
NM_005339chr454112 3575 957 428 77 22976 1243 1667 1164
NM_005342chrX4595 574 284 275 12828 1535 --
NM_005346chr64258 99 86 61 ------
NM_005347chr921184 597 11693 ----
NM_005358chr1351858 1449 1432 497 418 ------
NM_005359chr18126474 6419 5361 5191 5060 2162 1359 1169 774 507 327 97 45260 1900 907 564 --16537
NM_005370chr1951272 1073 891 336 322 ------
NM_005374chr1772365 2257 1972 1823 1690 1684 31 --11752 --
NM_005375chr62980 298 21051 811 1843 --
NM_005378chr22559 160 --137 --
NM_005382chr8--1421 ----
NM_005384chr91184 147 ----
NM_005387chr111263 ------
NM_005388chr94537 362 338 256 1381 ----
NM_005392chr931271 331 26 --1324 --
NM_005397chr783854 3645 2786 2521 1407 641 397 301 ------
NM_005398chr1051236 1033 173 87 62 --21371 937 --
NM_005399chr1114184 3889 3338 3091 2810 1754 1455 874 268 150 143 13627 11286 --
NM_005400chr282630 2337 2252 1915 1004 689 380 24 ------
NM_005402chr711730 11835 11378 --
NM_005406chr1811470 --21333 1097 --
NM_005415chr21494 1598 ----
NM_005417chr2071400 758 524 273 219 105 79 11455 12006 11314
NM_005418chr114629 502 135 97 ------
NM_005424chr1248 29 ------
NM_005426chr13654 341 43 ------
NM_005430chr123690 373 344 1771 1953 --
NM_005433chr1832443 1104 533 --1100 --
NM_005435chr7----1205 --
NM_005436chr1073704 3651 2725 1274 819 386 105 --23943 1161 --
NM_005437chr1041459 1119 494 32 --11367 --
NM_005438chr113533 470 223 ------
NM_005439chr122511 377 --1224 --
NM_005440chr1743093 1220 878 407 --23273 3203 --
NM_005442chr35620 467 261 75 39 ------
NM_005455chr131673 1537 377 ------
NM_005458chr972189 1884 1790 1598 1559 992 550 22128 260 2749 423 --
NM_005461chr2051596 1232 631 390 364 11433 ----
NM_005475chr1232876 1997 531 ------
NM_005476chr931055 378 308 --11219 --
NM_005479chr1021304 1214 11167 11033 1605
NM_005486chr173470 130 66 ------
NM_005487chr2261971 1766 1550 1451 859 177 ------
NM_005493chr6167 ------
NM_005494chr71243 --1233 --
NM_005497chr1786118 6079 5823 5762 2321 1694 1309 1127 34832 4128 1171 ----
NM_005499chr192661 119 ------
NM_005502chr973115 2707 2561 2554 2487 1169 567 13098 157 --
NM_005504chr12106583 5868 4651 2642 2431 1465 1458 1051 575 346 26604 5968 22177 1160 --
NM_005506chr432622 2061 2012 12787 1330 --
NM_005509chr51133 1719 1312 --
NM_005517chr181429 1285 1240 1183 1138 1087 1047 537 11190 ----
NM_005519chr101149 1508 ----
NM_005522chr73948 317 155 11110 ----
NM_005525chr1--1161 ----
NM_005529chr141005 929 342 117 ------
NM_005539chr104487 441 388 294 --1517 --
NM_005542chr741931 1861 1432 240 11276 ----
NM_005550chr162545 105 ------
NM_005552chr144527 223 208 150 ------
NM_005561chr133883 776 39 ------
NM_005562chr151450 1329 1220 1096 403 11211 11311 1496
NM_005563chr13608 580 302 1690 ----
NM_005565chr52407 41 ------
NM_005569chr22154 21481 215 ----
NM_005570chr182946 135 11163 ----
NM_005575chr53803 111 60 2586 71 ----
NM_005578chr353401 1273 269 239 98 21151 603 13349 14086
NM_005584chr131319 ------
NM_005587chr153887 312 216 ------
NM_005596chr985706 4925 2515 2154 1991 1459 1185 439 --45049 2095 816 622 --
NM_005599chr161565 1468 1364 1315 1168 1003 ------
NM_005600chr11254 ------
NM_005602chr33916 423 93 1329 ----
NM_005603chr181480 41981 1872 1339 230 ----
NM_005604chr632404 632 525 11914 1226 --
NM_005611chr161467 11263 ----
NM_005613chr142140 652 499 76 1578 ----
NM_005614chr731106 1025 913 1978 ----
NM_005625chr8163 ------
NM_005627chr63834 795 108 1995 ----
NM_005634chrX2601 91 1276 ----
NM_005639chr1251451 691 450 147 22 159 ----
NM_005647chrX73246 2750 2728 2280 693 679 313 --32359 1225 860 --
NM_005648chr81147 ------
NM_005651chr41360 ------
NM_005660chrX--1232 ----
NM_005662chr82394 368 ------
NM_005664chr152248 131 --1413 --
NM_005667chr21362 ------
NM_005668chr574108 4043 1575 1540 1298 979 690 14061 11740 --
NM_005677chr331324 1021 972 ------
NM_005684chr11285 ------
NM_005686chr11495 ------
NM_005688chr31319 11074 ----
NM_005704chr12221 89 21038 806 1424 --
NM_005707chr152269 152 ------
NM_005711chr54851 772 746 77 ------
NM_005715chr662250 1972 1787 983 692 615 ------
NM_005717chr131248 258 112 1136 ----
NM_005718chr33800 554 273 ------
NM_005719chr121195 ------
NM_005721chr221015 704 1871 11077 --
NM_005722chr242006 1557 700 104 ----1462
NM_005725chr162188 1829 1701 1591 220 131 1594 ----
NM_005730chr1253090 2291 1239 1112 982 --22874 2851 --
NM_005731chr21150 ----1304
NM_005734chr112748 166 ------
NM_005737chr262881 2820 2693 2455 2222 914 12558 21004 160 --
NM_005738chr731405 524 149 ----1367
NM_005739chr1532290 2195 27 1380 1457 --
NM_005744chr151118 ------
NM_005746chr762302 2126 2075 826 323 226 11871 ----
NM_005748chr1263354 2649 2550 1156 757 549 --23047 209 --
NM_005752chr1631011 996 240 ----11183
NM_005754chr511108 --1281 --
NM_005756chrX11543 ----11462
NM_005759chr283676 3593 1493 1315 1280 553 536 189 14489 ----
NM_005767chr13--1300 ----
NM_005768chr123578 135 72 ------
NM_005776chr141790 ------
NM_005778chr32372 132 ------
NM_005779chr563296 436 394 363 351 185 23663 2763 ----
NM_005780chr1321019 809 ------
NM_005783chr22634 39 ------
NM_005786chr181160 ------
NM_005789chr1761831 1393 1332 469 118 28 ------
NM_005807chr11212 ------
NM_005808chr393460 3329 3225 2949 2874 2714 2625 1050 827 33563 3121 709 13393 --
NM_005813chr24920 796 645 88 --21017 782 --
NM_005822chr632087 1699 637 --1454 --
NM_005826chr11484 ------
NM_005828chr17115061 3875 1930 1876 1724 1514 780 355 341 174 53 --2568 115 --
NM_005832chr31234 11395 ----
NM_005840chrX167709 6891 3075 2993 2663 2456 2450 2396 2171 1595 1509 737 623 520 375 368 57546 6906 4973 2760 1631 ----
NM_005841chr41227 1285 ----
NM_005842chr131122 ------
NM_005843chr241909 1339 603 337 ------
NM_005852chr1751129 1049 1023 370 131 --1142 --
NM_005853chr162431 240 ------
NM_005857chr131146 918 310 21477 1003 ----
NM_005859chr5--1400 ----
NM_005863chr102388 374 21130 359 11426 --
NM_005866chr91866 ------
NM_005869chr5--1151 ----
NM_005870chr1321375 174 1194 ----
NM_005871chr101941 --130 --
NM_005877chr2242159 1864 750 91 --12015 --
NM_005880chr16--11065 1476 --
NM_005882chr43900 734 671 ------
NM_005896chr21738 ------
NM_005898chr1133000 2397 738 --1200 --
NM_005899chr1731142 305 108 21048 449 ----
NM_005900chr431029 846 116 ------
NM_005901chr18238615 8543 8052 6764 6289 6262 6135 5679 5466 3095 2810 2637 2445 2255 2236 1832 1509 1447 1431 1088 550 457 369 11167 11405 --
NM_005902chr1563498 1697 1533 1493 1444 367 33957 1140 897 ----
NM_005903chr565211 4171 3707 1978 1569 850 2690 476 ----
NM_005904chr1851374 921 562 453 57 ------
NM_005907chr631067 129 25 ------
NM_005909chr564123 3532 3118 517 294 249 --13909 --
NM_005910chr1763708 2699 1480 1153 912 91 --2980 740 12653
NM_005911chr21411 ------
NM_005920chr183498 2948 2907 2842 1446 1179 533 233 --1295 --
NM_005924chr7--1932 ----
NM_005933chr11102281 2217 2197 2079 2073 1978 1956 1915 1204 120 ------
NM_005935chr4104513 3776 3751 3567 1546 1484 1085 772 564 43 25174 523 --15221
NM_005937chr1732813 913 698 24182 249 11487 --
NM_005941chr834198 3596 32 1677 1260 --
NM_005943chr651324 1256 647 517 266 --11602 --
NM_005944chr341208 1095 944 333 ------
NM_005955chr1124896 4688 4461 3933 3537 2167 1952 1609 1470 1064 1046 601 14922 1670 --
NM_005962chr1032011 1778 829 ----1580
NM_005962chr1032011 1778 829 ----1580
NM_005964chr1721526 383 --1373 11301
NM_005967chr122248 107 ----1548
NM_005968chr191169 ------
NM_005982chr142221 95 ------
NM_005984chr22----1119 --
NM_005990chr5122643 2608 2311 1935 1927 1766 1006 977 736 628 366 63 ------
NM_005996chr1241528 1004 310 109 11146 ----
NM_006002chr13--141 ----
NM_006007chr984084 3346 1646 1595 952 704 322 237 22921 1260 1314 13336
NM_006011chr15124269 4179 4124 3999 3774 2905 2670 1150 1143 1132 967 922 11342 53117 2915 1268 1169 1158 13461
NM_006015chr121200 266 ----11037
NM_006016chr622289 208 22015 1961 11540 --
NM_006020chr1471319 1309 889 874 329 287 176 11277 ----
NM_006023chr101169 ------
NM_006024chr73590 264 199 1938 ----
NM_006030chr341701 380 314 146 ------
NM_006035chr1441197 1000 233 203 ------
NM_006037chr2114869 3783 3717 3473 3051 1733 557 525 450 153 42 23811 3420 14307 24681 3132
NM_006039chr172753 441 --21053 365 --
NM_006040chr1651204 964 441 267 78 ------
NM_006043chr164696 679 261 37 ------
NM_006047chr2032613 2369 495 ------
NM_006048chr121233 24 ------
NM_006051chr51105 --153 --
NM_006055chr253019 2979 2849 1162 45 13191 ----
NM_006060chr773813 3779 2692 1194 717 610 461 12958 11310 --
NM_006064chrX1102 ------
NM_006067chr162797 268 ------
NM_006068chr41275 ------
NM_006080chr752648 2407 2378 2091 293 ------
NM_006090chr1137 ------
NM_006094chr862282 1843 688 447 361 183 --1949 --
NM_006095chr4113778 3709 3671 3566 3134 2945 2862 1662 779 622 28 --13846 --
NM_006096chr811166 --21703 41 --
NM_006099chr13775 643 148 ------
NM_006106chr1143254 2972 1358 1102 --12600 --
NM_006107chr172493 419 ------
NM_006108chr111111 32009 1796 908 ----
NM_006109chr14148 ------
NM_006113chr141738 1667 605 465 21732 668 ----
NM_006116chr2261574 1498 1350 1057 127 111 ----11327
NM_006133chr1162474 2458 1940 1527 705 677 ----11743
NM_006134chr2141599 1567 1299 1285 ------
NM_006135chr141444 1312 261 183 ------
NM_006136chr7139 ------
NM_006139chr221954 931 --12632 --
NM_006141chr1642725 2642 2495 2289 --12588 --
NM_006145chr194876 836 444 337 2910 735 1982 --
NM_006147chr12450 185 ------
NM_006148chr17102762 2643 1134 1073 523 464 309 170 161 87 ------
NM_006153chr33249 235 185 ------
NM_006156chr141200 ------
NM_006157chr11--1291 ----
NM_006158chr831681 1398 694 11638 11241 --
NM_006160chr1731470 1144 39 ------
NM_006161chr51243 ------
NM_006162chr1831612 1184 686 --21302 519 --
NM_006166chr1252545 1690 1663 974 47 --1255 --
NM_006177chr142902 738 --2258 79 --
NM_006178chr1721291 530 --1133 --
NM_006180chr951923 1804 822 498 330 11700 21343 348 --
NM_006183chr121139 ------
NM_006186chr221149 480 1124 ----
NM_006190chr21906 1371 ----
NM_006191chr122312 67 ------
NM_006192chr2051096 349 253 219 53 1944 ----
NM_006194chr1421190 108 21056 406 ----
NM_006195chr92965 894 ------
NM_006196chr2134 1309 ----
NM_006197chr861839 1491 857 757 84 29 1842 ----
NM_006202chr1961704 1462 1410 1315 631 75 ----11913
NM_006203chr555473 5351 5143 4590 3572 35227 4101 359 1890 --
NM_006206chr442576 2163 1796 1091 --12269 11931
NM_006212chr1125278 4610 4541 4253 4029 3657 3548 1438 969 875 602 335 14475 --13790
NM_006216chr23661 646 42 ------
NM_006224chr1761761 1620 941 916 554 540 130 22296 738 1850
NM_006226chr21442 11345 ----
NM_006237chr1351841 1496 682 172 70 1535 ----
NM_006241chr332305 1793 664 ------
NM_006243chr1122 --2900 352 --
NM_006245chr6172 ------
NM_006246chr143510 392 79 ----1221
NM_006247chr192315 150 1470 ----
NM_006251chr563021 2414 950 813 128 28 12618 ----
NM_006252chr187511 6290 5659 2730 1504 1483 822 353 35610 2971 191 11624 --
NM_006254chr32162 90 ------
NM_006255chr145902 796 748 260 136 ------
NM_006256chr142563 2302 336 76 ------
NM_006258chr103345 288 24 21477 991 ----
NM_006265chr82118 106 ------
NM_006267chr2133 ------
NM_006268chr1161039 917 363 356 273 248 ------
NM_006275chr201973 188 ----
NM_006277chr24679 547 241 134 ------
NM_006282chr2043067 2965 727 90 21676 463 2552 426 21495 715
NM_006283chr8104494 4424 1925 1918 1265 1203 896 822 151 32 13049 195 --
NM_006290chr641877 1613 1512 1264 ----1482
NM_006292chr11------1187
NM_006293chr152340 188 ------
NM_006294chr82448 417 ------
NM_006301chr121510 ------
NM_006306chrX31666 1404 599 42307 1726 917 376 15012 --
NM_006310chr172900 30 1400 ----
NM_006313chr1241667 1536 1435 1087 ------
NM_006315chr463431 3364 1815 1501 1006 315 12739 11120 --
NM_006320chr411123 ------
NM_006321chr352118 1954 496 471 81 --11901 --
NM_006323chr42273 125 ----1492
NM_006328chr112666 225 --1475 --
NM_006330chr831365 446 97 1116 ----
NM_006333chr21455 ------
NM_006334chr9187 ------
NM_006335chr11332 --1812 --
NM_006345chr411260 ----1317
NM_006350chr5145 ------
NM_006352chr131481 837 130 ------
NM_006353chr611179 --2944 25 --
NM_006357chr22326 117 ------
NM_006359chrX32078 916 38 --1206 --
NM_006361chr1751994 1961 1696 1627 93 --2402 333 --
NM_006364chr142844 485 1453 ----
NM_006366chr611258 11073 ----
NM_006367chr14198 113 54 24 ------
NM_006373chr1791383 1157 571 521 424 344 128 104 91 ------
NM_006375chrX2444 301 1569 ----
NM_006377chr911230 11285 31146 1023 92 --
NM_006379chr722042 45 ------
NM_006380chr17104372 3965 3377 2966 2960 2922 1658 292 163 96 1613 ----
NM_006386chr2262119 2086 1755 624 426 191 ------
NM_006389chr11111359 1295 1143 1076 1064 873 865 450 292 188 177 --1510 --
NM_006400chr122277 52 ------
NM_006401chr92404 344 ------
NM_006403chr641857 1806 1795 1588 31407 1133 480 ----
NM_006407chr341391 1206 505 73 --11259 --
NM_006417chr11228 ------
NM_006420chr2043208 3200 1338 1232 --33062 961 34 --
NM_006421chr841194 1182 485 40 ------
NM_006424chr461687 1586 1283 791 73 49 --11714 --
NM_006427chr141169 ------
NM_006432chr142333 70 ------
NM_006449chr252181 1468 871 271 89 1159 ----
NM_006451chr521043 704 ------
NM_006454chr482863 2801 2705 2181 1935 1160 1045 851 --22712 2534 --
NM_006457chr453329 2858 1638 818 799 1374 11601 --
NM_006459chr1051864 1742 723 615 562 ------
NM_006460chr1731597 1241 730 1490 11552 --
NM_006464chr284346 4178 3776 3612 1812 1653 1040 928 24642 4318 61523 1494 454 439 402 225 --
NM_006465chr1542172 1682 520 393 --1486 --
NM_006466chr202952 777 21021 33 ----
NM_006467chr552223 2131 2043 1826 215 11493 ----
NM_006469chr151592 1428 625 315 123 --11121 11500
NM_006471chr18192 ------
NM_006478chr22286 67 ------
NM_006480chr52521 451 --170 --
NM_006482chr1273575 3548 2689 1472 801 786 738 ----12910
NM_006489chr1421266 220 --21963 75 --
NM_006494chr193820 763 215 ------
NM_006496chr121403 1370 31906 673 417 11258 --
NM_006497chr172530 25 ------
NM_006516chr131535 468 379 --21436 645 --
NM_006520chrX21698 1301 11095 ----
NM_006526chr2051710 1651 1386 496 318 31689 412 152 1824 --
NM_006527chr42189 104 ------
NM_006532chr1951984 1692 810 605 540 ------
NM_006534chr2063411 3090 857 534 324 209 12381 1642 --
NM_006538chr264097 3729 3072 2877 1361 235 ----11505
NM_006540chr831461 1160 115 ------
NM_006544chr1486046 5384 5302 4694 2363 1673 664 541 --12444 11015
NM_006546chr17125424 5114 4784 4424 4241 4113 2499 2289 1727 755 578 536 16441 14599 --
NM_006547chr71160 --1269 --
NM_006548chr341156 246 147 127 --1390 --
NM_006549chr1242801 2445 2274 1975 11857 12973 --
NM_006557chr9111532 1206 624 618 535 432 359 350 309 303 295 ------
NM_006558chr81474 ------
NM_006559chr131215 924 178 --1164 --
NM_006560chr111473 ------
NM_006561chr10116111 5888 5858 5203 4906 4844 4838 4805 4009 2474 205 1514 24983 3965 --
NM_006565chr163846 515 451 ------
NM_006572chr1762967 2780 2177 1349 508 146 ----12886
NM_006574chr32243 231 ------
NM_006575chr1441450 441 157 129 11332 ----
NM_006577chr231186 858 24 ------
NM_006591chr1121246 429 11864 21260 387 1505
NM_006593chr24635 219 179 134 ----1194
NM_006595chr1131309 393 289 22000 271 1629 --
NM_006599chr1668170 7987 6379 2438 2378 1163 38266 2754 727 ----
NM_006601chr123983 716 691 11040 11065 151
NM_006603chrX3815 389 88 11958 ----
NM_006606chr2042513 2346 2334 25 --12415 --
NM_006609chr283000 2587 2508 2186 1989 697 544 522 1675 ----
NM_006614chr353081 3051 2237 410 332 12488 ----
NM_006618chr161411 1304 1056 1008 443 262 ------
NM_006620chr6124841 4208 3744 3360 1512 1199 759 692 348 255 223 53 34339 3645 1874 --1170
NM_006621chr151882 1876 1355 337 151 1351 11669 --
NM_006624chr1041838 727 139 103 11994 ----
NM_006625chr13970 448 334 21112 908 11023 --
NM_006625chr13970 448 334 21112 908 11023 --
NM_006625chr13970 448 334 21112 908 11023 --
NM_006628chr15124377 4288 3858 3517 1634 1337 1157 760 738 635 498 391 13203 21142 114 1833
NM_006629chr1812416 ------
NM_006633chr52549 30 ------
NM_006644chr132256 156 ------
NM_006646chr1342684 573 526 129 32843 1945 689 2596 325 1371
NM_006650chr553815 2692 2635 1088 114 --23677 2536 --
NM_006651chr441448 980 542 206 --21228 1019 --
NM_006653chr6250 28 --1104 --
NM_006654chr12114056 3783 3679 3489 1287 1262 1199 968 602 556 26 24619 1023 14290 --
NM_006658chr73910 296 82 --11073 --
NM_006662chr163390 246 66 ------
NM_006666chr19----163 --
NM_006667chrX3463 253 64 2384 39 ----
NM_006668chr144495 377 136 58 ------
NM_006670chr61541 --135 --
NM_006675chr1283340 2607 2353 2311 1057 1001 307 231 --22724 2400 --
NM_006676chr93397 359 299 ------
NM_006690chr202856 374 1716 --11757
NM_006695chr17----1293 --
NM_006698chr2031218 500 363 ------
NM_006709chr6159 ------
NM_006710chr23842 804 325 --1918 --
NM_006711chr162141 118 --1610 --
NM_006713chr51745 1821 ----
NM_006717chr972642 2399 2346 1285 394 330 122 33347 2127 846 13308 --
NM_006718chr61845 1223 ----
NM_006720chr1094180 4024 1627 1228 1145 965 864 733 564 23749 96 25098 4342 31455 1078 801
NM_006721chr101336 ----1642
NM_006722chr352988 2699 2413 2079 1102 1563 ----
NM_006726chr43207 153 26 21202 840 ----
NM_006727chr51397 ------
NM_006729chrX165340 5319 5225 5205 4921 4880 4657 4116 3978 3545 3463 3416 2231 1908 1590 892 1111 14903 --
NM_006732chr1952135 2074 1949 1788 1641 --1140 --
NM_006734chr62627 259 1473 ----
NM_006735chr71364 ------
NM_006738chr15134400 4183 3481 3449 3198 3064 1727 1282 1239 619 480 441 197 24419 1501 13654 --
NM_006742chr1631681 1603 140 --11987 --
NM_006745chr411088 ------
NM_006746chrX31049 526 78 ------
NM_006749chr81125 ------
NM_006750chr1665092 4906 2623 2476 624 86 36080 5552 1379 ----
NM_006751chr2185 ------
NM_006754chr72423 130 11273 11078 --
NM_006756chr851295 1241 577 356 162 1584 11284 --
NM_006761chr171835 ------
NM_006763chr131705 746 426 21873 802 1734 --
NM_006765chr8180 ------
NM_006766chr81383 1825 22685 1847 --
NM_006769chr1------1530
NM_006772chr631572 1535 308 --11108 --
NM_006775chr633034 2906 88 ------
NM_006777chrX32365 2158 1785 31111 644 65 --22131 725
NM_006788chr1842029 571 327 132 21913 100 21815 1724 --
NM_006791chr15------1464
NM_006800chrX4528 494 126 34 1627 1217 --
NM_006805chr521414 356 --11194 --
NM_006806chr211271 ------
NM_006807chr1741210 244 237 182 --1379 --
NM_006809chr205646 631 251 158 68 --2945 931 --
NM_006811chr203779 637 190 ----1109
NM_006813chr61336 ------
NM_006815chr121472 ----11146
NM_006822chr171237 1593 ----
NM_006823chr821284 190 ------
NM_006825chr123695 196 190 ------
NM_006827chr1423232 2400 1223 --1836
NM_006828chr62414 49 1436 ----
NM_006832chr142961 123 --2807 673 --
NM_006833chr73324 142 135 ------
NM_006838chr1221469 363 ------
NM_006846chr5172 ------
NM_006851chr1272912 2829 2553 2243 920 349 200 1262 ----
NM_006854chr731842 1825 1423 21239 371 11606 1138
NM_006856chr1221023 706 11082 ----
NM_006873chr253318 953 926 391 166 13248 13372 --
NM_006874chr42889 465 2318 61 ----
NM_006875chrX2780 598 ------
NM_006876chr111576 1228 ----
NM_006885chr1662941 2747 2659 2652 824 691 11702 --23953 3118
NM_006888chr1493535 3332 3247 3239 2829 2496 723 630 168 33418 1298 1273 ----
NM_006893chr1--185 ----
NM_006896chr73787 323 235 --126 --
NM_006902chr142322 422 222 38 11175 ----
NM_006906chr113369 129 122 --2800 377 --
NM_006908chr751492 1356 1292 408 54 11328 --1374
NM_006910chr16144 ------
NM_006915chrX1717 --1253 11623
NM_006920chr251603 1285 562 359 179 ----11693
NM_006922chr261863 867 857 841 173 159 11022 ----
NM_006924chr174872 862 628 363 ------
NM_006927chr162439 166 12118 1621 --
NM_006930chr551762 758 450 420 251 ------
NM_006931chr1261667 1531 1491 773 278 209 ------
NM_006936chr2161257 1141 1092 896 163 87 1178 ----
NM_006937chr17134 ------
NM_006939chr141260 ----1275
NM_006940chr12--11654 ----
NM_006946chr112383 185 ------
NM_006950chrX1738 --1701 --
NM_006955chr1042318 843 765 655 13442 23419 3206 --
NM_006963chr1011230 1450 ----
NM_006965chr182340 258 ------
NM_006981chr922915 2255 ------
NM_006990chr1102421 2199 1785 1759 1753 1612 1570 638 616 510 12393 ----
NM_006996chr141876 681 555 351 1655 141 --
NM_006999chr561781 1692 1618 1583 1267 225 --2134 38 --
NM_007005chr931260 994 48 1281 ----
NM_007006chr1643021 2539 215 43 22954 575 ----
NM_007007chr1294021 3222 3176 3078 1782 1141 722 683 154 34149 376 251 14336 13240
NM_007008chr2--1825 ----
NM_007011chr15156489 5963 5340 4543 4365 4254 2294 2047 1988 1611 1250 941 588 339 255 26719 1742 35624 5332 784 --
NM_007013chr82884 92 ------
NM_007023chr22890 267 11083 ----
NM_007026chr171388 ----1498
NM_007027chr31113 ------
NM_007030chr5115014 4795 3521 3301 1155 1073 879 737 634 298 53 ------
NM_007034chr12752 87 ------
NM_007038chr2185961 5445 3753 2181 1850 1610 488 150 14987 15579 15259
NM_007039chr1421751 258 ------
NM_007040chr19174 --1734 --
NM_007042chr31500 21835 556 1317 1337
NM_007050chr20127254 7121 6074 6025 2952 2493 747 697 609 509 462 413 --57769 6815 6566 5248 157 --
NM_007051chr11119 ------
NM_007054chr573019 2723 2673 945 786 590 385 ----13522
NM_007067chr1751590 1101 565 224 77 --11373 --
NM_007073chr663986 3915 3316 1268 599 93 23007 2570 ----
NM_007078chr1093022 2880 2867 1125 1072 800 378 173 154 12847 1546 --
NM_007084chr1321543 597 21519 1279 2588 291 --
NM_007106chr1332434 1117 361 ------
NM_007107chr322194 371 1860 ----
NM_007114chr332571 2283 653 32650 2490 759 ----
NM_007118chr52897 204 2306 257 ----
NM_007124chr641808 1537 682 412 11661 ----
NM_007129chr13--2861 768 ----
NM_007137chrX115385 4674 4529 4388 3997 3510 2208 1450 1395 640 201 11693 --24346 910
NM_007139chr711122 ------
NM_007144chr1741291 1276 1233 930 --1353 --
NM_007145chr1921242 50 ------
NM_007146chr1712118 12422 ----
NM_007158chr13408 355 302 ------
NM_007159chr311731 ------
NM_007166chr1121246 519 --11282 --
NM_007167chr11857 --1827 --
NM_007170chr11651 ------
NM_007173chr1152411 2352 1560 552 236 21911 310 1705 --
NM_007174chr1252032 1514 524 70 39 --21482 240 --
NM_007175chr883525 3314 2548 2318 915 612 522 394 1593 12799 --
NM_007181chr191169 ------
NM_007185chr15814 685 672 317 291 ------
NM_007191chr122616 182 ------
NM_007192chr1421054 293 --11018 1467
NM_007195chr1853673 3606 2786 1198 1063 22508 977 12691 --
NM_007200chr15134400 4183 3481 3449 3198 3064 1727 1282 1239 619 480 441 197 24419 1501 13654 --
NM_007202chr171750 ------
NM_007203chr983324 3288 3211 3034 1501 941 865 752 --13882 --
NM_007212chr152267 865 791 709 317 ------
NM_007214chr651214 1063 478 463 31 41296 345 236 42 ----
NM_007217chr3--161 ----
NM_007222chr811702 1196 --11549
NM_007232chr203979 821 762 --2968 383 --
NM_007235chr121217 1141 ----
NM_007236chr1592002 1644 1557 1507 689 508 479 424 262 --1683 --
NM_007245chr163718 125 118 ------
NM_007246chr43904 393 254 1197 ----
NM_007247chr1741074 747 429 162 --2882 821 --
NM_007249chr13189278 8223 7887 7162 3758 3690 3377 3258 3246 3121 3033 2427 1456 1149 768 736 608 269 11543 39002 8987 5882 21749 563
NM_007271chr651448 1399 1381 1218 398 11749 11145 --
NM_007275chr321110 118 --1806 --
NM_007276chr72208 162 ------
NM_007279chr192587 466 ------
NM_007281chr41190 ------
NM_007282chr32686 88 ------
NM_007286chr542127 1459 784 487 ------
NM_007294chr1721156 183 ------
NM_007295chr1721156 183 ------
NM_007296chr1721156 183 ------
NM_007297chr1721156 183 ------
NM_007298chr1721156 183 ------
NM_007299chr1721156 183 ------
NM_007300chr1721156 183 ------
NM_007302chr1721156 183 ------
NM_007303chr1721156 183 ------
NM_007304chr1721156 183 ------
NM_007305chr1721156 183 ------
NM_007308chr41151 ------
NM_007313chr991926 1913 1882 1625 568 561 461 220 176 --21958 124 --
NM_007315chr231387 453 71 ------
NM_007322chr191429 ------
NM_007324chr1167 ------
NM_007325chrX42117 1976 686 230 ------
NM_007327chr931143 245 24 ------
NM_007331chr42972 336 --32604 2239 1094 --
NM_007341chr211338 --1274 --
NM_007345chr1842158 1756 853 497 1800 ----
NM_007347chr1563233 2654 2309 2197 993 372 ------
NM_007350chr1264296 4188 3241 1453 1153 171 --34332 3637 973 --
NM_007351chr4281 64 ------
NM_007353chr753065 1888 457 363 282 32745 2393 1896 22975 693 12427
NM_007357chr13177 102 82 ------
NM_007358chr131560 544 44 ------
NM_007361chr141553 --1503 --
NM_007365chr142089 1460 206 75 --2560 240 --
NM_007371chr9266 53 --1208 --
NM_007372chr171888 ------
NM_007373chr1091587 1334 578 565 530 201 174 129 69 11300 ----
NM_007374chr14----1452 --
NM_007375chr172449 2415 2402 2152 1719 977 603 12287 2537 332 12367
NM_009588chr6----1211 --
NM_012064chr1231108 1047 996 ------
NM_012074chr141173 ------
NM_012081chr563300 3263 761 486 456 155 ----13773
NM_012082chr83705 685 314 ------
NM_012084chrX2480 49 ------
NM_012090chr11309 ------
NM_012092chr251739 1457 699 436 118 1369 11715 --
NM_012093chr121169 236 11000 ----
NM_012095chr1083421 3407 3271 2916 2141 1039 870 786 ------
NM_012096chr383424 2950 2813 2306 1487 1086 848 170 32663 1277 469 ----
NM_012097chr221837 607 --1617 --
NM_012102chr192430 2241 1886 884 840 800 793 771 513 1536 ----
NM_012104chr1193822 3453 2990 2548 993 859 269 221 135 13808 11046 --
NM_012104chr1193822 3453 2990 2548 993 859 269 221 135 13808 11046 --
NM_012111chr141155 ------
NM_012115chr63556 530 505 ------
NM_012118chr43459 382 80 ------
NM_012120chr62890 455 1565 ----
NM_012129chr7--11645 ----
NM_012137chr192888 2836 2677 2220 2195 2111 590 294 58 ------
NM_012141chr13123315 3104 2843 2755 1094 1084 1036 1009 747 686 349 333 ------
NM_012144chr9121 --1204 --
NM_012154chr82876 575 ------
NM_012156chr2073409 3122 2917 2648 1342 765 421 --22583 276 --
NM_012158chr1311136 ----1689
NM_012161chr41927 --21136 379 11093
NM_012164chr9237467 7101 6838 6697 6438 6344 6066 6023 5986 5516 5499 5371 5265 2767 2147 2099 2010 1906 1365 1168 1151 814 653 22974 570 56810 5732 4639 783 68 --
NM_012175chr11----188 --
NM_012177chr61563 ------
NM_012180chr42222 188 ------
NM_012181chr19----129 --
NM_012193chr1195378 5366 5184 5159 4095 4009 3959 3321 677 --34874 4705 995 11664
NM_012197chr941456 1288 1044 470 21406 1035 ----
NM_012199chr1104510 3639 2976 2941 1764 1443 1000 918 654 641 13766 33052 1485 360 --
NM_012202chr111260 ------
NM_012207chr102829 168 --1357 --
NM_012213chr161547 1684 ----
NM_012214chr296369 6105 5613 5425 5067 5009 4859 1649 955 14997 12130 --
NM_012215chr1041602 1346 538 316 --11338 --
NM_012218chr1972948 2797 829 385 277 260 32 11115 22916 875 --
NM_012223chr221311 927 ------
NM_012224chr41485 ------
NM_012229chr103486 217 179 1378 2567 188 1918
NM_012234chr363744 3484 3193 2960 2736 135 31099 933 771 --13491
NM_012238chr1031546 1355 175 ------
NM_012242chr101761 ------
NM_012243chr11386 2774 341 --1305
NM_012245chr141415 ------
NM_012247chr101952 1709 ----
NM_012248chr162574 249 ------
NM_012249chr283280 2877 2806 1195 799 389 368 347 12513 ----
NM_012252chr744678 1255 698 68 --15369 14727
NM_012257chr741041 766 411 35 --1833 --
NM_012259chr621398 547 --169 --
NM_012261chr201513 ------
NM_012262chr1105085 4675 4412 3793 3440 1274 1024 876 528 390 --14011 --
NM_012268chr191310 ------
NM_012279chr551324 819 659 558 491 ------
NM_012281chr772409 2293 2145 1670 1640 1552 89 --21490 719 --
NM_012286chrX1488 141 --1452
NM_012287chr31236 23899 2902 24096 957 --
NM_012288chr6115444 5252 4329 4228 3945 3802 1672 748 577 317 308 ------
NM_012290chr211037 ------
NM_012293chr232265 2072 178 22052 1665 --22099 638
NM_012294chr7123914 3908 3614 2965 2917 2635 897 710 679 666 397 31 --1618 12687
NM_012296chr1152413 1489 626 195 109 13044 21098 1070 13200
NM_012297chr442641 355 323 53 1514 ----
NM_012300chr542053 1777 685 596 --21717 372 --
NM_012301chr741941 1839 775 699 ------
NM_012302chr171170 1099 820 484 473 260 87 ------
NM_012304chr562486 2100 2000 1611 989 615 --31792 973 530 --
NM_012307chr1811067 ------
NM_012308chr1172374 1825 1679 855 606 328 114 ----11928
NM_012309chr11134758 4360 4222 3545 3362 1917 1111 910 688 619 396 328 297 1710 --1953
NM_012311chr102590 496 ------
NM_012316chr1124289 3873 1994 1910 1455 1320 1161 716 575 412 326 112 ----25426 4278
NM_012323chr2221579 77 21243 1155 199 --
NM_012324chr225761 301 291 236 133 ------
NM_012325chr2041666 1450 1272 1128 11313 1144 --
NM_012326chr22736 251 ------
NM_012327chr182511 190 ----11182
NM_012328chr72941 372 ------
NM_012329chr1761549 1136 1038 676 564 168 --21050 535 --
NM_012330chr1041787 1650 1536 54 11604 --1247
NM_012333chr15516 505 468 395 131 ------
NM_012334chr5144476 4347 4230 3683 3657 3007 1842 1559 1509 780 690 406 207 28 ----14060
NM_012337chr1147 ------
NM_012338chr72967 870 ------
NM_012342chr102163 56 ----1125
NM_012343chr531114 882 95 --142 --
NM_012347chr662466 2282 1187 453 369 32 12141 --12420
NM_012382chr564264 4214 4043 3544 2747 1669 ----13552
NM_012383chr9166 ------
NM_012384chr2092376 2356 2237 1894 1659 1553 526 420 116 12440 ----
NM_012394chr1181 ------
NM_012395chr783370 2654 2376 2360 2272 650 504 250 32343 592 481 1316 2333 180
NM_012399chr2241834 1367 1345 210 11741 ----
NM_012405chr183722 3638 2727 2670 2530 1477 1305 363 11122 ----
NM_012407chr221133 ------
NM_012412chr7----1627 --
NM_012414chr13535 294 222 ------
NM_012419chr63578 552 440 ------
NM_012425chr1042708 2147 781 729 --12665 --
NM_012426chr163378 317 79 ------
NM_012428chr152734 65 ------
NM_012430chr31105 ------
NM_012431chr73994 886 466 1108 185 --
NM_012434chr63442 326 72 ------
NM_012445chr41530 --2508 144 --
NM_012448chr1762475 1883 1678 492 454 223 1972 22147 1994 --
NM_012454chr61570 1207 ----
NM_012455chr251582 1293 1247 1199 1097 --1642 --
NM_012461chr144540 277 69 40 --1640 1670
NM_012463chr122472 299 1135 ----
NM_012465chr1032444 1081 481 32234 912 216 ----
NM_012474chr1172 ------
NM_012475chr1------1241
NM_012479chr741831 876 651 243 --2972 435 11720
NM_012482chr11165 ------
NM_013231chr1494313 3606 2798 2743 1735 1634 1205 342 221 11315 --1133
NM_013233chr251374 1151 1045 199 77 ------
NM_013236chr2221097 473 --1192 --
NM_013254chr122688 37 ------
NM_013255chr7148699 8637 8388 7114 6452 6443 2839 2733 1949 1621 973 622 566 448 38649 6682 6539 46044 2270 930 893 --
NM_013259chr31244 1127 ----
NM_013261chr473106 2972 2545 2496 865 635 261 11438 23330 118 --
NM_013262chr631461 1441 927 --21315 1063 --
NM_013269chr12104481 4408 3991 3976 3810 3205 3192 1555 1204 757 11411 24364 1747 14185
NM_013272chr15----126 --
NM_013277chr1231017 65 59 21051 999 2907 71 --
NM_013279chr1121819 106 ------
NM_013282chr1911141 ------
NM_013286chr383475 3416 3056 2888 2662 954 626 256 ------
NM_013302chr1694492 4328 4080 4031 3512 1305 459 322 163 --11180 --
NM_013305chr181190 --1135 --
NM_013316chr72804 47 ------
NM_013323chr1751057 912 870 277 123 ------
NM_013328chr1121 ------
NM_013330chr11172 ------
NM_013335chr2172 ------
NM_013341chr282614 2533 2086 2076 1176 1063 446 208 ------
NM_013346chrX173 ------
NM_013348chr192191 144 11023 ----
NM_013354chr82428 386 11427 --11147
NM_013363chr32396 33 ----1300
NM_013365chr223736 616 525 ------
NM_013372chr1563386 2158 1182 1131 938 212 23341 2628 1983 --
NM_013373chr223716 170 82 ------
NM_013374chr342167 1993 1119 430 32812 2650 2500 12310 --
NM_013380chr19--1823 ----
NM_013381chr121900 12416 ----
NM_013382chr1431722 946 115 ------
NM_013386chr131732 1699 259 ------
NM_013388chr2176 ------
NM_013396chr2141490 1427 551 289 ------
NM_013400chr72987 878 ------
NM_013401chr112727 227 ------
NM_013410chr11179 --1224 --
NM_013411chr131794 1739 708 12000 12285 --
NM_013423chrX1933 1348 ----
NM_013427chrX1933 1348 ----
NM_013433chr1941847 1664 568 33 ------
NM_013434chr281922 1786 1698 1285 769 469 405 303 1103 ----
NM_013434chr281922 1786 1698 1285 769 469 405 303 1103 ----
NM_013435chr1831873 1517 490 --11738 --
NM_013436chr21299 ------
NM_013437chr831300 1015 868 ------
NM_013438chr971727 1694 1685 1534 372 222 169 1428 ----
NM_013443chr93998 898 239 --11055 --
NM_013444chrX51078 900 437 353 191 ------
NM_013446chr761415 1291 1171 1134 469 423 --11408 --
NM_013448chr141175 ------
NM_013449chr1242946 2817 2703 1982 --1425 --
NM_013450chr21829 ------
NM_013943chr132775 764 98 --22244 1263 --
NM_013951chr21962 --32470 2309 1975 --
NM_013952chr221039 76 --32547 2386 2052 --
NM_013953chr221039 76 --32547 2386 2052 --
NM_013958chr82148 101 ------
NM_013959chr82148 101 ------
NM_013961chr82148 101 ------
NM_013962chr82148 101 ------
NM_013986chr221123 ------
NM_013989chr1444770 4338 4053 283 1640 --14060
NM_013992chr221039 76 --32547 2386 2052 --
NM_013995chrX2474 24 --1841 --
NM_014000chr1071943 691 566 541 358 323 198 --11286 --
NM_014011chr221757 1680 21815 577 ----
NM_014016chr3--1225 11395 --
NM_014021chr142800 2476 2470 949 12243 11255 11123
NM_014023chr1072599 2051 626 589 400 340 67 1537 12616 --
NM_014030chr17----1232 11003
NM_014043chr32402 258 194 ----
NM_014048chr1685295 5169 5122 4325 4152 1812 1658 906 ------
NM_014055chr12--1467 ----
NM_014071chr20191 ------
NM_014089chr1342142 1955 1857 1508 11966 ----
NM_014109chr81207 ------
NM_014112chr884625 2201 2010 1998 1991 1610 1350 783 21973 1630 34367 3480 3351 --
NM_014117chr1632563 2249 455 ------
NM_014141chr754980 3851 2108 1538 216 15184 ----
NM_014145chr205791 677 644 582 93 1262 1294 --
NM_014154chr321598 212 ------
NM_014155chr11117302 4596 2640 2499 2364 2201 2184 1810 1780 1280 85 36526 2107 465 1871 15098
NM_014171chr22256 46 ------
NM_014176chr1140 ------
NM_014181chr252927 2198 669 487 367 12444 --1754
NM_014189chr45450 378 296 75 46 ------
NM_014190chr44730 648 427 398 ------
NM_014191chr1221008 421 1983 ----
NM_014213chr2----1188 --
NM_014216chr1451595 1353 1173 1125 448 1274 21236 1207 --
NM_014217chr1----21284 558 --
NM_014222chr9171 ------
NM_014223chr12548 539 --2730 576 --
NM_014230chr173154 95 47 ------
NM_014231chr1271940 763 253 161 155 61 54 --12006 --
NM_014232chr172440 320 ------
NM_014232chr172440 320 ------
NM_014233chr1751658 1571 1342 668 286 11328 21431 187 --
NM_014234chr6245 25 ------
NM_014238chr1761295 1239 346 180 119 69 --31377 575 548 --
NM_014240chr3104089 3291 3105 2929 2878 2601 1592 1458 510 208 22735 847 33081 1438 661 --
NM_014243chr431780 465 180 1120 ----
NM_014245chr341116 737 360 234 ----1192
NM_014246chr2252342 2011 1730 791 581 ----1417
NM_014248chr221130 ------
NM_014250chr2261971 1766 1550 1451 859 177 ------
NM_014253chrX31705 1586 21 12270 193 --
NM_014258chr20----146 --
NM_014264chr41218 2649 493 ----
NM_014268chr1841284 1063 269 170 1444 1981 --
NM_014271chrX2649 49 ------
NM_014279chr91211 ------
NM_014283chr131377 1060 62 ------
NM_014284chr1----1911 --
NM_014286chr993602 3510 2748 2416 1223 953 514 443 216 --33097 2907 265 --
NM_014287chr16--1340 1421 --
NM_014288chr12268 43 ------
NM_014289chrX31414 1207 169 11307 ----
NM_014292chr2241763 1234 277 104 11952 ----
NM_014294chr821300 1038 --11385 --
NM_014298chr163569 176 132 1200 ----
NM_014300chr151129 --2468 371 --
NM_014305chr131127 ------
NM_014309chr2264748 3843 3712 3616 285 191 21396 456 15415 24887 4075
NM_014316chr1641991 1803 1796 1413 --2609 47 --
NM_014319chr1241406 767 631 243 11471 ----
NM_014323chr222200 89 ------
NM_014325chr1261892 1658 1542 1485 851 185 --2613 465 --
NM_014326chr152917 248 ----1114
NM_014333chr1172060 963 789 783 624 582 185 21773 735 ----
NM_014335chr1521397 993 1336 11106 --
NM_014342chr1141438 1267 945 32 ------
NM_014344chr11172 --1843 --
NM_014345chr61351 1233 ----
NM_014352chr1111136 --1512 1950
NM_014372chr12629 492 ------
NM_014374chr72987 878 ------
NM_014380chrX1207 --1165 --
NM_014382chr341658 1142 549 290 126 11708 --
NM_014390chr75535 491 404 115 55 ------
NM_014392chr411601 1369 --1143
NM_014393chr851904 439 330 308 57 ------
NM_014399chr7--154 1956 --
NM_014408chr13208 70 59 ------
NM_014410chr181361 ------
NM_014411chr731563 1330 623 1451 --12005
NM_014415chr361633 1455 624 364 334 231 11462 ----
NM_014417chr193906 642 299 --193 --
NM_014421chr452077 1795 1684 1444 539 21949 1807 11403 --
NM_014423chr5105659 5423 5144 3760 3507 2138 1168 379 362 220 14276 --11312
NM_014426chr20----1535 --
NM_014431chr1061585 1436 1381 1261 446 350 11605 11464 --
NM_014445chr332211 1660 648 1983 21572 331 --
NM_014447chr44576 469 296 268 ------
NM_014452chr62917 239 11062 ----
NM_014454chr63875 869 136 ------
NM_014456chr1021917 296 ------
NM_014458chr121332 181 11220 136 --
NM_014470chr121706 --1545 --
NM_014476chr42422 412 2365 212 ----
NM_014488chr112461 252 ------
NM_014491chr73740 732 288 1895 ----
NM_014494chr1612008 --3630 396 112 --
NM_014496chrX1191 --1256 --
NM_014506chr92627 105 --1380 --
NM_014507chr2241139 1007 765 446 ------
NM_014515chr121382 1284 ----
NM_014517chr351661 1635 729 466 309 11582 ----
NM_014521chr241860 739 632 48 --1452 --
NM_014522chrX2652 207 ------
NM_014547chr152651 199 ------
NM_014547chr152651 199 ------
NM_014548chr151390 ----11332
NM_014554chr1262347 2165 713 625 271 96 1191 11974 --
NM_014562chr2189 ------
NM_014569chr751161 974 608 563 375 ------
NM_014570chr222237 95 ------
NM_014572chr134577 459 423 136 ------
NM_014574chr1431193 366 55 ------
NM_014575chr31147 ------
NM_014577chr221917 2765 614 ----
NM_014585chr261199 1116 1099 416 345 100 21089 375 ----
NM_014591chr10----11309 --
NM_014592chr52293 138 ------
NM_014603chr1731489 1269 682 1400 21621 1342 --
NM_014612chr941185 996 594 414 ------
NM_014613chr562665 2535 2239 898 694 265 12435 ----
NM_014614chr22150 100 1358 --181
NM_014616chr372866 2521 2123 1166 1038 892 832 22303 406 23432 2389 --
NM_014618chr91327 ------
NM_014623chr62210 158 ------
NM_014630chr15113296 3270 3015 2654 745 737 642 629 605 487 87 ----13151
NM_014635chr241661 1629 1601 106 11714 21304 1139 --
NM_014636chr963452 3108 1300 1021 767 216 33545 3157 284 33303 1221 475 --
NM_014646chr18103076 2671 2656 2528 2119 864 793 179 142 72 2732 398 12499 --
NM_014647chr1651725 1705 613 412 50 ------
NM_014653chr1262038 1720 1690 1510 198 130 ------
NM_014659chr152987 851 ------
NM_014660chr731074 946 279 ------
NM_014661chr10123540 3333 3035 2453 1515 1474 1309 1139 827 786 321 288 21352 558 2999 352 --
NM_014666chr521135 1124 1890 ----
NM_014667chr362386 2017 1752 482 378 35 32371 1976 126 11536 --
NM_014669chr161114 ------
NM_014670chr21583 1394 ----
NM_014671chr751220 1143 499 324 126 ------
NM_014674chr3163761 3296 3111 2910 2881 2716 2692 2627 2587 2575 2500 1237 1089 840 463 336 33898 3679 556 --23867 3848
NM_014676chr111442 21565 429 ----
NM_014677chr811292 11225 ----
NM_014682chr822067 1474 1118 ----
NM_014683chr1711401 --1763 --
NM_014685chr163550 532 366 ------
NM_014686chr1912054 --22460 1996 --
NM_014689chr22159 49 --1631 --
NM_014690chr752021 1118 987 443 393 12395 ----
NM_014693chr31174 ------
NM_014701chr1583138 2826 2644 2220 1205 980 153 81 --11052 --
NM_014702chr673365 3117 2948 2857 1285 1189 497 12129 ----
NM_014705chr731738 1611 35 1440 ----
NM_014707chr711812 1390 ----
NM_014709chr21109 1463 ----
NM_014712chr162219 173 --1429 --
NM_014713chr22434 337 ------
NM_014721chr6127026 6991 6845 5299 5074 2632 2501 1849 1766 1375 1301 1203 ------
NM_014723chr2083058 2140 2134 2047 1127 1020 904 284 --22883 1026 --
NM_014726chr1761011 879 474 426 291 228 ------
NM_014729chr82895 867 ------
NM_014730chr1285308 5085 5063 4990 3753 3593 879 73 --34290 4185 1694 --
NM_014730chr1285308 5085 5063 4990 3753 3593 879 73 --34290 4185 1694 --
NM_014731chr2021504 395 --11524 --
NM_014733chr551617 1419 304 206 125 11887 ----
NM_014735chrX61493 732 523 421 38 32 1343 ----
NM_014739chr674087 3877 3093 1413 580 311 277 1113 ----
NM_014743chr432569 378 294 23126 2661 ----
NM_014746chr294069 3750 3195 2885 1511 872 436 333 290 --1241 --
NM_014751chr841992 1979 737 222 11786 ----
NM_014752chr1151712 1544 1380 1336 539 ------
NM_014755chr253175 2771 1274 753 570 --13444 --
NM_014756chr115474 419 392 177 167 ------
NM_014757chr542022 1525 841 569 1432 1956 --
NM_014761chr1631171 186 168 --1438 --
NM_014764chr1221170 305 ------
NM_014772chr1863000 2891 2639 949 888 669 13025 13440 --
NM_014774chr11117 --13237 --
NM_014775chr22------1111
NM_014776chr1293067 2538 2485 2207 2179 2100 512 147 26 --12430 --
NM_014779chr331042 818 255 ------
NM_014782chrX147 ------
NM_014784chr111080 --126 --
NM_014787chr122578 23 --12095 --
NM_014795chr22943 875 1924 1475 --
NM_014802chr1221130 50 --11028 --
NM_014803chr1042639 2231 980 617 21923 1089 1801 --
NM_014807chr113784 676 661 ------
NM_014810chr183570 3100 2556 2397 1264 661 176 55 43693 3610 3133 3061 32668 1120 641 13404
NM_014812chr141837 630 537 412 ------
NM_014813chr12391 50 ------
NM_014819chr541543 1527 362 165 2321 46 ----
NM_014820chr342045 1859 552 183 ------
NM_014822chr42470 253 1585 ----
NM_014824chr1121963 1350 --182 --
NM_014826chr174375 4282 4253 4104 3895 3885 3728 1662 ----
NM_014827chr141387 607 599 141 ------
NM_014828chr1462065 1955 1683 995 945 550 ----11627
NM_014829chr52606 63 ------
NM_014830chr1263520 3303 3154 2755 2656 1285 ------
NM_014835chr2032085 550 184 12207 ----
NM_014836chr101447 ----11312
NM_014838chr2252525 2069 639 344 80 1453 ----
NM_014839chr18808 746 730 664 616 432 423 261 1988 22163 606 1127
NM_014840chr12103043 2503 2422 2413 1300 1123 779 183 141 84 --1955 --
NM_014841chr62431 424 1869 ----
NM_014848chr1572465 2381 2269 1970 1852 1016 473 2749 694 22371 1069 --
NM_014849chr121234 359 --21203 250 --
NM_014850chr3114854 4590 4375 4243 3929 3889 3237 1733 1421 569 402 --13045 --
NM_014859chr1761330 961 524 362 235 96 --1329 --
NM_014860chr272561 2410 1625 959 850 686 173 22589 1840 22474 2434 --
NM_014862chr15114226 3287 3209 3096 2997 2609 1688 1415 1317 1244 481 12830 ----
NM_014864chr193468 3044 1209 977 938 838 759 517 150 --1743 1403
NM_014869chr31524 21052 272 184 --
NM_014872chr952204 1999 1978 830 550 ------
NM_014873chr184680 3862 3696 1284 1234 827 563 485 24305 720 14011 --
NM_014874chr161505 1400 754 533 177 24 ------
NM_014876chr2262053 1751 1645 412 327 47 ------
NM_014877chr17187223 6884 6616 6392 6320 5936 5610 5325 4967 2514 2423 1763 1741 1709 412 265 184 136 26423 4804 57483 6890 4979 1869 637 --
NM_014878chr9147 --1111 --
NM_014883chr492465 2377 2343 2082 1759 1002 703 390 118 ------
NM_014887chr132831 722 ------
NM_014890chr31230 141 ----
NM_014892chr61519 ----153
NM_014893chrY32050 570 31 22124 1832 11472 --
NM_014897chr1741980 968 932 882 ------
NM_014898chr1931880 365 24 --1533 --
NM_014899chr542695 2542 707 237 23087 1058 11141 --
NM_014901chr552229 766 757 533 419 ------
NM_014902chr2021511 86 --1532 11535
NM_014903chr1242466 2226 1846 32 12430 ----
NM_014904chr1083949 3626 3542 2945 2746 1491 1339 914 --13306 --
NM_014905chr231474 811 354 11991 ----
NM_014906chr1733024 2754 1250 23623 2540 --13942
NM_014909chr1472970 2801 976 748 472 361 349 12626 13179 --
NM_014912chr1041248 1169 1159 225 22275 2190 ----
NM_014913chr1841442 566 541 242 --1123 --
NM_014917chr1------1873
NM_014918chr1551255 1184 612 543 286 ------
NM_014920chr683535 2937 2622 1497 1447 807 585 541 ----11490
NM_014921chr1932849 2311 660 ------
NM_014923chr132918 65 12161 ----
NM_014924chr1492989 2690 2193 1059 1017 581 474 281 31 12998 --13153
NM_014926chr31944 11079 ----
NM_014931chr192534 181 ------
NM_014932chr311772 ------
NM_014933chr42136 101 ------
NM_014934chr1363573 3267 2760 1111 999 91 22780 2456 23545 3292 --
NM_014938chr1272356 2311 2021 803 433 255 119 12158 ----
NM_014939chr1821290 190 ----11229
NM_014944chr161349 1200 1139 179 44 29 ------
NM_014945chr56723 624 432 335 224 126 ------
NM_014946chr232621 1086 726 1841 ----
NM_014947chr162716 2423 2049 710 462 260 --12961 --
NM_014949chr12969 180 --2986 110 --
NM_014950chr1421686 494 11087 ----
NM_014951chr1052560 1009 952 706 681 12522 ----
NM_014952chr1531992 591 377 --11711 --
NM_014953chr13104314 4171 3543 3462 2721 1333 1308 1014 463 132 1272 ----
NM_014961chr441573 756 408 390 1397 1318 --
NM_014964chr1721919 641 --1603 --
NM_014969chr13877 331 242 --1910 --
NM_014970chr1174 ------
NM_014974chr1061759 1753 1615 1522 1392 420 11639 ----
NM_014982chr14104712 3624 3618 3595 1979 914 889 364 241 155 11337 55121 4771 3638 3429 2085 --
NM_014988chr442402 846 210 204 --11930 --
NM_014989chr671612 1308 1259 822 785 369 342 --21335 610 --
NM_014991chr442792 2583 940 35 ----1406
NM_014992chr141705 1588 ----
NM_014996chr3143 ----1394
NM_014997chr762922 2711 2584 2133 1997 197 22966 144 ----
NM_014999chr1231186 1109 266 11253 ----
NM_015000chr123731 504 303 22370 531 ----
NM_015001chr1----2356 46 --
NM_015002chr1251506 1426 428 354 27 1405 11488 --
NM_015008chr343421 2627 2216 1015 ------
NM_015009chr31700 2672 130 ----
NM_015012chr111358 ------
NM_015015chr1951960 1948 807 715 325 --21739 819 --
NM_015020chr16103635 2868 2608 2582 916 718 575 357 189 71 --22851 2620 12478
NM_015023chr161641 1258 741 671 311 48 ------
NM_015025chr262548 2225 2215 1714 646 231 --22035 2021 --
NM_015026chr1254578 1700 1580 524 389 11590 14702 --
NM_015027chr1641586 1507 614 427 ----1392
NM_015032chr1342859 2126 318 27 32235 1130 845 12615 1430
NM_015035chr20116158 4538 4449 2530 1841 1768 1706 743 629 583 79 ----16353
NM_015039chr184000 3981 3325 2675 1555 1528 1177 74 ------
NM_015040chr252912 819 640 208 175 1437 ----
NM_015042chr15113985 3972 3832 3779 3410 1484 1337 1120 482 336 271 13450 1501 --
NM_015044chr16103051 2929 2797 2628 2423 396 301 284 158 147 ------
NM_015045chr10--32088 1470 198 12015 --
NM_015050chr63523 413 335 ------
NM_015051chr922961 2351 13153 ----
NM_015052chr72934 203 --11129 --
NM_015057chr132241 77 ------
NM_015059chr15123930 3836 3654 3568 3405 3215 2556 1196 848 567 215 149 ------
NM_015063chr1951420 1265 1164 1061 369 11392 ----
NM_015064chr12123162 2818 2761 2306 1427 1281 1045 913 666 546 538 116 13327 ----
NM_015068chr721545 29 ------
NM_015069chr16--198 ----
NM_015071chr5106157 4865 4665 4547 1891 1096 678 516 113 83 12229 1771 15062
NM_015072chr141383 ------
NM_015074chr1124555 3707 3211 3133 1928 1870 1550 1345 934 895 566 459 --1174 14735
NM_015075chrX21999 174 --11410 --
NM_015076chr6124307 3664 3525 3486 3277 2769 1726 1649 1323 993 492 61 2875 276 1638 --
NM_015080chr111898 --1234 --
NM_015082chr542146 2077 385 331 ------
NM_015086chr1241394 1192 518 83 ------
NM_015090chr1156055 5733 5713 5617 5464 4190 4048 3928 1903 1782 1657 1166 1093 616 406 1483 34441 2428 2398 134
NM_015091chr143737 279 130 ------
NM_015092chr1674645 4507 3349 3273 1788 1315 268 ------
NM_015093chr641736 599 544 127 11548 11621 --
NM_015097chr32305 175 31834 629 152 ----
NM_015100chr151989 1893 1778 780 236 --11852 --
NM_015102chr1----191 --
NM_015106chr31154 ------
NM_015107chrX82375 2276 1932 1742 1682 1672 1666 523 1404 ----
NM_015115chr453096 2612 837 797 157 12983 1196 12903
NM_015116chr1351137 1112 665 77 33 11669 150 --
NM_015124chr2232163 830 769 32364 721 111 1153 --
NM_015125chr192462 424 ------
NM_015132chr751885 1835 1295 1221 93 1224 ----
NM_015133chr162487 455 --21469 412 --
NM_015135chr7--1137 ----
NM_015137chr882596 2175 1920 1897 1718 1641 875 680 22165 417 ----
NM_015138chr1542314 2221 497 175 1138 22430 311 --
NM_015141chr372322 2286 2172 2148 2013 593 34 ----12354
NM_015144chr1683147 3110 3033 2637 1412 1330 899 227 2942 706 1531 --
NM_015149chr142157 659 639 358 ------
NM_015151chr212327 310 ------
NM_015153chr62551 123 --1162 --
NM_015155chr1073251 2643 2525 2472 1318 829 367 1401 23038 916 --
NM_015156chr14103984 3868 3691 3490 1451 720 371 223 166 85 43758 2858 2840 1243 23509 1096 --
NM_015161chr1641511 351 118 60 ------
NM_015169chr81366 129 ----
NM_015170chr862275 1880 1543 261 228 148 --12149 --
NM_015171chr163441 138 32 1461 ----
NM_015172chr111089 ----21255 193
NM_015176chr131206 660 296 ----1202
NM_015178chr83937 331 60 ------
NM_015180chr142787 634 ------
NM_015184chr3----175 --
NM_015185chrX92950 2672 2340 1004 880 812 666 635 321 12593 12906 --
NM_015186chr9------1368
NM_015187chr42879 812 1127 1947 --
NM_015191chr1142625 2528 1080 178 --12439 --
NM_015192chr2062449 2330 2313 2003 759 505 ----1512
NM_015193chr871343 1257 1220 1171 1047 300 52 ------
NM_015194chr175774 646 469 177 155 11506 1400 --
NM_015197chr1473291 2617 2525 719 346 315 188 --13041 --
NM_015198chr721227 71 ------
NM_015199chr372859 2751 2587 2315 2278 1117 263 ------
NM_015200chr462470 2105 2077 547 229 125 4736 680 565 60 ----
NM_015205chr13105179 4896 4790 4501 4049 1844 1089 975 461 381 --43998 2089 2029 1128 --
NM_015206chr1593731 3370 2722 2662 1223 867 576 507 53 23188 955 ----
NM_015208chr18--31496 1283 464 11121 13338
NM_015209chr171771 1710 898 807 640 458 250 ----1204
NM_015210chr1851147 771 290 258 35 ------
NM_015215chr153183 2170 653 625 201 11262 1143 --
NM_015219chr1722221 874 12541 22624 2053 --
NM_015221chr1031001 108 37 1600 --1224
NM_015225chr953193 2743 2662 2390 994 12947 22643 102 --
NM_015226chr1663013 2417 1130 786 347 331 --1191 1668
NM_015231chr114884 850 133 127 1299 ----
NM_015233chr1352421 2190 1878 989 771 12741 22473 1893 --
NM_015234chr651340 1191 1146 1024 274 ------
NM_015236chr411173 11034 ----
NM_015245chr652123 1886 1788 1101 419 --32551 2325 2309 --
NM_015247chr16125401 5245 4827 4492 3925 3295 2035 1988 1756 1451 194 140 1561 34784 3653 3605 --
NM_015250chr921756 742 11774 1231 11409
NM_015251chr1631610 1472 136 ------
NM_015252chr23826 599 252 ------
NM_015254chr862542 1006 664 639 180 127 ------
NM_015256chr51649 ------
NM_015260chr1931596 527 115 --11557 --
NM_015262chr101149 --1481 --
NM_015263chr153405 107 70 ------
NM_015264chr22104903 4866 4776 4021 3081 1907 1458 1354 1219 561 34656 1068 91 34205 1607 264 --
NM_015265chr262392 2337 2075 2042 308 49 --12179 22025 472
NM_015267chr121208 22198 692 1243 --
NM_015268chr31191 ------
NM_015269chr11610 ------
NM_015270chr1252152 1723 1652 880 58 ----1476
NM_015271chr433333 360 176 23542 290 ----
NM_015272chr1651987 1712 1435 1309 288 ----11658
NM_015277chr18378 57 44 --1272 --
NM_015278chr643218 2965 879 311 32609 2112 1013 12470 --
NM_015282chr262944 2770 2405 945 872 153 ------
NM_015284chr13513 476 340 21356 1298 11888 --
NM_015285chr1832201 2100 65 --22297 213 --
NM_015288chr552660 1529 654 178 84 12980 13863 12778
NM_015291chr1113385 3085 3034 2661 2419 2143 1089 824 818 756 632 11129 12818 --
NM_015292chr126772 762 295 249 151 31 ------
NM_015293chr62539 21 --1726 --
NM_015294chr1731145 926 727 ------
NM_015296chr1331238 1227 841 1168 ----
NM_015299chr1493373 1587 1251 1119 587 249 229 205 79 --23964 3700 33410 3322 1041
NM_015308chr112762 311 1182 ----
NM_015310chr8147426 5909 5846 5368 2381 2168 2024 1840 1366 1215 812 296 168 154 25796 201 36876 6667 1300 47376 7140 1723 1442
NM_015313chr1164855 4681 1910 1592 1156 582 11526 24849 714 --
NM_015315chr563251 2667 2245 1188 1157 574 --1342 --
NM_015317chr232388 1924 461 1804 12889 12411
NM_015321chr19144785 4743 3734 3653 3583 3441 3060 3034 1896 1782 1692 1349 1196 738 --14909 --
NM_015326chr152231 1080 732 608 196 ------
NM_015327chr111183 --1470 --
NM_015328chr792831 2689 2067 1238 1192 1169 705 549 273 --12191 --
NM_015329chr1952592 2490 1816 623 428 ------
NM_015335chr1272461 2282 2147 841 724 333 159 --1360 178
NM_015338chr2091939 1857 755 740 708 653 421 153 71 ------
NM_015339chr202852 305 --1821 --
NM_015343chr171128 ------
NM_015344chr821901 345 ------
NM_015346chr1431648 442 108 11284 11310 --
NM_015347chr1252934 2221 1961 1907 254 ------
NM_015349chr61923 1453 11003 --
NM_015353chr1772760 2609 2448 2404 2359 673 56 --11042 --
NM_015354chr91356 --1363 --
NM_015355chr1741744 503 330 219 ------
NM_015358chr211231 ------
NM_015359chr882852 2710 2623 2578 2346 1132 947 896 32977 2807 784 ----
NM_015361chr23837 744 376 1913 ----
NM_015365chrX53049 1261 564 286 229 34247 1375 763 23198 37 --
NM_015375chr144994 3795 965 506 ----13544
NM_015379chr71223 ------
NM_015382chr142808 627 ------
NM_015387chr21427 2626 321 ----
NM_015388chr61103 ------
NM_015393chr493601 3581 3430 2644 2346 1196 1154 714 219 23559 1070 --1698
NM_015396chr321381 88 1123 ----
NM_015397chr941418 1185 585 450 11869 1158 --
NM_015416chr123861 740 724 1918 ----
NM_015429chr3--21136 949 ----
NM_015430chr11248 36 ------
NM_015435chr821424 595 ----1462
NM_015436chr41313 ------
NM_015443chr1741032 615 519 453 11200 2277 64 --
NM_015446chr121458 1172 ------
NM_015447chr91245 2677 144 ----
NM_015455chr5114037 3994 3976 3539 3387 1141 794 620 608 340 224 12651 --11487
NM_015457chr111358 --134 --
NM_015458chr8105268 4973 4597 3624 1622 1509 1336 1177 1107 316 11016 11692 --
NM_015460chr341483 1425 303 205 ----1633
NM_015461chr18----2725 68 --
NM_015464chr72222 115 ------
NM_015466chr32220 185 ------
NM_015470chr22865 81 ------
NM_015472chr3185 1215 ----
NM_015472chr3185 1215 ----
NM_015481chr1231115 1032 837 ------
NM_015483chr74750 714 145 54 --1977 --
NM_015488chr281743 1465 1365 1302 1173 1156 624 516 --21736 1617 --
NM_015493chr1931868 664 142 1732 12133 --
NM_015497chr15172 1302 ----
NM_015508chr321319 581 --11024 --
NM_015514chr143623 411 195 ------
NM_015520chr392768 2585 2532 2524 2102 2089 1876 1863 1717 ----12130
NM_015530chr22720 103 ------
NM_015532chr1552786 2716 691 469 312 1227 --11874
NM_015534chr14963 901 805 90 --2812 155 --
NM_015535chr273687 3210 3067 2814 2691 1440 186 --33530 3053 223 --
NM_015541chr321070 97 ------
NM_015542chr1061248 1152 1122 1081 885 169 ------
NM_015548chr63240 158 116 ------
NM_015550chr763565 2977 2919 1181 540 506 13377 13303 --
NM_015553chr684686 4586 4268 4117 4067 3695 3587 3395 23260 1659 --11723
NM_015554chr1572860 2394 2178 1824 248 58 33 --12803 --
NM_015557chr1113635 3037 2619 2539 2375 1142 900 774 723 535 327 22698 2492 11174 --
NM_015559chr181692 ------
NM_015564chr573218 3175 3042 1414 1044 563 211 ------
NM_015567chr133927 818 30 21259 1018 ----
NM_015568chr2093976 2838 2816 2703 1624 692 248 187 112 33065 1362 880 34078 3957 3524 13841
NM_015569chr154671 4454 3110 1922 595 33146 1195 581 ----
NM_015570chr721289 726 21493 524 ----
NM_015571chr621781 1755 1172 ----
NM_015575chr243240 2424 1389 857 ----1103
NM_015576chr342378 2160 877 335 32659 1068 1017 21148 79 22013 1877
NM_015584chr173551 403 345 --11104 --
NM_015595chr36837 787 277 185 148 36 1420 ----
NM_015601chr103942 731 283 ------
NM_015602chr12464 209 11778 11343 --
NM_015605chr1061528 1137 1003 122 103 78 ------
NM_015607chr1--150 ----
NM_015609chr162894 2703 2122 1119 1053 657 22311 516 2791 694 --
NM_015610chr752320 1940 1875 442 372 22888 2623 21138 292 --
NM_015626chr1731098 1092 350 ------
NM_015630chr22256 80 1269 ----
NM_015635chr931894 1429 553 ----12203
NM_015640chr185188 4695 4513 4072 3999 1695 1368 59 23411 931 25170 446 --
NM_015641chr721090 50 ------
NM_015645chr111308 ------
NM_015646chr1241031 821 225 160 1877 ----
NM_015649chr194377 252 40 32 ------
NM_015652chr102491 58 ----1464
NM_015658chr15442 365 354 337 325 ------
NM_015660chr7--1205 ----
NM_015670chr171143 ------
NM_015678chr131676 --11373 --
NM_015686chrX32506 2436 2413 --12457 --
NM_015687chr6--1531 ----
NM_015694chr71111 ------
NM_015695chr661970 1758 818 653 506 68 ----1771
NM_015711chr194813 689 296 288 ------
NM_015714chr12364 297 ------
NM_015716chr171665 ------
NM_015719chr192818 693 ----1568
NM_015833chr2151969 1703 924 742 237 11603 12255 --
NM_015850chr882291 2038 1884 1678 1578 528 476 224 --1624 12137
NM_015852chr733463 2746 2227 ------
NM_015853chr111154 ------
NM_015855chr112906 683 ----1844
NM_015866chr111232 ------
NM_015872chr161483 1372 1359 1307 1245 1215 ------
NM_015878chr851983 1902 1892 1378 864 ------
NM_015879chr18198458 8285 7867 7118 6859 5513 2978 2755 2539 2448 2214 1970 1706 748 574 444 340 332 140 36937 6734 873 --1509
NM_015885chr114552 353 212 162 1791 ----
NM_015886chr8105700 4403 4167 3729 1882 1712 1412 934 738 80 --13626 --
NM_015888chr142441 1030 889 625 12701 ----
NM_015889chr221128 ------
NM_015891chr6--21802 164 ----
NM_015892chr10132190 2022 1907 1777 1542 1525 1504 825 797 479 250 115 71 --12476 --
NM_015898chr1932150 2070 2029 ------
NM_015902chr81601 ------
NM_015906chr184548 3547 3443 3043 1256 957 837 515 1214 ----
NM_015912chr842207 784 433 206 --22493 1569 11833
NM_015913chr13596 174 155 ------
NM_015915chr141281 ------
NM_015920chr152629 586 ------
NM_015933chr3147 ------
NM_015948chr61401 ------
NM_015955chr22438 46 1370 1329 --
NM_015975chrX3738 570 272 --11187 --
NM_015981chr583129 2788 1964 1185 1040 632 133 50 ------
NM_015984chr1236 30 ------
NM_015987chr12142 ------
NM_015990chr42888 714 11092 ----
NM_015994chr142502 155 1202 2630 236 --
NM_015995chr1585322 4993 3775 2004 1864 1052 528 321 --31444 661 309 --
NM_015999chr1162 ------
NM_016002chr1--178 ----
NM_016003chr752320 1940 1875 442 372 22888 2623 21138 292 --
NM_016009chr164560 4249 3228 1614 963 139 24258 1710 ----
NM_016018chr822306 730 --12002 --
NM_016022chr151049 367 287 223 95 --1326 --
NM_016032chrX21255 869 ------
NM_016037chr13805 393 30 1175 ----
NM_016045chr201741 21593 1240 ----
NM_016057chr1291294 1169 957 931 919 885 380 319 45 ------
NM_016060chr17----11113 --
NM_016061chr241339 1045 1023 270 ------
NM_016063chr61560 ------
NM_016072chr1232048 1868 1774 22293 2204 11914 --
NM_016073chr152425 154 ------
NM_016076chr152497 2075 1288 263 207 12868 12576 12880
NM_016083chr633754 3197 2924 23844 3648 13116 --
NM_016096chr821349 434 --11384 --
NM_016098chr61167 ------
NM_016118chr74762 445 233 31 --1957 --
NM_016124chr141278 1213 358 158 ------
NM_016125chr17----1575 --
NM_016127chr83723 618 569 ------
NM_016128chr3199 ------
NM_016129chr4179 ------
NM_016131chr242250 2154 2097 72 22263 327 ----
NM_016132chr1583077 2977 2637 1348 769 756 538 512 --12941 --
NM_016133chr2--1193 11135 --
NM_016141chr34744 228 215 57 --1813 --
NM_016144chr52562 53 1111 ----
NM_016147chr114939 877 163 38 ------
NM_016152chr321212 353 ------
NM_016156chr1182400 2272 2111 2083 1779 1745 885 350 22361 951 12050 1942
NM_016157chrX--187 ----
NM_016166chr15291 76 ------
NM_016169chr1042682 2650 1109 439 12562 13296 33271 981 543
NM_016192chr2--1206 ----
NM_016195chr10----2829 106 --
NM_016200chr7--129 ----
NM_016201chr372283 1704 1680 1464 330 211 47 --21858 1842 --
NM_016205chr431263 962 315 ------
NM_016206chr3148496 8468 7420 7198 7085 6736 6430 3610 2702 2422 2342 1838 568 225 13448 18474 --
NM_016211chr42136 101 ------
NM_016213chr151148 ------
NM_016216chr33614 600 200 ------
NM_016221chr541797 1640 841 450 --1328 --
NM_016226chr122134 108 ------
NM_016227chr131377 1060 62 ------
NM_016231chr1711377 164 ----
NM_016235chr1641360 1138 503 479 --11270 --
NM_016240chr851630 1574 1416 1304 493 --21244 1041 --
NM_016248chr13--13949 13351 1395
NM_016250chr142796 282 ------
NM_016252chr21908 --1861 --
NM_016256chr16162 ------
NM_016257chr163033 2497 1385 1311 1061 128 11119 ----
NM_016260chr2167617 7432 6875 6238 6202 5671 5584 5277 5220 5104 2913 2868 2327 2094 1557 165 26181 6014 27239 1569 --
NM_016261chr172660 503 1756 --173
NM_016270chr192489 346 ------
NM_016271chr18--31884 1836 572 ----
NM_016272chr2272761 2184 1071 1052 966 688 477 ------
NM_016275chr331992 197 32 11819 12776 --
NM_016277chr641640 1556 1357 98 21451 406 1143 --
NM_016281chr1211095 ------
NM_016284chr16--1899 ----
NM_016287chr131931 307 269 1217 ----
NM_016289chr221552 345 1876 ----
NM_016291chr3137 ------
NM_016300chr3--1131 ----
NM_016301chr121410 ------
NM_016303chrX2181 138 ------
NM_016308chr142092 1845 1764 605 ------
NM_016315chr221764 1716 1167 ----
NM_016316chr2--164 ----
NM_016322chr941030 126 85 43 --1942 --
NM_016329chr31391 --1128 --
NM_016333chr161498 ------
NM_016337chr141195 ------
NM_016339chr1731552 601 213 --161 --
NM_016351chr71502 ------
NM_016352chr721087 191 11427 ----
NM_016374chr111115 11550 127 --
NM_016374chr111115 11550 127 --
NM_016376chr1793829 3548 3381 3053 1453 752 468 287 58 23839 1500 11546 --
NM_016377chr651546 1442 449 54 29 11089 1718 --
NM_016396chr1561027 1007 368 289 265 93 1709 ----
NM_016403chr112565 188 ----1611
NM_016422chr1162701 2179 804 475 325 274 ----1681
NM_016424chr1721998 1924 1557 ----
NM_016431chr225761 301 291 236 133 ------
NM_016436chr2042711 2705 1716 271 32687 2171 2107 ----
NM_016441chr231951 1514 148 12393 ----
NM_016453chr3179 --1431 1621
NM_016470chr201107 ------
NM_016472chr1441258 1225 611 339 ------
NM_016485chr641572 1411 785 381 1351 --11832
NM_016486chr14194 119 77 37 ------
NM_016505chr11580 ----1224
NM_016507chr1732516 829 105 12905 --1973
NM_016513chr683535 2937 2622 1497 1447 807 585 541 ----11490
NM_016516chr21774 --2354 328 --
NM_016519chr43212 95 29 ------
NM_016525chr94776 651 241 147 ------
NM_016526chr1162449 2224 2167 2105 1717 755 --11788 1270
NM_016529chr136898 892 869 270 216 198 1841 11280 --
NM_016530chr1563837 3146 2574 670 603 346 13373 1294 --
NM_016531chr483631 3402 3033 829 617 580 416 55 --13643 --
NM_016538chr171471 --2396 35 --
NM_016542chrX31553 1265 1249 11576 --1112
NM_016545chr12621 342 ------
NM_016559chr351111 997 580 560 163 21371 432 ----
NM_016569chr1241528 1004 310 109 11146 ----
NM_016578chr111492 ------
NM_016587chr72208 162 ------
NM_016588chr61103 ------
NM_016603chr522068 485 21430 599 ----
NM_016604chr531264 79 27 --1451 --
NM_016605chr592717 2711 2449 2042 2007 1949 944 914 336 ----1639
NM_016607chrX31664 680 255 ------
NM_016612chr84273 117 93 41 ------
NM_016613chr452575 2343 2204 1967 1746 1559 ----
NM_016617chr1331719 695 423 12126 ----
NM_016618chr21401 ------
NM_016620chr131350 355 331 ------
NM_016621chr11104045 4015 3711 3623 2959 2814 1772 1650 668 244 --13387 --
NM_016623chr82518 121 148 ----
NM_016626chr181496 ------
NM_016628chr101759 1341 ----
NM_016654chr15--21355 207 1435 --
NM_016656chrX1102 ------
NM_016733chr22154 21481 215 ----
NM_016818chr211162 1520 ----
NM_016821chr32413 61 ------
NM_016823chr1721167 962 11078 1970 --
NM_016824chr1031853 1508 232 ------
NM_016827chr33717 539 34 ------
NM_016831chr131874 1718 712 12253 12408 --
NM_016834chr1763708 2699 1480 1153 912 91 --2980 740 12653
NM_016835chr1763708 2699 1480 1153 912 91 --2980 740 12653
NM_016836chr21108 ------
NM_016839chr21108 ------
NM_016841chr1763708 2699 1480 1153 912 91 --2980 740 12653
NM_016929chr61317 --180 --
NM_016936chr1661765 1539 1516 838 230 90 11629 ----
NM_016937chrX2346 56 ------
NM_016938chr111400 ------
NM_016946chr183638 2622 2493 1389 555 333 76 30 ------
NM_016952chr1194111 3989 3765 3640 3094 2868 1474 862 239 --11457 --
NM_017409chr123773 757 580 ------
NM_017410chr1211191 ------
NM_017412chr831000 66 58 --1906 --
NM_017420chr1433195 1358 143 21406 108 ----
NM_017423chr452134 1375 796 280 179 11797 1100 --
NM_017447chr2134375 482 445 ------
NM_017449chr131618 1066 49 ------
NM_017450chr173516 458 154 ------
NM_017452chr2031157 974 578 --11221 --
NM_017453chr2031157 974 578 --11221 --
NM_017454chr2031157 974 578 --11221 --
NM_017455chr152734 65 ------
NM_017456chr1762035 1525 494 285 98 27 ------
NM_017481chr112246 36 ------
NM_017488chr221172 401 --11235 --
NM_017491chr44783 414 200 162 --1151 --
NM_017519chr631020 118 110 ------
NM_017548chr331537 812 81 12181 1564 1250
NM_017550chr1941084 739 122 66 ------
NM_017551chr1092630 2609 2405 2264 2195 1057 659 443 366 ------
NM_017563chr386387 5491 5462 4266 2320 857 599 366 25337 4613 --36326 1482 359
NM_017575chr1741605 1387 1138 445 ------
NM_017580chr1072294 1882 1741 1595 956 921 169 144 ----
NM_017582chr151796 1713 1199 126 87 21462 1302 11267 --
NM_017589chr11124 ------
NM_017593chr43330 322 315 ------
NM_017594chr983197 3045 2220 1341 1307 1073 922 690 12953 23299 1014 --
NM_017600chr122438 214 ------
NM_017602chrX3582 201 108 1929 ----
NM_017607chr19145 ------
NM_017610chr1561902 1622 1422 243 222 124 --1270 --
NM_017617chr92584 64 31606 1255 1218 ----
NM_017626chr1021659 1178 --1554 --
NM_017628chr475192 4214 2105 2083 1982 1408 1239 23394 3293 1939 --
NM_017629chr141448 625 497 378 --2584 148 --
NM_017632chr41116 1421 ----
NM_017633chr663705 3120 2574 2388 1559 345 ------
NM_017634chr821875 1560 --31716 1660 1245 --
NM_017635chr11--21415 1378 ----
NM_017637chr9239365 9336 9132 9085 8818 8761 8370 8246 8158 7786 7486 6577 6455 6018 3698 3415 2709 2610 2341 1937 1781 1394 133 35841 3366 2582 22533 1001 --
NM_017640chr61783 --2641 245 --
NM_017641chr121467 21070 1017 149 --
NM_017643chr1772906 2877 2052 974 904 841 622 --11239 --
NM_017649chr1061216 500 411 381 318 306 --11054 --
NM_017650chr785835 4297 2218 1492 1373 605 561 415 22202 159 1567 --
NM_017657chr21756 ------
NM_017658chr1462920 1848 1017 896 251 237 14647 24163 3873 11586
NM_017660chr1963119 2891 2709 2341 315 263 --12722 --
NM_017661chr1521268 247 21301 974 ----
NM_017667chr71493 ------
NM_017670chr116874 726 327 202 182 41 --1747 --
NM_017679chr173262 196 89 ------
NM_017680chr9--1723 --1694
NM_017684chr1541660 485 435 67 11696 ----
NM_017693chr1311286 ------
NM_017694chr241577 1459 287 254 ------
NM_017700chr41121 --3402 228 127 --
NM_017709chr194160 3954 3552 2808 1378 1348 1193 311 120 --13280 --
NM_017715chr73745 623 567 --1509 --
NM_017719chr362348 2301 1784 807 537 312 ------
NM_017730chr32685 157 --1167 --
NM_017737chr142199 1858 700 359 --11686 --
NM_017744chr162119 1703 1522 955 447 126 21955 61 11499 --
NM_017745chrX1665 179 ----
NM_017752chrX31991 1773 648 ------
NM_017753chr91806 ------