TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3686
miRNA Sequence: AUCUGUAAGAGAAAGUAAAUGA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000051chr1163512 3451 3304 2647 2485 1386 --13182 --
NM_000084chrX105457 5202 4375 4243 2635 1740 1345 1241 664 193 --31389 713 42 --
NM_000176chr553907 3544 1538 845 503 11209 1154 12479
NM_000259chr1595990 5388 2388 2209 1451 758 594 557 205 23976 252 11557 --
NM_000297chr41702 1229 --21877 1370
NM_000332chr6127067 6780 6257 6135 5791 5125 4829 2363 1431 1012 649 142 25285 1276 12338 16384
NM_000390chrX73281 2677 2294 2259 1077 750 505 1457 21086 153 --
NM_000408chr263361 3266 879 782 716 386 --23151 454 --
NM_000461chr374589 4420 4145 4000 3500 1273 506 34403 4219 550 23755 838 1820
NM_000544chr6_cox_hap143217 1101 936 111 22194 310 32120 706 603 --
NM_000555chrX127432 7022 6600 5872 4847 2978 1609 1549 1407 1260 931 662 56731 5915 5320 2784 1735 25195 5052 --
NM_000618chr1276302 4027 2585 2160 826 459 327 35045 861 249 46329 5565 5431 5216 14211
NM_000618chr1276302 4027 2585 2160 826 459 327 35045 861 249 46329 5565 5431 5216 14211
NM_000686chrX41188 627 590 549 --11439 1635
NM_000809chr468888 8131 7972 7405 5671 1011 145 68152 7669 6411 6238 2263 1619 28621 1653
NM_000813chr575566 4521 3914 3589 3440 1024 925 14534 --21671 1492
NM_000826chr422425 421 --32120 1926 355 154
NM_000875chr1576196 5606 5090 2653 1616 1229 1160 36353 5203 1260 ----
NM_000877chr263005 2767 2072 613 449 54 --32412 844 84 --
NM_000901chr472143 2089 2060 997 932 690 488 --11619 --
NM_000944chr432330 630 419 --1248 11542
NM_000950chrX43422 2777 1467 613 12665 --23187 164
NM_001001419chr5125017 4696 4649 4237 4013 1617 749 611 344 218 104 70 14636 24259 973 --
NM_001001420chr5125017 4696 4649 4237 4013 1617 749 611 344 218 104 70 14636 24259 973 --
NM_001001481chr842505 2170 1281 448 22661 1303 ----
NM_001001665chr262782 2130 2111 1240 1086 329 12691 22900 121 --
NM_001001928chr2298313 8101 7963 7077 5585 5326 5181 809 239 17410 15613 --
NM_001002860chr1434623 4614 1885 24088 3480 23851 73 23325 484
NM_001003652chr1888451 8286 8158 5651 2828 1485 428 310 26585 2107 17981 --
NM_001003674chr1895839 5167 5073 4756 4482 4436 2372 1637 780 26893 6568 24551 347 15529
NM_001003675chr1895839 5167 5073 4756 4482 4436 2372 1637 780 26893 6568 24551 347 15529
NM_001003712chr1273942 3933 3673 3239 2939 2854 2627 13268 2856 452 24009 2827
NM_001004317chr663391 3181 3077 3069 1508 334 33646 2733 1319 1405 --
NM_001004419chr1283014 3007 2985 2910 1519 1513 952 82 23673 1313 24451 3927 --
NM_001005473chr576270 5963 5583 4782 4210 2560 1440 56569 6184 5899 5246 2076 26431 4062 15161
NM_001007024chr1774258 2882 2826 2752 757 580 340 14391 23759 634 13604
NM_001007025chr1774258 2882 2826 2752 757 580 340 14391 23759 634 13604
NM_001007097chr974641 4152 1742 1536 799 274 207 14314 --1963
NM_001007466chr684566 3871 2066 1358 1284 786 126 59 11726 25220 678 --
NM_001008539chr875245 5150 4752 4376 4354 1899 1604 25192 3338 23511 1926 14005
NM_001008738chr552732 2536 2318 1118 416 --12076 12608
NM_001008801chr191255 --21921 1786 22146 1734
NM_001008925chr433516 3191 2492 1226 --22878 723
NM_001009554chr464702 1864 1846 992 424 60 21821 211 --1967
NM_001009554chr464702 1864 1846 992 424 60 21821 211 --1967
NM_001009899chr376505 5301 4140 1632 1467 572 160 1717 46129 2249 2114 1601 --
NM_001009909chr1163736 3706 3564 3093 1188 675 13063 32657 2519 1084 --
NM_001010891chr555880 5355 1817 1026 42 12479 45220 4451 2774 2637 22109 1949
NM_001010922chr141483 1216 1194 184 1624 1757 21421 1369
NM_001011666chr735740 1596 133 25897 1939 14822 15732
NM_001012755chrX64912 4897 3775 2047 2033 1516 13459 44795 4707 1459 1322 --
NM_001012968chrX62153 1921 1855 1801 1790 1715 1412 ----
NM_001013620chr1287938 7742 7368 6976 2962 1886 1867 1285 --23098 971 12213
NM_001015045chr472566 1721 1549 923 705 431 337 12020 11779 --
NM_001018074chr553907 3544 1538 845 503 11209 1154 12479
NM_001018075chr553907 3544 1538 845 503 11209 1154 12479
NM_001018076chr553907 3544 1538 845 503 11209 1154 12479
NM_001018077chr553907 3544 1538 845 503 11209 1154 12479
NM_001024094chr553907 3544 1538 845 503 11209 1154 12479
NM_001024647chr1256863 6625 5709 5681 233 37143 2425 883 11910 21096 791
NM_001025076chr1065037 4373 4238 2371 1845 378 46195 4507 755 601 --1305
NM_001025077chr1066395 5731 5596 1736 1107 721 47553 5865 2113 1959 --11663
NM_001025356chr1232405 2372 434 2957 162 3780 739 449 1259
NM_001030055chr1463521 3200 1875 1765 1400 96 33109 1899 327 ----
NM_001031804chr1654377 3794 1527 1065 702 --21544 695 14229
NM_001032999chr2044272 3723 3510 1898 33551 863 733 21501 1110 14543
NM_001034841chr1685469 5305 4290 4093 4083 1459 1394 1239 25106 3378 54673 4511 4413 3942 3837 33861 1722 100
NM_001034954chr1083201 3163 3008 2959 2869 2663 2555 2112 22769 1276 ----
NM_001034955chr1083201 3163 3008 2959 2869 2663 2555 2112 22769 1276 ----
NM_001034956chr1083201 3163 3008 2959 2869 2663 2555 2112 22769 1276 ----
NM_001034957chr1083201 3163 3008 2959 2869 2663 2555 2112 22769 1276 ----
NM_001037535chrX71548 1067 472 331 231 153 128 ------
NM_001037536chrX71548 1067 472 331 231 153 128 ------
NM_001037540chrX71548 1067 472 331 231 153 128 ------
NM_001039547chr3127595 7034 6802 6274 5699 5035 3224 3111 2272 1886 1277 52 --46732 3009 2885 1388 22568 1339
NM_001039590chrX33849 3524 51 23757 148 --33821 2987 1425
NM_001039591chrX33849 3524 51 23757 148 --33821 2987 1425
NM_001039618chr1125304 3705 1818 1606 35885 5459 263
NM_001039693chr273109 3016 2921 1376 1229 799 146 --24018 99 --
NM_001039709chr2044272 3723 3510 1898 33551 863 733 21501 1110 14543
NM_001040157chr452169 1976 1911 823 269 11785 1254 --
NM_001040284chr1665694 4215 1022 938 327 320 1510 12095 15302
NM_001040402chr482948 2189 2116 1280 1065 597 216 197 22840 1163 --12175
NM_001040441chr185228 4674 4040 3693 3494 1970 997 677 24801 3974 15433 --
NM_001040446chr531707 913 279 12413 --22748 425
NM_001040665chr794379 4277 3282 3244 1700 1578 1065 310 297 --24286 688 13430
NM_001040712chr943305 937 73 34 12911 1253 13496
NM_001042404chr11416 --11511 21454 611
NM_001042413chr983427 2647 2503 778 722 183 171 118 33778 2614 1223 34023 2962 1346 --
NM_001042555chr1233624 3599 786 --22964 99 13424
NM_001042599chr257220 5245 4907 4860 128 12708 --27755 3155
NM_001042601chr342389 2368 2129 224 42831 2412 1247 983 --12868
NM_001042603chr12104920 4874 4129 3877 3669 1859 1777 1416 972 194 ------
NM_001042604chr394612 4544 4334 3743 3675 3430 3383 1232 764 ----23641 2983
NM_001042749chrX31759 335 92 --12009 1818
NM_001042750chrX31759 335 92 --12009 1818
NM_001042751chrX31759 335 92 --12009 1818
NM_001043318chr1463850 3753 2743 1209 565 90 13131 33338 2955 2887 13676
NM_001046chr563009 2992 2530 2160 2051 634 12355 11940 1387
NM_001083620chr422423 420 --32118 1924 354 154
NM_001099678chr3136317 5927 5446 4955 4612 4185 2269 1883 1769 1668 1453 686 242 21688 766 12215 1518
NM_001100108chr1117323 6266 5970 5631 3214 2980 2119 1259 898 785 152 ------
NM_001106chr3109570 9514 9336 8797 8466 7411 3549 3043 2777 2433 36775 3914 275 --12308
NM_001167chrX86485 6386 6231 5615 4784 1709 1326 816 --66374 5878 5743 4736 2128 1991 14684
NM_001173chr1463521 3200 1875 1765 1400 96 33109 1899 327 ----
NM_001204chr2107703 7321 6307 5901 5671 5087 5045 1111 1032 523 55410 869 706 157 56 37444 3027 972 --
NM_001206chr952687 2417 2255 812 672 1743 12924 12899
NM_001241chr262064 1968 1676 958 350 262 21997 657 --12253
NM_001241chr262064 1968 1676 958 350 262 21997 657 --12253
NM_001256chr1732183 1193 539 1159 --22301 1878
NM_001259chr775898 4921 4887 1881 1563 195 80 ----11422
NM_001310chr1212822 11213 12081 33063 2123 750
NM_001364chr1172925 2890 1374 1352 331 202 109 24041 735 24551 1226 --
NM_001396chr2132602 2432 2205 --2907 707 22472 43
NM_001412chrX53661 3595 2706 2280 380 43264 3006 1482 1073 1799 1655
NM_001438chr163406 2548 2331 2229 1297 817 ----13256
NM_001527chr684809 4712 4465 4192 756 605 494 448 --33488 3171 3037 24641 1114
NM_001546chr661158 967 952 943 546 511 ------
NM_001609chr1053678 3571 3296 1446 405 1594 33350 741 533 1652
NM_001668chr141866 1727 1603 708 1788 --1183
NM_001690chr342002 1907 485 363 --42308 1891 893 759 11628
NM_001755chr1652116 1848 653 638 537 --31875 800 583 --
NM_001858chr633879 3675 1430 34266 999 548 24064 1609 11335
NM_001918chr1127474 6734 6339 2776 2575 1842 1516 896 807 625 515 214 39313 8845 1231 37486 7175 7040 19077
NM_001981chr13596 402 327 12414 1164 22197 920
NM_002015chr1353168 3049 2680 664 352 23319 189 23224 2631 1296
NM_002024chrX41738 1422 813 592 21863 405 --1668
NM_002025chrX98995 8893 8374 7262 5614 2578 2072 1917 1106 --18919 --
NM_002035chr1873354 2457 1595 1314 1219 847 83 13042 --12747
NM_002040chr2142451 2338 1016 673 11147 ----
NM_002048chr9--21084 981 21271 483 11175
NM_002126chr1773895 3331 2731 1586 1437 1427 1386 22628 1514 ----
NM_002214chr755075 4544 3925 3838 1795 35510 5382 5207 31436 1301 310 1681
NM_002270chr565606 4924 3964 2232 1550 990 --21092 99 11943
NM_002310chr576463 6254 6149 5897 5043 1209 396 36241 2240 1240 14484 24283 1136
NM_002336chr1264604 4443 3882 3836 3128 987 1162 24512 4395 --
NM_002480chr1221471 287 ----21178 556
NM_002481chr176953 5463 5283 5233 3068 2267 1809 27459 5688 12717 12370
NM_002487chr155728 656 646 89 73 1785 ----
NM_002577chr353466 3427 2909 2507 703 --43421 2761 1309 1186 --
NM_002581chr944893 3539 2040 1330 24207 1620 25598 4681 1479
NM_002613chr1695004 4870 4716 4540 2035 1652 1058 1039 129 --34072 3822 3485 --
NM_002645chr1152162 1936 1036 707 381 ----1528
NM_002655chr8105075 4379 3800 3671 3563 3212 1801 1762 1481 649 ----35326 3659 28
NM_002657chr2052578 1471 1309 647 416 23308 137 --23884 1201
NM_002709chr253598 1273 1214 665 203 1695 1484 11373
NM_002822chr1241721 1640 1629 532 159 21701 578 1163
NM_002839chr943305 937 73 34 12911 1253 13496
NM_002858chr1--1138 --21248 45
NM_002886chr394885 4459 3962 3949 3432 1959 1042 660 228 --25067 856 14492
NM_002892chr142670 617 21065 268 --1324
NM_002977chr242750 521 232 28 22556 372 23063 2884 --
NM_002998chr842236 1483 1363 781 --22045 1571 11969
NM_003010chr173676 553 547 1864 1879 21766 1653
NM_003034chr1267892 7362 7165 2321 1934 208 17389 26629 6495 27147 5556
NM_003046chr875245 5150 4752 4376 4354 1899 1604 25192 3338 23511 1926 14005
NM_003108chr297050 6077 5222 4586 1452 1247 723 489 40 15892 --15072
NM_003112chr762858 2532 2216 622 607 328 2945 269 188 11286
NM_003161chr1733371 1085 798 --11357 22780 2688
NM_003262chr364809 4226 4012 1452 1156 228 14728 34683 4547 1593 33755 1870 162
NM_003298chr3126149 6140 5721 4903 4777 4128 4021 2231 1755 1435 1249 772 25935 543 1388 12402
NM_003304chr31136 2398 171 11549 1210
NM_003392chr373792 3239 3017 2760 1500 1480 1262 1272 1646 152
NM_003463chr652329 2198 1183 583 176 2665 395 ----
NM_003468chr254067 1363 1269 776 548 23360 3268 2753 657 --
NM_003474chr101222 21839 210 22189 623 11912
NM_003477chr11171 1494 --1181
NM_003489chr211988 22940 1017 --22646 757
NM_003574chr1875635 4493 4053 2188 722 459 154 25259 1759 11199 11455
NM_003583chr1223162 1504 21462 885 32942 726 317 --
NM_003590chr273773 2897 1315 1078 439 222 109 --12991 --
NM_003671chr943405 3339 2595 1060 --13310 22368 1122
NM_003758chr1541476 1250 1051 412 ----11574
NM_003758chr1541476 1250 1051 412 ----11574
NM_003759chr464214 3717 3317 1600 1214 702 --33473 1592 591 12941
NM_003895chr213792 415 142 --11825 22144 1568
NM_003913chr663351 1234 1039 799 259 238 ----14058
NM_003958chr673426 3192 2878 2786 2715 1038 635 23055 2627 31519 1171 695 --
NM_004171chr11189152 8950 8117 7799 7553 7088 6994 6650 6283 3104 3028 2935 2266 2254 2125 2080 1569 1137 28680 311 37073 6945 2213 26521 1633
NM_004316chr121372 ----2962 766
NM_004338chr1895839 5167 5073 4756 4482 4436 2372 1637 780 26893 6568 24551 347 15529
NM_004362chr45678 657 598 525 519 1294 1549 --
NM_004392chr1342273 283 244 46 ----2414 33
NM_004440chr641351 799 470 144 11753 41677 1343 294 33 --
NM_004458chrX52350 1935 603 575 357 --1238 12594
NM_004464chr473451 3067 2968 1022 534 387 199 12690 43498 3458 2613 322 --
NM_004504chr242689 2564 860 600 --22106 256 11157
NM_004586chrX104268 3583 1798 1703 1479 1297 1225 1165 368 327 ------
NM_004612chr994604 4491 3944 1705 1682 1597 1013 988 119 14118 11478 --
NM_004685chr1351831 1042 760 525 31 11123 12713 12543
NM_004719chr122990 270 --11124 22616 434
NM_004726chrX34867 4035 3706 11204 32146 2103 1968 24902 1187
NM_004744chr433708 2540 1078 13332 2889 58 1610
NM_004745chr857027 6883 6265 6228 4886 26316 5150 27000 761 15645
NM_004748chr1593649 2928 2785 1353 1280 1134 1024 926 261 ------
NM_004808chr1033125 932 546 --32355 1343 339 22898 2498
NM_004842chr631173 519 77 ----21160 1111
NM_004857chr1494634 3925 3503 3024 1618 854 430 243 220 34806 3074 567 11752 23064 1190
NM_004859chr1772888 2615 2547 2341 2099 2047 521 2821 625 1552 --
NM_004863chr1434512 2101 1736 25078 3798 44481 1512 914 351 11461
NM_004866chr534320 1248 97 13444 --43789 1498 1365 205
NM_004871chr1774258 2882 2826 2752 757 580 340 14391 23759 634 13604
NM_004898chr452365 965 545 416 170 22002 1898 31040 634 380 --
NM_004904chr735740 1596 133 25897 1939 14822 15732
NM_004956chr774583 4548 4451 2946 1186 962 59 33850 2845 1590 23937 603 14356
NM_004973chr611636 --11249 21540 1504
NM_004985chr12114545 4452 4133 4078 3639 3559 3367 3103 964 748 117 ------
NM_005000chr76973 903 744 386 287 274 1112 1404 --
NM_005036chr2298313 8101 7963 7077 5585 5326 5181 809 239 17410 15613 --
NM_005056chr12105164 5118 4373 4121 3913 2103 2021 1660 1216 438 ------
NM_005093chr2044272 3723 3510 1898 33551 863 733 21501 1110 14543
NM_005095chr13857 828 432 ----22221 1366
NM_005121chr1762602 2566 798 719 586 405 12361 23060 737 1825
NM_005124chr631004 419 402 1316 --1152
NM_005156chr974763 4037 2052 1824 1797 1244 884 14003 13546 12010
NM_005180chr1051502 1263 1195 68 49 --11654 --
NM_005188chr1176507 6464 5870 3152 2884 2175 785 33289 1880 301 28167 5122 --
NM_005197chr1445074 4906 4766 978 21390 1045 14024 15767
NM_005235chr257220 5245 4907 4860 128 12708 --27755 3155
NM_005254chr1531045 228 113 194 --11001
NM_005339chr474044 3795 3590 3311 1637 986 958 23025 1312 13870 --
NM_005359chr1876287 5695 5328 4849 2351 1208 1005 62518 1657 1581 988 357 330 36262 2218 1232 --
NM_005436chr1043768 3264 1162 559 43216 1500 826 389 22677 574 --
NM_005497chr1795687 5626 5442 4441 2357 1892 1750 1268 512 1789 14969 25863 223
NM_005502chr952326 2215 2102 1120 755 22616 2121 1180 12130
NM_005504chr1295909 5798 4840 4475 4106 2468 2080 1466 839 1767 46585 6131 1840 682 11394
NM_005542chr7----1510 21799 1509
NM_005578chr374972 4465 3628 3571 1903 1170 837 11266 1726 --
NM_005596chr985473 2096 1992 1900 1237 643 251 63 56070 5870 5507 4805 4628 11192 --
NM_005665chr163391 1452 1319 1025 444 152 14059 1770 13055
NM_005668chr534320 4241 3973 23664 1454 24451 930 24499 3314
NM_005739chr1562373 2060 1819 1717 650 638 32347 2009 1584 1672 --
NM_005828chr17105098 4962 4762 4386 3723 3628 3175 1737 1378 553 --34119 3689 1264 14811
NM_005840chrX116731 5869 5106 3076 2833 2615 1974 1728 1065 1038 938 15821 21937 1202 12059
NM_005842chr132564 24 1215 1733 1505
NM_005901chr1888451 8286 8158 5651 2828 1485 428 310 26585 2107 17981 --
NM_005902chr1554493 2799 1544 1244 437 23979 3330 24309 2986 33476 1447 1156
NM_005903chr5125017 4696 4649 4237 4013 1617 749 611 344 218 104 70 14636 24259 973 --
NM_005909chr543196 3084 2670 1540 11359 22897 1033 11430
NM_005941chr874033 3866 2595 2574 1619 960 33 13425 13894 11081
NM_005955chr131266 950 672 24389 1459 45342 2116 1982 795 23540 1294
NM_005964chr1741069 391 193 67 --21508 1250 11124
NM_005966chr232288 1923 1606 ----1329
NM_006007chr9114487 4401 4267 3766 3290 2760 1647 1489 1402 1392 323 --33919 1016 167 --
NM_006037chr274541 3710 3619 3474 1505 1262 1058 11744 13785 24579 1229
NM_006047chr2073233 1153 549 501 439 195 22 21365 1041 --1157
NM_006080chr762649 2365 2291 2092 275 226 11969 12352 12190
NM_006194chr141129 11241 --31337 433 190
NM_006203chr594987 4643 4508 1896 1859 1252 1242 853 758 --21689 1453 --
NM_006251chr572521 1303 632 403 242 152 29 1173 1765 --
NM_006252chr176670 5660 5243 5196 4828 2337 285 --57489 2919 2503 1846 1626 --
NM_006256chr152626 2344 2303 642 323 12013 12154 11757
NM_006283chr844561 4261 4231 1560 33134 916 588 2536 97 11928
NM_006380chr1753933 3871 3160 3104 1659 34216 1579 473 13579 2295 155
NM_006434chr1083201 3163 3008 2959 2869 2663 2555 2112 22769 1276 ----
NM_006482chr1223162 1504 21462 885 32942 726 317 --
NM_006534chr2022103 418 --11049 33093 2976 645
NM_006538chr274161 4071 3805 3355 1074 1008 33 13917 12992 1494
NM_006544chr1475789 5739 5058 4547 3771 2445 2290 25512 412 142 --
NM_006561chr1065037 4373 4238 2371 1845 378 46195 4507 755 601 --1305
NM_006599chr1686969 6506 6390 3288 1829 1201 566 170 12033 27782 1252 15224
NM_006603chrX31759 335 92 --12009 1818
NM_006620chr674524 4269 4129 4059 3808 3784 349 33076 1680 1552 34849 3061 896 13174
NM_006628chr1564611 4380 3707 843 337 115 23820 1016 33834 3573 1826 1886
NM_006654chr1233624 3599 786 --22964 99 13424
NM_006699chr172517 2105 2055 2042 1838 354 343 22665 58 12428 --
NM_006716chr721376 855 31248 410 153 2986 107 1183
NM_006729chrX75551 4084 3789 3464 2232 1561 1374 15414 14220 24625 995
NM_006731chr975750 5549 5389 4904 1010 325 203 11674 --14320
NM_006746chrX71548 1067 472 331 231 153 128 ------
NM_006750chr1687980 5955 2477 2220 2085 1777 1757 446 13030 12406 12935
NM_006908chr731150 1142 424 --1135 21436 973
NM_006956chr761833 1772 1757 1564 555 205 ----1567
NM_006996chr141916 1880 335 28 ----11791
NM_007038chr2144980 4448 4318 3705 34115 595 206 15581 --
NM_007114chr343273 1195 957 163 --22750 2285 2929 89
NM_007137chrX64675 4058 1708 1451 642 318 51507 1372 1180 481 281 14390 11112
NM_007145chr1921031 909 ----21352 900
NM_007195chr1853608 3572 2361 866 448 13680 21438 655 1999
NM_007249chr13127502 7204 7071 6990 5883 3128 3122 3034 1712 1486 1129 820 18676 12454 21860 427
NM_007353chr721889 685 1257 32753 893 403 21205 292
NM_012156chr2082759 2584 924 794 430 174 166 158 23189 187 1278 --
NM_012158chr1331590 605 275 ----1593
NM_012164chr977121 6439 5901 5763 4799 2775 437 27222 2704 67215 5851 2908 2480 1830 964 22150 1900
NM_012214chr265645 5258 5249 4655 2236 1617 14395 41629 626 391 377 15222
NM_012249chr253516 2812 2369 1016 84 1496 11043 1362
NM_012252chr764301 3620 3599 1614 499 223 21459 1426 ----
NM_012262chr155042 4012 2027 1236 1172 15246 13418 11414
NM_012300chr542378 2142 2111 845 12067 --1321
NM_012347chr612339 12880 12170 22557 2486
NM_012382chr584469 4215 4113 3797 3530 3484 1082 711 33576 3432 1220 1778 --
NM_012431chr753616 1443 995 815 727 2428 115 1958 22883 889
NM_012479chr752548 608 592 585 460 11024 12773 --
NM_013231chr1483612 3553 3505 3370 2871 1771 1661 266 12996 13108 --
NM_013269chr1272941 2934 2912 2837 1446 1440 879 23600 1240 24378 3854 --
NM_013309chr1541886 1628 614 248 12485 --2456 229
NM_013374chr342643 2600 240 199 12837 1628 12538
NM_013386chr131798 1179 479 --1415 1438
NM_013438chr951634 1283 620 485 259 1612 --11453
NM_013447chr19103784 3763 3478 3387 3347 3146 2913 2577 1141 577 53635 2401 693 284 171 13435 --
NM_014011chr221798 200 --11046 22310 997
NM_014021chr163409 3145 2859 2801 287 242 --1604 12538
NM_014023chr1052861 978 741 529 163 12534 --1638
NM_014048chr1654997 4807 4205 1951 1066 11240 11150 24488 4295
NM_014106chr1552662 2482 1847 557 522 --32372 841 708 11949
NM_014141chr7105142 5008 4597 4496 1742 1574 929 918 410 197 14564 34106 3961 2096 1468
NM_014155chr1177466 6759 2306 2069 1682 1385 880 --36565 5259 2642 17117
NM_014243chr46742 734 650 466 341 97 ----1707
NM_014331chr4137424 6531 6320 5603 5557 5297 5289 5268 5207 3029 2668 1564 394 --17062 1194
NM_014393chr852048 1585 679 551 422 --12159 22144 1525
NM_014421chr452078 1616 1509 126 60 2751 90 22036 30 22052 2007
NM_014423chr563968 3850 3442 2139 1099 576 35463 1356 1055 33781 1866 837 15147
NM_014445chr362058 2003 1980 1708 594 463 12112 12228 --
NM_014487chr4--1109 --2654 160
NM_014667chr382048 1829 1561 926 860 718 673 667 ------
NM_014674chr363798 2794 2743 2501 1099 721 --1493 23826 2719
NM_014711chr1651966 1680 1548 490 265 1532 --2416 312
NM_014721chr666856 6334 2597 1894 1205 358 37475 5946 5083 --12504
NM_014739chr642764 1437 1414 1112 33955 895 126 23349 409 --
NM_014810chr1103478 2940 2809 2802 2728 1322 1275 428 358 169 ----13214
NM_014812chr11416 --11511 21454 611
NM_014829chr562337 1793 1684 1590 1582 646 11608 ----
NM_014839chr132507 468 349 --41626 914 263 159 1426
NM_014873chr1124612 4581 4498 2979 1474 1340 1089 903 743 532 509 486 23519 980 13096 23136 1024
NM_014877chr1787484 6042 4838 1851 1797 638 566 83 26699 2088 37011 6176 5168 --
NM_014883chr472566 1721 1549 923 705 431 337 12020 11779 --
NM_014897chr1763232 2784 2354 969 590 463 22937 566 32734 2601 504 --
NM_014898chr1952423 1775 1552 572 537 2455 159 22070 1936 1229
NM_014906chr1783215 2985 1637 1485 1173 1095 867 603 --33341 2923 620 --
NM_014912chr1031419 158 79 32392 1413 195 23027 202 --
NM_014920chr6123620 3190 2824 2787 2346 1536 1170 918 456 364 117 88 12590 1707 --
NM_014946chr242983 2922 591 452 32379 82 26 1326 2969 101
NM_014950chr1471462 1172 524 438 400 284 65 21455 1195 ----
NM_014982chr1495058 3730 3576 1701 1688 1609 1180 570 460 21745 769 ----
NM_014988chr432824 2620 1855 1405 --32003 1788 392
NM_014991chr411212 42444 1260 1065 170 21314 329 33114 2049 874
NM_014999chr1221511 146 --1506 21172 109
NM_015020chr1683886 3817 3772 3213 3102 3069 2583 2551 13170 32699 381 244 11568
NM_015026chr1254090 3680 3658 1330 92 13539 24045 162 13617
NM_015049chr233113 2091 318 13017 --21170 422
NM_015051chr923187 881 13207 22470 2417 13251
NM_015092chr1653501 2988 1734 1352 955 12875 --14051
NM_015115chr482948 2189 2116 1280 1065 597 216 197 22840 1163 --12175
NM_015137chr822069 776 22316 829 32401 1820 757 --
NM_015144chr1641413 1399 270 264 1504 11297 12995
NM_015170chr842105 94 82 21 ----12315
NM_015206chr1543097 2766 586 69 1361 11375 23032 2665
NM_015208chr1864025 3243 2806 685 539 121 13322 --22705 2635
NM_015271chr474041 3957 3551 3335 3187 2932 463 24069 2805 11058 --
NM_015291chr163086 3035 2764 2492 1090 100 --13243 23521 2821
NM_015310chr8188306 8227 7815 7410 7112 6877 6669 5369 5252 3244 3036 2919 1773 1324 1301 1157 297 158 58212 5912 2859 2160 1591 25526 2983 36914 5377 1688
NM_015313chr1174758 4752 4746 1405 941 279 88 1494 11320 --
NM_015317chr242571 1126 625 441 31927 680 435 2852 422 1845
NM_015344chr851902 1420 662 499 491 --1519 --
NM_015349chr652973 829 755 641 278 --32803 1946 195 12139
NM_015375chr184890 4753 3954 3859 3405 1055 911 603 --24984 3141 --
NM_015385chr1083201 3163 3008 2959 2869 2663 2555 2112 22769 1276 ----
NM_015436chr433335 3010 2311 145 --22697 542
NM_015458chr845313 5003 4124 3901 ----24807 1152
NM_015554chr1582804 2796 2642 2407 2231 2135 2075 52 12286 12862 12757
NM_015565chr2131934 1466 429 12207 --1306
NM_015886chr875416 4328 4259 1713 957 823 761 24750 2090 24925 4208 21676 1637
NM_015888chr132870 1324 941 22464 1271 --21290 182
NM_015994chr141632 ----3239 225 158
NM_016009chr143895 1881 1624 1171 21198 846 14749 1174
NM_016087chr72423 104 11549 31472 1165 629 1372
NM_016206chr398044 7963 7525 7079 6567 2710 2703 2515 30 17130 38498 7658 6936 13613
NM_016217chr6165 21326 1156 23032 800 11252
NM_016221chr511529 41650 931 641 117 21642 1634 11953
NM_016260chr297308 7240 5921 5523 5278 5143 1570 1528 628 37460 2065 1487 26515 728 46405 4926 2831 1228
NM_016271chr1832303 2212 78 --12160 1437
NM_016374chr131419 1233 622 11468 1595 11517
NM_016374chr131419 1233 622 11468 1595 11517
NM_016377chr631173 519 77 ----21160 1111
NM_016422chr1121161 326 12864 12372 22182 1945
NM_016513chr6123620 3190 2824 2787 2346 1536 1170 918 456 364 117 88 12590 1707 --
NM_016530chr1573999 3838 3795 3495 2575 1031 411 23639 683 23817 3184 43149 2837 1274 267
NM_016531chr444119 4019 3455 1032 33485 1296 1109 53832 3569 2988 2779 265 --
NM_016577chr374280 3817 3776 3443 2779 821 741 11055 2844 372 11779
NM_016603chr532234 2179 267 ----1426
NM_016654chr1531045 228 113 194 --11001
NM_016953chr245406 4259 2298 2073 --56061 1886 1822 1687 701 15020
NM_017415chr584500 4152 4056 3647 2794 1569 287 276 31609 710 599 ----
NM_017420chr1463143 3069 1232 675 371 189 33634 1026 169 --1974
NM_017637chr9118493 8172 7708 6882 3148 2710 2342 763 603 460 217 11269 11810 12694
NM_017658chr1454165 4032 3289 1739 589 13669 --13616
NM_017666chrX32177 2124 1823 --11581 11976
NM_017831chr18114352 3988 3530 1800 1457 1147 1026 963 759 410 141 14163 13028 --
NM_017944chr1142911 2122 1130 776 --32134 1160 588 12172
NM_017994chr742129 2115 906 536 ----23012 2393
NM_018085chr197557 6445 6320 5923 5658 5331 1812 1391 56 --55417 5263 3092 2205 1631 18010
NM_018098chr341120 993 412 37 ----128
NM_018157chr1252843 2801 2161 214 191 23092 535 23232 1299 --
NM_018178chr121910 1578 1339 --11550
NM_018293chr322271 238 --22828 808 1333
NM_018299chr842505 2170 1281 448 22661 1303 ----
NM_018313chr332683 1691 146 2647 29 2554 426 1781
NM_018340chr1684645 4519 3699 3331 1749 1081 878 520 13718 34034 3574 1239 11988
NM_018362chr1173586 3307 2878 2796 2607 443 257 --33034 280 240 11289
NM_018373chr1486346 5887 4988 4977 1640 1545 1503 533 25731 5680 25555 2121 14577
NM_018374chr7124806 4651 4367 3514 1776 1210 1167 877 789 675 514 254 15016 --1384
NM_018409chr442245 956 235 63 23099 769 23051 121 --
NM_018439chr1832239 513 79 22634 1687 32198 2066 990 22317 661
NM_018440chr898597 6635 6536 5665 2957 2947 2299 2288 179 13260 11966 12403
NM_018566chr154944 4082 3982 3795 3495 14747 2674 182 14683
NM_018890chr731150 1142 424 --1135 21436 973
NM_018947chr744349 4293 3540 1900 34978 1724 1701 23804 615 11432
NM_018976chr1242004 851 397 111 32535 1893 139 --12320
NM_019001chr394612 4544 4334 3743 3675 3430 3383 1232 764 ----23641 2983
NM_019004chr771988 1563 1532 928 596 131 40 --2178 34 --
NM_019022chr1823138 2483 21155 362 --22540 91
NM_019084chr1032500 778 425 ----12106
NM_019556chrX11016 1172 1186 41232 1151 596 348
NM_020122chr2115990 4915 4642 4572 4143 4072 3857 3710 1481 594 386 25162 2125 15262 --
NM_020141chr142367 2121 2016 905 21641 194 12271 12241
NM_020177chr572940 2235 2210 2089 1261 692 504 --23044 2807 --
NM_020205chr153025 2931 2813 693 218 --1958 12134
NM_020245chr674472 3777 1972 1264 1190 692 32 11632 25126 584 --
NM_020466chr623316 518 1672 13350 21707 681
NM_020662chr631839 1650 83 11296 1249 21773 46
NM_020673chr2097508 7360 6853 6710 2865 2760 2334 1061 506 --67725 7569 6238 6102 5911 5310 --
NM_020717chrX134902 4615 4514 4457 4317 3872 3855 3648 3190 1925 973 502 396 13822 ----
NM_020718chr1666076 5997 5526 4582 4283 2194 --35072 4676 4168 --
NM_020734chr1243393 2418 2263 2204 1224 --1438
NM_020739chr1593649 2928 2785 1353 1280 1134 1024 926 261 ------
NM_020742chrX52664 2124 1077 1046 1040 --12425 12497
NM_020760chr211221 --31730 1642 580 11898
NM_020766chrX94499 4125 4061 3742 1517 893 740 681 135 ----21810 858
NM_020772chr1768282 7983 6108 2387 1463 324 28001 1346 46592 2882 2218 1938 1803
NM_020805chr1821643 589 21630 311 --1447
NM_020809chr1131522 395 294 12318 --22219 563
NM_020830chr252470 2450 2328 2064 362 ----12272
NM_020841chr1273942 3933 3673 3239 2939 2854 2627 13268 2856 452 24009 2827
NM_020853chr1252817 2481 2372 2019 589 22383 1999 12793 125
NM_020858chr1521624 1586 21836 1578 22323 1976 11813
NM_020909chr264050 3943 3632 2855 662 564 ----23777 1639
NM_020917chr1922933 476 --13422 137
NM_020948chr143616 2303 1001 692 23313 554 33504 1353 162 23686 3463
NM_021033chr1362494 2201 1372 1068 255 107 22559 77 21132 520 2920 86
NM_021148chr762372 2300 1875 1768 1649 587 1643 2972 745 --
NM_021255chr1453522 2898 1129 1032 816 13143 43005 2619 1383 346 24099 3057
NM_021629chr364595 4421 1935 1417 305 92 ----13782
NM_021645chr1362312 2213 1670 556 346 74 12112 11705 --
NM_021647chr464702 1864 1846 992 424 60 21821 211 --1967
NM_021783chrX31840 564 124 --1278 22355 682
NM_021813chr665434 5031 4645 4464 4181 413 14418 24763 826 11792
NM_021911chr575566 4521 3914 3589 3440 1024 925 14534 --21671 1492
NM_021954chr1353423 2802 1117 524 197 11155 13245 13495
NM_021960chr152473 2378 2268 888 813 1862 --21929 711
NM_021961chr11147237 7223 6675 6019 5801 2845 2444 2058 1376 1234 884 380 318 23 45494 2892 1029 998 --17064
NM_021964chr376140 5278 5131 4495 4385 1316 89 55965 5146 4868 4417 1674 26257 424 1211
NM_021998chrX21064 271 1208 --1219
NM_022048chr1586008 5193 4783 4022 2269 1338 1059 285 32365 2335 415 25335 4476 --
NM_022058chr241858 1667 703 498 21621 661 --11566
NM_022166chr16106304 4971 4371 2505 2451 2063 2034 1890 1634 263 26338 5899 45872 5443 2292 354 26248 6160
NM_022351chr843430 3164 2620 784 2998 573 33620 3461 599 --
NM_022456chr1256863 6625 5709 5681 233 37143 2425 883 11910 21096 791
NM_022469chr162929 2525 2428 2159 1069 898 21327 1301 1855 22449 2231
NM_022491chr1263150 2972 1430 1404 904 861 13439 23522 2757 --
NM_022781chr982479 2245 2173 1301 377 351 302 56 ----1972
NM_022845chr1652070 1802 607 592 491 --31829 754 537 --
NM_022977chrX52350 1935 603 575 357 --1238 12594
NM_023000chr142670 617 21065 268 --1324
NM_023001chr142670 617 21065 268 --1324
NM_024423chr1843713 1270 1076 666 13119 43614 3538 3290 479 13736
NM_024524chr362797 2685 2618 2286 2122 410 1301 --22786 589
NM_024590chr471905 1587 1570 1399 1382 451 319 --31229 416 374 1750
NM_024665chr364660 1506 1463 1366 451 425 24278 3644 13210 --
NM_024740chr1193479 2921 2903 2647 1583 1525 1064 937 220 12662 33201 3065 1167 1332
NM_024770chr2126271 6203 6049 4809 4652 4293 4071 2134 1144 1120 1111 863 26251 4300 21696 418 15234
NM_024817chr1585089 4810 4763 4300 4276 4174 1869 1689 15120 1940 21570 954
NM_024947chr3119098 8354 8324 3844 3815 3533 2843 2634 2114 1481 155 59557 9500 8006 1432 894 67574 7439 7137 3705 246 215 19075
NM_024989chr2137844 7581 6752 6654 6188 5865 3079 2976 2675 2316 1466 465 345 24962 2020 67726 5305 2937 2450 1967 1273 --
NM_024991chr1083201 3163 3008 2959 2869 2663 2555 2112 22769 1276 ----
NM_025040chr1922062 320 --11808 11578
NM_025054chr834231 2864 1402 24013 1312 23663 1540 1763
NM_025073chr184695 4583 4311 4132 3764 3698 870 544 13094 ----
NM_025134chr16102554 2385 2362 2314 2127 1818 1030 781 365 310 --1391 --
NM_025238chr1511009 1445 21344 592 11438
NM_030627chr563931 3433 3253 2652 1301 1055 13234 53459 3094 3008 2886 2860 --
NM_030647chr796142 5401 5313 5132 4106 1419 1061 980 762 11185 15288 --
NM_030674chr12124940 4888 4824 4697 4605 4567 4522 4214 3756 2147 938 534 45292 3931 1873 114 --2461 94
NM_030755chr1452729 2689 1079 560 101 21058 584 12578 11961
NM_030806chr1119373 9113 8560 7688 6890 6677 6016 2830 1704 688 147 38976 1517 827 23027 320 --
NM_030816chr153260 2658 2538 2467 46 12757 13222 --
NM_030885chr311444 --2543 91 21916 835
NM_031268chr1695004 4870 4716 4540 2035 1652 1058 1039 129 --34072 3822 3485 --
NM_031371chr131419 1233 622 11468 1595 11517
NM_031371chr131419 1233 622 11468 1595 11517
NM_031427chr1431743 1142 789 23961 2196 33937 3640 2241 11255
NM_031431chr132657 64 1143 11614 2356 169
NM_031442chrX113148 2894 2751 2621 2615 2601 2522 2309 2287 2026 772 --11970 1816
NM_031469chr663887 2558 1466 1095 605 342 23355 491 22692 266 13543
NM_032012chr9145086 5017 4885 4718 4658 4572 4520 4350 3570 3509 3269 2103 1931 1191 1143 24954 3296 14808
NM_032105chr177086 5596 5416 5366 3201 2400 1942 27592 5821 12850 12503
NM_032228chr1163090 3059 2901 2727 2463 985 ----33329 2789 1215
NM_032321chr241036 930 838 593 ----1654
NM_032373chr1064826 4110 1322 1215 927 368 43786 2174 1846 1083 --15739
NM_032439chr1061266 1212 1152 607 423 306 21101 599 21446 1344 --
NM_032440chr1052189 1053 945 585 139 --1114 1917
NM_032445chr1552592 2520 2242 89 24 1999 --1561
NM_032446chr523046 313 2960 831 13876 2678 289
NM_032466chr831409 1289 148 ----11457
NM_032468chr831409 1289 148 11728 --11457
NM_032682chr353387 2914 2860 1054 395 ----23218 2879
NM_032833chr152635 2599 2456 2020 345 --11733 11919
NM_032873chr11104402 4073 4008 3607 3311 3026 1603 1447 1014 941 24190 267 24518 1717 --
NM_033121chr1241807 272 208 137 31260 595 146 2506 370 --
NM_033143chr483782 3398 3299 1353 865 718 530 310 13021 43829 3789 2944 653 --
NM_033224chr7118055 7106 5294 5033 3112 2637 2517 2381 2323 1016 22 48104 7305 1916 627 16868 36197 2957 2275
NM_033285chr884468 4113 3736 2753 1605 710 669 251 --1678 24308 2933
NM_033331chr943405 3339 2595 1060 --13310 22368 1122
NM_033360chr12114666 4573 4254 4199 3760 3680 3488 3224 1085 869 238 ------
NM_033389chr1774854 4733 4407 3881 3747 1810 587 23037 1933 34874 4808 1763 11702
NM_033394chr241511 641 438 432 11209 --11368
NM_033426chr1432765 2079 375 12682 11102 12919
NM_033480chr612339 12880 12170 22557 2486
NM_033481chr612339 12880 12170 22557 2486
NM_033644chr542378 2142 2111 845 12067 --1321
NM_033645chr542378 2142 2111 845 12067 --1321
NM_033656chr2154504 3700 3654 1344 914 25994 2182 24070 427 15524
NM_052879chr1233843 2529 1206 13080 23060 287 13436
NM_052907chr1234037 2816 1052 21134 162 33949 3833 1671 11305
NM_052932chr1152409 2383 1009 785 31 11676 21596 207 --
NM_052937chr872668 2366 2292 2208 582 380 109 1757 22414 299 --
NM_053016chr9127689 7627 6576 6042 5978 5657 5029 2107 1495 935 565 119 46954 5348 4842 2403 35858 5364 5171 35635 5423 1635
NM_053023chr1163012 2919 2479 2449 2256 1154 --22510 1213 --
NM_057168chr72423 104 11549 31472 1165 629 1372
NM_057175chr442125 564 468 313 1962 1517 21661 185
NM_058241chr261964 1868 1576 858 250 162 21897 557 --12153
NM_058241chr261964 1868 1576 858 250 162 21897 557 --12153
NM_080759chr1342273 283 244 46 ----2414 33
NM_080760chr1342273 283 244 46 ----2414 33
NM_080764chr2283301 2531 2427 2314 2139 1070 691 433 1654 ----
NM_080872chr853908 3091 896 706 632 32602 1237 749 33826 2726 2694 --
NM_080874chr41196 --11290 31627 1571 628
NM_080927chr332302 1231 517 42951 256 140 82 12551 12515
NM_130391chr943305 937 73 34 12911 1253 13496
NM_130392chr943305 937 73 34 12911 1253 13496
NM_130393chr943305 937 73 34 12911 1253 13496
NM_130436chr2132602 2432 2205 --2907 707 22472 43
NM_130438chr2143179 3009 2782 465 --11284 23049 620
NM_130847chr1185095 3816 1940 1720 1515 1430 880 694 34659 286 30 11092 15497
NM_133334chr485960 5543 5507 4415 1468 1235 697 594 11936 14146 15371
NM_133372chr552732 2536 2318 1118 416 --12076 12608
NM_133646chr265475 4834 4220 4006 1272 449 15194 --2245 177
NM_138292chr1163512 3451 3304 2647 2485 1386 --13182 --
NM_138444chr1364434 3889 3833 1926 1503 739 2683 166 164 1718
NM_138468chr285728 4654 3939 2405 1577 1143 255 194 34309 1031 714 15961 --
NM_138621chr274161 4071 3805 3355 1074 1008 33 13917 12992 1494
NM_138633chr631173 519 77 ----21160 1111
NM_138694chr623561 200 13620 43664 3044 1434 171 2435 382
NM_138713chr1686969 6506 6390 3288 1829 1201 566 170 12033 27782 1252 15224
NM_138714chr1686969 6506 6390 3288 1829 1201 566 170 12033 27782 1252 15224
NM_138731chr1463500 2809 1062 1005 243 212 ----34100 1260 313
NM_138959chr1106617 6027 2721 2523 2357 2339 1207 575 261 48 11521 36199 5927 2558 --
NM_139169chr1062152 1594 1510 186 137 55 162 1906 --
NM_139207chr1231511 809 71 ----32112 1433 428
NM_144571chr456678 5867 2454 983 905 14700 1745 14622
NM_144583chr241736 1605 1227 38 21825 1341 148 193
NM_144590chr1032179 1159 162 31835 600 31 --32704 2290 2136
NM_144599chr1534200 2113 1948 11415 15436 25210 4269
NM_144721chr432665 1781 132 1167 1216 12750
NM_144778chr1312681 22172 348 --22341 914
NM_144949chr221798 200 --11046 22310 997
NM_144973chr1232099 1839 139 11793 --24449 4026
NM_145207chr445101 1267 835 357 --41994 1408 970 147 35184 5136 3345
NM_145251chr1421407 472 11116 --1502
NM_145259chr266839 6826 5874 5083 1170 302 47120 4679 2693 1233 25773 2156 1861
NM_145307chr1034272 3240 529 1136 24391 1429 44467 441 188 69
NM_145753chr341485 1355 653 258 1354 --1327
NM_152275chr212004 ----21998 720
NM_152519chr242061 1706 612 195 1557 22192 2179 21783 679
NM_152556chr742261 1995 196 115 31819 419 176 22033 125 1493
NM_152594chr1521793 1737 --1202 2877 221
NM_152624chr5157199 6860 6837 6455 6380 6250 5473 5353 2526 2046 1976 1737 1323 357 197 35034 2241 1580 1462 14557
NM_152629chr983427 2647 2503 778 722 183 171 118 33778 2614 1223 34023 2962 1346 --
NM_152641chr1242902 2624 2492 1097 ----12502
NM_152699chr3103734 3398 3316 3145 3105 2821 2549 990 355 266 --32957 2371 89 --
NM_152754chr763638 3485 824 720 246 74 --13175 --
NM_152756chr553919 3535 1445 400 24 1350 --43796 1219 776 683
NM_152774chr782468 2276 2254 1729 1044 1008 771 671 1748 --11882
NM_152787chrX83340 2603 1264 1199 1117 1009 952 203 ------
NM_152838chr2073233 1153 549 501 439 195 22 21365 1041 --1157
NM_152919chr19103784 3763 3478 3387 3347 3146 2913 2577 1141 577 53635 2401 693 284 171 13435 --
NM_152996chr112087 11371 --21754 1717
NM_152999chr794379 4277 3282 3244 1700 1578 1065 310 297 --24286 688 13430
NM_153013chr52658 418 11620 41926 1794 750 601 1981
NM_153188chr565606 4924 3964 2232 1550 990 --21092 99 11943
NM_153207chr1263897 3239 3182 2939 2664 675 21573 1473 --34026 1016 559
NM_153354chr5--1397 --2913 298
NM_153616chr1521624 1586 21836 1578 22323 1976 11813
NM_153617chr1521624 1586 21836 1578 22323 1976 11813
NM_153618chr1521624 1586 21836 1578 22323 1976 11813
NM_153619chr1542862 2824 121 54 23074 2816 23561 3214 13051
NM_153836chr232160 1861 1586 --31830 534 189 21973 840
NM_170665chr1274384 4324 3026 1639 1077 1020 213 33020 1167 675 14040 13860
NM_171998chrX3921 364 326 ----1985
NM_172193chr1441194 881 173 75 2954 215 --1849
NM_173214chr1686969 6506 6390 3288 1829 1201 566 170 12033 27782 1252 15224
NM_173468chr475998 5069 2020 1585 1289 1225 1099 34940 858 425 13741 --
NM_173469chr155400 390 162 90 63 --11517 1985
NM_173473chr1042278 1977 857 526 --31034 553 437 12663
NM_173531chr1942828 2534 962 835 2897 781 53592 3449 2632 2360 774 --
NM_173582chr1164337 1975 1455 562 314 252 --25600 779 21674 948
NM_173654chr352141 1718 417 230 153 --2717 584 21779 1686
NM_173694chrX42416 1798 657 62 1524 --12573
NM_173808chr153846 3099 1684 354 325 --24070 1574 11512
NM_173827chr493194 2861 2839 2129 1119 812 556 361 32 --21254 948 12727
NM_173829chr5115842 5769 5259 4746 3801 1726 1609 1404 813 733 117 46150 5537 5266 645 14348 15675
NM_173851chr83549 238 223 --23576 2741 13768
NM_175623chr1256863 6625 5709 5681 233 37143 2425 883 11910 21096 791
NM_175624chr1256958 6720 5804 5776 328 37238 2520 978 12005 21191 886
NM_175625chr1256958 6720 5804 5776 328 37238 2520 978 12005 21191 886
NM_175861chr1275617 4802 4760 4409 4064 3733 1526 1357 2613 254 11750
NM_175876chr132214 1995 34 12178 11833 1821
NM_177538chr2168660 8634 8273 7970 7705 7433 7246 6911 6729 5643 3048 2305 2069 1735 1133 1019 1783 58570 8122 7567 6375 5928 38148 3536 334
NM_177996chr2082759 2584 924 794 430 174 166 158 23189 187 1278 --
NM_178140chr522029 100 11808 21862 1014 1743
NM_178151chrX127432 7022 6600 5872 4847 2978 1609 1549 1407 1260 931 662 56731 5915 5320 2784 1735 25195 5052 --
NM_178152chrX127432 7022 6600 5872 4847 2978 1609 1549 1407 1260 931 662 56731 5915 5320 2784 1735 25195 5052 --
NM_178153chrX127432 7022 6600 5872 4847 2978 1609 1549 1407 1260 931 662 56731 5915 5320 2784 1735 25195 5052 --
NM_178426chr141966 1827 1703 808 1888 --1283
NM_178427chr141866 1727 1603 708 1788 --1183
NM_178498chr1143938 3856 3749 3640 43786 2463 821 638 11066 13849
NM_178505chr1073452 3293 3007 759 318 289 225 1447 21449 56 33208 2998 624
NM_178585chr411212 42444 1260 1065 170 21314 329 33114 2049 874
NM_181332chrX52664 2124 1077 1046 1040 --12425 12497
NM_181354chr851568 1524 1332 569 136 11746 --11306
NM_181481chr1895839 5167 5073 4756 4482 4436 2372 1637 780 26893 6568 24551 347 15529
NM_181482chr1895839 5167 5073 4756 4482 4436 2372 1637 780 26893 6568 24551 347 15529
NM_181483chr1895839 5167 5073 4756 4482 4436 2372 1637 780 26893 6568 24551 347 15529
NM_181659chr2022103 418 --11049 33093 2976 645
NM_181659chr2022103 418 --11049 33093 2976 645
NM_181672chrX71969 1818 1486 1406 1263 535 306 12049 21733 108 --
NM_181673chrX71969 1818 1486 1406 1263 535 306 12049 21733 108 --
NM_181723chr831968 1765 279 ----12190
NM_181782chr62818 713 --1279 2931 153
NM_181836chr542551 2188 667 332 --21847 1651 21992 709
NM_182515chr1995353 5166 4764 4384 1897 1531 1097 1013 62 45377 2592 1468 326 45301 1853 1579 1345 --
NM_182758chr1553913 3702 2785 729 698 --13443 1923
NM_182763chr152462 2367 2257 877 802 1851 --21918 700
NM_182848chr1311227 2577 255 --21447 224
NM_182898chr735740 1596 133 25897 1939 14822 15732
NM_182899chr735740 1596 133 25897 1939 14822 15732
NM_182972chr162812 2371 2054 1883 1842 933 22082 1876 --12530
NM_183078chr683332 3098 2784 2692 2621 1502 944 541 22961 2533 31425 1077 601 --
NM_183387chr141941 123 149 1328
NM_194247chr241487 1285 1267 552 2986 425 --14429
NM_194278chr1463850 3753 2743 1209 565 90 13131 33338 2955 2887 13676
NM_194282chr442803 1081 413 232 42358 1961 819 38 43032 1247 1215 934 --
NM_194314chr175372 4532 4153 3435 1593 1188 1063 ----15576
NM_194328chr982479 2245 2173 1301 377 351 302 56 ----1972
NM_194329chr982479 2245 2173 1301 377 351 302 56 ----1972
NM_194330chr982479 2245 2173 1301 377 351 302 56 ----1972
NM_194332chr982479 2245 2173 1301 377 351 302 56 ----1972
NM_194434chr1875635 4493 4053 2188 722 459 154 25259 1759 11199 11455
NM_198128chr1832303 2212 78 --12160 1437
NM_198181chr1582420 2079 1071 329 205 175 147 117 ----22924 477
NM_198336chr7--1745 1422 21711 1421
NM_198549chr153272 2547 2365 2265 607 23024 162 --2585 255
NM_198581chr286269 6133 6106 6030 5603 5275 955 145 --56684 6547 5740 5112 4978 16804
NM_198829chr731150 1142 424 --1135 21436 973
NM_199050chr2183626 3337 2726 1565 1517 1470 514 241 1658 --12596
NM_199132chr191255 --21921 1786 22146 1734
NM_199188chr1233843 2529 1206 13080 23060 287 13436
NM_199190chr1233843 2529 1206 13080 23060 287 13436
NM_199324chr462876 2862 1171 1115 422 376 32499 1041 843 23437 305 --
NM_199436chr242983 2922 591 452 32379 82 26 1326 2969 101
NM_199462chr184890 4753 3954 3859 3405 1055 911 603 --24984 3141 --
NM_201545chr141442 495 450 210 2973 38 11183 21201 528
NM_203446chr212952 493 --12635 42954 2378 2043 804
NM_203463chr274041 3891 3099 1950 1336 1003 480 11529 23473 719 --
NM_206594chr163406 2548 2331 2229 1297 817 ----13256
NM_206595chr163406 2548 2331 2229 1297 817 ----13256
NM_206854chr655206 1531 1147 899 409 24749 4581 25068 4996 1856
NM_206855chr656171 2496 2112 1864 1374 25714 5546 36033 5961 922 11821
NM_206876chr253598 1273 1214 665 203 1695 1484 11373
NM_206907chr572521 1303 632 403 242 152 29 1173 1765 --
NM_206909chr8188306 8227 7815 7410 7112 6877 6669 5369 5252 3244 3036 2919 1773 1324 1301 1157 297 158 58212 5912 2859 2160 1591 25526 2983 36914 5377 1688
NM_207303chr1063983 1482 1302 806 592 236 --12747 13714
NM_207304chr1312568 22059 235 --22228 801
NM_207406chr495012 4919 4829 4328 4294 1764 1339 1193 566 26354 6320 1583 --
NM_213589chr285382 4712 3892 3721 2047 1238 1142 215 21621 1102 34971 4644 4167 --
NM_213651chr131798 1179 479 --1415 1438