TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3680-5p
miRNA Sequence: GACUCACUCACAGGAUUGUGCA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001010867chr1146585 5284 4589 1861 1830 1816 1803 1752 1052 860 753 537 241 191 12551 26191 1617 --
NM_001030007chr1663934 3842 3427 2660 1528 1365 --33482 3478 3281 23349 1026
NM_001039547chr3127860 7642 7599 6535 6118 5738 5703 5438 2276 2108 1147 424 21166 1011 11762 --
NM_001128chr1663934 3842 3427 2660 1528 1365 --33482 3478 3281 23349 1026
NM_006599chr1657711 3313 2257 2143 2100 ----22014 1170
NM_015375chr1104074 3390 3212 1958 1569 1239 1165 958 915 547 --11199 24482 1755
NM_022048chr15106372 5497 5391 5197 5112 4683 4071 3907 1882 394 --1176 14834
NM_080618chr202841 103 ----2922 370
NM_130847chr11104201 3971 2295 1834 1387 1341 942 504 493 487 --14597 --
NM_138713chr1657711 3313 2257 2143 2100 ----22014 1170
NM_138714chr1657711 3313 2257 2143 2100 ----22014 1170
NM_145259chr287068 5587 4816 4556 2056 2012 552 546 --32084 1223 1219 11228
NM_173214chr1657711 3313 2257 2143 2100 ----22014 1170
NM_177538chr2167974 7814 7293 7085 6765 6733 5572 3180 2912 2508 2461 2351 2312 2073 1739 1023 --27171 6916 --
NM_182515chr1996284 5516 4768 4497 4223 2628 1017 492 66 12541 --11145
NM_199462chr1104074 3390 3212 1958 1569 1239 1165 958 915 547 --11199 24482 1755