TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3682-3p
miRNA Sequence: UGAUGAUACAGGUGGAGGUAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr1163560 3499 2931 1096 880 853 22549 2467 ----
NM_000092chr234179 2937 82 34257 4037 3292 24325 3708 11086
NM_000112chr5125511 5388 5024 4581 4330 2126 1808 1400 1247 1040 986 122 24506 1526 11412 --
NM_000115chr1372521 2196 2023 2009 1848 904 831 22670 609 22323 932 2490 479
NM_000129chr631486 1108 1100 1278 --1288
NM_000165chr641337 1162 1055 691 ----1672
NM_000216chrX113650 3598 3581 3484 3439 3352 2528 1549 962 747 492 ----12746
NM_000259chr15116380 6354 5724 5682 4422 4387 4081 2134 861 456 109 16140 ----
NM_000267chr1783397 3232 3125 2557 1077 778 744 464 11280 ----
NM_000304chr172839 717 ----1708
NM_000337chr556156 5341 4379 422 267 11321 12178 25485 5376
NM_000369chr1481772 1695 650 612 533 515 288 181 --11665 --
NM_000448chr1173268 3020 2152 2049 698 689 309 --11233 --
NM_000555chrX87880 7141 6112 5158 5086 3016 2585 1376 --35637 4888 49 --
NM_000618chr1296576 6453 6131 5188 4745 2553 2192 1219 710 16521 11307 --
NM_000618chr1296576 6453 6131 5188 4745 2553 2192 1219 710 16521 11307 --
NM_000633chr1874903 4471 4376 3991 1489 1444 435 --33460 772 224 --
NM_000671chr451338 1181 1021 321 134 --1490 1295
NM_000719chr1286626 6373 5403 4861 2102 2017 1717 893 --26503 992 --
NM_000724chr1031632 602 128 --11587 11677
NM_000809chr4148912 8886 8656 8617 8187 7940 7850 7737 6093 2423 1958 1780 1509 416 38954 1266 1141 18678 58875 7688 7306 7233 6392
NM_000813chr554428 2142 669 491 421 25347 5161 25438 2050 --
NM_000814chr1594150 4060 3440 3285 1184 1087 1069 799 356 --42952 976 391 346 1414
NM_000838chr642075 2045 1932 1804 1750 12571 12621
NM_000866chr32656 408 --1687 21272 704
NM_000885chr282170 2147 2061 1916 1614 593 585 129 1503 ----
NM_000902chr341984 787 572 213 --13097 11089
NM_000910chr431527 1261 729 ----1316
NM_000926chr11179405 7454 6201 2978 2592 2277 2219 2165 1566 1407 1328 1110 1004 991 375 330 280 47480 3609 2773 2581 37860 2227 2012 39245 8747 659
NM_000950chrX63537 2971 2347 1436 1153 30 21046 170 ----
NM_001001419chr594597 4513 4325 4298 4030 2046 733 715 229 13700 34802 3901 1927 --
NM_001001420chr594597 4513 4325 4298 4030 2046 733 715 229 13700 34802 3901 1927 --
NM_001001433chr2031973 619 337 ----11205
NM_001001481chr843009 2418 590 64 --22984 1082 13190
NM_001001664chr283828 3739 3238 2873 2723 1331 275 217 --13861 --
NM_001003652chr18108611 7654 6235 6099 5492 1864 1463 700 321 54 1790 11629 --
NM_001003674chr18126752 6551 6240 5375 5211 5012 4811 2642 2430 956 414 407 27078 6428 --16106
NM_001003675chr18126752 6551 6240 5375 5211 5012 4811 2642 2430 956 414 407 27078 6428 --16106
NM_001003712chr1283995 3981 3656 2863 2811 2535 534 510 --11112 --
NM_001004317chr6114400 4259 4027 3719 3474 2751 1657 1445 810 461 178 ------
NM_001008239chr1833628 1086 78 12865 --23026 1420
NM_001008495chr882113 1884 1468 892 409 305 215 160 ------
NM_001008539chr864162 3296 1559 319 93 26 25292 1645 --176
NM_001008925chr4103475 3197 2920 2360 842 476 361 266 255 247 --12369 23056 773
NM_001010000chr1863297 2881 734 648 33 26 12770 22410 2255 --
NM_001010891chr5136600 6292 5050 4818 4403 4243 2221 1616 1572 1486 974 806 150 --12276 --
NM_001010895chr961990 1982 1818 1786 1369 605 --21661 624 11713
NM_001011513chr4113635 3413 3357 2748 2677 2648 1221 894 851 829 199 --13848 --
NM_001011666chr775728 4997 4806 4209 2249 523 140 25823 1113 12270 15601
NM_001012393chr1154929 4172 1066 871 226 1303 2503 446 --
NM_001012761chr542706 1972 623 66 1868 12205 12115
NM_001013659chr1944548 2019 1120 743 14903 21654 375 11046
NM_001014797chr1047053 6946 6175 5490 31734 1533 1514 28153 3077 13007
NM_001015882chr93857 706 45 ----1445
NM_001018065chr9106078 6038 5460 4211 2128 1956 1856 1721 1280 873 35267 4949 530 ----
NM_001018066chr9106078 6038 5460 4211 2128 1956 1856 1721 1280 873 35267 4949 530 ----
NM_001024956chr11105867 5274 4911 4344 3711 2034 1441 1141 737 372 13614 53816 1396 587 117 48 --
NM_001025068chr321809 349 ----1627
NM_001025069chr321809 349 ----1627
NM_001025076chr1074475 1485 1167 994 373 285 117 25348 4370 35958 5350 2409 --
NM_001025077chr1095833 4609 2843 2525 2352 1731 1643 1475 1097 26706 5728 27316 6708 --
NM_001025252chr862198 1284 1045 710 595 294 23078 2483 --2823 663
NM_001025253chr862198 1284 1045 710 595 294 23078 2483 --2823 663
NM_001025580chrX64310 1206 723 699 269 203 2156 143 13391 12877
NM_001029858chr662362 1013 303 291 282 58 --22539 797 11113
NM_001029875chr54803 492 398 327 ----1479
NM_001030055chr1494608 4001 3833 3317 1639 1582 1574 1398 1385 13401 1276 --
NM_001031700chr472022 1844 1701 1600 671 311 282 --2992 804 --
NM_001031709chr101341 1385 1126 1124
NM_001032394chr642728 885 699 22 ----2326 98
NM_001032999chr2045250 4279 897 847 1100 --21141 828
NM_001033045chr274430 4092 3511 1618 961 717 257 11027 21735 1622 --
NM_001033057chr352112 1512 416 359 193 2750 297 --11778
NM_001033117chr324798 3932 21949 1825 11058 21828 303
NM_001037174chr242263 2250 1863 1841 1915 --21990 321
NM_001037334chr1862302 616 376 244 185 56 11559 --12069
NM_001037535chrX71445 1223 594 532 255 126 71 11006 --1361
NM_001037536chrX71445 1223 594 532 255 126 71 11006 --1361
NM_001037540chrX71445 1223 594 532 255 126 71 11006 --1361
NM_001037954chr1162791 1226 1110 1084 379 359 13453 1332 --
NM_001039091chrX51413 891 457 248 169 --11335 1925
NM_001039547chr3127071 7051 6827 6065 5844 5236 2639 2117 1548 1409 1335 526 ------
NM_001039585chr162984 1373 932 891 859 548 --13564 1162
NM_001039693chr293734 3102 2855 2803 2781 2693 1330 1235 386 --11165 1325
NM_001039709chr2045250 4279 897 847 1100 --21141 828
NM_001039840chrX116027 5444 5124 4864 4711 3993 2268 1752 1520 358 36 24221 274 36057 1456 803 --
NM_001039937chr1383830 2567 1543 831 568 447 264 149 ------
NM_001040179chr65819 809 706 271 258 ----158
NM_001040202chr4102574 2473 2407 2083 1851 1816 1727 765 531 356 11789 ----
NM_001040284chr1675932 5656 5224 4132 1952 1333 850 --34634 1295 637 21742 1434
NM_001040429chr1343336 2776 2652 661 1467 --1604
NM_001040441chr164196 1393 1132 585 525 245 --24875 3431 1608
NM_001040665chr783632 3404 3050 1266 438 210 174 95 --54939 4851 1912 1007 962 --
NM_001040712chr962822 2683 2449 1254 832 701 12801 1581 12341
NM_001042355chr1694241 3912 3878 3277 1920 1863 1248 908 393 11234 21349 1184 15407
NM_001042412chr1694241 3912 3878 3277 1920 1863 1248 908 393 11234 21349 1184 15407
NM_001042413chr9113861 3617 3564 3337 3275 2947 2820 2751 2678 1425 1182 42638 1508 697 180 ----
NM_001042473chr104776 389 317 293 21962 595 ----
NM_001042492chr1783397 3232 3125 2557 1077 778 744 464 11280 ----
NM_001042550chr951871 1301 640 586 467 1348 --1227
NM_001042555chr1274636 4409 3302 1758 1401 1321 665 23590 1723 11814 14325
NM_001042599chr2107790 6892 6404 6195 6055 4902 2239 2132 1288 853 34938 2628 1619 47379 2023 1631 1544 15999
NM_001042603chr1235287 4892 4399 161 24601 665 24599 1671
NM_001042604chr3124488 4408 3654 3542 3410 1667 1484 1477 1471 1086 841 320 1983 1396 --
NM_001042749chrX21400 1390 1701 --11975
NM_001042750chrX21400 1390 1701 --11975
NM_001042751chrX21400 1390 1701 --11975
NM_001044385chr273786 3681 2707 2620 1572 478 138 1199 21582 201 23514 1400
NM_001046chr592898 2641 2367 2200 2001 919 806 704 689 ------
NM_001099678chr3136407 5784 5637 5382 5157 5083 4526 4429 4379 2287 1825 1045 459 34227 1392 363 1631 --
NM_001106chr3179553 9306 8083 7823 7014 6495 6480 3480 3297 3108 1740 1491 1243 176 164 155 137 38318 3608 932 27546 3401 11655
NM_001113490chrX63015 2561 2356 961 338 50 33392 1379 29 13236 --
NM_001153chr22704 150 ----282 79
NM_001167chrX45231 5106 4620 321 14957 21360 196 16423
NM_001173chr1494608 4001 3833 3317 1639 1582 1574 1398 1385 13401 1276 --
NM_001198chr641777 1536 373 228 --2633 386 1903
NM_001201chr453214 2480 2432 1320 356 140 33935 2406 1052 --
NM_001204chr2157455 7283 7174 5999 5826 4905 2687 2058 1447 1397 1371 1218 1090 693 43 36147 5278 1624 57589 5786 5641 2499 471 --
NM_001427chr742138 1579 1441 331 --1152 11452
NM_001438chr133639 2276 201 12507 1792 22431 1141
NM_001449chrX31269 1157 300 --11283 21281 953
NM_001527chr6104668 4657 3956 3885 3480 808 403 346 318 247 134 1863 --
NM_001621chr772996 2886 2501 1920 859 646 445 13042 ----
NM_001621chr772996 2886 2501 1920 859 646 445 13042 ----
NM_001695chr883765 3706 3183 1650 1137 899 593 294 ----11458
NM_001701chr981310 1257 1242 1147 469 423 228 217 ------
NM_001742chr781855 1728 1686 1377 1255 1190 226 41 --1104 11197
NM_001858chr664369 3748 1993 926 278 80 23279 1231 23281 431 14424
NM_001977chr441674 1529 646 450 11425 2477 291 --
NM_002025chrX128825 8464 8108 7122 6471 6028 2994 2096 1768 1229 1218 1086 18247 37484 2370 1455 18160
NM_002035chr1863862 3475 3467 2951 2943 182 22847 306 12849 --
NM_002092chr475077 4133 3955 3874 1853 1409 1379 11511 14506 13388
NM_002126chr17104023 3832 3025 3013 2938 2921 1506 1198 576 247 23483 3187 ----
NM_002158chr263543 3487 2781 965 902 637 --11272 --
NM_002210chr283262 3223 3166 2569 2559 2217 778 56 12513 ----
NM_002214chr765691 5461 4529 4457 4443 1604 25441 4296 34656 4481 1037 34479 923 824
NM_002223chr1232890 2840 2631 13905 --13238
NM_002264chr364261 4175 3840 3168 1656 1223 23802 3469 14813 23778 3172
NM_002270chr585022 4973 4692 4228 4164 3837 2254 329 15216 25218 4463 --
NM_002310chr5136601 6590 5995 5774 5464 5260 5010 4647 4216 1172 1079 870 822 14708 36413 4318 1489 --
NM_002336chr1273571 3361 3331 1567 1376 1082 927 13907 13255 13659
NM_002381chr22705 111 ----11004
NM_002448chr41753 --1745 1743
NM_002545chr1154929 4172 1066 871 226 1303 2503 446 --
NM_002577chr353418 2904 1314 740 274 --11265 12830
NM_002581chr9105677 5110 5095 5082 4917 4417 1915 1856 1738 749 21405 641 25448 1207 --
NM_002645chr1152949 2791 2682 2261 2170 11973 1857 --
NM_002655chr8105025 5016 4584 4428 3700 3561 2057 1993 1462 600 --11122 --
NM_002677chr872310 1967 1126 728 437 246 194 12009 136 11044
NM_002719chr141907 --12167 11733
NM_002731chr172768 2454 2266 2034 1925 454 141 1761 ----
NM_002737chr1776705 5163 1326 1291 755 721 191 16430 26223 657 --
NM_002740chr372754 2667 1813 1770 912 387 371 22777 933 ----
NM_002765chrX51413 891 457 248 169 --11335 1925
NM_002822chr1251744 1658 1519 674 73 --21208 735 --
NM_002834chr1273910 3856 2987 2864 2516 2489 237 ----24054 3811
NM_002837chr1253607 1542 971 936 169 24146 3030 12979 --
NM_002839chr962822 2683 2449 1254 832 701 12801 1581 12341
NM_002858chr161119 971 510 491 472 174 21099 391 ----
NM_002886chr3104754 4725 4475 4073 3731 1539 1466 1430 1310 1203 13823 13398 15114
NM_002977chr283331 3261 2857 2503 953 848 394 383 --23270 311 --
NM_003034chr12178006 7609 7591 7098 6732 6719 5096 3159 3129 3100 2752 2599 2418 1894 1850 787 465 --37322 5934 2281 17106
NM_003042chr362209 2140 2126 1580 1385 287 ----11998
NM_003046chr864162 3296 1559 319 93 26 25292 1645 --176
NM_003048chr242847 1960 1084 232 ----12115
NM_003081chr202819 759 --2138 74 11123
NM_003099chr1555020 2578 2032 1904 1517 --26567 1582 22037 739
NM_003108chr276411 5449 4944 4809 4617 1513 287 14642 ----
NM_003112chr762821 2499 2251 1262 1186 291 22798 2416 13118 12292
NM_003199chr1855208 3775 2124 1973 823 34108 1415 172 31112 242 65 11918
NM_003257chr1531309 416 78 11366 --1274
NM_003262chr365205 4376 4007 1228 776 177 --11923 24316 1034
NM_003274chr2152935 2115 1918 1052 731 22823 771 --1136
NM_003292chr171953 908 863 624 615 369 153 2761 39 1392 --
NM_003298chr355726 4720 4119 579 553 --11925 --
NM_003392chr374365 4119 1296 586 183 174 165 13679 ----
NM_003483chr121876 ----22889 2104
NM_003566chr1253477 2631 2342 2292 903 --1193 1401
NM_003590chr283870 3270 3243 3190 2858 2839 1161 215 22467 73 ----
NM_003607chr184122 3487 3413 3251 2799 1685 1487 1285 --24054 3436 13559
NM_003615chr3123947 3673 3541 3530 3316 3308 1326 1077 880 392 89 59 --11157 --
NM_003617chr175017 4755 4419 4385 614 584 26 --23872 3804 1974
NM_003626chr1141360 1017 508 473 1399 --1402
NM_003663chr353263 3029 2668 855 754 12734 12736 --
NM_003722chr372624 2551 1952 1848 1089 627 496 ------
NM_003763chr2031973 619 337 ----11205
NM_003816chr85941 581 340 251 229 1493 21405 1089 1386
NM_003822chr163121 2964 2353 2268 2096 923 ----11283
NM_003913chr654146 3267 2659 1405 952 13439 34366 4027 3768 --
NM_003930chr772259 1746 1586 1579 532 438 375 12216 --12338
NM_003966chr5127780 7553 6744 6211 6106 6084 6010 5987 5397 5025 1358 1022 35503 5410 1966 26607 6091 --
NM_004087chr331642 679 178 21634 715 --21308 481
NM_004093chr1363164 3110 2978 2703 2304 2289 11245 --12504
NM_004113chr32749 717 11739 --21561 592
NM_004124chr1493232 2920 2680 2414 1331 1046 697 418 165 13354 13462 1404
NM_004136chr1583159 3150 2624 1017 1006 927 590 528 1890 22600 2539 23308 840
NM_004171chr11138984 8407 8236 6913 6637 6528 3738 3359 3136 1589 1518 975 228 23216 965 11050 29125 6256
NM_004232chr1863781 3072 2841 2587 1237 819 2268 132 ----
NM_004274chr14103223 3068 3029 2971 2665 2505 2153 646 229 32 13145 --22134 1269
NM_004337chr85815 689 369 303 287 1633 ----
NM_004338chr18126752 6551 6240 5375 5211 5012 4811 2642 2430 956 414 407 27078 6428 --16106
NM_004342chr772354 1430 774 757 591 441 109 1265 --1150
NM_004464chr494203 3877 3184 2927 2766 1728 1366 500 472 --24267 3978 --
NM_004504chr272789 2666 2505 621 430 400 220 --11084 --
NM_004612chr9104489 4032 3972 3751 3493 1653 1513 798 585 325 13334 ----
NM_004666chr671281 1160 1109 978 351 306 166 --21334 85 --
NM_004726chrX94986 4411 4177 4153 3825 2026 617 587 83 34196 220 199 ----
NM_004734chr1343138 3076 2817 2273 43210 2874 2862 1074 --12837
NM_004796chr1442316 2012 708 261 ----12056
NM_004815chr174868 3960 3604 1659 917 698 209 --24640 1132 23527 3000
NM_004857chr1434672 3411 1121 11162 23387 101 13385
NM_004866chr564614 4449 3508 3322 1976 767 --24648 536 --
NM_004904chr775728 4997 4806 4209 2249 523 140 25823 1113 12270 15601
NM_004932chr531733 1711 1408 11553 11444 21529 409
NM_004972chr93735 326 78 --1863 192
NM_004985chr12104498 4365 3916 1603 1080 1068 746 651 593 352 --33476 1816 506 --
NM_005056chr1235531 5136 4643 1305 24845 909 24843 1915
NM_005065chr1485211 4345 3706 3405 3296 1179 1148 1029 13481 1997 --
NM_005079chr862198 1284 1045 710 595 294 23078 2483 --2823 663
NM_005093chr2045250 4279 897 847 1100 --21141 828
NM_005151chr1862302 616 376 244 185 56 11559 --12069
NM_005156chr985395 4460 3632 1618 1062 1050 912 530 --13331 --
NM_005160chr22126089 6046 5958 5630 5584 5413 5248 4868 2192 1045 688 664 14190 16595 11226
NM_005188chr11138120 8083 7416 3199 2446 2270 1766 1445 872 783 654 508 192 16175 ----
NM_005197chr1496135 5941 5627 5239 5051 4663 742 408 264 11846 ----
NM_005233chr362405 894 874 599 310 59 --1179 --
NM_005235chr2107790 6892 6404 6195 6055 4902 2239 2132 1288 853 34938 2628 1619 47379 2023 1631 1544 15999
NM_005238chr1163508 2442 652 616 318 305 13186 1836 --
NM_005259chr261256 1169 1064 529 429 420 --11337 --
NM_005359chr18106134 5948 5804 5051 4057 2421 1612 1551 1486 275 --1349 --
NM_005433chr1852184 1083 470 420 303 11998 --11977
NM_005475chr1232887 2129 1051 22921 401 --13188
NM_005502chr9113180 3064 2851 2772 2750 2703 1250 968 761 541 271 --23014 2905 --
NM_005504chr12126578 6411 6345 5598 5022 4568 4441 2513 2363 1343 946 793 25828 180 12243 25543 4699
NM_005509chr581767 1555 1392 496 258 244 234 73 ------
NM_005596chr946155 5864 1898 1702 --11585 11583
NM_005665chr194661 4420 3869 3640 3194 1506 1083 929 49 --11496 --
NM_005668chr564596 3959 3901 3546 1206 1189 33863 3370 286 14608 11086
NM_005746chr741700 1051 685 627 ----12421
NM_005759chr274636 4523 3276 3084 2937 196 55 21688 1337 23421 934 --
NM_005795chr282578 2416 2064 1863 1162 850 561 110 ----1713
NM_005898chr1132690 2559 221 --31262 827 80 --
NM_005901chr18108611 7654 6235 6099 5492 1864 1463 700 321 54 1790 11629 --
NM_005903chr594597 4513 4325 4298 4030 2046 733 715 229 13700 34802 3901 1927 --
NM_005907chr651676 1543 599 274 180 --1246 2521 149
NM_005935chr474845 4779 4018 3339 1411 382 166 --11511 14956
NM_005941chr8103712 3107 2900 2878 2716 2585 1601 1152 846 236 ----13083
NM_006055chr273147 2991 2639 2484 2390 691 386 22542 165 31129 560 167 12142
NM_006080chr772784 2635 2461 2133 942 564 313 22476 842 12916 --
NM_006095chr4104445 4422 3355 3252 3223 3168 2784 1649 893 154 34158 3060 843 ----
NM_006106chr1133237 909 338 --11199 1574
NM_006154chr1582921 2616 2347 2102 1961 960 519 408 1783 ----
NM_006166chr1292634 2581 2224 1685 1669 954 560 522 440 11954 ----
NM_006203chr572000 1783 1426 880 622 602 162 22155 1030 2189 99 --
NM_006226chr241399 981 482 364 ----1988
NM_006241chr341904 918 285 117 2873 635 --1230
NM_006251chr562906 1273 1181 1011 332 189 --23394 2683 --
NM_006252chr1107117 7047 4994 4838 4707 3014 3005 2523 2492 477 15430 15211 --
NM_006283chr8104942 4238 3854 1785 1761 1755 1682 938 311 63 14479 ----
NM_006287chr242692 2088 508 351 2934 270 --22118 861
NM_006457chr4113635 3413 3357 2748 2677 2648 1221 894 851 829 199 --13848 --
NM_006544chr14124478 4274 4237 4082 3930 3855 2234 1929 1893 1050 821 601 --15314 24438 1389
NM_006561chr1074475 1485 1167 994 373 285 117 25348 4370 35958 5350 2409 --
NM_006572chr1753437 2383 2158 936 870 1758 23135 2859 1948
NM_006599chr16107624 6030 5826 5812 2422 2404 722 361 337 273 26828 5684 25047 1263 --
NM_006603chrX21400 1390 1701 --11975
NM_006614chr343617 1131 904 520 13498 22582 2244 --
NM_006620chr654507 3387 3304 3144 603 1306 --13401
NM_006624chr1041765 1593 485 215 11977 11448 --
NM_006654chr1274636 4409 3302 1758 1401 1321 665 23590 1723 11814 14325
NM_006682chr762296 2000 1966 1159 1027 873 12859 2849 761 12767
NM_006717chr983090 2848 2555 2478 2221 1096 267 48 13162 ----
NM_006729chrX105576 4846 4581 4360 3850 2075 1618 1304 489 401 23889 1172 24728 246 42009 1973 1175 620
NM_006731chr945788 4740 767 139 11760 34765 4542 992 14007
NM_006746chrX71445 1223 594 532 255 126 71 11006 --1361
NM_006750chr1658065 7544 7496 1845 1403 17452 16282 25111 1287
NM_006775chr642918 2648 2600 286 21918 832 32684 2536 488 12534
NM_006823chr841363 1354 1164 193 21236 135 --11239
NM_006827chr1473298 3285 3102 2816 845 604 238 --13218 1683
NM_006832chr144404 362 177 109 --1102 --
NM_006851chr1242693 2592 2032 341 1564 --1532
NM_006915chrX52456 2018 1700 298 152 --22190 388 --
NM_006918chr11105867 5274 4911 4344 3711 2034 1441 1141 737 372 13614 53816 1396 587 117 48 --
NM_006948chr2162175 795 717 575 530 487 ----1405
NM_007006chr1673553 3415 3295 3191 2619 1057 306 --22299 2190 --
NM_007011chr1596800 5978 5894 5842 2642 1902 1779 1322 383 26861 5207 25991 1135 11879
NM_007038chr2195742 4204 2265 1823 1726 1673 980 348 341 11887 34510 4164 1162 14343
NM_007106chr1332758 2244 908 2881 325 1143 1884
NM_007195chr1883580 3557 3353 3240 2462 966 848 251 --12473 --
NM_007249chr13169354 9040 8313 8278 8267 7354 6912 6699 5816 5790 3771 2667 1880 843 603 401 26831 6724 48576 8284 7402 5778 15776
NM_007287chr341984 787 572 213 --13097 11089
NM_007288chr341984 787 572 213 --13097 11089
NM_007289chr341984 787 572 213 --13097 11089
NM_007331chr442692 2039 857 632 --12658 21754 660
NM_007345chr1832119 143 131 1610 21912 313 1946
NM_007347chr1533191 1117 593 --22928 960 11007
NM_012095chr1052463 1274 1125 731 46 22148 987 --12770
NM_012097chr242263 2250 1863 1841 1915 --21990 321
NM_012120chr662617 1869 1151 1114 922 314 ----12333
NM_012141chr1383830 2567 1543 831 568 447 264 149 ------
NM_012164chr9127507 6968 5837 5776 5255 2770 2620 2443 2203 1373 1207 130 47557 5822 2797 2711 --36903 1989 113
NM_012214chr2125499 3997 2544 2057 1777 1066 930 850 696 374 262 129 21256 397 34936 2535 2396 --
NM_012229chr1041457 1157 461 297 11334 --1148
NM_012249chr273377 3253 2985 2311 656 555 209 12375 ----
NM_012252chr7155108 4749 4540 4386 4237 3843 3428 3417 3298 1957 1279 1164 1076 793 525 21941 892 11978 --
NM_012262chr195261 4972 4617 3965 3596 1923 1723 1410 825 --13187 --
NM_012287chr3104486 4461 4309 3751 3732 3277 2760 1610 1144 1085 12781 --12784
NM_012316chr164505 4175 3719 2024 1229 1045 --11574 11582
NM_012382chr5104539 4416 3475 3061 3008 2870 1691 1185 1166 500 --1810 11472
NM_012395chr753374 3294 2884 2435 1057 1717 --144
NM_012416chr961023 794 336 296 75 34 --128 --
NM_012464chr462770 2743 2702 948 930 136 ----12175
NM_013231chr1473396 3267 2821 1769 1150 1090 750 ----14063
NM_013250chr1121156 972 1431 21265 160 1262
NM_013374chr332239 1926 489 --12212 33027 649 613
NM_013386chr1--2458 331 --11246
NM_013437chr881310 1143 1134 933 496 314 121 55 1511 ----
NM_014028chr653280 1040 839 708 452 2819 270 ----
NM_014048chr1635146 3883 3437 24227 3923 34738 1143 1036 25228 4422
NM_014141chr785376 4801 4006 2142 1889 1856 1079 544 --14844 11439
NM_014155chr11127234 7202 6942 6532 5569 5036 2536 1774 1054 816 769 100 1582 15652 --
NM_014267chr116818 683 626 588 572 92 1257 1319 --
NM_014372chr171936 1873 1569 1525 1463 1409 555 11694 1559 11865
NM_014382chr341440 418 192 53 --1529 11609
NM_014388chr195874 5723 5649 4864 4251 1843 1827 1527 1256 26011 1082 2442 133 --
NM_014423chr5125586 5434 5395 4741 3978 1909 1700 1492 1408 968 877 562 24819 4484 ----
NM_014458chr141328 380 217 101 --11384 11069
NM_014572chr1341816 1765 1485 677 ----11782
NM_014586chr2164471 4257 1574 1471 1019 681 13985 24847 227 14422
NM_014614chr241043 1005 373 115 --11294 11161
NM_014616chr363456 2244 1356 799 682 575 --21128 820 --
NM_014702chr682878 2623 2593 2482 983 790 736 157 --12491 --
NM_014721chr6157431 7128 6854 6348 5577 5088 4968 4684 2045 1980 1800 1656 1558 1329 38 26705 4721 14817 --
NM_014742chr202631 188 21734 1709 --21740 1301
NM_014795chr261370 1174 1092 1037 463 406 ------
NM_014826chr184122 3487 3413 3251 2799 1685 1487 1285 --24054 3436 13559
NM_014828chr143544 339 318 2614 443 11960 21847 695
NM_014829chr542209 1783 410 381 11890 --1529
NM_014850chr324798 3932 21949 1825 11058 21828 303
NM_014897chr1763164 3020 2998 2883 1296 1069 1700 1193 12364
NM_014904chr1083578 2769 2752 947 726 648 634 193 --12988 --
NM_014912chr1073314 3306 3074 1289 711 664 140 23261 504 ----
NM_014926chr331119 439 328 1218 --2463 266
NM_014936chr642631 2235 1991 1799 32280 243 215 1969 --
NM_014951chr1072635 2122 1854 1812 1714 190 28 --12075 11632
NM_014982chr14104822 4733 4632 4533 4445 3892 1461 1097 796 390 ------
NM_015000chr1282521 2401 1058 999 933 758 226 208 --1366 1591
NM_015025chr262684 2504 2459 2382 1042 578 12448 1460 --
NM_015026chr12114202 3892 2922 1656 1585 1556 1517 1429 1121 704 593 --1456 13186
NM_015040chr243128 2404 792 572 33154 2886 804 --1460
NM_015045chr1071837 1776 1712 745 703 688 380 --1115 --
NM_015192chr2082732 2370 2242 1992 549 468 183 48 1559 22396 1000 --
NM_015206chr1573867 3440 3123 2989 2968 2913 2457 12503 11133 1557
NM_015208chr1862514 1472 1072 879 212 146 13495 1459 --
NM_015247chr1694241 3912 3878 3277 1920 1863 1248 908 393 11234 21349 1184 15407
NM_015271chr483942 3496 2813 1601 1527 1153 794 109 14330 11086 13905
NM_015278chr683106 2254 1119 936 920 844 725 79 --33446 1123 388 --
NM_015313chr1164251 4202 3880 3801 3598 3412 --1885 11087
NM_015315chr573372 3358 3310 3287 3088 2614 520 --13242 1535
NM_015317chr272799 2404 2315 1991 1080 558 507 22148 68 ----
NM_015347chr1282903 2867 2670 2488 2411 567 240 227 --12101 --
NM_015365chrX64310 1206 723 699 269 203 2156 143 13391 12877
NM_015429chr37755 445 279 269 141 49 33 ------
NM_015436chr4103294 3016 2739 2179 661 295 180 85 74 66 --12188 22875 592
NM_015458chr895159 4913 3885 3444 3310 1148 838 816 173 13461 13476 --
NM_015484chr12687 261 1755 1605 1907
NM_015520chr352810 2210 1114 1057 891 2995 71 --12476
NM_015525chr6--1848 196 1851
NM_015564chr562760 2347 1165 999 809 597 ----1584
NM_015571chr642393 2255 914 800 ----2677 674
NM_015602chr171671 1607 1486 494 186 166 149 ------
NM_015630chr21213 1246 1870 1206
NM_015678chr131214 ----21390 1237
NM_015713chr8103556 3403 3007 2886 2848 2482 2340 1163 718 36 1452 22406 454 --
NM_015886chr8124922 4909 4852 4836 4710 3755 3724 1872 1832 1518 1264 88 24438 2272 24811 1285 22275 298
NM_015888chr183330 2445 2108 1284 1137 905 543 273 23356 2267 --12924
NM_015906chr194604 4541 4520 4124 3006 1836 1730 1594 1183 --1651 --
NM_016021chr632715 840 474 --12301 21083 1080
NM_016075chr1392873 2503 2134 2025 1063 883 621 368 295 --12638 --
NM_016083chr663232 1130 918 768 570 434 --12627 12555
NM_016131chr24391 310 270 174 --21840 583 11540
NM_016132chr1573391 3239 2242 2141 2098 1195 585 --12678 --
NM_016206chr3198993 8901 8837 8035 7961 7804 6351 6156 6045 5938 5800 5478 3406 2967 2513 2219 1668 1530 559 38831 5551 1420 28741 7073 11423
NM_016218chr521251 287 --1513 1351
NM_016260chr2137623 7494 5990 5919 5646 4870 4743 2337 1991 1695 283 156 118 11762 ----
NM_016271chr1871966 1646 424 347 303 282 166 --12013 --
NM_016315chr24264 85 62 55 --21328 472 11680
NM_016424chr1772001 1769 1669 1347 329 304 262 11513 11515 --
NM_016441chr252388 2204 2158 1859 967 ----11977
NM_016442chr552212 2133 1984 1743 650 2685 502 12324 --
NM_016530chr1594015 3793 3598 3348 3068 3023 1625 1541 1442 1520 23095 797 1562
NM_016531chr483747 3677 3197 3101 2682 1523 1152 71 1930 22808 138 --
NM_016607chrX51680 1093 676 303 114 ----2331 126
NM_016613chr472022 1844 1701 1112 671 311 282 --2992 804 12714
NM_016644chr55503 423 359 341 43 ----1199
NM_016952chr1143357 1231 173 136 1109 33296 3056 474 1732
NM_016953chr2136005 5951 5705 5633 5497 5479 5245 4912 4821 4660 4194 3898 3707 34305 1876 1866 24857 70 --
NM_017412chr821316 1070 --11182 1207
NM_017420chr1453644 3543 3332 3141 273 ----11369
NM_017423chr4--2419 173 1175 11493
NM_017447chr2153790 1016 388 275 188 32681 500 161 12683 11008
NM_017580chr1072160 1977 1541 1479 496 415 340 ----11994
NM_017610chr1551969 1317 731 683 278 --1227 11322
NM_017628chr485234 5188 5015 4787 4672 3232 1068 749 11834 54724 3891 1721 381 227 --
NM_017634chr861650 1568 1380 680 665 299 11866 ----
NM_017643chr1772946 2871 2675 2622 964 689 384 1507 ----
NM_017650chr7116059 5831 5421 5384 5271 2363 2354 2238 2139 1749 1656 13697 14000 --
NM_017651chr661121 1092 1086 1042 384 375 ------
NM_017658chr14104654 4573 4370 4200 3183 1830 1807 1619 1489 552 11093 14630 1625
NM_017672chr15121 1998 --21346 1001
NM_017752chrX71885 1684 531 477 445 145 22 ------
NM_017769chr1473182 3132 2280 2258 930 606 148 32925 2887 82 13064 1993
NM_017813chr875787 4887 4664 3995 1825 950 238 35682 4836 1020 15195 --
NM_017831chr1864690 4620 4085 3234 1163 229 13924 --11336
NM_017848chrX43942 3878 3366 3257 23655 391 23744 2993 1325
NM_017919chr965798 4445 3784 3662 3639 2017 --1837 21697 1649
NM_018155chr362758 2507 2216 1013 814 446 2802 439 1828 12751
NM_018247chr693141 2392 2362 2138 738 481 341 93 25 12711 12713 --
NM_018299chr843009 2418 590 64 --22984 1082 13190
NM_018339chr991799 1792 1358 1350 684 565 181 143 70 11566 ----
NM_018342chr471715 1498 658 614 581 526 263 ------
NM_018351chr1274613 4399 1849 1263 842 571 443 22968 626 34371 3524 786 --
NM_018362chr1183697 3584 675 512 266 155 128 111 --13490 22959 1530
NM_018364chr153647 3034 1602 1385 686 23334 2523 23436 2644 --
NM_018373chr1496482 5790 5714 5011 4986 4063 1846 935 531 55989 4731 4037 2343 1909 26327 1304 --
NM_018374chr7135122 5053 4816 4765 3896 3636 3239 2061 2047 1720 1542 1073 542 1712 31801 1255 714 12101
NM_018403chr341398 836 704 250 --13762 13997
NM_018409chr473201 2629 2573 2232 900 382 286 22133 29 --12495
NM_018429chr542855 2345 1929 369 --12937 1908
NM_018440chr8128480 7756 7736 7543 6993 6128 2425 2001 1709 1630 1463 1352 36787 3361 2061 12244 --
NM_018566chr1115074 4525 4344 4112 4065 3911 3894 3756 3735 401 294 22033 2011 11444 14383
NM_018638chr12105124 4564 4005 3788 3769 3594 1556 913 474 297 ------
NM_018662chr164233 4114 4025 4000 3046 255 --22731 543 1437
NM_018841chr153355 2873 669 604 396 13811 23939 3731 --
NM_018970chr753086 2633 1229 932 676 22751 2108 ----
NM_019001chr3124488 4408 3654 3542 3410 1667 1484 1477 1471 1086 841 320 1983 1396 --
NM_019072chr574154 4140 4131 4030 3809 1133 288 1827 1486 --
NM_019080chr1361503 1429 1287 1231 555 56 --11018 --
NM_019083chr141635 1615 1058 24 --21451 226 11567
NM_019087chr561596 434 402 374 239 46 21548 175 1177 --
NM_019117chrX43422 2136 858 754 --53453 1025 674 408 128 13113
NM_019556chrX31131 960 421 ----1449
NM_020159chr451724 1249 1197 452 236 ----11262
NM_020177chr552959 2741 2060 847 690 13193 2835 109 --
NM_020297chr1263249 3028 2829 1048 462 168 32703 2630 66 22676 1267 --
NM_020390chr354880 1756 1557 1381 300 33981 1619 175 ----
NM_020455chr642728 885 699 22 ----2326 98
NM_020673chr20157447 7386 7272 6867 6386 6350 5572 5500 5395 2948 2332 1746 1601 644 194 --35723 1402 435 14821
NM_020718chr16166481 6405 6053 6036 5101 4506 4444 4374 2542 2475 2425 2096 1990 1168 940 652 ------
NM_020734chr1273088 2688 2590 2459 2416 2289 451 23046 2245 12247 1408
NM_020766chrX94623 4419 3561 3387 3334 3221 1015 852 275 1145 23143 147 --
NM_020772chr17138517 8497 8181 7851 7528 7443 7217 7007 6036 5976 5560 1007 784 --13477 21276 361
NM_020774chr18176047 5505 5479 5272 5207 5023 5012 4024 2324 2279 2116 2102 1821 1274 1134 1063 103 15972 11660 14833
NM_020794chr111392 ----21109 1002
NM_020809chr1172093 2085 2053 1922 568 245 67 1114 1116 --
NM_020810chr1452408 1245 971 559 62 --2709 656 1850
NM_020841chr1283995 3981 3656 2863 2811 2535 534 510 --11112 --
NM_020844chr8107728 7654 7049 6103 5718 5026 4817 2913 2769 1501 26328 2954 1821 --
NM_020871chrX72513 2429 1805 1613 866 850 529 1947 12205 --
NM_020873chr31248 --1849 1232
NM_020935chr294375 3998 3942 3369 3310 1612 1462 852 209 21696 1434 --21392 806
NM_021032chr32749 717 11739 --21561 592
NM_021033chr1333260 2654 1419 --11316 13332
NM_021038chr373340 3253 2877 2171 2076 697 377 12744 --21168 96
NM_021116chr7128758 8583 8489 8391 7658 7416 7373 6893 5722 5679 3431 874 13317 15907 --
NM_021629chr365012 4155 3850 572 373 117 1688 13155 14078
NM_021911chr554428 2142 669 491 421 25347 5161 25438 2050 --
NM_021912chr1594150 4060 3440 3285 1184 1087 1069 799 356 --42952 976 391 346 1414
NM_021914chr1452291 2275 1533 390 230 1296 2356 145 1572
NM_021954chr1363132 2816 2714 1182 1007 543 ----22849 1481
NM_021961chr1166384 6171 5270 2598 1789 77 --1192 16558
NM_021964chr3156487 6222 6190 6138 5806 5668 5634 5311 4996 4614 4406 4383 2490 1008 1001 26125 2438 ----
NM_022133chr861883 1826 1704 1647 1611 285 ------
NM_022336chr262404 2370 2147 1828 671 595 ----11744
NM_022351chr853014 2912 2696 671 77 12875 --12917
NM_022469chr152328 981 871 852 756 13306 12175 1778
NM_022483chr591610 1458 1371 1306 637 462 178 114 103 1600 ----
NM_022763chr353144 2065 1979 1086 837 11938 12440 --
NM_022781chr963193 3171 3102 2989 880 278 --12751 1889
NM_022828chr521544 1123 1415 --1418
NM_022841chr1552466 2163 818 466 385 ----12099
NM_022918chr1151953 1573 639 279 249 --11499 --
NM_024345chr9115365 4933 4826 4563 2376 2140 2009 1960 1074 206 160 25475 2429 14391 --
NM_024646chr154009 3345 2966 858 498 11466 1216 13505
NM_024665chr3104403 3617 3475 3088 2906 1583 1558 1416 1077 738 11604 ----
NM_024770chr296294 5476 4449 4374 2565 1856 478 291 126 14886 22636 408 --
NM_024817chr1585871 5426 5150 5058 4126 1823 749 648 ------
NM_024920chr451570 1118 345 321 255 1270 --1557
NM_024947chr3219562 8997 7914 7886 7643 7042 6782 6042 3702 3415 3256 3091 2594 2227 2203 2067 1985 1120 974 435 421 26924 2052 28446 8037 26104 314
NM_024989chr2137768 6828 6652 6633 6186 6028 5250 2942 2867 2566 2075 981 213 --1255 16732
NM_025073chr1104702 4620 4221 3570 3201 3011 2973 1439 650 493 14412 11403 --
NM_025235chr1062199 1915 1846 1781 638 93 31653 532 44 ----
NM_030621chr14104144 4080 3600 3577 3032 1695 1421 888 829 744 13885 14264 --
NM_030625chr1062227 865 713 567 482 446 ------
NM_030627chr563929 3618 3475 2904 1373 656 11517 11037 23832 1532
NM_030647chr7116140 4127 2118 1940 1758 1688 1590 972 952 728 603 34284 4162 326 ----
NM_030650chr254068 3892 3327 2828 1295 --33558 1395 114 12904
NM_030751chr1031251 1202 476 --2628 58 2626 379
NM_030751chr1031251 1202 476 --2628 58 2626 379
NM_030755chr1463029 2604 849 121 58 28 12147 11147 --
NM_030791chr1471825 1475 1278 1259 376 326 260 --1155 --
NM_030806chr159302 8821 3179 2137 710 --26051 3404 1566
NM_030817chr1293538 3394 3096 2724 2714 1405 747 672 41 --12323 --
NM_031427chr14135795 5524 4963 4651 1718 1583 1379 1158 1005 720 713 585 41 25583 3894 45585 2309 1548 1434 --
NM_031442chrX83200 3104 3033 2810 1967 1144 757 250 ----12217
NM_032012chr962035 1949 1079 594 522 322 11363 35125 4938 4705 14929
NM_032042chr552876 2821 2127 1952 1086 11812 --11021
NM_032121chrX62525 517 344 273 208 135 --12746 12037
NM_032128chr44846 284 271 247 1696 ----
NM_032160chr1874034 2905 1460 1385 1344 1127 274 12792 14043 1197
NM_032182chr1031353 662 380 1206 --1601
NM_032189chr1385028 5005 4569 4352 3137 460 254 206 ----14790
NM_032208chr252839 2635 1371 1334 319 1954 12498 23443 3150
NM_032217chr4188 31042 873 189 1224 11146
NM_032228chr1193496 3008 2513 2405 2211 967 642 517 76 --1596 --
NM_032373chr10105615 5481 4448 3718 2103 1908 1638 1299 1162 914 25444 4580 --1849
NM_032440chr1062621 2567 2455 2431 409 55 --2941 69 --
NM_032446chr573851 3480 3264 3118 2880 1216 1193 --13356 --
NM_032457chr4123910 3782 3718 3625 2858 2505 2491 2391 1057 809 656 372 11203 53773 3227 1205 835 422 11105
NM_032503chr65819 809 706 271 258 ----158
NM_032505chr352791 1846 533 332 243 1210 --11806
NM_032521chr2053218 3152 2744 306 136 13168 --12344
NM_032622chr421390 133 ----1501
NM_032968chrX84100 3764 3658 3588 3579 1408 581 252 185 --1304
NM_032969chrX84100 3764 3658 3588 3579 1408 581 252 185 --1304
NM_032973chrY84092 3756 3650 3584 3575 1408 581 252 185 --1304
NM_033020chr194604 4541 4520 4124 3006 1836 1730 1594 1183 --1651 --
NM_033107chr761657 1575 1335 580 548 526 ----11559
NM_033132chr13122355 2184 2164 2074 2010 1841 1681 1658 1604 1568 1538 373 ------
NM_033138chr772354 1430 774 757 591 441 109 1265 --1150
NM_033139chr772354 1430 774 757 591 441 109 1265 --1150
NM_033140chr772354 1430 774 757 591 441 109 1265 --1150
NM_033143chr484534 4208 3515 3258 3097 1697 831 803 --24598 4309 --
NM_033157chr772354 1430 774 757 591 441 109 1265 --1150
NM_033181chr663232 1130 918 768 570 434 --12627 12555
NM_033224chr7107156 7120 5058 3051 2860 2729 1996 1776 1571 1221 27063 5623 36626 6562 1761 16472
NM_033225chr832787 866 351 --12844 21965 758
NM_033290chrX53797 3471 2569 2451 1159 --12809 13638
NM_033360chr12104619 4486 4037 1724 1201 1189 867 772 714 473 --23597 627 --
NM_033389chr17104790 4308 3913 3855 3685 3203 1673 1153 624 582 --23212 215 11112
NM_033425chr1162791 1226 1110 1084 379 359 13453 1332 --
NM_033505chr296729 6562 5489 4571 2352 1873 1498 674 593 16119 ----
NM_033551chr573372 3358 3310 3287 3088 2614 520 --13242 1535
NM_033655chr921075 964 --21017 97 1943
NM_033656chr2185608 5377 4556 4247 1973 1151 1035 337 24353 1690 ----
NM_052937chr832711 2085 2069 --42390 2143 1782 1737 --
NM_053016chr9127358 7167 7116 2840 2676 2666 2489 2462 2080 1820 1631 916 16895 12560 --
NM_058170chr171613 492 360 224 213 98 87 ------
NM_080764chr2243257 2642 180 156 --22166 1095 12515
NM_080867chr1483507 3307 1770 1415 1114 725 719 439 13434 23436 678 --
NM_130391chr962822 2683 2449 1254 832 701 12801 1581 12341
NM_130392chr962822 2683 2449 1254 832 701 12801 1581 12341
NM_130393chr962822 2683 2449 1254 832 701 12801 1581 12341
NM_130809chr563143 2302 2198 1086 217 161 12270 21092 114 --
NM_130811chr202819 759 --2138 74 11123
NM_133265chrX63015 2561 2356 961 338 50 33392 1379 29 13236 --
NM_133334chr4126195 5341 5276 4701 4354 3861 2060 1562 1043 600 550 78 --25621 44 --
NM_133473chr1921793 171 1703 --21901 1320
NM_133493chr694629 4243 4094 4075 3932 3578 3408 3062 1793 --13829 --
NM_133638chr531063 517 351 1272 --190
NM_133646chr265536 1839 1423 1137 943 358 55322 3522 3399 1534 1492 ----
NM_138288chr1442162 1991 738 151 21882 363 11730 --
NM_138292chr1163560 3499 2931 1096 880 853 22549 2467 ----
NM_138357chr1021404 624 --11809 1459
NM_138400chr742728 2144 1126 125 --23405 108 --
NM_138444chr1354935 4410 4016 3161 1122 14726 --14674
NM_138473chr1244626 1493 414 378 24933 4308 14776 1181
NM_138638chr1452291 2275 1533 390 230 1296 2356 145 1572
NM_138713chr16107624 6030 5826 5812 2422 2404 722 361 337 273 26828 5684 25047 1263 --
NM_138714chr16107624 6030 5826 5812 2422 2404 722 361 337 273 26828 5684 25047 1263 --
NM_138731chr14103964 3209 2807 1660 1648 1366 1317 1239 768 736 24070 308 13727 --
NM_138970chr1442316 2012 708 261 ----12056
NM_144571chr466152 2513 1875 1861 1768 891 --21855 167 15134
NM_144578chr1475172 4877 4716 1676 1132 728 210 11886 --15274
NM_144718chr342584 2477 1763 589 ----1627
NM_144721chr462777 2453 1108 634 90 36 ----12256
NM_145055chr1833628 1086 78 12865 --23026 1420
NM_145206chr1023111 77 22997 509 --22889 269
NM_145207chr445339 5281 4739 1456 11677 14033 1532
NM_145259chr267007 5956 5515 2428 927 819 --36969 6022 4824 12175
NM_145307chr1094547 4029 3810 3043 1783 1717 1232 985 956 23700 1604 ----
NM_145698chr104776 389 317 293 21962 595 ----
NM_148955chr1555020 2578 2032 1904 1517 --26567 1582 22037 739
NM_148957chr1332574 2078 521 32700 2653 2613 12655 --
NM_152261chr1261883 1832 1723 655 592 582 1830 ----
NM_152388chr273786 3681 2707 2620 1572 478 138 1199 21582 201 23514 1400
NM_152389chr241401 1384 1086 643 --11607 11169
NM_152409chr573201 2754 2706 2557 2245 882 236 ----12638
NM_152529chr274430 4092 3511 1618 961 717 257 11027 21735 1622 --
NM_152608chr172515 2473 2446 1698 1023 1007 261 ----11992
NM_152624chr597419 6710 6268 6018 5692 2964 2434 2033 1296 ------
NM_152629chr9113861 3617 3564 3337 3275 2947 2820 2751 2678 1425 1182 42638 1508 697 180 ----
NM_152678chr392660 2448 2291 2213 2206 1853 1094 641 570 --12333 --
NM_152745chr72733 296 2789 207 --1357
NM_152774chr762580 1742 1697 828 769 323 12232 31787 959 635 --
NM_152826chr1555020 2578 2032 1904 1517 --26567 1582 22037 739
NM_152836chr861883 1826 1704 1647 1611 285 ------
NM_152837chr861883 1826 1704 1647 1611 285 ------
NM_152924chr1596800 5978 5894 5842 2642 1902 1779 1322 383 26861 5207 25991 1135 11879
NM_152999chr783632 3404 3050 1266 438 210 174 95 --54939 4851 1912 1007 962 --
NM_153184chr351573 1521 281 168 89 1295 163 --
NM_153188chr585022 4973 4692 4228 4164 3837 2254 329 15216 25218 4463 --
NM_153207chr1263511 3279 3271 1624 1178 851 1491 ----
NM_153262chr142570 2394 474 392 --33174 1188 228 --
NM_153321chr172839 717 ----1708
NM_153322chr172839 717 ----1708
NM_153332chr893038 2279 2234 1227 837 656 454 329 24 --22669 2657 --
NM_153456chr13116006 4891 3896 3886 2458 2388 1727 595 588 400 167 16252 36086 5818 512 --
NM_153686chr462291 1592 982 232 184 134 1122 11573 --
NM_153687chr122304 137 1287 --135
NM_153810chr1094966 4499 4264 3911 3767 3697 3627 1059 932 1448 ----
NM_170710chr483165 3139 2938 2419 2342 2106 1228 317 12193 12350 12174
NM_172069chr252291 2081 1595 1494 246 1561 12349 1275
NM_172071chr1127256 6216 6044 5975 5902 5795 5596 4687 2424 1768 744 325 36443 4916 1091 --14952
NM_172127chr461656 1645 1510 683 195 188 --32035 2025 1354 --
NM_172128chr461612 1601 1466 639 151 144 --31991 1981 1310 --
NM_172240chr1251396 1274 490 281 115 21059 904 1222 --
NM_173214chr16107624 6030 5826 5812 2422 2404 722 361 337 273 26828 5684 25047 1263 --
NM_173468chr485829 5665 5601 5475 5231 1481 1223 1189 33955 3785 1875 ----
NM_173496chr1052942 2814 2595 690 97 1455 --11016
NM_173552chr372335 2307 996 768 679 530 361 ----21560 232
NM_173576chr1062287 1821 775 370 351 122 --1136 --
NM_173582chr11156233 5904 5560 5155 4244 2485 2432 2424 2415 1183 1091 925 477 312 250 --14360 --
NM_173642chr1109155 7708 7697 7551 6619 3227 3132 2125 1538 1463 28349 895 26895 848 --
NM_173644chr2031905 1852 1345 --11937 11454
NM_173808chr163979 3355 3060 3041 1215 911 33343 1420 1069 14420 --
NM_173829chr5124987 4842 4080 4049 4014 2491 2285 1333 343 253 143 83 25284 1794 ----
NM_173851chr883955 3406 3053 3017 2653 1600 1168 109 13775 33797 2546 1611 --
NM_175610chr1531309 416 78 11366 --1274
NM_175861chr1275745 4887 4812 4009 1660 1094 916 11487 34213 4120 886 --
NM_177424chr161888 1502 1327 637 451 115 1178 1650 --
NM_177438chr14104144 4080 3600 3577 3032 1695 1421 888 829 744 13885 14264 --
NM_177947chrX51680 1093 676 303 114 ----2331 126
NM_177948chrX51680 1093 676 303 114 ----2331 126
NM_177968chr261593 1405 876 624 506 149 1134 ----
NM_177985chr242263 2250 1863 1841 1915 --21990 321
NM_178011chr1082961 2593 2185 2168 2053 1994 1172 549 ------
NM_178151chrX87880 7141 6112 5158 5086 3016 2585 1376 --35637 4888 49 --
NM_178152chrX87880 7141 6112 5158 5086 3016 2585 1376 --35637 4888 49 --
NM_178153chrX87880 7141 6112 5158 5086 3016 2585 1376 --35637 4888 49 --
NM_178586chr141907 --12167 11733
NM_178815chr1052767 2534 1068 995 291 ----1879
NM_181265chr483165 3139 2938 2419 2342 2106 1228 317 12193 12350 12174
NM_181354chr841645 1532 1489 682 1675 ----
NM_181358chr184093 3629 3453 2772 925 903 878 588 12697 ----
NM_181481chr18126752 6551 6240 5375 5211 5012 4811 2642 2430 956 414 407 27078 6428 --16106
NM_181482chr18126752 6551 6240 5375 5211 5012 4811 2642 2430 956 414 407 27078 6428 --16106
NM_181483chr18126752 6551 6240 5375 5211 5012 4811 2642 2430 956 414 407 27078 6428 --16106
NM_181670chr1241308 975 492 475 --1483 11252
NM_181706chr1141884 1851 1524 259 22108 129 --22225 340
NM_181714chr681965 1645 1616 1592 1385 699 643 64 --11460 --
NM_181723chr892321 2283 2232 1810 1519 1491 792 781 319 --12006 11988
NM_181782chr681898 1723 1634 901 816 504 398 129 ------
NM_181839chr841363 1354 1164 193 21236 135 --11239
NM_182515chr1986399 6326 6239 2520 2337 2218 1607 37 --16300 --
NM_182765chr1051995 1571 852 801 410 --2467 266 --
NM_182898chr775728 4997 4806 4209 2249 523 140 25823 1113 12270 15601
NM_182899chr775728 4997 4806 4209 2249 523 140 25823 1113 12270 15601
NM_182907chr641777 1536 373 228 --2633 386 1903
NM_182948chr172768 2454 2266 2034 1925 454 141 1761 ----
NM_194291chr862457 2295 2151 963 284 127 --21001 196 --
NM_194314chr162064 1920 1359 1348 628 287 23725 310 24125 3727 1566
NM_194328chr963193 3171 3102 2989 880 278 --12751 1889
NM_194329chr963193 3171 3102 2989 880 278 --12751 1889
NM_194330chr963193 3171 3102 2989 880 278 --12751 1889
NM_194332chr963193 3171 3102 2989 880 278 --12751 1889
NM_198066chr1462855 1941 1212 951 488 204 --12760 12843
NM_198128chr1871966 1646 424 347 303 282 166 --12013 --
NM_198268chr184093 3629 3453 2772 925 903 878 588 12697 ----
NM_198269chr184093 3629 3453 2772 925 903 878 588 12697 ----
NM_198399chr321809 349 ----1627
NM_198400chr1582921 2616 2347 2102 1961 960 519 408 1783 ----
NM_198485chr352199 2149 1772 762 509 31975 551 274 22434 30 --
NM_198581chr265456 2249 2202 618 583 555 26225 5810 ----
NM_198889chr4188 31042 873 189 1224 11146
NM_199072chr743015 2915 2689 343 --22778 2317 12040
NM_199168chr1011070 2335 326 11344 1288
NM_199324chr493606 3523 2552 2511 2447 1344 1332 773 467 ------
NM_199355chr1641684 1646 660 580 21637 1169 11639 --
NM_199421chr1483507 3307 1770 1415 1114 725 719 439 13434 23436 678 --
NM_201570chr1031632 602 128 --11587 11677
NM_201571chr1031632 602 128 --11587 11677
NM_201572chr1031632 602 128 --11587 11677
NM_201590chr1031632 602 128 --11587 11677
NM_201593chr1031632 602 128 --11587 11677
NM_201596chr1031632 602 128 --11587 11677
NM_201597chr1031632 602 128 --11587 11677
NM_203382chr521641 361 ----1572
NM_203406chr5102905 2729 2233 2114 1927 837 806 404 368 108 --22338 226 --
NM_203446chr2153017 2800 2465 2129 76 ----12064
NM_203458chr153525 3238 2998 2564 935 --11012 13863
NM_203463chr233659 1676 255 23158 120 --14947
NM_205860chr163121 2964 2353 2268 2096 923 ----11283
NM_206594chr133639 2276 201 12507 1792 22431 1141
NM_206595chr133639 2276 201 12507 1792 22431 1141
NM_206855chr696326 5594 5560 4009 1923 1357 583 537 423 ------
NM_206907chr562906 1273 1181 1011 332 189 --23394 2683 --
NM_207012chr1052463 1274 1125 731 46 22148 987 --12770
NM_207015chr321729 126 11858 12376 11997
NM_207170chr12687 261 1755 1605 1907
NM_207292chr373340 3253 2877 2171 2076 697 377 12744 --21168 96
NM_207293chr373340 3253 2877 2171 2076 697 377 12744 --21168 96
NM_207294chr373340 3253 2877 2171 2076 697 377 12744 --21168 96
NM_207295chr373340 3253 2877 2171 2076 697 377 12744 --21168 96
NM_207296chr373340 3253 2877 2171 2076 697 377 12744 --21168 96
NM_207297chr373365 3278 2902 2196 2101 722 402 12769 --21193 121
NM_207306chr134529 4439 1716 221324 1288 1252 1216 1180 1144 1108 1072 1000 964 928 892 860 824 752 716 680 608 572 536 500 464 ----
NM_207361chr1386146 5295 4262 2107 1894 1495 1186 477 25182 392 21794 1153 --
NM_207372chr1032453 574 269 31858 1846 545 2706 565 31861 1849 563
NM_207406chr474281 2334 2109 1658 1582 201 94 11209 44213 2094 1664 1333 14494
NM_212558chr983713 3627 3499 3338 3121 1361 1008 771 13577 33458 1686 761 --
NM_213589chr2105295 5228 4839 4676 1148 1066 661 430 338 64 --14044 --
NM_213606chr1052640 2614 2212 1745 116 --22138 1087 11042
NM_213651chr1--2458 331 --11246