TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3685
miRNA Sequence: UUUCCUACCCUACCUGAAGACU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX66294 5488 4236 2770 873 221 36656 6189 185 --25079 373
NM_000332chr637011 2712 2672 46794 4924 2646 881 35048 2044 354 11596
NM_000337chr596139 5900 5301 5168 4355 2500 2160 739 550 24751 1743 25580 581 11033
NM_000633chr1874667 4022 3815 3498 1291 631 615 41655 966 710 688 14352 13489
NM_001003800chr9113760 3726 3654 3243 3077 2971 2404 1442 1192 1100 437 1984 23381 116 11031
NM_001005473chr586423 6027 5921 2255 1694 478 409 232 34953 1286 664 --1131
NM_001008239chr1853551 2928 846 479 116 33449 288 182 1226 1778
NM_001009899chr386157 5791 4790 4596 2441 1801 1317 638 22536 1268 24062 317 1143
NM_001010891chr5106450 5529 5408 4603 4546 2461 2082 690 474 159 36539 4948 4914 16578 --
NM_001012753chr1921017 227 ----5893 809 371 269 187
NM_001013659chr1933594 3454 1894 34724 1945 363 --35057 348 32
NM_001014797chr1097515 6772 6670 6297 6128 6102 5825 5291 4969 27814 6541 57632 6439 6052 5698 5239 12650
NM_001033044chr141148 523 488 480 1470 1462 --
NM_001033049chr215754 413 393 319 109 1338 --2504 490
NM_001033056chr141148 523 488 480 1470 1462 --
NM_001040284chr1674990 2273 1627 1462 1135 418 352 52302 975 658 524 331 13898 --
NM_001042599chr275774 5420 5229 3065 1479 1241 198 77725 6236 2989 2553 2263 2053 1721 12862 --
NM_001100108chr1168130 7332 6413 5951 5889 5874 2518 2351 1643 1635 1365 1271 1139 448 426 315 56396 2293 568 259 195 15305 122
NM_001106chr3149745 7807 7764 7528 6836 6400 6197 3823 3337 3059 2752 1606 943 660 23723 397 13425 --
NM_001259chr785731 4855 4370 4115 1960 1351 979 850 11928 --25887 4947
NM_002025chrX128146 7645 3579 3021 2872 2696 2488 2201 1353 1000 863 325 25739 3129 ----
NM_002065chr141148 523 488 480 1470 1462 --
NM_002481chr197929 7791 6059 5816 5755 5149 5009 2668 1092 15315 35550 1828 789 17340
NM_002886chr354181 3972 3578 1840 1340 34855 1914 1814 --23230 1773
NM_003099chr15156458 6123 5546 5463 5279 5014 4803 4761 4736 4495 4016 986 442 322 315 36612 3993 618 12328 --
NM_003112chr742685 2258 1104 450 32971 728 717 --196
NM_004293chr943782 2621 1225 732 ----23102 2857
NM_004774chr1783120 2137 975 854 845 815 552 273 12941 2705 285 1317
NM_005076chr1113888 3654 3562 3457 3432 2900 1459 1055 661 295 153 33302 2863 1666 1147 --
NM_005188chr11117046 6344 3181 1345 1074 1014 949 842 756 468 123 17298 --26330 6286
NM_005235chr275774 5420 5229 3065 1479 1241 198 77725 6236 2989 2553 2263 2053 1721 12862 --
NM_006599chr1686359 6230 6084 2688 1380 1012 1002 621 42802 2596 1979 1092 17613 --
NM_006838chr1251695 1288 657 635 262 1234 1728 11789
NM_007050chr20117362 6531 6295 1993 1837 1637 810 718 392 363 187 37242 6107 5682 25146 3019 --
NM_007137chrX85377 4008 4000 3799 3366 2212 1464 321 41896 1740 266 238 11400 11362
NM_007249chr13108559 8190 7863 7795 6530 6131 3059 1782 1550 780 16516 --26582 3502
NM_012104chr1142433 960 774 627 43586 3568 3191 641 13170 41076 455 193 74
NM_012104chr1142433 960 774 627 43586 3568 3191 641 13170 41076 455 193 74
NM_012199chr184025 3777 3547 3493 849 461 439 116 24251 412 31393 572 105 24216 3441
NM_014372chr13271 189 89 2638 332 --1182
NM_014898chr192118 47 32427 315 199 2378 82 12153
NM_014936chr632645 2539 447 22470 2427 --2519 237
NM_015313chr1194828 3024 1921 1041 1016 831 741 294 158 13912 --13511
NM_015576chr312364 12449 12033 22053 2041
NM_015833chr215754 413 393 319 109 1338 --2504 490
NM_017637chr977946 7327 7255 3446 2250 2125 236 38805 7978 227 16345 26582 2661
NM_018374chr743842 1909 1302 861 44033 3588 832 83 11330 13552
NM_020205chr193410 3053 2983 2533 2157 894 579 342 112 43015 2935 616 419 --1461
NM_020718chr1645020 5014 2308 770 25418 1659 35520 2621 980 25179 2636
NM_020772chr1767739 7577 6842 6010 5888 2690 17331 --37900 6695 6299
NM_021116chr7148918 8226 8209 7587 6430 3497 3196 2767 1549 1499 1327 1210 533 459 16209 48043 515 282 41 13421
NM_024345chr965658 4133 3895 2295 979 48 25967 4429 --1411
NM_024989chr245199 3094 2536 1869 37050 6586 137 11191 26449 927
NM_031427chr1495666 5639 5325 4670 2115 1887 1444 1224 471 1905 --13996
NM_032105chr198062 7924 6192 5949 5888 5282 5142 2801 1225 15448 35683 1961 922 17473
NM_033083chr323187 2456 23249 2672 3955 710 116 23000 415
NM_033224chr737614 7211 3009 35771 3121 1811 27112 6493 13234
NM_033656chr2125811 3876 25963 1020 --33929 1708 1164
NM_133170chr20117362 6531 6295 1993 1837 1637 810 718 392 363 187 37242 6107 5682 25146 3019 --
NM_138713chr1686359 6230 6084 2688 1380 1012 1002 621 42802 2596 1979 1092 17613 --
NM_138714chr1686359 6230 6084 2688 1380 1012 1002 621 42802 2596 1979 1092 17613 --
NM_138971chr1142433 960 774 627 43586 3568 3191 641 13170 41076 455 193 74
NM_138971chr1142433 960 774 627 43586 3568 3191 641 13170 41076 455 193 74
NM_138972chr1142433 960 774 627 43586 3568 3191 641 13170 41076 455 193 74
NM_138972chr1142433 960 774 627 43586 3568 3191 641 13170 41076 455 193 74
NM_138973chr1142433 960 774 627 43586 3568 3191 641 13170 41076 455 193 74
NM_138973chr1142433 960 774 627 43586 3568 3191 641 13170 41076 455 193 74
NM_144973chr1285371 4357 3990 3325 2039 2026 796 708 34654 4419 3386 24946 1128 13931
NM_145055chr1853551 2928 846 479 116 33449 288 182 1226 1778
NM_145259chr276674 4817 4663 2057 2005 1999 1993 25640 5227 --17071
NM_148955chr15156458 6123 5546 5463 5279 5014 4803 4761 4736 4495 4016 986 442 322 315 36612 3993 618 12328 --
NM_152263chr154873 3926 2020 1630 780 36077 1957 812 34550 3797 2055 23773 1740
NM_152636chr1163060 3000 2833 2347 2103 572 12683 22665 377 1631
NM_152754chr753584 3429 1062 814 535 43685 3489 1214 760 --1447
NM_152826chr15156458 6123 5546 5463 5279 5014 4803 4761 4736 4495 4016 986 442 322 315 36612 3993 618 12328 --
NM_153456chr1395874 4910 4886 4466 4332 3917 1402 1026 219 23874 677 55157 4919 1420 737 225 --
NM_172071chr126167 2963 14719 27155 1541 47040 1578 1109 64
NM_173214chr1686359 6230 6084 2688 1380 1012 1002 621 42802 2596 1979 1092 17613 --
NM_173468chr495592 4406 4291 4125 2189 1558 1051 943 891 56021 5438 5134 3837 1933 --15521
NM_177424chr13816 806 212 ----21905 1367
NM_212558chr933928 1571 1301 34233 550 183 --33868 3245 228