TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3678-5p
miRNA Sequence: UCCGUACAAACUCUGCUGUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000337chr566630 2107 1262 132 122 116 ------
NM_001024647chr1237308 2420 1460 --11687 17676
NM_001025079chr343186 1276 560 473 ----23192 1316
NM_001777chr343186 1276 560 473 ----23192 1316
NM_002006chr445756 5546 4318 3691 --14323 --
NM_002254chr291951 1939 1931 1923 1887 112 106 96 90 ------
NM_005121chr1753416 2965 2781 1246 1210 --11231 1399
NM_005613chr161748 1512 625 539 527 446 ------
NM_006047chr2043238 2819 512 189 --12589 13119
NM_006315chr494164 4057 3765 3642 3515 3284 2775 1762 133 --13503 --
NM_007038chr2175780 5529 5384 4396 4191 2374 944 ------
NM_013255chr748837 1284 1147 543 ----18703
NM_014877chr1796904 6490 5673 2285 1871 1720 652 582 444 ------
NM_015458chr865257 5028 4967 922 630 152 --14946 --
NM_015560chr342597 467 253 141 12707 --12186
NM_015564chr53518 454 259 ----12468
NM_015886chr844887 1307 364 344 --14016 1372
NM_015906chr133800 3753 3292 ----11511
NM_016507chr1742955 2389 2383 2371 ----12520
NM_017813chr885461 4751 4304 3903 1504 1465 1033 648 --11266 --
NM_018227chr433143 494 311 ----12769
NM_018243chr443686 497 336 293 ----11288
NM_018429chr52880 330 --1731 11867
NM_019044chr234554 1890 23 ----1315
NM_020673chr2037538 2826 2047 --14908 1272
NM_021061chr831803 641 579 ----1475
NM_021072chr542572 2361 921 758 ----12480
NM_022456chr1237308 2420 1460 --11687 17676
NM_022901chr931878 1834 1800 11728 11810 --
NM_024744chr241843 397 389 381 ------
NM_025138chr132478 274 --11171 1210
NM_032505chr342459 2216 2038 878 ----12136
NM_033020chr133800 3753 3292 ----11511
NM_130831chr342597 467 253 141 12707 --12186
NM_130832chr342597 467 253 141 12707 --12186
NM_130833chr342597 467 253 141 12707 --12186
NM_130834chr342597 467 253 141 12707 --12186
NM_130835chr342597 467 253 141 12707 --12186
NM_130836chr342597 467 253 141 12707 --12186
NM_130837chr342597 467 253 141 12707 --12186
NM_138459chr642767 2591 202 170 ----22669 208
NM_152838chr2043238 2819 512 189 --12589 13119
NM_170719chr132478 274 --11171 1210
NM_175623chr1237308 2420 1460 --11687 17676
NM_175624chr1237403 2515 1555 --11782 17771
NM_175625chr1237403 2515 1555 --11782 17771
NM_198793chr343182 1272 556 469 ----23188 1312
NM_213589chr275316 3976 1203 667 205 199 132 --13789 --