TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3682-5p
miRNA Sequence: CUACUUCUACCUGUGUUAUCAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000633chr1845076 4080 3520 549 33502 1436 887 --21630 1618
NM_001007024chr1784063 3872 3631 3468 3225 3035 2893 78 53413 1298 1103 871 831 11460 33071 1063 1024
NM_001007025chr1784063 3872 3631 3468 3225 3035 2893 78 53413 1298 1103 871 831 11460 33071 1063 1024
NM_001018067chr175138 4849 4528 3575 1079 840 386 23546 1630 --24306 181
NM_001018068chr175138 4849 4528 3575 1079 840 386 23546 1630 --24306 181
NM_001018069chr175138 4849 4528 3575 1079 840 386 23546 1630 --24306 181
NM_001024647chr12117582 7221 6462 5349 2534 2170 1383 855 775 396 90 --22507 135 --
NM_001025077chr1061866 1596 1255 973 900 486 16007 25951 5099 25773 2500
NM_001042599chr277372 7072 5989 5885 5215 2543 1412 --16203 25295 2392
NM_001099678chr345106 3986 2512 1136 --24510 1837 21774 729
NM_001100108chr1117159 6679 6125 6009 5953 5044 3206 697 486 317 122 47736 1469 1171 632 37388 5307 1330 1200
NM_001759chr12115212 5149 5069 4247 4232 3351 1977 1829 1451 576 207 --1494 1149
NM_001918chr1169174 7867 7517 7491 5750 3515 3498 3327 2570 2430 2000 1831 1687 1554 1074 368 28620 5902 --13598
NM_002481chr1187282 6773 6737 6242 5728 5236 4854 2493 2119 1829 1361 1338 1307 1291 1094 1058 791 271 15153 37183 6968 5546 --
NM_002760chrY115554 5245 4524 4394 4119 3929 3793 2031 1140 996 540 --11890 14386
NM_003574chr18125619 5073 4923 4532 4460 4235 1475 1465 1420 1091 855 763 13649 23776 431 15165
NM_003759chr464106 3476 3164 2635 1445 454 --33200 2672 1547 13914
NM_003966chr5127437 6402 6395 6283 5739 2587 1398 1302 1131 797 595 323 11320 1418 17564
NM_004171chr1188873 7142 6397 6152 3487 2632 1985 735 11499 27850 1550 1470
NM_004745chr865824 5717 5479 4493 1183 734 --26369 1497 36977 2124 378
NM_004871chr1784063 3872 3631 3468 3225 3035 2893 78 53413 1298 1103 871 831 11460 33071 1063 1024
NM_004999chr674044 3740 3012 2892 1326 1184 1160 21579 384 23626 626 12997
NM_005188chr1178240 7330 6126 5380 1975 1242 80 12068 27567 6685 25332 5285
NM_005235chr277372 7072 5989 5885 5215 2543 1412 --16203 25295 2392
NM_005359chr1886455 5278 4491 2127 2001 1388 735 392 --24911 2457 36307 4595 4082
NM_005497chr17105541 5341 5199 5192 5101 4653 4431 4295 2367 1102 13815 23804 1190 15456
NM_005813chr222219 187 ----22333 461
NM_006306chrX115755 5710 5327 4843 4748 2156 1475 798 495 198 156 --45734 1900 1251 716 15219
NM_006544chr1495728 5437 5232 5021 4427 1507 846 646 571 1832 11818 14012
NM_007050chr20127996 7406 6421 6260 5861 5253 5217 2664 2652 2606 2268 393 16535 25168 258 35786 5413 5204
NM_012104chr1163864 3266 2822 835 822 606 --33252 1179 357 23578 3173
NM_012104chr1163864 3266 2822 835 822 606 --33252 1179 357 23578 3173
NM_012214chr276405 6071 5135 4756 4091 1557 646 15622 22146 472 34801 4492 2119
NM_015313chr11104331 4026 3039 1548 1498 509 496 487 475 45 2956 528 ----
NM_015569chr144281 3797 3414 573 1521 23457 759 44654 3699 3576 1414
NM_015640chr175138 4849 4528 3575 1079 840 386 23546 1630 --24306 181
NM_015879chr18118292 7939 7574 7398 7359 7197 6758 5324 1330 1013 264 15300 38133 7485 2005 --
NM_015906chr154780 3328 1676 1571 204 23810 1343 --13153
NM_016206chr3158062 7848 6554 6533 6098 5896 3458 3153 2899 2553 1951 1578 1557 1331 911 ------
NM_016297chr273258 3241 996 718 631 527 235 13286 13402 11091
NM_017637chr978150 8046 7820 7045 3447 746 232 --47645 7621 3063 3007 12991
NM_018085chr1146651 6315 5172 5102 3295 3053 2986 1807 1665 1658 1386 1242 1111 366 25627 2898 12015 --
NM_018440chr866355 6210 2106 1865 1702 1430 11985 1175 36123 5499 74
NM_020122chr2115569 4435 4035 3921 3705 2137 1750 1702 1554 506 423 ----1439
NM_020774chr1876043 4918 4671 3937 540 413 77 15833 15919 14448
NM_020871chrX31899 937 583 148 1486 22399 2366
NM_022456chr12117582 7221 6462 5349 2534 2170 1383 855 775 396 90 --22507 135 --
NM_023929chr822693 365 12496 --32732 777 631
NM_024345chr995976 4921 2331 2193 1934 1613 447 393 70 --1976 11988
NM_024665chr374718 4044 3983 3914 3879 1068 256 24282 512 1601 13114
NM_024770chr2106110 5427 4968 2129 1984 1388 1268 1095 716 586 ----25992 4266
NM_030806chr1159248 8831 8527 6757 6667 5697 3230 2934 2698 2240 933 829 695 611 353 1602 1551 11264
NM_031483chr20122984 2606 2455 2250 1240 1084 1040 812 726 646 360 318 1555 12305 --
NM_032105chr1187415 6906 6870 6375 5861 5369 4987 2626 2252 1962 1494 1471 1440 1424 1227 1191 924 404 15286 37316 7101 5679 --
NM_032446chr582895 2827 2537 1361 707 680 669 194 ----1998
NM_032859chr1363211 2432 1253 1172 1135 902 23853 2968 172 21496 583
NM_033020chr154780 3328 1676 1571 204 23810 1343 --13153
NM_033083chr3133352 2901 2834 2732 2652 2477 1153 1034 967 951 628 493 117 11278 1449 --
NM_053042chr4103174 3001 2619 2508 2354 2208 2098 1959 161 147 ----12761
NM_133170chr20127996 7406 6421 6260 5861 5253 5217 2664 2652 2606 2268 393 16535 25168 258 35786 5413 5204
NM_138971chr1163864 3266 2822 835 822 606 --33252 1179 357 23578 3173
NM_138971chr1163864 3266 2822 835 822 606 --33252 1179 357 23578 3173
NM_138972chr1163864 3266 2822 835 822 606 --33252 1179 357 23578 3173
NM_138972chr1163864 3266 2822 835 822 606 --33252 1179 357 23578 3173
NM_138973chr1163864 3266 2822 835 822 606 --33252 1179 357 23578 3173
NM_138973chr1163864 3266 2822 835 822 606 --33252 1179 357 23578 3173
NM_139207chr1252210 2012 1772 644 277 --21436 886 11749
NM_144571chr496513 5946 2815 2699 2567 2176 708 80 74 14992 25365 5126 --
NM_144578chr1421419 42 ----24803 204
NM_144599chr1584793 3390 1795 1626 1238 611 82 74 21972 1686 14689 13459
NM_144973chr12135320 5049 4749 4358 4236 3904 3709 3358 2028 1279 1215 787 627 11137 35038 4029 3259 --
NM_173468chr485096 3945 3839 2001 1069 937 802 259 12193 14182 11751
NM_175623chr12117582 7221 6462 5349 2534 2170 1383 855 775 396 90 --22507 135 --
NM_175624chr12117677 7316 6557 5444 2629 2265 1478 950 870 491 185 --22602 230 --
NM_175625chr12117677 7316 6557 5444 2629 2265 1478 950 870 491 185 --22602 230 --
NM_194434chr18125619 5073 4923 4532 4460 4235 1475 1465 1420 1091 855 763 13649 23776 431 15165
NM_198549chr133125 1000 164 --22398 981 22901 1251
NM_198581chr2116833 6779 6474 6230 5187 2974 1735 1546 1327 632 624 --12949 --
NM_201263chr171864 853 791 767 454 306 235 1744 --1751
NM_203459chr132278 926 732 ----2859 497
NM_207306chr1201391 1355 1319 1283 1247 1211 1175 1103 1067 1031 995 923 855 819 783 711 639 567 495 459 ------