TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3679-3p
miRNA Sequence: CUUCCCCCCAGUAAUCUUCAUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001017440chr747742 7202 1840 1286 33193 2555 548 25410 937 25631 1216
NM_001256chr1732072 244 232 ----22939 1141
NM_002886chr345129 3250 798 351 24615 3871 --2809 354
NM_003412chr312397 --6510 504 497 476 470 258 --
NM_006237chr1382197 522 335 263 241 121 59 37 1234 3819 256 243 2338 272
NM_006546chr1756088 5632 5041 4709 4062 45300 4409 646 637 36551 5486 5434 15635
NM_014891chr751640 1038 291 174 167 --2188 179 --
NM_015550chr723423 1222 ----22855 2229
NM_015686chrX61898 1755 1660 1008 378 65 52156 2016 830 752 391 2123 67 2680 115
NM_020699chr1135164 5130 5110 5103 4463 3932 3717 3678 3672 2067 2026 723 607 41441 849 711 301 --11598
NM_021964chr326597 5252 26603 6591 --24663 495
NM_022648chr284017 3797 3584 1217 733 162 51 36 33731 416 139 23115 371 24432 169
NM_022758chr621152 56 12703 11138 2320 301
NM_024294chr621152 56 12703 11138 2320 301
NM_031468chr747742 7202 1840 1286 33193 2555 548 25410 937 25631 1216
NM_052906chr22174347 4338 3792 3705 3664 3308 3229 2040 1765 1685 1152 1064 789 517 354 306 83 23525 3250 44131 4089 318 58 1520
NM_145313chr1031284 1201 219 1231 1225 --
NM_145320chr723423 1222 ----22855 2229
NM_145321chr723423 1222 ----22855 2229
NM_145322chr723423 1222 ----22855 2229
NM_175861chr12153 25665 538 --25791 659
NM_213589chr245040 3872 3375 1562 1644 11673 24761 2196