TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3689c
miRNA Sequence: CUGGGAGGUGUGAUAUUGUGGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr5--167 ----
NM_000018chr172106 39 1125 ----
NM_000021chr1441049 904 883 354 ----2696 135
NM_000024chr52437 372 ------
NM_000033chrX6853 740 389 357 122 106 --2184 110 --
NM_000037chr892515 2456 2189 2167 2075 1661 924 551 31 2791 432 21824 613 11748
NM_000063chr63281 233 98 --1205 --
NM_000070chr153354 141 115 ------
NM_000074chrX2657 113 2612 598 ----
NM_000075chr122186 104 --1188 --
NM_000080chr176836 610 228 213 91 23 --1270 --
NM_000081chr141521 1306 320 286 --1434 --
NM_000084chrX126728 6151 5866 5828 5414 5363 4814 2217 1805 1557 819 204 34226 2648 1164 35809 1772 1095 14359
NM_000088chr1761186 1169 1125 419 405 392 1162 31221 1210 31 21268 408
NM_000089chr72708 192 1626 197 --
NM_000092chr273014 2970 1485 1228 991 865 140 14608 --1204
NM_000093chr962189 1556 968 726 540 106 124 1116 12278
NM_000104chr21401 ------
NM_000115chr1322315 276 11870 ----
NM_000125chr694024 3332 1556 1445 1439 1230 900 834 772 23599 3572 1729 --
NM_000127chr8----165 --
NM_000138chr1522424 1848 11615 1304 --
NM_000141chr1031119 306 183 --2245 77 1944
NM_000153chr1421675 41 11454 ----
NM_000163chr531942 1625 721 1140 11592 11761
NM_000166chrX7597 249 153 135 118 66 60 --2144 24 --
NM_000167chrX2687 338 125 --21465 1325
NM_000168chr792637 2239 2172 2153 973 766 502 426 202 12433 1772 22808 2115
NM_000170chr93214 79 41 ------
NM_000176chr543517 3388 3220 1170 1635 11101 --
NM_000188chr105696 487 206 192 30 --170 --
NM_000192chr121311 ----1983
NM_000202chrX113938 3255 2718 2692 2613 2492 2482 2451 2426 2414 1025 --22697 43 12770
NM_000208chr19104119 3522 3302 1574 1397 837 760 753 517 37 ------
NM_000216chrX43175 568 116 78 ------
NM_000217chr12165222 5175 4938 4415 4188 4178 3662 3654 3449 3353 1956 1783 1695 1602 827 316 --14062 --
NM_000222chr431500 655 55 21990 209 11382 --
NM_000248chr342388 2382 2021 1928 12361 --1779
NM_000258chr32243 52 --1166 --
NM_000259chr15166372 5018 4887 4673 4625 4546 4519 4238 4161 2484 2425 2416 2248 405 366 143 35745 5441 115 14627 --
NM_000264chr963134 2076 1215 1174 1086 284 ------
NM_000266chrX3993 196 113 1265 ----
NM_000267chr17113475 3459 2944 2934 2749 2667 2162 1125 952 887 62 --32862 2426 2142 --
NM_000271chr181223 ------
NM_000276chrX42129 1957 435 152 12173 3784 355 300 --
NM_000280chr111688 ------
NM_000303chr167950 511 496 356 235 171 149 --31321 1266 78 11454
NM_000304chr173878 411 385 --1416 --
NM_000318chr822297 108 --52749 2020 1894 1874 528 42034 1908 693 561
NM_000319chr122989 67 ------
NM_000321chr1331279 79 54 2456 262 ----
NM_000322chr63267 128 66 21596 99 --21163 26
NM_000330chrX1651 11526 1440 --
NM_000332chr6146511 6128 5911 4887 4761 2869 2429 1970 1165 509 499 441 325 34 1915 26711 2325 --
NM_000333chr32395 112 1106 ----
NM_000334chr17152205 2104 2085 1972 1937 1855 1797 1782 1760 1750 714 411 292 271 178 --11896 --
NM_000335chr371898 1535 847 787 631 485 95 21872 1612 21567 527 --
NM_000337chr5166519 6234 6062 5978 5275 5265 5177 4919 4660 4653 2315 2147 1256 949 724 533 --11301 15430
NM_000345chr43867 182 127 ------
NM_000353chr164810 248 200 178 1979 11082 1844
NM_000358chr5154 ------
NM_000361chr2062123 1813 752 466 108 48 11405 2575 521 --
NM_000362chr22193406 3006 2937 2885 2687 2214 1454 1392 1291 1210 846 821 400 387 371 353 176 50 29 13324 33126 832 70 12909
NM_000365chr124377 322 111 26 ------
NM_000368chr9104356 4242 4101 3695 3012 1665 1038 929 716 195 21253 405 2457 221 --
NM_000378chr113782 321 81 21261 126 ----
NM_000379chr241212 415 366 47 ------
NM_000386chr172563 25 --129 --
NM_000388chr331152 826 513 --2883 481 --
NM_000389chr6111430 1138 1118 979 600 531 380 331 286 261 124 --31482 1342 382 --
NM_000390chrX23051 937 11001 ----
NM_000391chr11131725 1664 1578 1446 1211 1184 1145 528 492 477 253 194 125 1162 ----
NM_000393chr21153 12020 1466 --
NM_000399chr102330 99 132 ----
NM_000408chr22665 545 1951 ----
NM_000411chr2162813 2449 2045 1309 1196 253 22150 531 32454 1229 232 --
NM_000421chr171126 ------
NM_000423chr12145 132 ----
NM_000424chr121226 1268 --128
NM_000425chrX7711 589 558 210 170 122 55 --1715 --
NM_000427chr1173 ----1196
NM_000428chr1452255 2223 1777 1745 141 ----2498 309
NM_000430chr1753723 3062 3039 838 23 22947 821 13433 --
NM_000435chr199746 646 630 266 251 244 121 79 56 1968 2297 218 --
NM_000439chr552557 1614 814 186 136 42126 2019 1832 1569 ----
NM_000442chr174513 225 214 112 --1229 --
NM_000445chr85833 773 705 299 48 --1308 196
NM_000448chr1142709 2669 1010 71 33105 573 149 12006 --
NM_000451chrX71884 667 459 250 159 96 35 21773 725 31354 653 563 21523 1387
NM_000452chr1331889 1771 1518 21716 732 11760 --
NM_000458chr174678 629 223 166 --1917 --
NM_000461chr3154362 4279 4134 3584 3339 2965 2888 1710 1312 1222 1140 1096 792 525 291 1880 11232 1586
NM_000462chr151166 21155 411 ----
NM_000474chr72526 230 ------
NM_000478chr15649 467 216 172 94 --150 --
NM_000488chr1175 ------
NM_000489chrX73044 2826 1099 1026 778 295 124 12919 1265 --
NM_000493chr62195 150 --1858 --
NM_000495chrX1955 1879 ----
NM_000503chr821506 1385 ------
NM_000505chr5127 ------
NM_000508chr4--2728 629 2824 329 --
NM_000516chr201120 --1235 --
NM_000523chr261175 821 474 387 268 141 1759 ----
NM_000525chr1171481 1330 1234 1208 1052 235 107 ----1207
NM_000533chrX71830 1706 1485 1440 348 175 70 ----1258
NM_000539chr391514 1439 1192 1014 518 496 258 56 40 --1433 2982 266
NM_000542chr28695 258 251 169 153 141 129 77 --1327 --
NM_000546chr1751132 1120 857 128 51 --21022 37 --
NM_000555chrX137652 7125 7010 6994 6669 5659 5627 4934 2777 2764 2701 2406 1958 37820 5035 2595 46979 5002 4854 2052 25902 5178
NM_000557chr202390 50 1353 1363 --
NM_000567chr15897 890 770 163 104 1827 280 32 1965
NM_000572chr13409 357 115 ------
NM_000578chr251733 1716 1631 1310 464 1679 ----
NM_000599chr2214477 4105 4050 3979 3562 3531 3482 3470 3291 3247 3163 2994 1678 1449 831 640 610 568 550 497 67 23744 1123 23190 36 12919
NM_000609chr10112992 2918 2795 2731 2614 2557 2209 2162 853 708 82 22849 1217 12665 --
NM_000610chr1162943 2556 1930 819 358 249 12119 1416 --
NM_000612chr11143679 3631 3552 2895 2874 2606 2418 843 628 521 320 258 149 50 ------
NM_000615chr1162802 2420 1845 1063 893 584 ------
NM_000618chr12145412 5380 4944 4786 4256 4222 2465 2331 2027 2007 1262 532 497 350 15789 25835 5114 45548 2620 1067 298
NM_000618chr12145412 5380 4944 4786 4256 4222 2465 2331 2027 2007 1262 532 497 350 15789 25835 5114 45548 2620 1067 298
NM_000619chr12--1486 ----
NM_000620chr12172135 2069 2011 1908 1876 1867 1503 1432 1401 826 739 505 255 246 168 130 99 1722 11534 12027
NM_000621chr1321434 1284 ------
NM_000633chr1863397 3182 1670 1262 1045 560 24057 835 35043 3419 3193 --
NM_000635chr1981582 1399 600 445 290 198 136 21 --1453 --
NM_000660chr194230 218 212 203 ------
NM_000668chr471364 1176 1170 1152 1146 243 42 ------
NM_000684chr102808 425 --139 --
NM_000687chr202284 56 ------
NM_000693chr1551575 1428 1202 91 21 --1154 --
NM_000706chr122635 232 ------
NM_000719chr12236458 6315 6280 6225 5671 5531 5329 5198 5002 4481 4458 4302 4228 2632 2506 2357 2140 791 611 457 407 308 250 --24448 2146 15782
NM_000721chr1132654 2118 2090 2083 1836 1733 1688 1048 524 438 311 299 36 --1313 --
NM_000723chr17121294 1282 1251 1206 1099 491 449 433 278 257 167 106 1370 2496 289 11406
NM_000724chr1041454 1385 1240 1226 --11435 --
NM_000725chr126940 780 330 258 216 190 --2332 268 --
NM_000726chr231064 976 316 ----1955
NM_000738chr113782 181 132 --3940 843 113 --
NM_000739chr72589 71 ------
NM_000757chr17891 734 319 300 255 91 78 --3741 333 323 --
NM_000767chr1971563 1412 1397 1069 1004 340 125 11152 --21121 477
NM_000773chr101121 ------
NM_000793chr14154940 4924 4544 4538 4026 3980 3395 3368 3188 1453 1326 1077 890 555 205 34621 1607 442 13340 11275
NM_000795chr116936 921 320 310 107 41 --41119 942 265 35 --
NM_000800chr531346 668 422 ----1671
NM_000801chr2031064 996 191 ------
NM_000806chr5174 ------
NM_000810chr15139 ------
NM_000811chr51284 ------
NM_000813chr542132 1167 507 40 25021 1188 ----
NM_000814chr1563938 3928 2818 1674 1240 524 13889 13914 --
NM_000816chr52426 170 ------
NM_000817chr21238 ------
NM_000818chr10--1368 ----
NM_000824chr41387 ------
NM_000826chr42959 605 198 ----
NM_000827chr572166 2003 1805 1615 1592 859 628 ----21872 912
NM_000831chr1246059 6043 5946 5575 5533 5491 5404 5259 5232 4825 4421 4154 4116 4103 3841 1806 1767 1261 1068 375 263 195 168 135 --45925 5294 1627 394 --
NM_000833chr1631266 1158 172 --21012 557 --
NM_000834chr1271298 897 318 242 216 192 99 1406 1267 --
NM_000836chr199992 933 853 791 724 697 636 627 313 --2939 742 --
NM_000837chr87525 406 365 166 142 130 85 --1210 1531
NM_000838chr631094 564 46 --11016 --
NM_000839chr34432 353 339 144 ------
NM_000841chr65851 724 610 596 310 --1257 --
NM_000842chr111655 1682 ----
NM_000864chr15960 952 824 795 271 ------
NM_000868chrX3292 272 256 1843 ----
NM_000870chr561307 653 559 425 401 204 1225 1240 --
NM_000872chr1031373 1078 489 --21323 312 --
NM_000875chr15216448 5957 5842 4800 4616 4416 4372 2799 1720 1580 1486 1335 958 858 845 813 610 340 325 315 97 --24749 1854 --
NM_000876chr63379 172 70 ------
NM_000883chr75620 483 250 198 68 ------
NM_000883chr75620 483 250 198 68 ------
NM_000891chr1743601 3286 2931 1122 ------
NM_000894chr19----165 123
NM_000902chr392952 2913 2897 2824 2386 2280 2136 2039 1293 23123 700 12899 21974 485
NM_000910chr431805 1535 90 --11549 --
NM_000914chr61139 ------
NM_000917chr10125 ------
NM_000919chr51465 ------
NM_000922chr114423 170 164 110 197 ----
NM_000924chr12141354 1293 1270 1195 1145 1127 1086 1021 972 865 469 366 233 167 --1321 --
NM_000926chr11158175 8150 7942 6891 6761 3757 3436 2857 1575 1460 1384 1160 1127 1045 838 47076 3115 2043 1139 28254 2090 --
NM_000933chr2011652 21494 1437 ----
NM_000935chr311067 ------
NM_000939chr2265 31 --186 --
NM_000944chr411693 --11556 --
NM_000945chr211316 1180 11318 --
NM_000949chr53962 733 110 ------
NM_000960chr193800 498 312 1224 ----
NM_000961chr20143728 3301 2904 2488 2438 1107 1035 594 529 358 343 270 132 120 2996 252 33798 2873 67 33468 3335 3039
NM_000962chr982638 2156 2059 1920 1043 1017 933 182 --12305 --
NM_000964chr1781335 1311 1262 1228 944 410 200 126 --2974 106 --
NM_000965chr321058 954 11032 ----
NM_000966chr12131041 1024 978 929 882 740 674 432 338 221 173 103 63 --3756 711 300 1117
NM_000971chr8--159 ----
NM_000983chr141444 1174 374 129 ------
NM_000984chr171437 ------
NM_001001132chr2141367 1289 1031 113 11180 --11254
NM_001001323chr122170 140 1174 ----
NM_001001331chr3122526 2311 2219 2059 1931 1904 1874 1842 899 354 276 267 1254 ----
NM_001001342chr1021312 264 --21300 1281 11063
NM_001001389chr1162943 2556 1930 819 358 249 12119 1416 --
NM_001001390chr1162943 2556 1930 819 358 249 12119 1416 --
NM_001001391chr1162943 2556 1930 819 358 249 12119 1416 --
NM_001001392chr1162989 2602 1976 865 404 295 12165 1462 --
NM_001001395chr1222661 2237 ------
NM_001001433chr2042736 1071 149 42 22830 2390 --13052
NM_001001436chr16174 1735 ----
NM_001001481chr822614 2230 --122 --
NM_001001484chr102957 298 12425 ----
NM_001001502chr53390 112 91 ------
NM_001001522chr113321 161 34 ------
NM_001001523chr171260 1230 534 245 87 51 26 --1539 1920
NM_001001549chr772019 2009 1906 852 602 530 205 1582 1604 --
NM_001001550chr772019 2009 1906 852 602 530 205 1582 1604 --
NM_001001552chr13330 315 117 ------
NM_001001555chr772019 2009 1906 852 602 530 205 1582 1604 --
NM_001001557chr831589 1495 170 11681 3661 554 172 --
NM_001001560chr223165 159 127 --1748 --
NM_001001664chr252855 2556 1202 1052 362 ------
NM_001001684chr1741984 1782 869 790 11700 1226 22136 1787
NM_001001740chr1197 ------
NM_001001740chr1197 ------
NM_001001890chr21134246 4167 4084 3993 3000 2943 2855 2812 2790 1112 746 177 67 12840 13478 --
NM_001001924chr861488 1482 1429 1355 463 325 21784 1688 11714 --
NM_001001925chr861488 1482 1429 1355 463 325 21784 1688 11714 --
NM_001001931chr861488 1482 1429 1355 463 325 21784 1688 11714 --
NM_001001936chr1031141 327 27 ----1914
NM_001001974chr1011999 12141 --12329
NM_001001995chrX----1161 1555
NM_001002009chr7126 1182 ----
NM_001002010chr7126 1182 ----
NM_001002018chr16487 66 39 31 --125 --
NM_001002026chr362284 1715 450 372 302 39 --1341 21765 1564
NM_001002031chr12131 --121 --
NM_001002233chr852128 1865 1448 774 114 1197 ----
NM_001002243chr2151 ------
NM_001002245chr173417 263 45 ------
NM_001002246chr173417 263 45 ------
NM_001002247chr173417 263 45 ------
NM_001002248chr173417 263 45 ------
NM_001002249chr173417 263 45 ------
NM_001002252chr12287 30 --165 --
NM_001002255chr62355 143 ------
NM_001002265chr104663 168 157 147 ------
NM_001002266chr104663 168 157 147 ------
NM_001002269chr91455 ------
NM_001002295chr10--1831 ----
NM_001002296chr8278 27 11039 1504 --
NM_001002762chr10112589 2499 2375 2300 2034 1189 966 868 828 515 241 12576 32625 2042 983 --
NM_001002811chr12428 322 2474 166 ----
NM_001002812chr12428 322 2474 166 ----
NM_001002812chr12428 322 2474 166 ----
NM_001002814chr873628 3613 3085 2669 1448 774 114 23672 197 23618 3089 12912
NM_001002838chrX4706 674 668 440 --11676 --
NM_001002843chr151346 1199 ----
NM_001002860chr1474049 2967 1680 1497 1083 552 518 23129 1865 ----
NM_001002909chr17122142 2118 1738 1663 1592 1387 594 373 344 316 222 205 --32073 1918 1910 1210
NM_001002919chr21128 ------
NM_001003406chr22133216 3179 3132 2966 2959 2934 2857 2647 2326 1257 590 455 320 --33221 1227 190 11305
NM_001003652chr18148495 8041 7643 6860 6295 2817 2365 2333 2304 2225 1002 748 448 206 38176 6847 6362 1939 --
NM_001003674chr18196880 6466 5816 4914 4898 4706 4349 4304 2345 2307 2257 2221 1796 1429 1198 1137 1128 193 67 22490 451 25806 2665 --
NM_001003675chr18196880 6466 5816 4914 4898 4706 4349 4304 2345 2307 2257 2221 1796 1429 1198 1137 1128 193 67 22490 451 25806 2665 --
NM_001003676chr118643 375 363 348 336 261 239 150 ----1736
NM_001003682chr12536 514 ------
NM_001003694chr34578 434 148 50 ------
NM_001003712chr1242765 1586 1117 303 ------
NM_001003792chr3174 ------
NM_001003793chr3174 ------
NM_001003800chr993399 3387 3286 1483 1328 1249 1139 1107 574 --31301 1141 862 --
NM_001003809chr183116 76 45 1101 ----
NM_001003810chr41723 1621 ----
NM_001003940chr15153611 3584 3025 2759 2570 2506 2398 2388 1513 1428 1256 1247 1184 1031 402 1264 43550 3190 3015 428 --
NM_001003942chr15153611 3584 3025 2759 2570 2506 2398 2388 1513 1428 1256 1247 1184 1031 402 1264 43550 3190 3015 428 --
NM_001003943chr15153615 3588 3029 2763 2574 2510 2402 2392 1517 1432 1260 1251 1188 1035 406 1268 43554 3194 3019 432 --
NM_001004051chrX--141 ----
NM_001004065chr982931 2920 2859 2559 1561 559 439 337 13646 ----
NM_001004105chr5----166 --
NM_001004127chr136845 830 786 722 636 180 ------
NM_001004196chr32802 316 1977 1204 --
NM_001004304chr12143072 3063 3007 2785 2413 2206 2134 2038 1253 1048 685 551 488 310 21285 876 --12252
NM_001004317chr661641 1222 1029 956 908 353 1572 ----
NM_001004342chr1265818 5552 5074 5056 4774 4762 4706 4619 4504 1998 1908 1613 1408 1396 1315 1240 1049 856 837 815 777 741 702 607 455 382 25356 884 75564 4390 1912 1433 1425 1348 1249 --
NM_001004354chr910873 858 816 806 783 769 761 755 179 58 1363 1220 --
NM_001004360chr241702 1598 1433 320 ----1586
NM_001004419chr1294363 4355 4334 4315 4071 4036 560 441 272 11252 24160 3699 11333
NM_001004439chr1581113 1019 942 921 835 511 464 280 2492 133 11012 --
NM_001004441chr5--21175 203 --11376
NM_001005209chr23680 98 79 1191 --1183
NM_001005217chr4175 ------
NM_001005271chr1791081 853 341 273 198 185 151 138 92 1264 3994 304 278 --
NM_001005273chr1791081 853 341 273 198 185 151 138 92 1264 3994 304 278 --
NM_001005290chr12366 108 1486 1210 --
NM_001005340chr72857 544 ------
NM_001005353chr141078 466 362 175 ------
NM_001005353chr141078 466 362 175 ------
NM_001005354chr123518 48 21 ------
NM_001005366chr122882 739 ------
NM_001005375chrY21397 1183 11527 197 --
NM_001005377chr193113 66 55 ------
NM_001005386chr22204 99 ------
NM_001005404chr1753595 3360 2844 1335 969 24289 4268 1130 163
NM_001005408chr172357 147 ------
NM_001005463chr1062433 2012 1879 1048 863 715 ------
NM_001005473chr5116304 5699 5640 5462 4835 4694 2305 1477 374 338 198 14336 --24924 4838
NM_001005505chr371167 377 326 100 64 57 30 --1458 --
NM_001005527chr33231 169 68 1242 ----
NM_001005609chrX113464 3448 3353 2488 2374 1403 807 738 415 60 35 11085 22418 604 23453 1424
NM_001005739chr2----1638 --
NM_001005743chr1471177 1120 546 486 397 367 255 ------
NM_001005744chr1471177 1120 546 486 397 367 255 ------
NM_001005745chr1471177 1120 546 486 397 367 255 ------
NM_001005746chr231064 976 316 ----1955
NM_001005747chr231064 976 316 ----1955
NM_001005782chr21216 ------
NM_001005849chr171140 ------
NM_001005910chr31499 ------
NM_001005911chr31499 ------
NM_001005920chr1661088 996 864 820 722 357 ------
NM_001006115chr3102687 2387 2352 2250 2237 2127 1125 683 407 30 --41885 877 722 196 --
NM_001006600chr51381 ------
NM_001006617chr941317 1096 909 488 ------
NM_001006619chr941317 1096 909 488 ------
NM_001006620chr941317 1096 909 488 ------
NM_001006621chr941317 1096 909 488 ------
NM_001006626chr72589 71 ------
NM_001006627chr72589 71 ------
NM_001006628chr72589 71 ------
NM_001006629chr72589 71 ------
NM_001006630chr72589 71 ------
NM_001006631chr72589 71 ------
NM_001006632chr72589 71 ------
NM_001006634chr162518 33 ------
NM_001006636chr22821 679 1853 ----
NM_001006641chr951631 1195 397 335 195 --31570 1508 518 21198 533
NM_001006642chr951631 1195 397 335 195 --31570 1508 518 21198 533
NM_001006643chr951631 1195 397 335 195 --31570 1508 518 21198 533
NM_001006657chr262989 2840 2458 911 243 236 --12579 --
NM_001006665chr12581 171 --160 --
NM_001006945chr11655 ------
NM_001007023chr14154940 4924 4544 4538 4026 3980 3395 3368 3188 1453 1326 1077 890 555 205 34621 1607 442 13340 11275
NM_001007024chr17114166 3753 3518 3116 3042 1771 535 476 459 430 255 23462 2703 2847 719 2741 617
NM_001007025chr17114166 3753 3518 3116 3042 1771 535 476 459 430 255 23462 2703 2847 719 2741 617
NM_001007067chr831013 345 83 ------
NM_001007068chr831013 345 83 ------
NM_001007069chr831013 345 83 ------
NM_001007070chr831013 345 83 ------
NM_001007075chr421071 898 ------
NM_001007097chr9104532 4484 4202 3513 3505 3156 3125 3093 1900 218 11960 23339 3161 11834
NM_001007102chr6--21137 83 ----
NM_001007156chr1571761 1475 1264 1223 432 422 198 --11842 11766
NM_001007226chr1721419 1299 11047 ----
NM_001007227chr1721419 1299 11047 ----
NM_001007228chr1721419 1299 11047 ----
NM_001007229chr1721419 1299 11047 ----
NM_001007230chr1721419 1299 11047 ----
NM_001007237chr172146 1960 1939 1871 168 141 50 1463 ----
NM_001007246chr2141548 1273 1193 749 ------
NM_001007257chr111043 --21416 1031 --
NM_001007267chr21707 1135 ----
NM_001007271chr104765 374 304 169 --1189 --
NM_001007277chr112778 428 --2447 195 --
NM_001007466chr6103877 3183 3146 1965 1897 1807 1629 1134 1109 27 24992 1835 21477 1136 --
NM_001007544chr12427 352 ------
NM_001007553chr131114 144 77 ----193
NM_001007559chr1831738 1434 73 --31707 698 91 11875
NM_001007565chr31276 ----150
NM_001007794chr12642 584 ------
NM_001008220chr5163787 3607 3275 3254 3132 2542 980 910 882 591 553 305 166 155 142 124 1202 13629 --
NM_001008222chrX71194 1185 1105 1059 1003 319 295 --1560 1382
NM_001008223chr125510 460 119 57 40 ------
NM_001008239chr1873257 2505 790 426 299 148 142 12417 2594 39 --
NM_001008388chr41328 2211 94 --1412
NM_001008392chr393575 3410 3378 2880 2691 1439 1159 832 317 12857 22640 23 --
NM_001008397chr51230 ------
NM_001008405chr711296 21488 68 --11540
NM_001008407chr7101809 1449 1336 1190 677 662 557 531 288 40 21504 656 ----
NM_001008495chr82753 505 ------
NM_001008541chr1042255 707 595 388 ----1196
NM_001008541chr1042255 707 595 388 ----1196
NM_001008566chr222441 368 ------
NM_001008660chr1141357 595 115 66 ------
NM_001008701chr19232962 2934 2838 2753 2741 2575 2492 2479 2284 2027 2020 1193 1181 882 871 816 766 688 506 436 317 308 202 12781 32946 1246 666 --
NM_001008726chr1421691 1650 ------
NM_001008738chr532347 1053 102 1756 32928 2359 1892 22059 1059
NM_001008744chr1421249 85 --11494 11502
NM_001008777chr171231 ------
NM_001008800chr1146 ------
NM_001008801chr1921542 1442 11582 21549 29 11716
NM_001008883chr1146 ------
NM_001009183chr14147 1425 ----
NM_001009184chr87525 406 365 166 142 130 85 --1210 1531
NM_001009185chr51723 ----1737
NM_001009552chr81400 ------
NM_001009554chr443429 1871 1757 102 2980 930 --11510
NM_001009554chr443429 1871 1757 102 2980 930 --11510
NM_001009555chr441437 1331 608 506 11248 1711 --
NM_001009566chr181116 1076 1069 379 292 223 120 60 --1256 --
NM_001009571chr721557 1355 21199 1117 ----
NM_001009598chr1144 ------
NM_001009880chr22164812 4546 3641 3588 1805 1568 1498 1252 1173 1087 939 887 655 504 191 140 11755 24375 830 --
NM_001009899chr366017 5848 4435 4406 2062 1448 35950 4580 4565 22267 1417 32232 2097 1584
NM_001009955chr11112 2229 162 2529 134 --
NM_001009955chr11112 2229 162 2529 134 --
NM_001009959chr262580 1978 851 602 568 436 12640 --1482
NM_001009960chr732837 2160 1057 11954 22540 906 22039 919
NM_001009993chr2114363 4199 4113 4086 3735 3660 3190 3011 2840 1463 1302 --11606 --
NM_001009996chr31198 ------
NM_001010861chr132682 2049 821 12089 ----
NM_001010867chr1206580 6209 5941 5657 5405 5258 4393 2603 2596 2101 1759 1392 813 807 788 643 618 468 202 75 45703 5059 4122 4074 65393 2633 2323 2070 1583 815 --
NM_001010877chr6--1169 ----
NM_001010888chrX64492 4102 4093 4080 3744 1408 --1533 34086 1255 669
NM_001010891chr545636 2586 2331 560 24515 349 25338 5170 45203 2757 2620 1371
NM_001010895chr95698 638 456 390 183 1423 ----
NM_001010908chr10--1592 ----
NM_001010924chr103993 332 249 1459 ----
NM_001010926chr13659 78 57 ------
NM_001010934chr71385 ------
NM_001010986chrX178 1429 11834 1403
NM_001011546chr20131 ------
NM_001011551chrX1460 ------
NM_001011658chrX21674 1374 --2671 340 31408 704 505
NM_001011663chr10----1290 --
NM_001011666chr7136358 5955 5046 4783 4513 4445 2466 1966 1718 1449 1262 572 492 --21437 1264 35958 5054 1580
NM_001011705chr131271 1288 ----
NM_001011708chr262795 2024 1155 1129 1119 271 22563 37 ----
NM_001011713chr1411005 ------
NM_001012264chr1410774 764 737 692 668 633 390 237 225 86 1645 --2788 118
NM_001012267chr971976 1685 1456 543 478 389 149 11633 11714 --
NM_001012300chr123226 214 30 ------
NM_001012329chr1112226 2154 2094 1663 1583 1554 660 493 331 107 101 --31718 1577 1538 --
NM_001012338chr15262 40 --167 --
NM_001012393chr11104339 4184 4162 3242 3210 1227 1015 958 891 275 21352 310 24168 627 13219
NM_001012398chr162960 897 ------
NM_001012415chr93730 640 217 ------
NM_001012420chr152845 71 11887 ----
NM_001012423chr152845 71 11887 ----
NM_001012426chr6333290 3084 3074 2995 2877 2843 2464 2393 2115 1373 1332 1298 1242 1187 1111 1083 1059 960 947 920 906 886 796 507 459 325 308 278 258 247 142 66 41 12769 83346 2997 2630 2483 2127 1076 899 46 32801 2663 88
NM_001012427chr6333290 3084 3074 2995 2877 2843 2464 2393 2115 1373 1332 1298 1242 1187 1111 1083 1059 960 947 920 906 886 796 507 459 325 308 278 258 247 142 66 41 12769 83346 2997 2630 2483 2127 1076 899 46 32801 2663 88
NM_001012454chr71135 1150 ----
NM_001012512chr18--1210 ----
NM_001012513chr18--2221 30 ----
NM_001012514chr24905 155 137 69 ------
NM_001012516chr24905 155 137 69 ------
NM_001012614chr41241 ------
NM_001012732chr441050 867 347 260 ------
NM_001012751chr1031751 1671 427 --1508 --
NM_001012755chrX84572 4414 3145 3074 1639 1009 986 45 31442 1407 139 41582 1272 1087 496 11305
NM_001012968chrX5815 735 573 567 326 --2386 349 --
NM_001012977chrX91315 522 488 287 187 177 159 147 81 ------
NM_001013031chr1083128 2403 1340 1305 1106 816 683 232 1988 22670 2420 1867
NM_001013415chr431427 623 56 ------
NM_001013438chr321015 702 ------
NM_001013439chr32861 548 ------
NM_001013615chr16959 792 334 302 75 58 11150 2468 322 1482
NM_001013620chr1287977 7604 3210 2912 2726 1972 1558 1550 36383 6048 1421 37542 5994 754 36008 3081 2946
NM_001013624chr1771151 908 352 286 228 182 54 31028 955 32 2983 197 1163
NM_001013635chr12101216 1155 1149 1123 1055 1048 893 295 265 26 --21117 297 --
NM_001013690chr12162397 2361 2183 2120 2049 1806 1758 1745 1664 1623 935 904 473 409 363 357 --22403 1625 11602
NM_001013693chr1152493 2452 2445 2245 2163 2154 1972 1830 890 735 428 321 234 215 205 1650 --12476
NM_001013693chr1152493 2452 2445 2245 2163 2154 1972 1830 890 735 428 321 234 215 205 1650 --12476
NM_001013843chr15--1827 ----
NM_001014283chr1351946 1825 1809 1451 709 ------
NM_001014435chr166566 511 414 112 89 53 ------
NM_001014442chr13133 1134 ----
NM_001014443chr11181 ------
NM_001014794chr11291 63 1211 ----
NM_001014795chr11291 63 1211 ----
NM_001014797chr10237840 7733 7687 7603 7236 7206 7042 5584 2769 2515 2352 2337 2327 2293 1833 1791 1632 1460 1050 965 437 300 136 12944 17608 13156
NM_001014839chr181036 907 887 821 424 107 94 65 ------
NM_001014841chr181036 907 887 821 424 107 94 65 ------
NM_001015048chr1453148 2366 2188 1036 975 11304 ----
NM_001015049chr1453148 2366 2188 1036 975 11304 ----
NM_001015053chr17181542 1494 1473 1451 1409 1232 1212 1163 1125 1041 1028 555 418 273 237 163 121 107 --1214 --
NM_001015508chr82703 629 ------
NM_001015877chrX21140 657 22228 524 13006 1817
NM_001015882chr92793 154 ------
NM_001017368chr1782490 2202 1839 1125 931 408 336 310 3887 715 113 32219 1732 164 --
NM_001017371chr231087 946 875 ------
NM_001017395chr353355 3139 3082 802 416 11436 ----
NM_001017424chr14579 529 504 271 ------
NM_001017425chr14579 529 504 271 ------
NM_001017440chr7307990 7911 7614 7449 7101 6920 6553 6517 6422 6410 5582 3300 2943 2838 2817 2546 2519 2350 2250 2093 1629 1601 1515 1479 1093 883 849 736 656 510 37798 7525 1828 57960 6607 2650 1523 888 --
NM_001017523chr1271921 1800 1736 1638 1611 131 26 11862 11744 --
NM_001017916chr17131743 1710 1664 1587 1393 814 775 758 702 600 329 217 165 --21714 706 --
NM_001017917chr17131743 1710 1664 1587 1393 814 775 758 702 600 329 217 165 --21714 706 --
NM_001017920chr21127 ------
NM_001017923chr1431203 48 34 21412 672 ----
NM_001017930chrX51429 1070 1037 1020 993 ------
NM_001017962chr10125 ------
NM_001017973chr5125 ------
NM_001017974chr5125 ------
NM_001017975chr12427 171 ------
NM_001017981chr225570 290 275 72 39 ------
NM_001017995chr5244594 4231 4207 4116 4005 3627 3375 3131 3050 3027 3007 1935 1672 1623 1589 1483 1428 1151 1047 936 760 555 372 275 44570 4029 3631 98 63678 1823 1625 648 193 138 1479
NM_001018005chr15157 124 ----
NM_001018050chr22173252 3185 3015 2764 2734 2692 2616 2604 2564 2524 2487 2352 2133 2108 1172 251 178 --22739 2702 --
NM_001018052chr22173252 3185 3015 2764 2734 2692 2616 2604 2564 2524 2487 2352 2133 2108 1172 251 178 --22739 2702 --
NM_001018054chr11483 ------
NM_001018064chr95844 779 284 227 27 ----130
NM_001018065chr9125857 4795 4613 3954 3887 3825 1669 621 604 575 373 140 22262 1426 55722 4838 2411 2010 1677 --
NM_001018066chr9125857 4795 4613 3954 3887 3825 1669 621 604 575 373 140 22262 1426 55722 4838 2411 2010 1677 --
NM_001018072chr1271921 1800 1736 1638 1611 131 26 11862 11744 --
NM_001018074chr543517 3388 3220 1170 1635 11101 --
NM_001018075chr543517 3388 3220 1170 1635 11101 --
NM_001018076chr543517 3388 3220 1170 1635 11101 --
NM_001018077chr543517 3388 3220 1170 1635 11101 --
NM_001018108chr15132032 1820 1507 919 734 727 654 338 215 192 173 157 79 --1217 --
NM_001018111chr783530 3235 1055 923 631 610 560 431 21538 545 1587 1124
NM_001020658chr141411 449 441 131 --11385 --
NM_001020658chr141411 449 441 131 --11385 --
NM_001023567chr153459 349 71 --1187 --
NM_001023587chr341179 374 318 45 ------
NM_001024024chr14138 ------
NM_001024070chr14134 ------
NM_001024094chr543517 3388 3220 1170 1635 11101 --
NM_001024226chr13939 215 48 --121 --
NM_001024227chr13939 215 48 --121 --
NM_001024228chr13939 215 48 --121 --
NM_001024401chr16172811 2433 2267 2184 2078 2064 2011 1877 1094 1003 787 777 586 474 447 362 352 --32551 962 401 --
NM_001024460chr641020 985 428 147 --1446 --
NM_001024463chr152847 229 --1129 --
NM_001024649chr562773 1882 859 693 528 37 ----1546
NM_001024807chr194346 218 72 40 --1309 --
NM_001024808chr12132525 2490 2422 2363 2128 1905 1037 984 864 823 732 540 404 --22653 2321 --
NM_001024809chr1781335 1311 1262 1228 944 410 200 126 --2974 106 --
NM_001024845chr14862 780 422 45 ----1810
NM_001024858chr14232970 2766 2705 2690 2630 2569 2554 2504 2383 2285 2102 2045 1991 916 885 693 680 655 622 314 301 231 69 12455 52506 2109 717 627 444 1891
NM_001024912chr198600 472 406 300 261 250 181 83 1426 1474 11200
NM_001024934chr61557 --1559 --
NM_001024935chr61557 --1559 --
NM_001024936chr61557 --1559 --
NM_001024937chr1713774 717 710 699 607 585 515 279 246 184 86 63 45 --1253 1203
NM_001024947chr5196 21120 1006 ----
NM_001024948chr142855 2423 2153 1274 ----1712
NM_001025076chr10145122 5030 5002 4977 4738 4340 4275 2441 2255 2012 1110 394 169 28 34164 1910 463 25929 4922 --
NM_001025077chr10176480 6388 6360 6335 6096 5698 5633 2468 1752 1527 1162 1092 1052 442 223 163 28 25522 1821 27287 6280 --
NM_001025079chr383728 1135 1105 904 738 660 623 418 --1662 --
NM_001025081chr1871278 1191 1002 626 480 246 106 11081 11035 21251 488
NM_001025090chr1871278 1191 1002 626 480 246 106 11081 11035 21251 488
NM_001025092chr1871278 1191 1002 626 480 246 106 11081 11035 21251 488
NM_001025101chr1871278 1191 1002 626 480 246 106 11081 11035 21251 488
NM_001025105chr531344 1333 59 ----11383
NM_001025108chr252825 1081 708 643 82 24054 3194 33290 3183 710 22981 2840
NM_001025109chr111954 936 865 734 418 388 325 312 268 110 50 1998 1788 --
NM_001025205chr36295 112 93 68 41 28 --1297 --
NM_001025232chr121144 ------
NM_001025233chr1232088 1807 625 --11035 --
NM_001025252chr811104 --1655 12884
NM_001025253chr811104 --1655 12884
NM_001025266chr3194487 4398 4234 3958 3833 3286 1957 1900 1831 1700 1668 1513 1486 1278 1247 741 502 489 419 --13802 13969
NM_001025366chr671487 1417 697 604 518 52 25 ------
NM_001025366chr671487 1417 697 604 518 52 25 ------
NM_001025367chr671487 1417 697 604 518 52 25 ------
NM_001025367chr671487 1417 697 604 518 52 25 ------
NM_001025368chr671487 1417 697 604 518 52 25 ------
NM_001025368chr671487 1417 697 604 518 52 25 ------
NM_001025369chr681503 1433 1168 713 620 534 68 41 ------
NM_001025369chr681503 1433 1168 713 620 534 68 41 ------
NM_001025370chr671487 1417 697 604 518 52 25 ------
NM_001025370chr671487 1417 697 604 518 52 25 ------
NM_001025579chr1791175 1128 983 818 807 764 478 121 23 1868 178 --
NM_001025580chrX134115 3668 3603 3257 3205 3074 615 391 382 363 333 320 33 --54123 4097 3480 1389 49 --
NM_001025595chr421598 1559 ------
NM_001025596chr111143 ------
NM_001025780chr911033 --11002 11165
NM_001029835chr73355 55 33 --157 --
NM_001029858chr632995 853 842 13014 12997 21314 1031
NM_001029860chr8----187 --
NM_001029864chr2062449 2122 1878 1606 371 276 11863 22131 822 2970 836
NM_001029869chr5241 22 ----146
NM_001029875chr572807 2034 2014 1199 1185 553 137 --12596 --
NM_001029882chr11157 --3171 122 75 --
NM_001029882chr11157 --3171 122 75 --
NM_001029891chrX3740 141 40 --168 --
NM_001029976chr82148 43 --185 --
NM_001029998chr421351 583 11189 ----
NM_001030001chr14--1329 ----
NM_001030007chr1693731 3631 2836 2821 1228 1060 893 761 184 33567 917 751 33088 2472 267 --
NM_001030055chr1434422 2972 874 41511 1482 1433 580 ----
NM_001030059chr101301 --1339 --
NM_001031677chr51398 ----1392
NM_001031679chr1283284 3156 2726 2658 2628 2575 2527 2240 12498 ----
NM_001031680chr192112 2068 2009 1957 1867 985 632 368 277 --122 1423
NM_001031685chr1--1372 ----
NM_001031690chr7202927 2774 2758 2740 2732 2405 2247 2087 2038 1178 1170 941 835 819 409 377 133 125 66 33 32259 1148 437 62118 2043 1228 1189 1138 27 --
NM_001031695chr22185266 5200 5094 5081 4932 4922 4607 4504 4468 4380 3906 3474 3399 1221 881 711 608 600 11564 35087 4996 1385 --
NM_001031702chr33772 233 89 1247 ----
NM_001031709chr10--1289 ----
NM_001031732chr452996 2848 1179 726 657 --12894 --
NM_001031738chr21204 ------
NM_001031740chr141181 1133 443 180 1226 ----
NM_001031801chr222146 32 ------
NM_001031804chr1673986 3594 3518 3462 3264 2916 446 24086 3182 21149 778 11207
NM_001031812chr51944 1772 ----
NM_001032279chr113338 50 31 ------
NM_001032280chr6101476 1195 1178 1111 453 238 226 200 177 93 --127 --
NM_001032282chr8173 --11184 --
NM_001032283chr122952 36 ------
NM_001032284chr122952 36 ------
NM_001032288chr2071308 585 407 381 284 126 27 --2400 393 21236 551
NM_001032289chrX6764 340 268 174 70 50 --1224 --
NM_001032293chr17----1120 --
NM_001032296chr13102849 2723 2373 2173 966 840 678 662 188 54 --22498 216 --
NM_001032380chr1021843 213 1529 ----
NM_001033025chr131244 1226 531 ------
NM_001033026chr194449 162 86 50 ------
NM_001033044chr191783 1777 1662 1197 353 277 204 67 61 --134 --
NM_001033045chr23701 146 99 24188 4021 ----
NM_001033047chr472293 1935 630 429 190 77 28 11776 1245 11874
NM_001033056chr191783 1777 1662 1197 353 277 204 67 61 --134 --
NM_001033057chr321452 664 ------
NM_001033059chr651552 799 667 650 550 ------
NM_001033081chr161585 610 455 198 191 60 31504 622 406 2615 244 --
NM_001033082chr161585 610 455 198 191 60 31504 622 406 2615 244 --
NM_001033085chr21238 ------
NM_001033087chr2062263 1263 1017 896 679 26 1562 11254 --
NM_001033117chr3224697 4556 4481 4403 4395 4303 4281 3471 1614 1603 1568 1494 1478 1445 1318 751 665 544 319 292 197 72 23700 845 44045 814 691 83 11882
NM_001033507chr1133 1304 1314 11494
NM_001033551chr17274069 4054 3821 3740 3712 3688 3622 3361 3190 3135 2879 2688 2588 1434 1184 1129 1086 1055 989 593 577 428 417 221 141 76 22 12672 74058 1436 1280 1090 258 227 150 --
NM_001033557chr21466 ------
NM_001033561chr175826 809 337 327 314 --1835 --
NM_001033566chr171926 1283 ----
NM_001033568chr171926 1283 ----
NM_001033576chr1792298 2039 944 837 780 769 520 440 243 22564 600 12234 --
NM_001033602chr1332368 2354 137 12323 22430 507 --
NM_001033659chr1731454 1113 346 ------
NM_001033723chr882608 2465 2341 1997 1742 1089 766 484 --12517 --
NM_001033756chr651421 1351 631 538 452 ------
NM_001033756chr651421 1351 631 538 452 ------
NM_001033859chr172106 39 1125 ----
NM_001033925chr1031756 1749 440 1663 ----
NM_001034025chr121916 --1350 1267
NM_001034837chr52626 28 ----1746
NM_001034838chr52626 28 ----1746
NM_001034841chr16104779 4457 4211 4124 4105 3793 3709 3635 663 48 21435 37 24461 4260 44656 4494 4274 4139
NM_001034850chr51136 --1319 --
NM_001034954chr1062453 1248 778 361 335 269 ------
NM_001034955chr1062453 1248 778 361 335 269 ------
NM_001034956chr1062453 1248 778 361 335 269 ------
NM_001034957chr1062453 1248 778 361 335 269 ------
NM_001035254chr9102457 2142 1726 747 729 644 555 392 188 118 1359 41991 1883 663 169 1750
NM_001035256chr2265 31 --186 --
NM_001035260chr101456 ------
NM_001035521chr24737 204 131 86 3786 606 219 ----
NM_001035534chr9121434 1423 1376 1180 1095 1028 970 461 446 342 292 47 --21248 1010 --
NM_001037131chr271273 1257 1165 1039 141 122 101 --1127 --
NM_001037132chr742140 2038 1696 651 12163 172 --
NM_001037133chr742140 2038 1696 651 12163 172 --
NM_001037164chr741786 1320 202 99 ------
NM_001037277chr131604 1139 321 ------
NM_001037278chr131604 1139 321 ------
NM_001037317chr132682 2049 821 12089 ----
NM_001037332chr5132254 2171 2081 1792 583 521 493 364 344 284 259 170 124 12581 --3560 349 336
NM_001037333chr5132254 2171 2081 1792 583 521 493 364 344 284 259 170 124 12581 --3560 349 336
NM_001037334chr181480 ------
NM_001037582chr41323 --1597 2630 462
NM_001037631chr2129 ------
NM_001037872chr21532 ------
NM_001037954chr1143397 2445 2305 1346 ------
NM_001038493chr241100 343 208 108 --1226 --
NM_001038640chr152915 147 ------
NM_001038707chr1102145 2019 1541 1431 839 748 455 440 190 86 12009 21726 636 --
NM_001038707chr1102145 2019 1541 1431 839 748 455 440 190 86 12009 21726 636 --
NM_001039199chr2084793 4468 4164 4019 3849 3203 3161 1717 23117 683 21637 1177 --
NM_001039348chr21801 --11001 --
NM_001039349chr21801 --11001 --
NM_001039350chr7101432 1281 1208 1128 1099 275 237 172 80 73 --21285 241 --
NM_001039355chr144742 374 247 21 --1962 --
NM_001039459chr74763 469 459 323 --2295 227 130
NM_001039465chr14--161 ----
NM_001039479chr1451836 1702 1499 860 29 --11852 --
NM_001039538chr221033 925 12601 ----
NM_001039547chr3117538 7277 7146 6355 6282 6072 5111 3002 2720 2695 1244 22925 2019 21856 557 42868 2735 1870 1217
NM_001039550chr23748 88 54 ------
NM_001039570chr22254457 4436 4385 4198 4154 4130 4113 4036 3979 3950 3826 3630 3531 3283 3084 1678 1307 1229 601 476 248 193 135 94 65 --34438 4182 139 11841
NM_001039571chr22254457 4436 4385 4198 4154 4130 4113 4036 3979 3950 3826 3630 3531 3283 3084 1678 1307 1229 601 476 248 193 135 94 65 --34438 4182 139 11841
NM_001039574chr15916 902 891 302 138 ------
NM_001039577chr1103984 3141 3073 2875 2813 2738 1446 1302 1285 699 23711 1342 24392 738 --
NM_001039582chrX4225 86 74 50 --1361 --
NM_001039583chr223419 218 122 ------
NM_001039584chr223419 218 122 ------
NM_001039590chrX43454 3222 2879 1089 ------
NM_001039591chrX43454 3222 2879 1089 ------
NM_001039618chr1154753 4388 4357 307 234 34837 4670 176 ----
NM_001039690chr1631492 448 150 22235 336 11814 1592
NM_001039697chr951386 1260 1219 649 320 2446 308 31556 1407 618 --
NM_001039711chr17922 910 901 894 193 169 35 11061 --188
NM_001039712chr17922 910 901 894 193 169 35 11061 --188
NM_001039762chr1011560 --1116 --
NM_001039771chr1481053 1030 980 898 881 820 106 58 --2889 219 --
NM_001039802chr141318 1312 429 175 --1183 21321 1042
NM_001039840chrX96000 5946 5924 5684 4837 4163 2343 1673 888 45069 4918 548 205 1890 --
NM_001039877chr196744 614 549 179 164 76 --2816 563 --
NM_001039888chr13792 694 651 1618 ----
NM_001039916chr1241023 347 239 193 --1394 1246
NM_001039917chr1241023 347 239 193 --1394 1246
NM_001039918chr1241023 347 239 193 --1394 1246
NM_001039919chr1241023 347 239 193 --1394 1246
NM_001039920chr1241023 347 239 193 --1394 1246
NM_001039937chr1353876 3195 2517 1001 740 11498 ----
NM_001039938chr1311193 11135 11507 --
NM_001039960chr1281384 1318 1167 514 482 446 237 81 --1303 --
NM_001040001chr642035 544 346 338 --1519 11639
NM_001040002chr17101344 480 361 344 326 230 222 205 105 86 11252 1330 --
NM_001040020chr721499 526 ----1529
NM_001040057chr721253 207 ------
NM_001040100chr3--1324 --11059
NM_001040110chr761848 1474 1455 1311 753 597 --21466 576 --
NM_001040113chr162914 833 1765 ----
NM_001040134chr1961484 1369 1332 1219 1069 132 --31046 381 64 --
NM_001040142chr222015 81 ------
NM_001040143chr222015 81 ------
NM_001040144chr1631492 448 150 22235 336 11814 1592
NM_001040146chr1631492 448 150 22235 336 11814 1592
NM_001040151chr11204391 4263 3993 3935 3831 3767 3637 3444 3383 3220 3144 3000 2951 1839 1118 773 359 313 269 110 24308 3204 23998 3232 21255 827
NM_001040152chr7125054 5020 4092 1970 1856 1794 1706 1385 1271 651 476 343 --15024 12050
NM_001040157chr452643 2211 2035 805 405 11949 ----
NM_001040158chr5178 ------
NM_001040159chr431379 302 80 ------
NM_001040172chr561307 653 559 425 401 204 1225 1240 --
NM_001040173chr561307 653 559 425 401 204 1225 1240 --
NM_001040181chr31978 --1397 174
NM_001040182chr31978 --1397 174
NM_001040183chr31978 --1397 174
NM_001040199chr31978 --1397 174
NM_001040200chr31978 --1397 174
NM_001040202chr441671 884 559 83 --12054 --
NM_001040214chr642218 278 205 64 ------
NM_001040280chr621298 265 ------
NM_001040284chr1665274 5177 4348 3695 747 132 35259 4738 3616 ----
NM_001040402chr443133 2802 866 401 ------
NM_001040409chr21675 1335 ----
NM_001040424chr2172910 2881 2844 2826 2091 910 279 32287 2034 1953 ----
NM_001040429chr1343508 2244 365 67 ------
NM_001040439chr16111310 1140 1122 1013 967 938 925 552 440 258 202 --21160 341 1111
NM_001040441chr161937 1623 1599 1282 1150 626 ------
NM_001040446chr541854 813 598 152 ----12113
NM_001040450chr151380 ------
NM_001040453chr151380 ------
NM_001040624chr852349 2265 2068 532 133 --12351 --
NM_001040625chr852349 2265 2068 532 133 --12351 --
NM_001040626chr852349 2265 2068 532 133 --12351 --
NM_001040627chr852349 2265 2068 532 133 --12351 --
NM_001040628chr852349 2265 2068 532 133 --12351 --
NM_001040629chr852349 2265 2068 532 133 --12351 --
NM_001040630chr852349 2265 2068 532 133 --12351 --
NM_001040633chr72672 128 1775 ----
NM_001040708chr811025 ------
NM_001040709chr1122087 970 909 830 821 644 475 425 188 98 81 62 --42481 753 539 170 21636 883
NM_001040712chr942739 2529 989 429 11209 1431 --
NM_001040715chr1671170 1051 1029 991 373 232 181 --1427 --
NM_001040876chr411375 1262 --11391
NM_001042357chr1051048 586 557 428 53 --2226 22 --
NM_001042358chr1051048 586 557 428 53 --2226 22 --
NM_001042360chr1051048 586 557 428 53 --2226 22 --
NM_001042361chr1051079 617 588 459 84 --2257 53 --
NM_001042363chr1051048 586 557 428 53 --2226 22 --
NM_001042364chr1051079 617 588 459 84 --2257 53 --
NM_001042365chr1051079 617 588 459 84 --2257 53 --
NM_001042368chr95542 326 315 132 79 --3328 182 84 --
NM_001042387chr1051079 617 588 459 84 --2257 53 --
NM_001042388chr183332 106 33 ------
NM_001042389chr1051048 586 557 428 53 --2226 22 --
NM_001042390chr1051048 586 557 428 53 --2226 22 --
NM_001042392chr1051048 586 557 428 53 --2226 22 --
NM_001042393chr1051079 617 588 459 84 --2257 53 --
NM_001042395chr1051048 586 557 428 53 --2226 22 --
NM_001042396chr1051079 617 588 459 84 --2257 53 --
NM_001042397chr1051079 617 588 459 84 --2257 53 --
NM_001042404chr121935 1543 ------
NM_001042413chr9104060 3823 3808 2980 1594 1091 1034 1000 849 71 --32535 1587 820 --
NM_001042424chr472835 2290 2094 1095 418 148 130 22236 372 2637 291 --
NM_001042425chr6101476 1195 1178 1111 453 238 226 200 177 93 --127 --
NM_001042430chr141366 2207 183 2446 119 --
NM_001042437chr2----3880 681 155 --
NM_001042472chr205559 505 463 420 41 --2422 45 --
NM_001042473chr1021989 322 31664 1439 1337 --11471
NM_001042476chr16111997 1933 1892 1783 1719 663 653 477 394 370 85 12197 22178 217 21860 123
NM_001042478chr1125 ------
NM_001042486chr2091560 1529 1369 1245 1134 576 528 410 293 11152 1173 --
NM_001042492chr17113475 3459 2944 2934 2749 2667 2162 1125 952 887 62 --32862 2426 2142 --
NM_001042494chr1593640 3332 3159 2594 2437 1002 902 169 85 12740 --22772 2628
NM_001042495chr1593640 3332 3159 2594 2437 1002 902 169 85 12740 --22772 2628
NM_001042496chr1593640 3332 3159 2594 2437 1002 902 169 85 12740 --22772 2628
NM_001042497chr1593640 3332 3159 2594 2437 1002 902 169 85 12740 --22772 2628
NM_001042498chrX6901 405 311 207 187 127 --1361 --
NM_001042506chrX101156 1000 522 488 287 187 177 159 147 81 ------
NM_001042533chr331086 497 129 ------
NM_001042537chrX22028 680 --11681 1835
NM_001042539chr16101067 987 945 937 266 256 241 162 152 122 --1103 1168
NM_001042543chr421041 1014 ------
NM_001042555chr1294168 4144 3041 3035 2983 1845 1212 782 533 13129 14146 13192
NM_001042576chr201465 --1168 --
NM_001042599chr2147612 7060 6790 6716 6485 6370 5765 5739 5512 5472 2599 2528 1956 61 26908 5980 23038 114 12812
NM_001042601chr332171 661 505 ------
NM_001042603chr1263970 3911 1789 1546 1395 1369 1100 35116 619 463 --
NM_001042604chr3--33553 3175 1552 13466 --
NM_001042632chr2062316 1928 1903 1661 885 120 --11618 --
NM_001042633chr2062316 1928 1903 1661 885 120 --11618 --
NM_001042646chr381711 1552 630 262 93 64 58 49 1340 21577 1388 1122
NM_001042663chr171330 1075 505 346 277 94 58 --21008 348 --
NM_001042664chr171330 1075 505 346 277 94 58 --21008 348 --
NM_001042665chr171330 1075 505 346 277 94 58 --21008 348 --
NM_001042681chr1112400 2283 2250 2157 2055 1874 877 827 570 268 204 ------
NM_001042682chr1112400 2283 2250 2157 2055 1874 877 827 570 268 204 ------
NM_001042682chr1112400 2283 2250 2157 2055 1874 877 827 570 268 204 ------
NM_001042683chr611213 1222 ----
NM_001042724chr195757 565 533 523 270 --1300 --
NM_001042728chr12131041 1024 978 929 882 740 674 432 338 221 173 103 63 --3756 711 300 1117
NM_001042729chr13550 198 23 170 1544 --
NM_001042747chr13550 198 23 170 1544 --
NM_001042749chrX11372 --1759 --
NM_001042750chrX11372 --1759 --
NM_001042751chrX11372 --1759 --
NM_001043318chr14173712 3281 3254 3167 3003 2725 1615 1487 1376 1362 1095 1062 1035 889 814 808 501 11509 31598 1273 752 12870
NM_001043351chr161483 784 420 177 137 34 12014 --21653 1516
NM_001044305chr631283 620 225 11085 --1287
NM_001044385chr273805 3716 2963 1332 1205 753 413 33671 1465 132 ----
NM_001044722chr51944 1772 ----
NM_001044723chr51944 1772 ----
NM_001046chr532320 467 431 --11922 --
NM_001048183chr183717 3230 2889 2699 1133 1086 547 318 12815 53773 3043 3024 2680 87 33188 2847 2713
NM_001071775chr1311708 ------
NM_001077628chr13482 462 40 ------
NM_001079874chr141866 440 306 125 --21446 271 1142
NM_001080418chr16603 578 548 538 212 165 --1453 --
NM_001083620chr42958 604 198 ----
NM_001083621chr1184618 4492 4183 4032 3818 3583 3537 3270 3169 2997 1393 1316 806 775 522 500 230 27 24630 4130 54497 3394 1321 1181 990 1660
NM_001087chr22327 150 --1402 1330
NM_001092chr1791889 1627 844 789 621 493 463 438 214 31952 131 94 1495 --
NM_001095chr12161856 1719 1667 1495 1272 1249 1221 705 552 466 367 286 276 258 162 73 --41687 1284 487 369 --
NM_001096chr17148 1784 ----
NM_001100108chr1196816 6753 6002 5852 3120 3007 2200 1794 1572 1562 1422 1222 1210 1155 1101 793 707 506 337 26223 1616 47855 7653 6444 2154 --
NM_001106chr3138060 7991 7305 6610 6275 2961 2816 2248 1837 507 498 460 309 11391 --17479
NM_001112808chr1--2100 80 ----
NM_001113490chrX103478 3467 3231 2864 2700 839 772 657 581 573 13376 12459 --
NM_001116chr16172344 2290 2164 2144 2033 1244 1207 1142 1031 972 914 796 480 378 196 182 98 --21238 768 --
NM_001117chr1861910 758 741 684 548 390 11719 ----
NM_001121chr101172 ------
NM_001122631chr111445 ------
NM_001122679chr5--167 ----
NM_001123chr10166 ------
NM_001124chr114662 562 171 74 --158 --
NM_001126chr11235 1689 ----
NM_001127chr226873 828 777 201 176 77 --2885 402 --
NM_001128chr1693731 3631 2836 2821 1228 1060 893 761 184 33567 917 751 33088 2472 267 --
NM_001130chr194632 333 199 113 ----1640
NM_001131chr64369 338 326 135 ------
NM_001140chr174478 226 202 114 --2466 100 183
NM_001144chr162199 29 ------
NM_001146chr831935 1672 103 --21676 108 --
NM_001148chr442128 1814 767 749 11831 --1531
NM_001149chr101118 ------
NM_001153chr2----1128 --
NM_001160chr1251867 1767 1114 978 661 2442 170 --41129 993 826 695
NM_001163chr9101019 1003 952 892 877 820 811 767 327 96 --1333 --
NM_001167chrX45896 4606 2538 400 55726 2385 1790 1504 1175 --26290 2111
NM_001172chr141611 --1505 --
NM_001173chr1434422 2972 874 41511 1482 1433 580 ----
NM_001174chrX32303 1576 115 ------
NM_001175chr123138 74 48 ------
NM_001177chr1231512 301 45 1814 11856 --
NM_001183chrX4598 552 87 56 1186 1232 --
NM_001186chr2133218 706 195 1568 --1443
NM_001191chr2081398 1337 1116 945 572 453 380 330 --2482 31 --
NM_001194chr192506 417 ------
NM_001198chr672228 2191 1903 844 806 550 309 22153 2050 2829 311 --
NM_001199chr81185 --1205 --
NM_001200chr20--1110 ----
NM_001201chr453749 3611 2925 2727 909 12461 12894 --
NM_001202chr14177 ------
NM_001204chr285215 4789 3018 892 608 578 177 94 21799 1146 34791 1188 111 25320 780
NM_001206chr982784 2059 1218 1212 1191 474 150 57 ----12350
NM_001219chr741743 1400 1389 149 11511 1906 --
NM_001221chr41103 ------
NM_001222chr1041318 1260 591 391 --1167 --
NM_001225chr11131 ------
NM_001232chr15951 889 480 223 132 --1891 --
NM_001237chr41354 ------
NM_001237chr41354 ------
NM_001238chr192434 119 ------
NM_001241chr2--12372 ----
NM_001241chr2--12372 ----
NM_001256chr1732156 547 273 ------
NM_001259chr796231 6217 6104 5990 5463 4187 1190 1127 922 --26309 112 --
NM_001260chr131242 ------
NM_001265chr135318 210 191 127 88 --194 --
NM_001271chr1582522 2316 1108 739 732 684 648 368 11280 1241 --
NM_001273chr125181 115 99 71 44 ------
NM_001275chr141275 ------
NM_001277chr115861 808 757 749 691 --1770 --
NM_001280chr192105 95 ----131
NM_001290chr43894 194 183 ------
NM_001292chr152202 130 --1892 --
NM_001293chr11164 135 ----
NM_001300chr102128 40 ------
NM_001304chr1793617 3593 2733 2494 1532 1201 642 170 23 13304 12496 --
NM_001310chr1242985 2338 2100 49 12489 22106 1063 1704
NM_001319chr194836 724 414 232 ------
NM_001328chr41241 ------
NM_001329chr10----1556 --
NM_001331chr1192187 2019 1737 923 741 501 206 200 118 3595 230 163 52021 1749 1739 1111 1103 --
NM_001332chr511249 ------
NM_001347chr4101392 1267 1261 1063 1056 600 506 334 308 44 --1144 --
NM_001351chr321371 1188 11501 ----
NM_001358chr41177 ------
NM_001364chr11234601 4300 4174 4006 3962 3782 3760 3710 3624 3341 3316 3262 3222 3189 3172 3125 2938 1550 956 932 855 391 294 24347 3609 53517 3194 1921 937 393 11515
NM_001365chr172322 97 --2558 102 --
NM_001380chr105995 806 420 56 39 ------
NM_001382chr11399 85 62 2458 329 ----
NM_001383chr172544 253 --1589 --
NM_001386chr861578 874 766 208 175 77 --2900 330 --
NM_001387chr5102925 2579 2336 2269 2123 2099 1009 803 675 225 12892 32914 1241 917 --
NM_001389chr211447 ------
NM_001390chr1863568 2861 2426 1341 1001 985 ----131
NM_001391chr1811108 ------
NM_001396chr2151791 1102 699 645 551 1747 ----
NM_001397chr1132557 2367 2307 2300 2284 2259 2047 2021 1991 1827 1039 984 499 1162 1932 --
NM_001399chrX113464 3448 3353 2488 2374 1403 807 738 415 60 35 11085 22418 604 23453 1424
NM_001400chr13482 463 318 1297 ----
NM_001401chr951289 1182 385 56 35 ------
NM_001402chr641907 1662 1309 1286 --11664 21439 1323
NM_001406chr17121648 1639 1622 1158 1129 534 498 452 440 412 273 172 11308 51519 565 374 195 128 11150
NM_001407chr391657 1642 1505 1441 1316 592 419 383 99 ------
NM_001408chr1121497 1485 1295 1287 1263 1231 1102 598 413 401 361 37 --2394 382 1364
NM_001412chrX83709 3533 3393 3048 2997 2879 2597 298 --13064 --
NM_001417chr1251778 1468 1302 521 27 ----11747
NM_001418chr11----1666 --
NM_001418chr11----1666 --
NM_001419chr19114125 4010 3614 3519 3054 1866 1859 1742 1589 835 513 24730 3369 23607 3036 --
NM_001420chr19152940 2880 2856 2830 2812 2708 2581 2554 2527 2520 2511 1163 409 222 31 --2387 22 --
NM_001421chrX101684 1668 1613 1467 1437 1365 1359 1335 1261 1234 11401 ----
NM_001426chr23593 236 58 --2603 37 1508
NM_001427chr7121726 1541 830 794 769 746 737 718 701 690 562 425 ------
NM_001429chr222908 236 ------
NM_001432chr462834 1409 1195 646 310 61 ------
NM_001438chr1133681 2880 2281 1326 853 429 381 366 358 321 301 268 22 --2221 24 --
NM_001439chr131244 1226 531 ------
NM_001448chrX31510 1440 503 ------
NM_001449chrX4509 133 121 100 --1362 --
NM_001453chr651687 1520 1259 367 357 1564 2394 361 --
NM_001455chr684838 4086 3926 3443 1763 1605 469 89 13523 ----
NM_001478chr126970 610 243 219 179 44 1961 2820 344 --
NM_001482chr151773 1205 ----
NM_001493chrX6735 229 210 183 89 75 --1505 1775
NM_001495chr84907 823 401 118 1987 1145 --
NM_001497chr962292 2058 1789 1122 1112 485 --21028 86 --
NM_001518chr74925 806 359 350 ------
NM_001520chr164225 158 107 23 --128 --
NM_001521chr24737 204 131 86 3786 606 219 ----
NM_001523chr191112 ------
NM_001542chr172146 1960 1939 1871 168 141 50 1463 ----
NM_001543chr5264825 4721 4529 4441 4083 3870 3577 3471 3423 3083 1921 1872 1780 1602 1568 1520 1395 1209 894 782 706 636 540 330 241 213 33360 1810 471 54221 4123 1923 811 581 1915
NM_001546chr611246 ------
NM_001554chr11436 ------
NM_001555chrX247 31 ------
NM_001560chrX72419 2290 2168 1938 1874 1707 622 12231 151 --
NM_001584chr1131105 1023 876 ------
NM_001587chrX42129 1957 435 152 12173 3784 355 300 --
NM_001604chr111688 ------
NM_001605chr16122 ----1104
NM_001610chr116779 677 244 182 111 21 --132 --
NM_001616chr231369 577 269 2868 559 23320 834 --
NM_001621chr722537 527 ------
NM_001621chr722537 527 ------
NM_001634chr651552 799 667 650 550 ------
NM_001642chr1151236 912 845 294 120 1320 ----
NM_001650chr1862697 2591 1654 1079 681 617 11526 2557 60 1684
NM_001654chrX4417 395 354 308 --1335 --
NM_001655chr1151771 1529 441 299 79 --11480 1609
NM_001658chr13939 215 48 --121 --
NM_001659chr12182628 2572 2503 2444 2076 2016 1815 1684 888 671 591 446 414 279 272 154 145 78 1799 21686 1070 --
NM_001663chr1442695 550 540 288 ------
NM_001664chr32232 221 --1946 --
NM_001665chr114575 426 366 37 ------
NM_001668chr192266 2124 2107 1524 867 684 596 164 94 ------
NM_001677chr1122 ------
NM_001678chr17191730 1698 1644 1635 1560 1553 1403 1323 1205 1191 726 583 563 497 486 447 423 193 73 1207 31233 1207 451 --
NM_001679chr31145 --171 --
NM_001681chr121236 ----1128
NM_001683chr3122526 2311 2219 2059 1931 1904 1874 1842 899 354 276 267 1254 ----
NM_001690chr362543 2293 1653 542 206 49 12035 22502 709 2876 742
NM_001693chr841139 1044 964 79 ----1333
NM_001694chr162342 52 ------
NM_001699chr1991749 1723 1665 1639 1458 1372 154 82 72 --3243 74 29 2669 534
NM_001701chr941355 1335 1283 82 160 ----
NM_001702chr8----2455 436 --
NM_001706chr32234 189 ------
NM_001707chr72122 24 1200 1578 --
NM_001709chr1132667 867 601 --1775 --
NM_001717chr153531 263 193 11173 --11481
NM_001731chr121276 ------
NM_001742chr71201 --21216 86 --
NM_001743chr22151 90 ------
NM_001746chr562773 1882 859 693 528 37 ----1546
NM_001748chr121007 63 2943 377 ----
NM_001753chr761511 1409 1212 730 663 468 ------
NM_001754chr21134246 4167 4084 3993 3000 2943 2855 2812 2790 1112 746 177 67 12840 13478 --
NM_001755chr162768 349 --1782 --
NM_001759chr12185049 4940 4025 3998 3761 3573 3504 3373 3323 1871 1646 1418 1247 1171 1157 1058 1036 552 2715 510 23436 2134 --
NM_001760chr65801 731 339 214 62 1245 ----
NM_001768chr25432 331 92 66 44 ------
NM_001773chr1131320 1302 1231 1100 476 416 247 119 85 76 70 59 47 11364 21154 64 11026
NM_001777chr383728 1135 1105 904 738 660 623 418 --1662 --
NM_001781chr12191 1142 ----
NM_001782chr92231 55 --1246 --
NM_001783chr193343 254 68 ----1387
NM_001789chr341465 1404 125 37 1154 1145 --
NM_001791chr141318 1312 429 175 --1183 21321 1042
NM_001792chr18--158 ----
NM_001802chr164783 188 54 48 --1933 --
NM_001806chr1922725 2011 11058 12867 1300
NM_001810chr205773 690 553 224 125 ------
NM_001821chr173634 3510 1703 1196 139 77 36 1813 11718 --
NM_001830chrX83507 3291 3161 3068 2908 2695 1364 871 --2982 743 13510
NM_001838chr174850 296 122 33 1628 2619 385 --
NM_001842chr95504 489 462 432 193 ------
NM_001843chr12126 ----178
NM_001844chr122320 149 --1130 --
NM_001852chr14603 567 532 100 1641 2542 264 --
NM_001854chr1--1240 ----
NM_001855chr94753 722 703 332 ------
NM_001858chr634156 3709 805 23778 196 ----
NM_001859chr973526 3316 3263 3129 3006 977 225 --13265 1195
NM_001862chr2183 ------
NM_001863chr19142 ------
NM_001882chr51112 ------
NM_001891chr4128 ------
NM_001892chr531344 1333 59 ----11383
NM_001895chr2051018 976 370 277 53 1793 1364 1284
NM_001896chr16135 ------
NM_001901chr61132 ------
NM_001903chr51672 1920 ----
NM_001915chr17131743 1710 1664 1587 1393 814 775 758 702 600 329 217 165 --21714 706 --
NM_001918chr1109300 8411 7207 6681 6064 5968 5616 3322 2984 1005 47023 6697 3076 38 13677 --
NM_001920chr121654 ------
NM_001921chr441050 867 347 260 ------
NM_001923chr115470 200 65 59 33 ------
NM_001927chr25692 681 129 107 74 ------
NM_001933chr145985 462 284 187 58 ----1423
NM_001935chr221003 978 1139 ----
NM_001936chr7101432 1281 1208 1128 1099 275 237 172 80 73 --21285 241 --
NM_001938chr121548 1423 ------
NM_001945chr551033 1001 990 275 89 --1143 --
NM_001946chr121285 ------
NM_001949chr692133 2098 1145 1012 1006 725 308 291 84 13048 ----
NM_001951chr81129 1231 ----
NM_001954chr69526 278 269 220 207 196 177 92 24 --1591 1100
NM_001964chr52185 132 1966 --11199
NM_001965chr23127 91 69 2474 83 ----
NM_001970chr177594 578 535 477 243 235 62 --1108 --
NM_001971chr12127 ----130
NM_001978chr87790 729 722 275 217 196 173 1830 ----
NM_001981chr121520 411 --1707 --
NM_001982chr126368 314 247 88 82 71 1209 21117 319 1989
NM_001999chr51120 ----11338
NM_002006chr4135839 5487 5437 5426 5270 5259 4099 1844 1680 1502 832 526 198 21466 1130 --1730
NM_002009chr1542296 2171 1804 1063 --1871 --
NM_002010chr131192 ------
NM_002015chr1353134 3059 2350 2327 140 22927 2354 22194 2120 --
NM_002017chr111236 ------
NM_002025chrX159258 8738 7965 7561 7534 7528 7390 6814 6683 5692 2519 2263 1892 1705 915 13407 --18692
NM_002026chr221022 1014 ------
NM_002028chr1461312 868 509 360 278 40 ------
NM_002033chr1133021 1238 962 31497 802 379 43760 2776 2610 907 12643
NM_002035chr1841205 913 798 171 --23774 408 --
NM_002037chr62143 52 ------
NM_002039chr42229 82 1318 ----
NM_002045chr35350 128 93 58 36 ------
NM_002048chr95896 222 197 183 50 1257 --1123
NM_002051chr10--1831 ----
NM_002055chr1781718 1625 1585 1557 1258 655 597 129 ------
NM_002056chr21185 1794 ----
NM_002060chr15486 372 200 169 75 ------
NM_002062chr6111562 1539 1276 1156 498 466 213 188 152 74 21 1512 --1231
NM_002063chrX1982 --1236 --
NM_002065chr191783 1777 1662 1197 353 277 204 67 61 --134 --
NM_002072chr97816 789 408 391 372 225 32 ------
NM_002074chr151390 552 231 179 111 --11345 --
NM_002076chr1283142 2687 2681 2535 2373 2171 1298 1097 12224 12540 22853 2721
NM_002077chr951919 1562 1547 508 152 1542 22067 1518 1514
NM_002079chr101449 ------
NM_002080chr162833 223 --1864 --
NM_002083chr142245 30 ------
NM_002086chr1782033 1941 1876 1851 1662 1423 604 254 --41853 1668 531 135 --
NM_002087chr174209 96 79 68 ------
NM_002091chr18--1210 ----
NM_002092chr494807 4788 4612 4050 3932 3757 3219 2009 731 13330 14239 24646 4407
NM_002094chr161101 ------
NM_002099chr421545 641 ----11904
NM_002103chr196993 933 816 773 713 37 2842 75 1263 --
NM_002105chr115684 271 195 133 35 --31019 906 769 1755
NM_002114chr62457 65 ------
NM_002126chr17123771 3496 3061 2798 1082 991 379 342 323 313 302 126 --1242 --
NM_002135chr124411 386 364 38 --1415 --
NM_002138chr41723 1621 ----
NM_002139chrX2611 600 1449 ----
NM_002140chr9--11205 ----
NM_002145chr17170 ------
NM_002146chr174929 533 181 143 21320 514 --1505
NM_002147chr175801 354 168 103 69 2820 238 1229 --
NM_002157chr2--1172 ----
NM_002160chr92251 171 ------
NM_002161chr9135 ------
NM_002167chr12143 72 ------
NM_002168chr15294 59 ------
NM_002181chr25682 497 289 238 23 1274 155 --
NM_002187chr52957 933 1218 ----
NM_002193chr251865 564 403 369 61 --1612 --
NM_002199chr42736 225 ------
NM_002204chr1771396 1345 1339 1262 1203 213 196 --31311 530 361 --
NM_002205chr127941 837 771 269 181 118 23 ------
NM_002207chr3162 1699 ----
NM_002211chr101986 ------
NM_002220chr153364 328 282 ------
NM_002221chr1152960 2886 2668 2525 2290 2247 2230 1029 1008 708 586 431 104 46 38 12208 1710 --
NM_002223chr1223044 1326 1519 43437 3224 1536 615 --
NM_002226chr144882 761 744 689 ------
NM_002228chr13944 845 197 ----11183
NM_002229chr191364 --4188 160 140 59 --
NM_002230chr175986 137 85 60 46 --179 --
NM_002232chr13226 200 140 --2963 850 --
NM_002235chr1291647 1292 1253 1230 1202 670 467 336 110 --11059 --
NM_002240chr213168 59 32 ----1255
NM_002249chr11443 ------
NM_002253chr431017 996 207 ------
NM_002254chr251820 1725 883 409 170 1830 11571 1650
NM_002264chr394408 3607 3122 1936 1344 1264 1258 486 344 34232 904 686 14554 --
NM_002265chr1731051 827 49 --1307 --
NM_002267chr13127 --22157 2048 --
NM_002268chr341621 770 764 555 ------
NM_002270chr595451 4551 4253 4040 3943 1408 1381 572 493 24014 3443 24211 1669 --
NM_002271chr1351936 836 629 582 538 --31821 1814 442 --
NM_002285chr252825 1081 708 643 82 24054 3194 33290 3183 710 22981 2840
NM_002293chr192498 2163 1777 1111 968 487 377 348 218 ------
NM_002294chrX----162 --
NM_002310chr575611 5420 1885 1850 1839 973 747 --11048 15501
NM_002319chr78932 812 745 321 307 301 188 37 --1218 --
NM_002333chr1941265 1054 981 257 ------
NM_002334chr1191989 1750 1721 1515 1309 771 689 309 105 --31486 693 115 --
NM_002336chr1264961 4199 3404 1802 1423 745 1941 12037 --
NM_002355chr1241371 1103 570 165 ------
NM_002356chr631944 176 41 12459 ----
NM_002359chr17133756 3513 3321 3136 3045 2826 2759 2728 1716 1514 1129 124 98 23008 394 23827 3050 --
NM_002361chr192219 76 ----182
NM_002372chr52581 223 ----1289
NM_002373chr15101335 1321 1311 1286 1089 977 490 331 268 164 ------
NM_002374chr221033 925 12601 ----
NM_002375chr3161703 1590 1577 656 622 540 533 368 340 291 206 182 166 67 54 32 --2344 82 --
NM_002382chr1481308 1039 942 490 399 181 118 56 --11041 --
NM_002383chr169890 810 768 760 350 299 89 79 64 --2375 329 --
NM_002384chr182210 156 ----1396
NM_002385chr1871278 1191 1002 626 480 246 106 11081 11035 21251 488
NM_002387chr5104223 1782 1271 922 873 752 426 299 293 210 13508 1757 11918
NM_002390chr1792077 1917 1900 563 400 364 275 228 104 ------
NM_002395chr611020 ------
NM_002397chr521788 1539 ------
NM_002399chr1521020 120 ------
NM_002401chr1782350 1835 1763 1679 644 459 143 85 --12360 1415
NM_002403chr12163 33 ------
NM_002406chr511944 932 766 744 702 412 392 372 356 170 29 --1861 --
NM_002419chr113532 452 409 ------
NM_002429chr1221210 1164 1180 11354 1299
NM_002430chr22102114 1740 1733 916 841 749 452 60 37 22 --1710 --
NM_002442chr12111567 1329 1292 1127 1114 608 441 342 308 241 104 --11592 --
NM_002444chrX101730 1666 1435 1356 643 371 219 177 56 29 11336 31314 576 499 --
NM_002448chr43594 499 98 1679 ----
NM_002455chr1139 ------
NM_002465chr121202 ----1239
NM_002466chr205391 355 134 124 94 1274 ----
NM_002473chr2291268 518 448 416 285 209 115 80 53 11179 4866 512 199 60 --
NM_002479chr12209 145 1489 1535 182
NM_002480chr121396 ------
NM_002487chr15--1711 ----
NM_002489chr72316 45 ------
NM_002495chr5--195 ----
NM_002499chr1541635 872 215 174 --22049 697 --
NM_002500chr21425 ------
NM_002501chr19274056 3919 3901 3889 3871 3687 3241 3199 3097 3059 3006 2986 2972 1593 1559 1547 1407 1392 1337 1223 897 874 618 570 551 454 352 1632 23729 3221 --
NM_002505chr641418 570 483 394 2543 72 21272 396 --
NM_002506chr1254 21 ------
NM_002507chr17111944 1919 1906 1746 1485 1396 1278 793 479 288 237 --31897 766 316 --
NM_002508chr131954 1604 359 1306 21271 666 1340
NM_002515chr1461739 1604 1476 1373 1272 38 --11746 --
NM_002516chr196265 228 206 54 48 21 --139 --
NM_002518chr2--11171 ----
NM_002522chr17163149 3046 2758 2703 2584 2535 2524 2508 975 874 842 834 673 227 178 82 --33856 1129 836 11379
NM_002524chr17995 848 264 194 141 132 72 ------
NM_002526chr63582 428 113 11758 ----
NM_002530chr15262 40 --167 --
NM_002542chr33211 65 40 ------
NM_002545chr11104339 4184 4162 3242 3210 1227 1015 958 891 275 21352 310 24168 627 13219
NM_002547chrX104015 3983 3942 3935 3920 1273 656 514 340 115 ------
NM_002553chr71400 ------
NM_002556chr1151783 1772 1622 338 302 31859 1401 823 --11844
NM_002558chr173311 101 87 11146 41055 909 268 109 --
NM_002569chr1561404 1278 988 435 353 38 --41330 1307 222 130 --
NM_002570chr155402 369 121 58 36 --1876 1203
NM_002576chr1151123 1097 329 314 105 ----1229
NM_002577chr3143715 3521 3124 2850 2606 1625 1613 1528 1494 1487 986 896 793 760 --21010 781 12744
NM_002579chr1961484 1369 1332 1219 1069 132 --31046 381 64 --
NM_002581chr985570 5350 5063 2269 1480 443 209 95 31926 436 32 21447 1042 1263
NM_002585chr13306 290 261 175 ----
NM_002586chr691163 399 352 322 237 215 131 67 36 --31487 1104 1089 --
NM_002588chr5141704 1669 1651 1485 1396 1374 1258 717 538 502 482 355 174 37 1324 2542 440 1648
NM_002594chr2052052 1594 707 32 22 1206 ----
NM_002595chr12--11871 ----
NM_002599chr114971 378 140 21 2289 185 139 --
NM_002601chr23329 318 197 1183 ----
NM_002603chr8131 ------
NM_002605chr1521203 357 ------
NM_002608chr2291516 1488 1482 1358 1342 563 338 263 142 11245 71494 1401 1274 532 404 191 173 11526
NM_002609chr571712 1333 556 485 353 321 268 ------
NM_002613chr16154688 3924 3673 3453 2139 2019 2010 1945 1867 1860 1519 1418 970 547 79 --23931 442 1946
NM_002616chr174381 374 116 51 --1229 --
NM_002628chr32490 461 ------
NM_002636chr63427 398 68 --2429 420 --
NM_002641chrX2782 601 ------
NM_002642chr1------151
NM_002645chr1152223 904 883 753 638 ------
NM_002646chr192002 1857 1809 1499 798 724 596 80 64 --32156 2149 1480 21646 1513
NM_002648chr671208 984 976 947 932 73 23 --21199 222 1173
NM_002649chr731141 623 144 1466 ----
NM_002650chr222138 75 ------
NM_002651chr18897 867 649 585 336 222 212 46 1675 1887 --
NM_002653chr54846 804 316 138 --2149 142 --
NM_002655chr812000 --13915 --
NM_002657chr20213656 3608 3596 3416 3240 3211 3165 2645 2518 2474 2454 2372 1361 1301 1031 852 681 615 531 310 291 1482 52908 2522 2493 1547 1149 --
NM_002668chrX4149 100 85 63 ------
NM_002677chr82666 61 12584 --1669
NM_002697chr1199 ------
NM_002698chr19212606 2599 2526 2344 2330 2324 2305 2286 2267 2260 2223 1197 1185 1132 1065 1033 1015 753 313 215 186 12355 22716 319 12118
NM_002699chr191365 1253 1078 972 580 502 426 345 157 ------
NM_002705chr165279 261 80 65 45 ------
NM_002707chr21154 ------
NM_002710chr121121 --1126 --
NM_002714chr65974 938 890 857 131 ------
NM_002715chr53814 439 339 ------
NM_002716chr11103521 3508 3112 3091 2495 2281 2237 1451 1433 872 1255 --1759
NM_002717chr82479 466 ------
NM_002718chr362569 2322 1641 891 649 368 --1896 2621 240
NM_002721chr91358 ------
NM_002730chr1991267 1162 1130 1110 973 459 239 224 214 --31256 912 276 --
NM_002731chr162962 2347 775 677 664 259 ----12624
NM_002734chr1731538 33 21 ------
NM_002740chr332322 2053 196 --32347 2324 358 --
NM_002745chr2284180 4100 4023 1322 1311 388 321 199 --23210 61 --
NM_002746chr168593 494 248 206 193 144 57 44 ------
NM_002747chr1851509 648 563 91 81 11522 ----
NM_002748chr152955 276 ------
NM_002752chr52401 43 ------
NM_002753chr42824 299 1848 ----
NM_002760chrY115581 5499 5196 4678 4196 4129 2220 2200 1723 1593 640 22097 103 31907 1289 66 --
NM_002763chr12157 141 ------
NM_002772chr21142 2529 391 ----
NM_002773chr163381 102 58 ------
NM_002776chr19111950 1936 1648 1633 1453 707 696 359 159 106 87 --2603 165 --
NM_002791chr141102 --1114 --
NM_002808chr31106 ------
NM_002819chr1971400 1153 1099 545 521 351 43 11000 ----
NM_002821chr65547 505 309 158 88 1814 ----
NM_002823chr2168 1219 ----
NM_002824chr126460 381 310 159 136 35 ------
NM_002827chr202324 157 11443 21692 203 --
NM_002829chr94824 273 69 46 2878 34 1349 --
NM_002833chr15101425 1338 1115 414 365 356 325 311 121 37 21418 1398 ----
NM_002834chr1253996 3350 2993 1149 52 11074 11053 1205
NM_002838chr13972 485 34 ------
NM_002839chr942739 2529 989 429 11209 1431 --
NM_002840chr151219 517 371 324 276 --193 --
NM_002843chr1193269 3048 2885 2423 2215 1112 738 701 541 22271 1234 32705 2110 750 --
NM_002844chr61368 ------
NM_002847chr731333 1092 121 --21335 1005 --
NM_002850chr19101216 973 965 943 456 395 360 238 196 69 --157 1248
NM_002854chr22474 63 33 27 ------
NM_002855chr11243634 3551 3279 3222 3119 3006 2669 2638 2283 1489 1340 1281 1034 937 815 581 572 456 350 255 208 192 49 38 --63557 1447 1438 1410 460 80 --
NM_002859chr12131820 1713 1611 1567 1353 1336 637 598 413 244 219 201 30 11806 2551 543 --
NM_002865chr8161 ------
NM_002866chr195497 212 47 39 30 ------
NM_002868chr12192411 2314 2263 2233 2172 2160 1994 1987 1956 1930 1909 1817 1557 1496 417 369 331 315 129 32415 807 117 1200 1251
NM_002869chr1131772 1757 442 1860 21782 400 --
NM_002872chr224225 163 97 22 ------
NM_002874chr931982 890 874 ------
NM_002880chr34681 659 563 227 --1644 --
NM_002881chr23240 231 102 135 31013 420 95 31406 940 246
NM_002885chr16991 896 704 305 147 138 ------
NM_002886chr354803 4601 4149 3363 244 11641 21132 1093 --
NM_002892chr1441431 607 151 21 21318 1226 123 --
NM_002893chrX--1306 --1342
NM_002904chr6183 ------
NM_002907chr121423 ------
NM_002911chr1941428 1400 1305 653 ------
NM_002912chr6----1306 --
NM_002918chr1941059 764 305 143 --3356 321 286 --
NM_002926chr461174 1149 843 439 106 43 ------
NM_002933chr14472 62 45 29 ------
NM_002940chr411375 1262 --11391
NM_002941chr33250 207 57 1427 ----
NM_002942chr3--11340 ----
NM_002945chr171589 --162 --
NM_002953chr12581 171 --160 --
NM_002956chr1231213 1018 166 ------
NM_002959chr1164172 4147 4115 4016 3490 3102 3068 2723 1590 1265 1191 955 895 400 126 91 23350 1436 34174 3062 679 --
NM_002966chr1278 26 ------
NM_002968chr16196 --164 --
NM_002970chrX--152 ----
NM_002971chr32367 77 ------
NM_002973chr12138 ------
NM_002998chr83544 417 401 ------
NM_003009chr191265 --146 --
NM_003010chr1742378 1919 1819 1542 1368 31960 1848 1688 --
NM_003011chr941327 382 241 28 21384 664 ----
NM_003012chr852714 2066 1143 1084 158 12783 11068 --
NM_003013chr44591 127 96 77 ------
NM_003016chr1751856 1771 1337 771 101 11690 ----
NM_003017chr631374 1256 509 ------
NM_003021chr198870 427 321 310 251 162 79 33 1373 2462 256 --
NM_003026chr951335 464 425 155 27 11082 --1428
NM_003027chr15164 ------
NM_003028chr9193775 3332 3158 3126 2920 2624 2531 2479 2373 2357 1468 1425 1359 1291 1066 991 754 408 233 --63683 3597 2541 1496 1255 284 --
NM_003029chr151429 557 276 194 22 ----1402
NM_003030chr341412 1334 760 114 ------
NM_003036chr131242 991 433 --11159 --
NM_003039chr11137 --145 --
NM_003042chr371758 1713 696 606 540 470 32 --185 1543
NM_003043chr3133998 3759 3743 3588 3444 3429 3052 2957 1323 1203 1188 946 908 23934 1641 34002 3247 3060 1513
NM_003045chr13174943 4525 4303 3694 3417 3321 3179 3119 1608 1290 1044 801 693 423 362 280 77 14143 2924 367 --
NM_003047chr1171344 1243 1160 1061 959 507 411 323 307 275 257 205 188 161 109 83 45 1966 1174 --
NM_003051chr1--11550 1652 --
NM_003060chr53929 508 188 21232 818 ----
NM_003062chr5128 ------
NM_003068chr81408 ----1842
NM_003069chrX1196 ------
NM_003070chr93746 716 41 ------
NM_003071chr331903 1382 1361 1296 ----
NM_003072chr191132 --1359 --
NM_003074chr351394 732 255 159 137 11886 11407 --
NM_003075chr125317 127 86 66 23 ------
NM_003076chr12161680 1489 1436 1415 1406 1373 1333 1322 1184 1037 612 505 474 239 222 202 --41657 1525 669 189 --
NM_003077chr173646 573 223 --123 --
NM_003079chr173405 369 323 --1371 1984
NM_003081chr2011148 1415 --1152
NM_003085chr53390 112 91 ------
NM_003091chr201191 ------
NM_003096chr22170 36 ------
NM_003099chr15126056 5942 5933 1819 1462 1136 775 605 529 175 115 59 22184 463 25243 1506 15945
NM_003108chr2166680 6553 6501 6178 5645 5579 5062 2869 2775 2660 1877 1853 1815 1038 864 275 25389 336 --26375 2086
NM_003110chr178840 696 412 401 216 198 165 53 1366 ----
NM_003111chr231087 946 875 ------
NM_003112chr712937 --1277 --
NM_003120chr115335 306 144 90 35 --2321 312 1340
NM_003128chr232873 2408 1937 --11949 11053
NM_003131chr6172205 2111 1963 1429 820 802 673 666 654 523 406 370 329 250 209 200 190 --41970 679 222 146 --
NM_003137chr652086 907 278 74 51 --1280 --
NM_003139chr117764 719 685 615 238 232 218 --2770 679 3785 670 140
NM_003142chr21230 ------
NM_003144chr621837 107 11656 21875 589 --
NM_003145chr16368 310 192 149 47 22 251 29 1375 --
NM_003149chr351540 1241 1211 533 406 11399 21226 497 --
NM_003150chr17112395 2200 1881 1678 1644 1600 1578 916 371 319 132 ------
NM_003155chr872327 2076 1730 1037 886 224 192 12461 22095 2086 --
NM_003156chr1181179 1156 399 377 287 246 62 39 1997 21158 382 --
NM_003161chr1763464 3161 2396 1262 1201 1142 ------
NM_003164chr113376 180 45 2549 420 ----
NM_003165chr9151944 1692 1671 1602 1594 1562 1515 1489 1410 1298 769 694 619 403 196 --1157 21608 1452
NM_003170chr174387 198 80 66 ------
NM_003173chrX71240 1098 1047 388 128 73 57 ------
NM_003178chr392235 2017 1802 1727 1665 1518 555 406 270 1274 21483 87 11767
NM_003179chrX171448 1419 1362 1356 1219 1206 1200 1131 1122 983 908 383 377 280 267 229 67 21452 1386 169 1397
NM_003184chr83916 233 108 ------
NM_003185chr204510 494 467 241 --1479 --
NM_003186chr113321 161 34 ------
NM_003189chr182833 2081 693 675 359 274 256 249 --12427 32441 404 277
NM_003194chr63487 452 25 ------
NM_003199chr1864516 3657 1672 1612 1381 849 1166 --11099
NM_003200chr19112076 2034 2016 1893 1851 1827 1761 1654 1560 931 917 --11611 --
NM_003202chr55606 581 515 126 61 ----1135
NM_003203chr2179 --1901 1915
NM_003214chr651192 1055 1020 134 47 ------
NM_003215chr441399 1244 177 24 133 21161 1095 --
NM_003216chr22183167 3136 3030 2807 2348 2260 2076 1312 1117 1072 941 778 718 644 499 469 340 309 12115 23215 979 --
NM_003217chr1281657 1442 1300 659 622 383 326 37 123 143 --
NM_003220chr6101476 1195 1178 1111 453 238 226 200 177 93 --127 --
NM_003221chr6163432 3399 3373 3347 3263 3076 2848 2777 2645 2566 1592 822 606 596 520 309 33543 3122 495 11489 --
NM_003223chr166623 582 551 545 284 22 ------
NM_003234chr331545 691 21 1736 32026 1782 958 --
NM_003236chr252592 779 551 377 106 13046 ----
NM_003244chr182349 285 ------
NM_003246chr153665 428 140 21660 222 11947 --
NM_003247chr62140 103 ------
NM_003250chr172142 51 1392 1123 --
NM_003253chr2171522 1291 562 475 467 398 65 ------
NM_003255chr17142567 2371 2091 1648 1017 837 642 537 509 473 340 280 211 80 --2999 285 --
NM_003263chr4130 ------
NM_003275chr92470 379 ------
NM_003285chr14557 521 222 205 --2369 210 --
NM_003286chr2031098 786 436 ------
NM_003289chr92200 43 --1193 --
NM_003298chr3146015 5196 4676 4608 4501 4069 3836 3828 2319 2309 2188 1630 1495 1045 24589 975 54503 3961 2313 1047 41 --
NM_003304chr3--11016 --11484
NM_003317chr143700 542 48 ------
NM_003319chr21978 ------
NM_003320chr11174184 4155 4089 3568 3523 3269 3015 2743 1327 1319 1294 1260 987 829 724 261 98 1953 ----
NM_003322chr65335 277 152 134 90 --1125 --
NM_003325chr221214 --177 --
NM_003326chr172698 2327 2141 2036 916 653 496 --42146 2080 144 98 --
NM_003334chrX3199 69 42 --155 --
NM_003336chrX3928 160 65 11086 ----
NM_003337chr511348 11713 155 --
NM_003338chr1021339 542 1163 ----
NM_003339chr531405 626 111 1610 1209 --
NM_003340chr42179 135 --1445 --
NM_003342chr1782693 2535 2259 2190 2112 2099 2080 954 11102 ----
NM_003344chr72509 206 ------
NM_003345chr163417 401 133 ------
NM_003347chr22102358 2270 1995 1426 910 838 588 417 377 360 ------
NM_003348chr1261626 1425 1419 1397 250 56 ----11707
NM_003349chr2071308 585 407 381 284 126 27 --2400 393 21236 551
NM_003352chr21216 ------
NM_003359chr41917 --1189 2356 222
NM_003363chr32603 555 ------
NM_003367chr194203 180 94 57 ------
NM_003369chr1132581 2390 683 ------
NM_003370chr197739 588 574 229 217 161 118 --1745 --
NM_003371chr971711 746 674 633 612 469 115 1604 1107 --
NM_003372chrX1351 ------
NM_003373chr10121761 1751 1493 1416 1257 735 635 610 495 390 378 353 31524 1442 1297 11499 1453
NM_003374chr53799 776 632 --1160 --
NM_003376chr671487 1417 697 604 518 52 25 ------
NM_003376chr671487 1417 697 604 518 52 25 ------
NM_003381chr61687 --140 --
NM_003385chr2--2946 747 ----
NM_003387chr2122803 2420 2105 1881 1856 948 941 931 400 373 85 71 ------
NM_003390chr115825 802 735 363 21 ------
NM_003392chr383562 2933 1346 1313 1039 1019 511 32 ----13419
NM_003394chr123640 543 179 --2597 276 182
NM_003400chr2----1169 --
NM_003403chr14274 44 ------
NM_003406chr861748 1734 1678 1482 317 140 11381 ----
NM_003407chr192562 278 ------
NM_003409chr1831130 313 245 ------
NM_003410chrX52905 2433 2415 1229 797 --12002 --
NM_003412chr332711 1114 1105 --12713 --
NM_003413chrX31899 408 248 ------
NM_003418chr33326 101 24 ------
NM_003439chr743335 1399 723 598 1758 1187 --
NM_003442chr113551 335 275 ------
NM_003457chr17----1120 --
NM_003458chr3194002 3817 3556 3292 3239 3208 3051 1507 1488 1316 1303 1290 1017 974 937 723 446 407 331 --21122 370 --
NM_003459chr24293 246 109 55 --1122 --
NM_003463chr682676 2670 993 984 920 514 303 103 ----1987
NM_003468chr263161 1128 1084 1077 1070 595 34331 3647 707 32897 502 112 --
NM_003470chr1681872 1722 1630 1269 544 529 502 354 --11560 --
NM_003471chr31125 12347 ----
NM_003472chr6131 ------
NM_003474chr1031984 883 561 --11613 12267
NM_003478chr1122447 350 23082 2740 --12833
NM_003481chr123466 389 362 ------
NM_003482chr12152644 2510 2490 2172 2045 1730 1111 977 753 726 507 390 380 200 52 22760 991 ----
NM_003483chr1252777 2235 2195 2070 1055 ------
NM_003485chr1471223 1096 896 883 873 81 74 --21271 1245 1354
NM_003487chr171201 ------
NM_003489chr2132192 1052 748 22416 585 ----
NM_003490chr222163 52 --1856 1788
NM_003496chr74800 738 319 74 ------
NM_003505chr781667 699 604 591 585 569 562 467 ----1662
NM_003507chr261943 572 464 327 105 26 --2601 585 --
NM_003528chr151738 1338 528 331 271 --1273 --
NM_003551chr51439 1310 ----
NM_003559chr17153537 3097 3071 2984 2788 2757 2744 2736 2505 1128 1006 842 435 416 247 12639 31010 860 487 --
NM_003563chr1721419 1299 11047 ----
NM_003564chr15536 429 197 169 80 1100 131 --
NM_003566chr1252692 2231 1217 767 212 1364 ----
NM_003569chr61113 ------
NM_003574chr1845145 4144 1693 476 --12212 --
NM_003575chr72975 268 --31371 1036 517 11099
NM_003576chr13102849 2723 2373 2173 966 840 678 662 188 54 --22498 216 --
NM_003583chr1251045 798 776 396 368 ------
NM_003586chr164584 515 493 191 ------
NM_003590chr263797 3596 1223 953 634 446 1657 ----
NM_003591chr101280 ------
NM_003592chr72134 107 ------
NM_003593chr172601 527 --1185 --
NM_003595chr222441 368 ------
NM_003603chr442021 1625 389 371 --182 --
NM_003607chr1123950 3656 3458 3451 1562 1425 1376 1104 159 71 52 24 22786 281 33468 1012 56 11150
NM_003615chr343699 3004 928 806 13721 ----
NM_003616chr14--1394 ----
NM_003617chr1184559 4546 4525 4503 4246 4078 3809 3619 3107 3100 1960 1894 1512 1481 889 670 552 65 14290 185 --
NM_003620chr17--21072 841 ----
NM_003624chr1981237 1202 932 913 554 548 381 239 --1383 11329
NM_003627chr112512 419 --1487 --
NM_003629chr1113470 2942 2867 2523 1379 1243 1107 1045 815 627 438 ----12850
NM_003631chr102959 141 --235 28 --
NM_003632chr172354 58 ------
NM_003633chr562440 2166 1594 1033 1025 407 ------
NM_003634chr225925 864 209 35 23 ------
NM_003635chr104427 160 99 41 ------
NM_003636chr181872 1815 1725 1187 582 509 405 295 3348 316 147 31223 535 43 11818
NM_003642chr21238 ------
NM_003644chr17336324 6153 6021 5943 5673 5617 5565 5419 5086 4956 4897 4502 4467 4037 2519 2181 2142 2065 1763 1485 1350 1260 1251 1192 957 786 736 513 496 242 179 92 53 11272 46380 6026 788 600 --
NM_003654chr113528 116 89 ------
NM_003655chr175576 540 237 227 85 1755 2592 200 --
NM_003656chr3164 ------
NM_003660chr195754 631 536 64 43 ------
NM_003663chr342931 2548 2125 581 ------
NM_003664chr51358 1543 2407 92 --
NM_003670chr321391 36 1454 ----
NM_003671chr9113234 3132 3093 2931 2796 2756 2674 2298 1072 922 556 22836 213 32775 1206 819 11308
NM_003672chr111738 21925 1273 ----
NM_003673chr17151 1168 ----
NM_003680chr14253 160 91 29 1504 ----
NM_003684chr17986 740 450 429 408 319 148 --2762 444 --
NM_003685chr195804 791 766 393 379 --2624 228 --
NM_003688chrX--1217 ----
NM_003692chr91319 ------
NM_003705chr21691 ------
NM_003711chr5----1216 --
NM_003713chr12578 555 --11202 1157
NM_003722chr362271 2125 1672 481 96 85 136 ----
NM_003735chr5141704 1669 1651 1485 1396 1374 1258 717 538 502 482 355 174 37 1324 2542 440 1648
NM_003736chr5141704 1669 1651 1485 1396 1374 1258 717 538 502 482 355 174 37 1324 2542 440 1648
NM_003740chr651678 1441 672 135 42 --1145 --
NM_003741chr32261 130 ------
NM_003743chr232006 1611 476 ------
NM_003744chr1471177 1120 546 486 397 367 255 ------
NM_003749chr1342421 2314 1663 509 ------
NM_003758chr1521124 373 11280 ----
NM_003758chr1521124 373 11280 ----
NM_003759chr453218 2843 1622 1486 1165 13149 23232 44 --
NM_003760chr1----1553 --
NM_003762chr121225 170 ------
NM_003763chr2042736 1071 149 42 22830 2390 --13052
NM_003768chr181575 1554 1544 1444 734 557 309 53 --21636 303 11547
NM_003774chr1241057 962 880 834 12342 21269 1233 --
NM_003779chr15407 311 187 136 57 ------
NM_003783chr11766 1192 ----
NM_003787chr1821085 119 169 11125 --
NM_003791chr162239 149 ------
NM_003800chr621828 1808 11595 ----
NM_003819chr1--1296 ----
NM_003829chr931127 1106 451 --146 --
NM_003831chr181396 1327 21418 199 --
NM_003840chr882067 2054 1904 1895 1888 1427 49 30 --11965 --
NM_003842chr8112054 1912 1809 1749 1740 1733 876 505 436 127 31 1656 21900 487 --
NM_003850chr131246 1710 ----
NM_003861chr1482872 2851 2572 2030 1051 867 592 366 12200 22346 2326 --
NM_003862chr5150 1340 ----
NM_003870chr1551995 1986 541 240 151 1129 --12052
NM_003873chr1051837 1663 312 297 288 --11839 1747
NM_003877chr123930 892 206 ------
NM_003883chr55408 398 372 172 78 1180 ----
NM_003884chr31147 21879 1177 ----
NM_003885chr1772653 2019 1692 665 423 127 116 1719 1234 --
NM_003887chr221694 905 1233 ----
NM_003888chr15101625 1607 1327 1315 1228 414 396 383 75 48 1424 21238 387 1346
NM_003893chr103460 416 323 ------
NM_003896chr2----3880 681 155 --
NM_003902chr11645 ------
NM_003908chr20--11371 1487 --
NM_003913chr622695 2673 13340 11052 14037
NM_003919chr7--177 ----
NM_003922chr15233 24 ------
NM_003924chr44326 230 199 190 ----1635
NM_003927chr183776 447 368 ------
NM_003930chr752002 1951 1833 794 92 186 ----
NM_003931chr61557 --1559 --
NM_003936chr211988 772 421 409 390 378 363 339 295 289 246 --11098 --
NM_003938chr193769 393 75 --2771 202 --
NM_003939chr10193990 3820 3806 3461 3417 3328 3281 3145 1529 1500 1394 1381 902 869 736 622 479 314 274 22950 1339 31056 740 656 13813
NM_003941chr722304 2011 ------
NM_003947chr33304 165 89 11214 164 --
NM_003948chr442520 2411 691 208 22576 173 12368 --
NM_003949chr17222060 2005 1962 1918 1901 1880 1855 1835 1789 1684 1598 1572 1384 1367 1346 1259 719 615 576 543 292 270 --31264 423 250 21998 1601
NM_003955chr17101490 1483 1206 1138 603 537 296 151 140 53 --11032 --
NM_003958chr693660 3198 3105 3090 2483 883 667 527 510 --31007 988 160 11021
NM_003968chr31149 ------
NM_003972chr10----1305 --
NM_003975chr11328 ----172
NM_003983chr16184423 4328 4300 4050 3688 3614 3608 3434 3291 3181 2714 1599 1302 1233 1220 1043 983 473 --13843 --
NM_003992chr151277 ------
NM_004004chr132904 396 196 ----
NM_004019chrX3333 166 69 179 154 --
NM_004028chr1862697 2591 1654 1079 681 617 11526 2557 60 1684
NM_004035chr17134868 4424 3932 3731 3629 3616 3546 3430 3317 3304 3232 1285 871 --54875 4394 3598 3449 721 44561 3750 3464 406
NM_004036chr22121 76 --1236 --
NM_004050chr1472201 2003 868 790 760 607 594 12373 --1599
NM_004055chr11132208 1617 1554 1444 896 887 726 440 232 151 111 103 34 --3665 539 401 --
NM_004061chr5186 ------
NM_004067chr741431 1415 1069 582 --1233 11436
NM_004068chr36295 112 93 68 41 28 --1297 --
NM_004074chr112160 87 ------
NM_004077chr1271102 1077 1045 851 473 195 179 --1495 --
NM_004081chrY21397 1183 11527 197 --
NM_004083chr12151 --176 --
NM_004085chrX2510 97 ------
NM_004087chr321592 618 1452 11545 --
NM_004090chr1782723 2439 579 452 387 364 293 100 1379 53020 2352 1016 517 491 1666
NM_004093chr1382375 1312 1298 596 270 131 59 31 ------
NM_004096chr1091673 1510 1444 862 793 456 208 189 129 --31678 696 210 --
NM_004097chr23717 361 283 --1257 --
NM_004098chr10--11261 ----
NM_004099chr982083 1750 1688 1622 559 527 274 113 1677 --2709 26
NM_004102chr13584 492 151 ------
NM_004103chr87771 760 553 141 115 87 56 ------
NM_004105chr21801 --11001 --
NM_004107chr19165 ----1163
NM_004113chr331591 38 23 --273 55 --
NM_004114chrX1334 ------
NM_004116chr2----151 --
NM_004117chr681929 1627 823 641 628 611 539 45 --1874 2616 147
NM_004124chr1463374 2741 2728 2310 2255 352 23199 2188 ----
NM_004132chr107905 854 827 779 766 201 157 --1159 --
NM_004134chr51584 ------
NM_004136chr151332 ------
NM_004156chr81400 ------
NM_004157chr33905 892 339 ------
NM_004161chr211036 ------
NM_004162chr321124 1007 194 1187 --
NM_004171chr11169665 9036 8654 8593 8504 7771 6572 6513 6426 3527 2806 2029 1170 557 331 291 59099 3864 2333 1770 302 27819 3326 38961 2196 2063
NM_004172chr561962 1542 654 630 114 105 ------
NM_004183chr112681 629 ------
NM_004185chr13760 722 78 ----143
NM_004187chrX111095 1066 1052 980 452 434 421 365 356 242 213 11106 11241 --
NM_004193chr104390 370 364 196 --136 --
NM_004199chr5125 ------
NM_004200chr11132901 2747 2339 2075 1206 1064 1053 916 834 791 783 762 387 --32157 1130 993 12295
NM_004202chrY1175 ------
NM_004203chr16150 ------
NM_004205chr11125 ------
NM_004206chr3143 ------
NM_004210chr10132126 1803 1637 1437 1349 768 674 548 390 266 244 234 114 --51646 1608 1546 635 473 --
NM_004225chr811288 --11006 --
NM_004227chr793036 2512 1956 1212 933 833 822 302 251 --12654 --
NM_004229chrX31613 1556 589 ------
NM_004233chr621298 265 ------
NM_004235chr9173 2705 126 ----
NM_004236chr151376 ------
NM_004249chr4----172 --
NM_004272chr52717 588 ------
NM_004274chr1462830 2782 2759 328 298 260 33035 1091 146 2341 82 1164
NM_004277chr6--11204 1660 11625
NM_004279chr772233 2191 2111 2039 1941 1739 738 --12113 11742
NM_004283chr196972 875 680 604 103 32 --1880 1673
NM_004296chr14143950 3813 3397 3346 3224 2994 2746 2710 2686 1577 1408 897 450 235 --33399 1092 462 --
NM_004301chr3127 ------
NM_004302chr12122612 2573 2306 2119 1787 1112 862 777 762 481 163 85 12510 32463 2396 450 1204
NM_004305chr2144 1150 --149
NM_004308chr11141742 1448 1422 1194 748 736 613 607 452 383 263 213 124 59 21635 638 --11329
NM_004311chr10132727 2693 2563 2480 2326 2256 2214 2159 2136 2087 2027 1198 812 ----22490 344
NM_004313chr174327 180 148 99 1334 1354 --
NM_004316chr122433 381 ------
NM_004321chr2133353 3155 2953 2857 2702 2554 1399 1123 1113 469 177 88 47 1483 23058 2488 --
NM_004323chr9102470 2341 2284 2202 2068 2059 2046 268 183 131 --22481 568 11987
NM_004326chr171152 1142 1010 998 834 801 357 11054 21159 909 --
NM_004330chr152986 958 ------
NM_004331chr812707 1140 --1614
NM_004338chr18196880 6466 5816 4914 4898 4706 4349 4304 2345 2307 2257 2221 1796 1429 1198 1137 1128 193 67 22490 451 25806 2665 --
NM_004341chr2----166 --
NM_004342chr732289 1960 1872 ----11605
NM_004349chr81286 11115 ----
NM_004350chr192112 2068 2009 1957 1867 985 632 368 277 --122 1423
NM_004364chr194377 216 158 126 --11280 --
NM_004370chr641957 1460 812 802 --1594 11779
NM_004371chr13618 82 66 --1965 --
NM_004379chr23655 262 199 ------
NM_004380chr1632319 1700 518 ------
NM_004383chr152447 255 ------
NM_004384chr51944 1772 ----
NM_004386chr19101833 1701 1506 837 818 805 618 511 43 35 --1699 --
NM_004391chr3192035 1898 1886 1584 1501 1487 1435 1420 1360 1293 804 616 584 376 228 204 154 102 53 --1232 --
NM_004392chr1311833 12670 ----
NM_004393chr371849 1830 1546 798 738 576 156 12054 1695 22087 168
NM_004395chr58695 684 539 517 303 270 231 147 ------
NM_004396chr17------1281
NM_004397chr1153037 1354 600 401 74 23736 797 ----
NM_004399chr126811 624 298 246 169 37 1706 1770 1634
NM_004405chr210915 817 380 318 285 215 178 155 106 78 --2363 82 --
NM_004408chr92375 30 --1420 --
NM_004414chr2131096 625 490 ------
NM_004416chr1281088 762 748 740 690 233 57 22 1779 1696 --
NM_004417chr51421 ------
NM_004418chr22549 115 --1562 --
NM_004419chr102895 241 ------
NM_004420chr11202417 2408 2275 2209 2199 2130 2099 2089 2020 1946 1886 1875 1803 1589 1528 841 834 452 440 426 --52384 2223 2113 1743 287 --
NM_004422chr174341 167 161 139 ------
NM_004423chr3122700 2588 2455 2444 2347 2216 1099 1012 786 653 57 34 32320 2263 2089 22527 249 1917
NM_004426chr1231573 1316 463 --1471 --
NM_004427chr1111013 893 826 795 460 405 289 163 151 114 39 --21007 414 144
NM_004428chr13551 255 111 ------
NM_004429chrX81276 1222 458 337 316 208 78 55 --21335 339 --
NM_004430chr8131070 1001 978 962 953 810 794 697 622 391 206 136 110 32145 1048 158 31072 945 45 --
NM_004431chr15727 334 320 116 61 1309 ----
NM_004432chr911839 ------
NM_004433chr110619 550 540 428 311 271 196 187 106 58 11489 ----
NM_004436chr1281 38 ------
NM_004437chr1102410 1388 1164 1113 801 741 638 436 308 38 22968 1051 12399 11422
NM_004438chr233203 900 856 ------
NM_004440chr641959 1786 1726 280 21433 157 --21777 111
NM_004443chr34609 256 230 164 ------
NM_004444chr75637 550 285 277 37 ------
NM_004446chr1----135 --
NM_004451chr113559 536 157 1549 1169 --
NM_004454chr332099 2032 46 --12119 1667
NM_004456chr7125 ------
NM_004458chrX22281 1819 31903 472 364 --11692
NM_004459chr1721547 1261 ------
NM_004463chrX5472 463 410 106 76 --182 --
NM_004468chr14249 220 133 29 --1608 --
NM_004472chr51104 ------
NM_004474chr151034 406 377 303 46 --1397 --
NM_004475chr176461 399 241 191 179 44 --1480 --
NM_004484chrX4318 309 267 116 ------
NM_004485chr1203802 3496 3479 3379 2991 2861 2828 2787 2771 2699 2685 1414 1168 1076 1063 1030 876 673 641 26 11257 11736 33160 1551 809
NM_004494chr1161238 1205 1171 970 816 489 353 344 330 324 273 242 213 191 136 100 --11069 --
NM_004496chr144414 310 301 285 ------
NM_004500chr1461923 367 197 135 120 85 --1137 --
NM_004501chr152797 1550 1250 848 489 11118 13589 --
NM_004503chr126794 203 169 59 38 26 ------
NM_004505chr171420 --1733 1671
NM_004514chr1763003 2808 2746 2608 2418 2322 2891 336 52812 2288 272 111 65 --
NM_004516chr1931262 1121 993 1434 ----
NM_004517chr11291 63 1211 ----
NM_004519chr82165 25 ------
NM_004525chr231317 1250 1206 --11194 --
NM_004527chr17101344 480 361 344 326 230 222 205 105 86 11252 1330 --
NM_004535chr2051721 1311 162 96 49 --1555 --
NM_004537chr1221154 55 ------
NM_004556chr62274 39 ------
NM_004569chr142737 34 1533 ----
NM_004571chr2193067 2735 2209 1322 1245 969 773 568 276 ------
NM_004574chr17135 --164 --
NM_004575chr441199 1039 1009 58 ------
NM_004576chr51151 ------
NM_004578chr13841 826 772 ------
NM_004580chr1541635 1352 719 706 --11626 --
NM_004583chr177539 533 525 505 278 261 33 --1252 --
NM_004586chrX74684 4615 4516 4054 3379 2175 155 1653 ----
NM_004587chr201465 --1168 --
NM_004588chr11214074 3611 3215 3206 3195 3140 2971 2647 1085 942 737 661 650 469 460 246 183 151 128 92 42 21089 672 126 13250
NM_004594chr165975 630 595 301 188 1197 ----
NM_004598chr592925 2397 2316 1053 960 633 396 262 153 --1708 --
NM_004602chr2041301 1272 529 283 1566 --11410
NM_004603chr771049 972 914 387 343 302 114 --2843 119 185
NM_004606chrX2268 32 ------
NM_004608chr163307 157 49 --140 --
NM_004609chr202488 394 ------
NM_004612chr964881 4751 4577 4513 831 217 24344 1567 1150 23872 3559
NM_004614chr16112413 2059 1993 1692 921 659 565 516 280 250 87 3913 633 616 12002 --
NM_004615chrX4676 623 157 123 177 ----
NM_004630chr1161055 1037 940 814 309 281 --21049 372 --
NM_004631chr11483 ------
NM_004634chr34578 434 148 50 ------
NM_004637chr371239 1174 1026 448 165 108 76 185 ----
NM_004639chr6122 ------
NM_004642chr12164 --1119 --
NM_004643chr142636 610 ------
NM_004645chr171831 1550 ----
NM_004654chrY1405 ------
NM_004656chr35880 399 84 75 61 11265 2885 155 --
NM_004660chrY21494 234 ----11576
NM_004661chr531227 1063 260 --1862 11092
NM_004663chr1531168 415 46 ------
NM_004664chr12----1221 --
NM_004667chr15--1213 1566 --
NM_004671chr181212 ------
NM_004673chr121484 479 1573 ----
NM_004674chr83184 176 111 188 --1610
NM_004684chr4139 ------
NM_004686chr81435 31576 331 50 ----
NM_004687chr171131 ------
NM_004690chr61609 1744 ----
NM_004703chr1722498 2347 ------
NM_004705chr111190 1164 ----
NM_004711chr22193577 3117 3083 3045 2836 2805 2769 2758 2548 2510 2281 1308 1207 879 805 699 658 46 31 22779 974 93376 3305 3266 2747 2534 1281 1213 1170 675 --
NM_004714chr194334 67 43 27 ------
NM_004716chr113803 741 329 2788 41 1331 1921
NM_004717chr751503 527 351 262 53 ------
NM_004719chr1252723 2276 2029 204 187 ------
NM_004723chr14924 858 420 239 --1766 --
NM_004726chrX84492 4259 2239 2224 2084 1917 1678 237 --14171 11951
NM_004730chr521525 696 ------
NM_004731chr1241427 1227 473 284 ------
NM_004734chr1342377 1276 877 843 12902 --134
NM_004736chr151858 1743 1728 1418 865 11881 ----
NM_004738chr2082445 2110 1973 1047 450 356 338 136 11745 --11029
NM_004739chr112540 66 ------
NM_004742chr361677 1257 1243 583 431 71 ------
NM_004745chr8196784 6693 6674 6222 6180 6136 5957 5908 5726 4624 4283 2197 1666 1483 725 608 115 90 21 15210 46311 6256 5034 94 --
NM_004746chr183116 76 45 1101 ----
NM_004755chr1411023 ----1118
NM_004759chr1162101 2021 1980 1917 1777 1574 1566 1510 1328 724 643 463 433 408 366 258 --1231 --
NM_004762chr17101569 1298 1288 1235 760 592 520 270 229 55 ------
NM_004772chr531403 296 281 21167 348 ----
NM_004774chr1772852 2372 1035 1029 984 863 341 --11929 --
NM_004779chr56881 433 256 239 216 73 --1918 --
NM_004781chr121486 306 --1390 --
NM_004781chr121486 306 --1390 --
NM_004783chr165599 484 242 219 132 --1631 --
NM_004784chr41126 ------
NM_004789chr91364 ------
NM_004792chr2124 ------
NM_004796chr14------12453
NM_004798chr20103217 3132 2925 1222 822 568 339 315 309 291 22582 629 ----
NM_004799chr1--1314 ----
NM_004801chr231399 1182 1163 ------
NM_004807chr2112420 2169 1968 1774 1684 1024 992 750 620 484 293 12305 22338 2253 --
NM_004808chr1022649 2181 --12844 12338
NM_004814chr1195 1504 ----
NM_004815chr154550 4432 4400 4383 4355 ------
NM_004821chr53782 625 322 ------
NM_004822chr17163750 3729 3713 3070 2878 2648 1496 1481 1446 1401 1387 1034 529 303 169 105 12826 33704 913 284 23718 1392
NM_004824chr621291 439 --11148 --
NM_004830chr63754 177 171 ------
NM_004831chr196782 764 724 169 93 30 ------
NM_004837chr131604 1139 321 ------
NM_004839chr152453 172 ------
NM_004841chr151152 980 921 881 49 1176 ----
NM_004845chrX94136 4102 3914 3377 3205 1659 878 505 163 14154 53052 1212 552 414 324 23220 3085
NM_004850chr22245 48 11134 1522 --
NM_004857chr1423593 1567 21151 545 11721 21735 1601
NM_004859chr1732601 766 253 --1530 12663
NM_004860chr175370 232 225 187 23 --1374 --
NM_004863chr1495019 3927 3665 3295 808 416 336 188 33 23912 602 34594 450 439 1718
NM_004869chr1821147 181 ------
NM_004871chr17114166 3753 3518 3116 3042 1771 535 476 459 430 255 23462 2703 2847 719 2741 617
NM_004872chr11308 ------
NM_004873chr1453148 2366 2188 1036 975 11304 ----
NM_004879chr112656 306 --2325 73 --
NM_004884chr1581664 1570 659 622 567 536 447 225 21640 1580 1575 --
NM_004893chr5178 ------
NM_004896chr102595 371 ------
NM_004898chr472746 2549 2276 2176 2168 474 462 --12917 --
NM_004902chr201175 ------
NM_004904chr7136358 5955 5046 4783 4513 4445 2466 1966 1718 1449 1262 572 492 --21437 1264 35958 5054 1580
NM_004907chr193780 760 239 ------
NM_004922chr102773 40 2903 343 1997 --
NM_004924chr194850 374 288 160 --1309 --
NM_004926chr14111622 681 572 559 548 531 515 232 155 72 23 --1442 --
NM_004930chr17530 277 212 175 147 91 79 ------
NM_004932chr5--1179 1663 --
NM_004936chr962448 2130 1916 1001 364 53 12144 22043 168 --
NM_004938chr971044 484 286 260 165 131 70 --2849 264 --
NM_004947chr3102086 1029 870 845 788 667 553 378 282 207 --32341 850 723 --
NM_004952chr110916 872 843 721 700 668 323 161 102 70 --2848 106 --
NM_004956chr743567 3147 3109 3042 ------
NM_004958chr12219 64 ----1373
NM_004959chr971398 1361 1130 590 388 290 282 --21376 1369 --
NM_004960chr16------178
NM_004961chrX61349 556 519 238 168 32 1344 ----
NM_004965chr21139 1650 ----
NM_004966chr101735 ------
NM_004969chr10151 --1370 --
NM_004975chr202370 219 ------
NM_004976chr11224862 4844 4827 4763 4676 4644 4336 4314 4084 3915 3308 3172 2009 1748 1735 1673 1502 1356 1331 1252 846 566 14853 34726 832 568 --
NM_004978chr181579 1565 1554 1270 1249 659 623 503 --21219 419 --
NM_004979chrX111088 1057 1013 829 796 390 323 311 286 252 235 --1191 11075
NM_004981chr222296 152 --173 --
NM_004985chr1254101 1803 851 582 194 34516 3493 699 ----
NM_004992chrX408065 7974 7886 7791 7460 6976 6933 6803 6784 6537 6353 6173 6007 5974 5924 5776 5278 3418 3180 2814 2568 2491 2142 1798 1634 1538 1509 1492 1379 1310 1283 1272 1222 1154 1002 935 447 393 322 92 57954 6314 3100 1758 457 87888 7798 6009 5872 3010 2523 1228 328 --
NM_004992chrX408065 7974 7886 7791 7460 6976 6933 6803 6784 6537 6353 6173 6007 5974 5924 5776 5278 3418 3180 2814 2568 2491 2142 1798 1634 1538 1509 1492 1379 1310 1283 1272 1222 1154 1002 935 447 393 322 92 57954 6314 3100 1758 457 87888 7798 6009 5872 3010 2523 1228 328 --
NM_004994chr201135 ------
NM_004995chr14101310 1263 1029 195 166 148 118 107 88 27 --1472 --
NM_004999chr693423 3223 3133 2981 1601 1386 1334 535 225 2914 217 14266 --
NM_005010chr742140 2038 1696 651 12163 172 --
NM_005011chr761848 1474 1455 1311 753 597 --21466 576 --
NM_005020chr73600 160 88 --1179 --
NM_005023chr511426 ----11429
NM_005026chr161574 1554 1309 437 275 200 11446 2341 332 1316
NM_005027chr1961113 1030 286 183 160 140 --1962 --
NM_005028chr1052167 1662 619 183 115 --1745 --
NM_005032chrX5721 341 285 190 34 --2726 261 --
NM_005038chr4------1452
NM_005045chr73722 707 155 131 ----
NM_005052chr172283 236 ------
NM_005053chr194468 212 183 177 ----1160
NM_005055chr112161 29 ------
NM_005056chr1274214 4155 2033 1790 1639 1613 190 1344 35360 863 707 --
NM_005057chr181747 1613 586 482 464 370 220 185 --4658 595 497 112 --
NM_005060chr171260 1230 534 245 87 51 26 --1539 1920
NM_005063chr1073360 1200 992 604 262 236 211 1322 1280 11136
NM_005065chr1462032 1858 1451 970 919 637 23488 1663 34540 1648 99 --
NM_005074chr62246 41 ------
NM_005076chr1204141 3738 3709 3587 3212 2915 2887 2654 2586 1369 1125 1089 978 949 919 845 504 494 230 66 11318 22766 753 --
NM_005078chr1591708 1174 1153 1147 601 501 466 328 224 --1503 --
NM_005079chr811104 --1655 12884
NM_005080chr222741 300 --1102 --
NM_005087chr32861 548 ------
NM_005096chrX61105 1019 813 449 283 225 ----1839
NM_005099chr121334 131 11029 --21174 894
NM_005105chr131531 759 719 ----11808
NM_005109chr352529 2477 605 164 157 --2867 109 --
NM_005110chr54625 578 531 134 --1598 --
NM_005112chr43966 857 341 1789 ----
NM_005114chr41562 ------
NM_005116chr2094190 3967 3857 2898 1003 763 520 443 268 --44141 2900 1433 321 --
NM_005119chr161308 1284 1166 931 430 166 ------
NM_005121chr1752705 2388 1506 1462 1337 12351 --13610
NM_005122chr1121 ------
NM_005124chr61134 ------
NM_005126chr32310 197 --11772 --
NM_005133chr113338 50 31 ------
NM_005134chr183332 106 33 ------
NM_005135chr1593640 3332 3159 2594 2437 1002 902 169 85 12740 --22772 2628
NM_005141chr4--2399 102 ----
NM_005146chr116732 352 224 217 71 57 ------
NM_005151chr181480 ------
NM_005153chr163107 73 66 1187 ----
NM_005156chr974707 4576 3653 3526 3520 3428 1526 124 ----
NM_005161chr11162190 2014 1978 1908 1647 1603 1519 1496 1395 803 694 483 465 367 141 40 --1448 --
NM_005166chr194346 218 72 40 --1309 --
NM_005167chr1133 --250 23 --
NM_005168chr231523 1377 584 ------
NM_005176chr12131 --121 --
NM_005180chr101167 ------
NM_005182chr166566 511 414 112 89 53 ------
NM_005184chr1991347 1320 1158 1147 430 309 279 233 182 2995 247 11090 --
NM_005186chr117560 508 476 142 132 103 37 --3436 148 64 --
NM_005187chr16171643 1494 1401 1371 1341 1323 1316 1307 597 530 524 381 359 345 335 244 164 11441 11619 11657
NM_005188chr11357929 7648 7496 6967 6898 6786 6636 6619 6454 6035 5787 5743 5734 5725 5549 5490 5458 3134 3094 3080 2980 2739 2726 2274 1863 1817 1736 1373 1365 1289 930 630 492 235 116 --37072 2925 1144 25105 1308
NM_005197chr14146196 5537 5502 5276 5082 5000 4275 3830 3820 3814 3788 2452 2238 1140 13997 14548 --
NM_005201chr31274 ------
NM_005202chr1111803 1596 895 887 724 622 396 348 148 78 33 21873 1762 2901 350 --
NM_005203chr101164 ------
NM_005206chr173901 416 408 --176 --
NM_005215chr181477 ------
NM_005219chr581625 1375 729 583 490 463 289 108 2545 151 11388 --
NM_005220chr17141432 1304 1291 1251 1096 958 469 450 343 316 194 153 131 120 --11443 --
NM_005225chr2091141 1134 1017 953 928 902 794 445 118 --184 --
NM_005229chrX101230 992 940 806 796 344 335 244 191 159 1147 1997 --
NM_005232chr7186 --188 --
NM_005233chr342346 2004 1004 884 2855 729 12196 --
NM_005235chr2147612 7060 6790 6716 6485 6370 5765 5739 5512 5472 2599 2528 1956 61 26908 5980 23038 114 12812
NM_005238chr1132890 2807 743 --12537 142
NM_005239chr2131735 1644 174 12041 ----
NM_005240chr13803 547 219 1622 ----
NM_005241chr31297 11184 ----
NM_005245chr4--2210 87 ----
NM_005248chr13550 198 23 170 1544 --
NM_005250chr16101936 1899 1806 1733 1711 1240 1195 190 70 27 --11245 --
NM_005252chr142237 85 ------
NM_005254chr1531122 980 454 --1873 --
NM_005257chr1831267 1174 253 1145 ----
NM_005261chr82849 346 ------
NM_005263chr16960 372 323 164 150 55 --1325 --
NM_005264chr10--1736 ----
NM_005274chr11157 128 ----
NM_005275chr62117 25 --130 --
NM_005276chr12111748 1660 1523 1408 706 638 631 625 589 235 94 --11750 --
NM_005276chr12111748 1660 1523 1408 706 638 631 625 589 235 94 --11750 --
NM_005277chr41215 1172 1322 --
NM_005296chrX2841 40 ------
NM_005308chr101503 ------
NM_005311chr772019 2009 1906 852 602 530 205 1582 1604 --
NM_005312chr9162580 2140 1950 1857 1007 968 947 899 661 540 439 386 298 290 178 54 --32035 740 312 --
NM_005313chr1531101 874 39 --198 --
NM_005335chr36373 280 175 117 68 36 --1301 --
NM_005336chr2172170 2154 2079 1923 1880 1845 1798 1666 1495 1457 866 474 417 411 120 114 25 11927 ----
NM_005337chr122337 40 --1425 --
NM_005339chr433635 1031 851 23525 1596 ----
NM_005342chrX52126 2013 1929 937 757 22357 140 --32854 2181 1107
NM_005347chr951668 1650 550 518 488 --1538 --
NM_005349chr43568 487 143 ------
NM_005359chr18106359 6024 4651 4349 4305 4289 2199 1682 1467 145 16347 12168 25730 2335
NM_005370chr1941249 1168 527 515 2924 447 2835 86 --
NM_005374chr17102373 2263 2128 2108 2080 657 606 371 130 65 11537 52159 2122 1527 435 428 --
NM_005376chr13776 384 89 ------
NM_005380chr171280 1230 1207 1061 920 860 22 --41069 516 504 28 --
NM_005382chr82161 86 ------
NM_005385chr352179 2171 2140 2078 2062 2901 183 ----
NM_005386chr204879 814 592 197 ----2605 200
NM_005387chr111240 --1608 --
NM_005389chr62674 27 1689 ----
NM_005392chr931561 129 115 11820 170 --
NM_005397chr783530 3235 1055 923 631 610 560 431 21538 545 1587 1124
NM_005399chr192923 1586 1576 1448 868 616 591 495 44 21430 1262 31099 563 242 --
NM_005400chr252763 948 423 162 100 12686 1172 --
NM_005402chr711748 ------
NM_005406chr1811310 ------
NM_005407chr1491392 1384 1248 308 298 292 273 264 202 --2639 68 --
NM_005410chr52749 140 ------
NM_005412chr125488 449 423 140 47 --2146 111 --
NM_005413chr27374 167 99 84 72 51 22 --164 --
NM_005415chr21500 --1747 --
NM_005418chr112693 654 1241 3698 581 572 --
NM_005426chr1--1372 ----
NM_005430chr12131055 1040 881 823 802 667 654 386 378 370 235 142 47 --3901 646 153 1418
NM_005433chr1822752 1905 ------
NM_005435chr72547 161 ------
NM_005436chr1072811 2592 2568 2506 1644 862 415 11451 23583 419 --
NM_005438chr114481 249 209 52 ------
NM_005439chr126496 462 130 83 75 23 ------
NM_005442chr31432 --1105 --
NM_005445chr101231 ------
NM_005453chr65475 457 221 190 87 1489 --1424
NM_005458chr981799 1520 951 904 865 819 532 29 --21671 121 --
NM_005461chr2041664 1314 1226 535 --1227 --
NM_005465chr11103 11806 ----
NM_005466chr142498 447 ------
NM_005474chr17181542 1494 1473 1451 1409 1232 1212 1163 1125 1041 1028 555 418 273 237 163 121 107 --1214 --
NM_005475chr12163075 2994 2753 2739 2457 2409 2288 2273 2202 2149 975 779 510 433 174 87 --32609 1303 92 --
NM_005477chr1562284 1902 1587 1045 794 41 --42522 2033 1910 837 --
NM_005477chr1562284 1902 1587 1045 794 41 --42522 2033 1910 837 --
NM_005493chr6----1781 --
NM_005497chr1795935 5237 4888 4783 2237 1639 243 189 71 35835 5803 4495 54938 4803 1862 1700 504 24817 1876
NM_005501chr1771209 1158 1152 1075 1016 388 26 --31124 343 174 --
NM_005502chr9--1219 ----
NM_005504chr1265717 4284 1642 1278 604 287 --21068 491 --
NM_005505chr125842 383 332 90 80 --1128 --
NM_005507chr117442 422 332 326 202 175 75 --1334 1205
NM_005509chr53756 393 325 11744 ----
NM_005512chr1181922 1479 1345 1287 756 739 348 167 --11997 --
NM_005515chr73623 185 59 ------
NM_005520chr51769 ------
NM_005522chr72379 249 ------
NM_005534chr211493 ------
NM_005539chr1031111 500 51 1988 ----
NM_005542chr72699 195 --1641 1278
NM_005544chr21915 1350 ----
NM_005552chr144468 147 82 40 --173 --
NM_005557chr173104 52 28 ------
NM_005558chr18925 870 711 670 392 323 180 49 --3182 93 72 --
NM_005562chr121617 1411 --21251 523 --
NM_005563chr1387 37 26 --1621 --
NM_005565chr52107 33 ------
NM_005566chr111371 1435 ----
NM_005569chr2251512 1194 1150 525 144 11122 11107 --
NM_005576chr152117 32 --169 139
NM_005578chr374803 4781 4765 3653 1457 462 229 22064 220 23863 3778 --
NM_005581chr195337 125 105 98 90 --1331 --
NM_005584chr132527 251 ------
NM_005587chr151342 ------
NM_005596chr954026 2500 2466 2193 1104 11802 12203 --
NM_005598chr1121566 1508 1479 1344 1311 1188 1169 504 324 209 79 32 11607 124 --
NM_005599chr141046 1038 484 338 ------
NM_005603chr1821250 63 ------
NM_005604chr64583 460 83 42 ------
NM_005605chr81295 ------
NM_005607chr82973 866 --2883 57 --
NM_005613chr132188 2133 307 1890 --1312
NM_005614chr74908 884 184 138 --1676 --
NM_005619chr193134 93 79 ------
NM_005625chr831013 345 83 ------
NM_005626chr12181 166 --1154 --
NM_005627chr61941 ----1218
NM_005637chr1831738 1434 73 --31707 698 91 11875
NM_005644chr11353 ------
NM_005647chrX133225 2907 2747 2610 854 788 778 770 749 661 599 462 405 12510 ----
NM_005649chr5----1473 --
NM_005652chr1651200 1111 1026 432 173 11017 --2341 207
NM_005653chr12136 ------
NM_005655chr8173 --11184 --
NM_005656chr2151377 1244 459 194 63 --1346 11155
NM_005662chr82168 135 1118 ----
NM_005663chr4----1370 --
NM_005665chr154008 3860 3612 1616 990 1721 1584 2753 617
NM_005668chr533850 1374 221 12867 13039 2913 747
NM_005669chr541758 334 41 31 22065 824 ----
NM_005677chr361453 1341 1062 1043 977 406 --1217 --
NM_005678chr153884 806 127 ------
NM_005688chr321060 968 --181 --
NM_005698chr12230 54 --1209 --
NM_005708chr131144 1159 ----
NM_005715chr631062 122 33 11008 ----
NM_005716chr196530 472 455 421 187 178 --2554 542 --
NM_005722chr22204 99 ------
NM_005725chr141565 550 312 65 11508 ----
NM_005730chr12123403 2373 2322 1457 1358 1134 1084 731 682 654 346 47 --53499 2788 2611 2595 1047 32961 1413 328
NM_005731chr22273 264 1359 ----
NM_005736chr1061534 1421 1300 451 267 25 ------
NM_005737chr262738 2719 998 788 523 467 --2385 334 12811
NM_005738chr741786 1320 202 99 ------
NM_005739chr1541885 1559 1545 530 ------
NM_005746chr722336 831 12700 ----
NM_005748chr1223360 2455 ------
NM_005749chr172210 67 ------
NM_005754chr51162 2765 202 ----
NM_005759chr2104614 4170 3395 3317 3295 3024 1800 562 453 361 1662 23223 48 14142
NM_005768chr125543 507 256 122 52 ------
NM_005776chr141585 ------
NM_005779chr583635 3293 3259 2419 949 850 268 28 13362 2854 733 13425
NM_005786chr181111 ------
NM_005789chr17172174 2147 2099 1946 1919 1573 1516 1509 1473 793 704 680 309 303 207 146 115 21384 1339 51897 1495 1421 520 488 --
NM_005795chr21221 22143 42 1819 1535
NM_005796chr16262 36 ----151
NM_005801chr172318 67 ------
NM_005807chr11223 --1233 --
NM_005808chr393575 3410 3378 2880 2691 1439 1159 832 317 12857 22640 23 --
NM_005811chr12297 24 ------
NM_005813chr21996 --22020 305 11860
NM_005814chr1131240 1094 981 934 569 540 517 336 283 221 130 65 50 --21231 586 --
NM_005819chr1103460 3057 2936 2483 1273 813 469 389 286 30 --13440 --
NM_005822chr65722 468 277 135 118 --12222 --
NM_005828chr17225036 4724 4586 4278 4153 4031 3880 3755 3736 3528 2026 1926 1853 1519 1315 1101 855 818 583 560 447 203 21972 1125 24226 4160 24281 740
NM_005833chr92178 111 ------
NM_005834chrX3185 77 43 ------
NM_005839chr12658 318 1805 ----
NM_005840chrX217533 6824 6670 6411 6286 6190 5537 5380 4698 2153 1387 1303 1095 916 847 591 577 495 464 342 114 57345 5448 5239 4790 1790 1443 16024
NM_005841chr45731 207 118 106 25 ------
NM_005842chr131263 ------
NM_005843chr22624 135 21942 1330 --195
NM_005850chr1121 136 ----
NM_005851chr116348 319 313 294 281 63 --1283 --
NM_005852chr1791081 853 341 273 198 185 151 138 92 1264 3994 304 278 --
NM_005853chr16----1113 --
NM_005857chr141442 1188 571 541 ------
NM_005859chr5--11111 ----
NM_005862chr31932 --11019 --
NM_005869chr51384 172 ----
NM_005875chr31124 1373 ----
NM_005876chr22623 45 --3790 749 704 --
NM_005877chr2232139 51 42 ------
NM_005880chr1611589 ------
NM_005885chr561075 429 168 88 77 28 ------
NM_005892chr172287 105 ------
NM_005895chr12143958 3837 3725 3572 3217 2979 2823 2799 2672 1535 1289 1072 668 401 --33234 1091 637 23114 805
NM_005898chr11193 ------
NM_005901chr18148495 8041 7643 6860 6295 2817 2365 2333 2304 2225 1002 748 448 206 38176 6847 6362 1939 --
NM_005904chr183978 592 75 ------
NM_005906chr62676 321 ------
NM_005907chr631366 503 352 ------
NM_005909chr594259 4090 3592 3322 2702 1605 1291 815 773 --32914 1591 1154 --
NM_005911chr251224 580 494 482 79 11185 1947 --
NM_005920chr1293595 3506 3492 3284 3225 3157 3146 3140 2733 2715 2520 2512 2436 2374 1500 1489 1467 1266 1232 1196 1151 1140 1129 978 830 737 218 66 30 --53276 2514 388 85 23 13059
NM_005922chr6------1105
NM_005927chr541026 314 177 45 1795 ----
NM_005933chr1152706 2415 759 696 90 23038 382 22228 517 --
NM_005934chr19142305 2250 2128 2077 1780 1727 946 924 783 740 717 505 170 71 12226 42017 1789 928 771 1408
NM_005935chr483930 2121 1724 884 816 650 408 234 35002 3722 150 ----
NM_005937chr17213960 3912 3750 3275 3114 2916 2865 2599 2585 1458 1217 1191 1109 1043 945 920 828 674 613 518 200 33789 3536 2717 43039 1196 900 465 --
NM_005938chrX61338 1316 1288 1082 1043 81 --1255 --
NM_005941chr854195 2694 577 504 188 13548 1893 1862
NM_005943chr651261 1244 398 211 159 ------
NM_005944chr32802 316 1977 1204 --
NM_005955chr175317 4358 3871 2177 1701 758 420 35356 2099 2067 22085 1935 35000 1965 1477
NM_005962chr1042255 707 595 388 ----1196
NM_005962chr1042255 707 595 388 ----1196
NM_005964chr1771459 1229 1047 488 451 100 62 ------
NM_005966chr222317 1660 21985 1978 ----
NM_005967chr126557 525 295 277 123 102 --1519 --
NM_005984chr224508 474 441 99 --2358 101 --
NM_005985chr206663 541 204 107 52 24 --1206 --
NM_005994chr173633 281 168 ------
NM_005996chr1241542 344 287 102 ------
NM_005998chr1146 ------
NM_006007chr934470 283 210 --23716 2959 23902 3492
NM_006011chr15254119 4091 4048 3939 3828 3761 3678 3603 3588 3530 3473 3456 3365 3318 3187 3039 3017 2972 2964 2891 2833 2678 1433 787 341 23197 1633 53703 3130 3092 3085 1317 13207
NM_006015chr161247 913 356 173 163 128 --2917 167 --
NM_006016chr6------21838 880
NM_006022chr134966 422 415 314 1337 ----
NM_006030chr371167 377 326 100 64 57 30 --1458 --
NM_006032chr141234 --137 --
NM_006034chr11162376 2037 1805 1787 1749 852 734 686 514 496 429 419 260 152 143 65 --21960 1849 --
NM_006035chr1451186 1130 1076 450 263 --11087 --
NM_006036chr251965 847 521 427 291 32587 2176 60 1296 --
NM_006037chr243335 3246 3092 1461 11307 34929 4109 3772 --
NM_006038chr2082220 2074 705 569 561 516 485 468 41615 1347 865 489 2687 368 --
NM_006040chr1681394 1244 1090 569 509 492 454 115 21069 925 11246 --
NM_006047chr2042746 2512 921 400 12533 ----
NM_006054chr1141420 1035 450 141 --11389 --
NM_006055chr242450 2420 967 510 --1159 --
NM_006062chr2101232 1074 938 457 364 318 249 124 95 59 11066 31022 996 89 2773 371
NM_006067chr162773 226 ------
NM_006070chr31276 ----150
NM_006078chr22------199
NM_006079chr61228 ------
NM_006089chrX21344 103 ------
NM_006090chr12642 584 ------
NM_006091chr15151749 1717 1671 1553 1409 1398 672 633 564 494 416 403 251 166 66 --31721 1649 570 11795
NM_006094chr852225 1933 1911 1597 26 12063 ----
NM_006095chr483974 2841 1785 1694 1025 602 473 36 23950 1130 12850 11777
NM_006096chr871561 1259 402 271 240 176 54 --11505 --
NM_006099chr14899 812 587 360 --1597 1818
NM_006106chr1111245 12897 1562 --
NM_006108chr1132143 1826 278 22308 1707 ----
NM_006113chr141866 440 306 125 --21446 271 1142
NM_006129chr85534 385 233 185 96 ------
NM_006133chr11142360 2157 2116 1936 1865 1749 1729 1606 1570 1000 979 871 701 372 --52275 1611 1546 690 348 --
NM_006134chr2131467 625 66 11202 --21120 604
NM_006135chr131096 951 494 ----1395
NM_006136chr711185 --11011 --
NM_006142chr1190 ----1476
NM_006145chr193454 408 389 --1262 --
NM_006154chr1522506 1903 12093 1107 --
NM_006156chr143266 216 94 --161 --
NM_006158chr821620 628 140 ----
NM_006160chr17131599 1574 1429 1260 1235 1038 338 329 296 267 231 215 190 2306 243 1401 --
NM_006161chr54268 213 86 33 ------
NM_006162chr1851514 677 642 46 25 ------
NM_006167chr852032 945 450 347 43 --11683 --
NM_006176chr117722 687 627 594 300 97 74 1266 1235 --
NM_006177chr147990 847 789 763 434 335 208 --2984 829 --
NM_006178chr1791500 1396 1172 992 508 348 318 231 159 21180 1061 1233 --
NM_006180chr95844 779 284 227 27 ----130
NM_006185chr117659 552 479 242 229 98 91 --178 --
NM_006186chr2----1132 --
NM_006187chr12193203 2993 2804 2472 2415 2202 2180 1978 916 875 845 458 412 397 378 345 331 273 176 1950 42174 402 308 201 --
NM_006191chr125950 788 642 119 47 --2793 49 2205 156
NM_006192chr209910 409 399 272 170 145 121 106 44 11050 4799 226 206 183 --
NM_006195chr911259 ------
NM_006196chr2143 ------
NM_006197chr81139 1458 ----
NM_006198chr211232 ------
NM_006201chrX61091 888 866 848 212 80 --21156 286 --
NM_006203chr565438 4502 3982 3793 2132 819 11125 24840 4200 --
NM_006206chr452437 2358 2238 448 123 12823 126 --
NM_006212chr191764 1224 959 949 756 653 488 104 63 33517 1431 1187 ----
NM_006218chr3162 ------
NM_006224chr1792248 2142 1914 1615 871 865 713 559 517 12524 11968 22378 72
NM_006226chr211361 ------
NM_006228chr82177 122 --121 --
NM_006237chr1342150 701 590 79 11511 ----
NM_006241chr331526 906 809 ------
NM_006245chr66388 374 343 199 178 109 1765 ----
NM_006246chr141469 ------
NM_006247chr193450 403 326 --1409 --
NM_006251chr582212 1165 938 600 495 485 454 68 1392 1582 1748
NM_006252chr167336 6324 6177 2854 2641 345 36922 5347 2563 26269 6246 --
NM_006255chr142766 80 --182 --
NM_006256chr1--1787 --11714
NM_006258chr101559 ------
NM_006259chr4----1839 --
NM_006266chr95542 326 315 132 79 --3328 182 84 --
NM_006267chr231177 578 539 ------
NM_006275chr2052483 2463 1730 189 63 1805 --12489
NM_006277chr21181 ------
NM_006279chr12935 594 ------
NM_006282chr2062934 1235 888 834 544 270 2763 320 23155 3123 13290
NM_006293chr152865 355 1664 --1124
NM_006300chr193343 284 219 ------
NM_006301chr122448 236 ------
NM_006305chr15164 ------
NM_006306chrX115882 4612 4455 4399 3948 1963 1527 264 92 81 49 54555 3651 1952 75 53 1643 --
NM_006311chr17191 ------
NM_006313chr1211638 ------
NM_006317chr58786 641 608 130 119 105 92 49 ------
NM_006320chr41292 ------
NM_006321chr382049 1859 1845 1629 1525 1388 617 51 21423 842 --1881
NM_006322chr132109 64 ------
NM_006325chr121308 ------
NM_006328chr114589 581 255 136 --1249 --
NM_006329chr142701 151 --133 1686
NM_006330chr8166 1651 ----
NM_006333chr22153 44 1662 ----
NM_006334chr9152 1317 ----
NM_006336chr981423 1346 1232 1059 553 484 323 86 1536 51429 1353 1243 961 100 --
NM_006337chr123226 214 30 ------
NM_006345chr43972 241 74 ------
NM_006347chr1128 ------
NM_006352chr141290 1276 1267 563 ------
NM_006358chr2281059 944 870 453 374 308 75 52 ------
NM_006359chrX22028 680 --11681 1835
NM_006361chr17111953 1744 1642 1388 1313 767 746 688 573 418 122 1225 61633 1298 693 442 430 124 --
NM_006364chr141908 ------
NM_006367chr14818 783 698 30 ------
NM_006369chr15384 359 309 286 134 ------
NM_006373chr1781340 891 555 450 380 157 146 110 1508 1360 --
NM_006375chrX51655 1578 1480 1272 222 ------
NM_006377chr931156 953 305 ----11103
NM_006379chr7129 ----1726
NM_006380chr1733560 1459 406 --13529 11634
NM_006383chr155587 497 489 232 190 --2466 192 --
NM_006386chr2262243 2233 1979 639 629 286 --1792 --
NM_006387chr194460 421 352 55 11106 2917 356 --
NM_006389chr1181059 1007 853 534 504 398 216 40 --1881 --
NM_006390chr1251869 1499 1341 670 104 1742 --11506
NM_006391chr11----155 --
NM_006393chr1063660 3231 3155 2832 629 116 ------
NM_006401chr91162 --1167 --
NM_006405chr14262 34 ------
NM_006411chr66948 880 874 268 102 45 --3931 239 25 --
NM_006415chr93350 61 26 ------
NM_006416chr6--1738 ----
NM_006420chr2073245 1209 1126 1032 1022 760 689 13132 ----
NM_006421chr831209 265 255 ------
NM_006422chr12282 74 ------
NM_006424chr491610 1487 1476 1423 1300 480 427 382 61 11509 21291 66 11893
NM_006430chr24513 483 397 120 1206 ----
NM_006434chr1062453 1248 778 361 335 269 ------
NM_006439chr42511 48 1218 ----
NM_006440chr221104 ------
NM_006449chr252125 2041 1733 1574 1482 21581 1532 ----
NM_006454chr4142886 2858 2624 2335 2281 2186 2074 1985 1944 1079 945 553 231 86 --52546 2413 2244 555 189 --
NM_006458chr113344 261 135 ------
NM_006459chr1041896 1875 530 118 --11908 --
NM_006460chr1731314 1122 300 --11577 --
NM_006464chr2234494 4011 3999 3769 2953 2941 2871 1758 1703 1626 1615 1604 1592 1471 1384 1119 964 730 384 295 283 167 101 --13749 --
NM_006465chr15122269 2180 2141 1995 1783 1731 1701 1426 832 822 422 360 21770 779 41942 509 293 21 --
NM_006469chr131444 333 289 ------
NM_006475chr132542 195 ------
NM_006480chr52360 107 ------
NM_006482chr1251045 798 776 396 368 ------
NM_006483chr194334 67 43 27 ------
NM_006484chr194334 67 43 27 ------
NM_006489chr1461739 1604 1476 1373 1272 38 --11746 --
NM_006494chr195689 638 126 112 104 --1769 --
NM_006496chr11545 ------
NM_006497chr179808 796 755 647 635 628 562 303 134 --1273 --
NM_006500chr118999 530 391 357 102 66 43 25 1259 ----
NM_006509chr192332 100 ----1382
NM_006516chr171473 1335 1324 522 483 53 33 183 21016 524 --
NM_006517chrX152159 1984 1971 1963 1918 1671 1501 1463 581 312 267 182 95 40 31 1729 2917 221 1520
NM_006520chrX1459 ------
NM_006521chrX61293 1102 1075 508 191 32 --187 --
NM_006532chr1991484 1394 828 584 423 291 271 239 181 11406 ----
NM_006534chr2042604 2179 1175 204 1564 1260 --
NM_006540chr82145 59 11375 ----
NM_006544chr1445676 5244 5205 1250 23726 1806 25392 5128 --
NM_006546chr17326516 6278 6217 6069 6000 5959 5952 5938 5537 5513 5216 5161 4348 4212 2645 2504 2345 2186 2153 2144 2094 1553 1516 1416 1082 1040 875 787 766 422 173 65 35781 4201 1137 46521 5965 4360 4353 34563 4223 1423
NM_006547chr721745 275 1390 ----
NM_006548chr31297 --1229 148
NM_006549chr12142755 2662 2651 2542 2492 2460 2341 2309 2056 2023 1169 922 822 456 12716 42467 2435 2040 485 --
NM_006555chr761961 1724 1715 1513 620 466 1654 ----
NM_006557chr951495 1127 1104 497 486 --1269 --
NM_006559chr13810 138 63 11012 11136 --
NM_006560chr111143 ------
NM_006561chr10145122 5030 5002 4977 4738 4340 4275 2441 2255 2012 1110 394 169 28 34164 1910 463 25929 4922 --
NM_006562chr105293 112 106 93 36 --161 --
NM_006563chr194318 124 109 28 1142 2457 362 --
NM_006565chr163830 299 72 --1341 1364
NM_006566chr182875 378 11015 ----
NM_006572chr1722188 1258 12996 2461 260 --
NM_006577chr22953 52 --1343 --
NM_006589chr1----2426 139 --
NM_006593chr25746 285 91 79 65 --3654 308 272 --
NM_006595chr1131904 1352 439 ------
NM_006599chr16138055 7577 7547 7478 7391 6402 5866 5152 2578 2506 1758 1232 1154 --27185 775 --
NM_006601chr122356 236 ----11129
NM_006603chrX11372 --1759 --
NM_006608chr12119 25 ------
NM_006609chr222160 38 ------
NM_006612chr174472 458 375 75 --1464 --
NM_006614chr31579 12748 145 --
NM_006618chr171592 1309 1296 430 371 333 272 1613 ----
NM_006621chr151608 1324 609 599 243 11302 11345 --
NM_006624chr1021603 850 1579 196 --
NM_006626chr932055 793 256 1920 ----
NM_006628chr1574220 4012 3522 3192 1605 1391 1096 14189 31836 1742 748 44651 4240 3691 3556
NM_006633chr5------1723
NM_006636chr21675 1335 ----
NM_006640chr1771563 1368 1193 705 615 191 157 1543 2721 66 11857
NM_006644chr131573 ------
NM_006646chr1352591 1238 1141 1095 745 22579 404 ----
NM_006650chr5163787 3607 3275 3254 3132 2542 980 910 882 591 553 305 166 155 142 124 1202 13629 --
NM_006651chr481474 1397 1372 1300 559 431 147 42 --11288 --
NM_006654chr1294168 4144 3041 3035 2983 1845 1212 782 533 13129 14146 13192
NM_006658chr72129 87 ------
NM_006662chr161126 --1135 --
NM_006675chr12183261 3207 3162 3006 2849 2821 2807 2531 2324 2251 1310 1229 1113 1044 1019 984 552 319 --32483 1025 993 --
NM_006690chr2082283 2027 1980 1832 861 786 396 50 12185 12060 --
NM_006694chr12272 259 ------
NM_006695chr173238 97 84 ------
NM_006698chr203390 373 270 --21127 396 --
NM_006699chr122345 1969 22485 2172 1401 --
NM_006703chr6297 60 1414 165 --
NM_006708chr641084 992 304 134 ------
NM_006709chr63108 55 23 ------
NM_006721chr10166 ------
NM_006722chr342388 2382 2021 1928 12361 --1779
NM_006724chr6------1105
NM_006726chr43914 824 327 11235 ----
NM_006727chr5--1208 ----
NM_006734chr6139 ------
NM_006735chr71112 ------
NM_006736chr251758 743 610 531 432 --3708 536 134 --
NM_006742chr16132009 1591 1493 1457 1412 1317 779 713 614 458 440 318 78 --31715 1337 571 --
NM_006749chr85981 829 184 130 110 --1135 --
NM_006750chr16127999 7157 5762 3152 1998 1804 1745 1723 578 429 372 109 23166 2172 77307 7045 5470 2049 606 519 431 22204 112
NM_006751chr23919 827 204 1363 ----
NM_006754chr7------1281
NM_006761chr176737 721 711 704 628 43 ------
NM_006763chr1122006 1755 1741 1710 1683 1607 1547 1434 1301 561 431 202 11489 11743 --
NM_006766chr862619 1866 1803 1796 752 655 1391 ----
NM_006769chr12583 151 ------
NM_006772chr6181707 1664 1647 1577 1557 1445 1436 1272 1206 1189 676 668 590 456 224 204 118 106 --21076 206 --
NM_006775chr662067 2009 2001 1211 812 327 --12011 --
NM_006777chrX92872 2471 1969 1176 843 579 546 535 195 --1360 --
NM_006778chr611317 2392 165 ----
NM_006788chr1831870 828 562 --21875 465 --
NM_006795chr11101409 1248 1242 1113 1045 520 484 465 264 119 --31372 568 527 --
NM_006801chr195650 517 439 130 76 ------
NM_006802chr13397 382 44 172 --11164
NM_006805chr54671 190 179 103 174 ----
NM_006807chr17------1363
NM_006809chr203726 365 119 --2699 140 --
NM_006811chr201916 1839 ----
NM_006814chr20112448 2253 2132 970 523 435 401 263 242 141 32 1203 12140 1273
NM_006815chr1211229 --1239 --
NM_006818chr18826 373 244 97 77 60 45 21 2698 180 --2935 51
NM_006819chr113338 274 22 ------
NM_006826chr231104 411 186 1253 ----
NM_006827chr1463034 2604 2572 2264 373 348 12980 124 12741
NM_006836chr123189 179 105 1507 ----
NM_006838chr1231711 397 223 --11713 --
NM_006842chr11--1142 ----
NM_006851chr1242749 2080 904 405 ------
NM_006852chr1782730 2565 2454 2365 1141 723 589 139 22867 1895 12456 --
NM_006854chr762028 1557 1541 679 527 415 ------
NM_006856chr1251158 1104 875 766 365 --3371 197 79 --
NM_006861chr1291861 568 387 375 218 200 163 153 42 --11317 --
NM_006870chr20131 ------
NM_006873chr232256 878 603 22749 1330 1365 --
NM_006874chr421250 1220 ----11223
NM_006875chrX6875 797 641 300 212 190 --2357 217 1193
NM_006876chr112534 203 ------
NM_006884chr341412 1334 760 114 ------
NM_006885chr16143442 3040 2936 2870 2823 1678 1516 1366 1127 1105 1042 728 302 157 --11113 13522
NM_006887chr21183 ------
NM_006888chr1453456 2560 2445 2382 2192 11199 --11003
NM_006889chr361538 1502 443 292 152 83 ----1353
NM_006896chr73813 377 22 1183 21139 428 --
NM_006898chr27821 577 550 224 170 98 40 --1125 --
NM_006901chr151162 --1360 --
NM_006906chr113810 772 102 --1774 --
NM_006908chr731279 1001 438 ----1476
NM_006913chr63434 338 69 ------
NM_006915chrX21830 1798 2993 42 --11967
NM_006917chr12101 22 ------
NM_006922chr262599 2423 872 575 345 156 32362 1030 484 ----
NM_006924chr1753766 3651 1378 988 697 21211 147 ----
NM_006925chr14--161 ----
NM_006930chr531780 1422 641 --11785 --
NM_006931chr1261574 436 427 292 47 22 --127 --
NM_006937chr171140 ------
NM_006940chr1231598 1250 1235 ------
NM_006943chr20283223 3127 3057 2902 2840 2818 2621 2115 1054 1035 988 976 799 778 670 453 442 377 355 329 307 286 238 222 202 161 120 101 1743 1279 --
NM_006946chr114550 487 229 32 2541 165 1424 --
NM_006948chr211356 --151 --
NM_006950chrX9864 773 729 633 601 359 315 170 103 --3689 595 127 --
NM_006951chr101629 ------
NM_006958chr82148 43 --185 --
NM_006981chr972811 2790 2641 739 597 97 31 ----12670
NM_006987chr1791187 1179 1124 481 322 248 144 66 28 --31172 526 254 1842
NM_006990chr1102491 2433 2156 1966 1876 658 612 330 185 40 22084 1861 22339 663 --
NM_006996chr11630 --1699 --
NM_006997chr101313 ------
NM_007005chr931004 385 35 --1153 --
NM_007006chr1643042 2699 523 446 1497 ----
NM_007008chr2--1806 1589 --
NM_007011chr15166524 6058 5848 5810 5016 4532 4176 2654 1982 1561 1112 830 645 83 76 36 --115077 5040 5000 4962 4883 4583 4394 1961 635 492 438 12681
NM_007013chr82416 137 ----21013 116
NM_007015chr131271 1288 ----
NM_007017chr51721 ------
NM_007024chr32514 30 --158 137
NM_007026chr172104 68 ------
NM_007030chr5175076 4640 4495 3294 3193 3158 1662 1564 1473 1441 1188 995 688 512 360 160 147 21483 974 64529 4302 938 891 379 164 2227 192
NM_007034chr11359 ------
NM_007036chr52823 691 ------
NM_007039chr1442063 2052 1656 472 21623 1596 ----
NM_007040chr1915989 935 920 910 887 422 351 304 258 242 163 144 126 70 23 1365 31105 391 252 --
NM_007042chr352298 446 405 126 40 1617 22469 2109 --
NM_007045chr6----1545 --
NM_007050chr20257776 7284 7145 7027 6805 6666 6640 5603 5345 3230 3137 2822 2789 2731 2576 1675 1450 1160 1035 781 754 617 480 380 293 --15736 --
NM_007052chrX----1391 1110
NM_007054chr543604 2728 2441 877 22475 1487 --12896
NM_007067chr1771532 1279 1120 1079 605 318 248 --11108 11282
NM_007084chr1341238 1177 564 74 31202 618 605 2448 88 --
NM_007106chr1322628 754 11784 ----
NM_007114chr321188 21 42479 2074 1074 72 --12782
NM_007115chr2----1178 --
NM_007122chr12586 246 ------
NM_007124chr61219 11739 ----
NM_007129chr138853 367 330 319 289 209 55 24 ------
NM_007137chrX165160 5070 5045 4940 4910 4493 4274 4198 4188 3825 3594 2137 2001 1953 894 274 --1757 --
NM_007144chr1761272 1085 484 472 38 26 1373 2100 49 1951
NM_007146chr1742667 1101 932 380 2940 816 12793 --
NM_007158chr131114 144 77 ----193
NM_007159chr321778 32 11108 ----
NM_007162chr64472 239 119 67 --172 --
NM_007166chr1141357 595 115 66 ------
NM_007170chr16784 273 260 188 141 85 1917 1248 --
NM_007172chr2263304 2283 2048 1287 187 48 32976 332 320 12996 --
NM_007174chr1271845 1714 1526 806 784 693 222 --41851 1594 699 572 --
NM_007175chr842343 505 104 74 1220 ----
NM_007178chr12----171 --
NM_007181chr192105 39 1147 ----
NM_007182chr33713 648 111 ------
NM_007185chr17809 433 407 340 197 173 74 --3223 159 54 --
NM_007191chr12--1476 ----
NM_007192chr1451045 1002 894 440 245 ------
NM_007195chr1873621 3133 2346 1285 916 900 819 --23151 1254 11421
NM_007197chr122399 310 1695 ----
NM_007202chr174684 649 606 155 ------
NM_007203chr982931 2920 2859 2559 1561 559 439 337 13646 ----
NM_007207chr12797 276 --2799 198 --
NM_007212chr131752 908 543 ------
NM_007216chr111360 ------
NM_007217chr3199 ------
NM_007219chr204932 924 836 664 --1936 --
NM_007224chr123638 623 66 --4469 109 68 31 --
NM_007232chr205718 709 165 125 35 ----1330
NM_007236chr1581716 1581 1562 660 436 373 254 60 31834 446 102 --21731 1596
NM_007245chr167843 599 365 189 180 169 130 --3759 751 367 --
NM_007247chr173831 715 100 ------
NM_007249chr13169176 8530 7966 7880 7462 7410 6861 6686 6669 6629 6163 5822 2401 2199 1356 395 48973 7733 2363 595 37273 6671 1324 29163 6217
NM_007271chr641172 1155 640 156 184 21634 64 --
NM_007275chr35915 451 396 75 51 2331 246 ----
NM_007278chr174339 151 100 72 ------
NM_007281chr4142 ------
NM_007286chr5152132 2035 2024 2008 1942 1315 722 663 617 474 347 291 235 212 177 11985 31872 619 293 --
NM_007287chr392952 2913 2897 2824 2386 2280 2136 2039 1293 23123 700 12899 21974 485
NM_007288chr392952 2913 2897 2824 2386 2280 2136 2039 1293 23123 700 12899 21974 485
NM_007289chr392952 2913 2897 2824 2386 2280 2136 2039 1293 23123 700 12899 21974 485
NM_007292chr17134868 4424 3932 3731 3629 3616 3546 3430 3317 3304 3232 1285 871 --54875 4394 3598 3449 721 44561 3750 3464 406
NM_007294chr1721277 195 --185 --
NM_007295chr1721277 195 --185 --
NM_007296chr1721277 195 --185 --
NM_007297chr1721277 195 --185 --
NM_007298chr1721277 195 --185 --
NM_007299chr1721277 195 --185 --
NM_007300chr1721277 195 --185 --
NM_007302chr1721277 195 --185 --
NM_007303chr1721277 195 --185 --
NM_007304chr1721277 195 --185 --
NM_007305chr1721277 195 --185 --
NM_007308chr42182 127 ------
NM_007324chr1--1314 ----
NM_007327chr991113 1092 952 916 888 829 754 127 32 --51192 869 852 435 288 --
NM_007350chr1233619 3246 1778 --34396 3191 1621 --
NM_007353chr7102927 2329 2102 1154 903 834 737 662 590 430 --3739 664 627 22384 561
NM_007365chr1162118 2044 1976 1955 1661 1597 1531 840 729 626 587 484 378 153 53 29 --31873 1599 848 1537
NM_007375chr132107 1880 492 1909 ----
NM_012062chr121210 ----1624
NM_012064chr122333 207 1791 ----
NM_012074chr146959 825 769 758 727 160 1844 1140 --
NM_012081chr552360 2274 820 192 160 13670 22329 695 --
NM_012089chr111218 ------
NM_012090chr11196 --1862 --
NM_012095chr1093515 3429 3305 2855 2286 2194 1111 549 317 1323 --11087
NM_012098chr9111543 1388 1336 1191 1149 1012 635 621 596 332 24 --1191 --
NM_012102chr1112400 2283 2250 2157 2055 1874 877 827 570 268 204 ------
NM_012104chr11123368 3226 2673 2461 2451 2399 2369 1520 1443 1229 1220 115 11457 ----
NM_012104chr11123368 3226 2673 2461 2451 2399 2369 1520 1443 1229 1220 115 11457 ----
NM_012115chr61404 ------
NM_012120chr612008 12882 ----
NM_012134chr131716 1239 1229 --157 --
NM_012141chr1353876 3195 2517 1001 740 11498 ----
NM_012154chr82152 83 1283 ----
NM_012158chr1331606 1531 1320 ------
NM_012161chr4----21035 807 --
NM_012164chr9186678 6609 6324 6253 6082 6071 5694 5671 4648 2294 2040 1665 1546 1147 790 550 516 491 ----22463 2328
NM_012166chr951463 1196 444 94 88 --31318 1023 480 1450
NM_012168chr13111 92 22 1285 1115 --
NM_012175chr111225 ------
NM_012177chr6--1477 ----
NM_012188chr5--1903 1811 --
NM_012193chr11145150 4996 4806 4796 4719 4632 4471 4046 4014 3576 3331 2157 1515 686 1569 1146 14180
NM_012197chr941437 1119 635 267 --21093 256 --
NM_012199chr1194114 4080 3953 3829 3598 3271 2921 1648 1526 1476 1438 1305 1153 1068 781 753 674 638 602 13612 43648 1307 1094 1087 14454
NM_012207chr101435 1257 ----
NM_012214chr285767 5630 5006 2517 2422 1573 733 153 35015 2365 2344 23954 2319 --
NM_012215chr10--11485 1401 --
NM_012219chr3182886 2799 2791 2744 2727 2716 2674 2460 2378 1143 1005 924 568 519 285 279 187 58 --11199 1195
NM_012232chr17111888 1847 1807 1727 1620 1454 332 320 140 115 40 --12184 --
NM_012234chr331503 676 439 ------
NM_012244chr14201659 1504 1496 1476 1428 1367 1289 1165 735 701 624 592 520 496 343 288 241 99 54 32 --31369 349 192 --
NM_012247chr102750 648 ------
NM_012249chr282523 2274 1097 1001 861 384 245 41 ------
NM_012250chr1111106 ----11109
NM_012257chr7--1232 ----
NM_012264chr22202028 1899 1771 1744 1737 1604 1552 1505 1483 864 839 831 773 716 534 458 443 375 359 149 --1844 --
NM_012264chr22202028 1899 1771 1744 1737 1604 1552 1505 1483 864 839 831 773 716 534 458 443 375 359 149 --1844 --
NM_012272chr12------1152
NM_012281chr722150 980 22069 140 11763 --
NM_012282chrX4769 664 196 35 1760 389 72 65 --
NM_012287chr374150 3270 1692 1551 1316 937 442 13979 21553 1489 11356
NM_012288chr6224952 4893 4619 4522 4153 3950 3936 3757 3669 3572 2304 2226 2019 1914 1261 1239 703 242 226 184 80 72 14856 54791 4745 3640 1864 769 12215
NM_012290chr2142 ------
NM_012296chr11203494 3430 3377 3361 3194 3029 2961 2915 2845 2628 2487 1530 848 418 396 191 157 98 61 53 1270 73251 2963 2682 2644 2535 88 55 --
NM_012297chr421856 807 ------
NM_012298chr33668 217 65 --1102 --
NM_012300chr562200 1812 1660 921 246 212 --21818 1642 1746
NM_012301chr761772 1551 1531 1462 616 318 ------
NM_012302chr111087 ------
NM_012304chr5132477 2363 2334 1852 1697 933 924 897 791 668 605 443 386 12262 11957 --
NM_012307chr18----1176 --
NM_012308chr11171834 1814 908 873 808 643 588 576 471 394 348 297 193 137 111 67 40 42601 1767 1648 549 2957 822 1201
NM_012309chr11164240 4170 4114 3880 3816 3798 3577 3550 3210 1501 1489 1362 609 526 413 378 34228 4197 3373 2916 462 --
NM_012316chr1234547 4170 3878 3870 3768 3689 3682 3557 2206 2052 1920 1871 1680 1641 1566 1317 1106 974 746 699 402 379 153 22200 946 23640 821 2861 607
NM_012322chr7171 ------
NM_012323chr2261530 1077 1039 1013 484 52 --1374 --
NM_012325chr2021259 424 ------
NM_012326chr25775 626 63 46 36 --2764 272 --
NM_012327chr18--11585 2329 277 --
NM_012329chr1741543 1199 393 358 ------
NM_012330chr103628 380 260 ------
NM_012333chr121298 456 --11562 --
NM_012334chr533426 3061 1564 13466 23971 3957 43094 1715 1598 428
NM_012340chr204264 242 192 82 ------
NM_012384chr2082022 1838 1783 973 786 615 220 49 11987 42230 1773 880 514 12033
NM_012395chr7123122 3002 2996 2584 2382 2355 2332 2317 2293 2108 1287 1164 --22308 2195 --
NM_012398chr19122647 2569 2485 2370 2278 2016 1095 735 729 517 164 132 1792 31896 659 178 1230
NM_012399chr2261800 1549 1530 1438 555 130 ----11449
NM_012407chr223419 218 122 ------
NM_012410chr166467 456 123 99 87 40 --1370 --
NM_012414chr11525 ------
NM_012416chr92820 98 1185 ----
NM_012417chr171408 --1604 --
NM_012420chr1042158 1753 1492 372 --21967 1428 1777
NM_012425chr101559 22467 76 31736 142 29 --
NM_012428chr152144 88 ------
NM_012429chr222522 41 2480 396 1561 --
NM_012434chr641241 1123 524 315 ------
NM_012446chr52439 145 ------
NM_012448chr17102551 2236 2168 2041 1839 1719 851 686 540 241 --22226 246 --
NM_012456chr11143 --145 --
NM_012461chr145659 466 190 78 49 1207 2256 137 --
NM_012464chr462363 2229 2109 2026 2006 1171 --12231 --
NM_012471chrX31841 1641 59 11203 ----
NM_012473chr227672 572 265 241 217 87 76 --5594 515 508 222 63 --
NM_012475chr11181 ------
NM_012478chr177833 408 324 297 288 230 101 --4688 190 52 24 --
NM_012479chr751767 941 720 107 61 --21848 109 --
NM_012482chr1--1646 ----
NM_013229chr1251867 1767 1114 978 661 2442 170 --41129 993 826 695
NM_013230chrY4590 465 429 35 ------
NM_013231chr1493593 3436 3302 3237 2811 1200 1154 1026 700 11145 ----
NM_013233chr231229 104 68 --190 --
NM_013243chr152313 165 1986 ----
NM_013245chr163539 260 227 --1547 --
NM_013246chr115717 683 292 163 45 ----1173
NM_013261chr463400 3243 917 680 102 63 --13017 --
NM_013269chr1294290 4282 4261 4242 3998 3963 487 368 199 11179 24087 3626 11260
NM_013275chr161564 --1155 --
NM_013277chr123931 165 78 --125 --
NM_013279chr11152220 2209 2141 2096 2045 1642 1621 1600 1537 1527 612 500 370 361 228 21577 632 32198 2127 1626 --
NM_013305chr184202 116 55 41 1813 1921 --
NM_013316chr73909 134 55 --160 --
NM_013334chr3138 ------
NM_013341chr262795 2024 1155 1129 1119 271 22563 37 ----
NM_013346chrX168 ------
NM_013354chr821354 375 --1380 --
NM_013357chr82868 202 --1204 --
NM_013363chr3163 ------
NM_013365chr223165 159 127 --1748 --
NM_013368chr195494 443 124 115 28 ------
NM_013372chr1571341 1082 893 473 465 343 121 12409 ----
NM_013373chr225936 829 811 303 67 ------
NM_013381chr1222114 215 ------
NM_013382chr14112068 2058 2023 1753 1734 1629 1605 1598 798 627 560 --2565 41 12029
NM_013396chr212270 61 --21292 338 --
NM_013400chr751060 967 914 751 696 1199 2763 680 --
NM_013403chr196744 614 549 179 164 76 --2816 563 --
NM_013410chr141078 466 362 175 ------
NM_013411chr162457 2032 1851 1731 1080 604 --1656 --
NM_013417chr9135 ------
NM_013433chr1991960 1946 1934 1878 1432 1345 533 182 140 --11285 --
NM_013434chr2101939 1742 1642 1477 1410 797 696 586 453 248 --31891 1770 250 --
NM_013434chr2101939 1742 1642 1477 1410 797 696 586 453 248 --31891 1770 250 --
NM_013436chr21639 1570 ----
NM_013437chr8--11114 ----
NM_013438chr931438 1296 641 11329 ----
NM_013444chrX81001 277 251 236 225 209 171 160 --1165 --
NM_013446chr7188 11446 --1102
NM_013449chr12162717 2374 2114 1132 1123 840 828 628 591 558 531 516 339 325 176 37 2647 474 42994 2379 821 565 2846 49
NM_013450chr2----11052 1361
NM_013937chr63380 298 58 ----1307
NM_013943chr172630 714 291 231 212 73 37 1173 ----
NM_013952chr292380 2314 2252 1036 928 772 661 580 514 --1591 12264
NM_013953chr292380 2314 2252 1036 928 772 661 580 514 --1591 12264
NM_013958chr8143 ------
NM_013959chr8143 ------
NM_013960chr82569 291 --2258 149 --
NM_013961chr8143 ------
NM_013962chr8143 ------
NM_013989chr14154940 4924 4544 4538 4026 3980 3395 3368 3188 1453 1326 1077 890 555 205 34621 1607 442 13340 11275
NM_013992chr292380 2314 2252 1036 928 772 661 580 514 --1591 12264
NM_013993chr69526 278 269 220 207 196 177 92 24 --1591 1100
NM_013994chr69526 278 269 220 207 196 177 92 24 --1591 1100
NM_013999chr17111381 517 398 381 363 267 259 242 142 123 23 11289 1367 --
NM_014000chr10121761 1751 1493 1416 1257 735 635 610 495 390 378 353 31524 1442 1297 11499 1453
NM_014002chr14631 539 168 115 --1155 --
NM_014007chr911253 1792 ----
NM_014011chr22966 480 --11822 1411
NM_014015chr163259 134 27 ------
NM_014021chr183231 2329 2314 2222 1317 1207 138 129 13391 ----
NM_014023chr1032234 1109 882 1657 31879 1134 250 --
NM_014028chr642951 2582 1333 552 ----12597
NM_014030chr17131139 1123 989 871 858 813 802 745 479 419 284 245 225 --1253 --
NM_014034chr621129 970 --1334 --
NM_014038chr72293 126 ------
NM_014042chr111220 ------
NM_014048chr1654515 3650 3479 1181 1053 --11709 --
NM_014056chr342171 2036 1763 1571 12058 21732 487 21895 1439
NM_014059chr132346 135 ------
NM_014069chr63384 55 28 --1275 186
NM_014079chr35726 715 334 266 83 ----1815
NM_014106chr1532130 938 689 ----1824
NM_014109chr84865 451 411 357 --2455 413 --
NM_014112chr853861 3336 857 667 532 34980 4766 4329 --1517
NM_014117chr1651898 1782 1036 447 94 11059 1749 --
NM_014149chr72594 150 1698 1202 --
NM_014153chr162182 122 ------
NM_014154chr3----1607 1312
NM_014155chr1196651 5852 5074 4643 2781 2322 1491 1474 551 36803 6074 5512 26114 1505 12784
NM_014157chr16133177 2865 2809 2487 1565 1434 1270 865 794 628 553 543 276 33271 1443 108 4925 831 278 80 12622
NM_014166chr132819 809 ------
NM_014169chr14--1243 ----
NM_014178chr141242 ------
NM_014181chr232387 2327 2045 ------
NM_014182chr123725 475 130 1139 ----
NM_014188chr13301 269 59 ------
NM_014190chr491724 1654 1604 1359 740 701 673 592 63 --1559 1107
NM_014212chr125946 788 614 386 162 1827 1948 --
NM_014217chr14579 529 504 271 ------
NM_014223chr15685 639 508 110 76 ------
NM_014231chr12112158 1804 1713 1605 1582 1485 830 476 233 134 83 2260 73 22029 1958 11671
NM_014232chr17151634 1493 1344 1211 1032 423 414 398 381 360 343 273 262 240 39 1657 41379 1036 386 70 --
NM_014232chr17151634 1493 1344 1211 1032 423 414 398 381 360 343 273 262 240 39 1657 41379 1036 386 70 --
NM_014233chr17111728 1718 1633 1525 1372 525 416 220 107 75 51 11637 21362 418 11783
NM_014234chr62172 55 ------
NM_014238chr175386 302 280 221 186 --2404 379 142
NM_014240chr393578 2765 2667 1597 1158 637 449 300 179 1686 23366 2869 23518 3380
NM_014243chr431938 170 51 --159 11753
NM_014245chr31225 --1793 2961 826
NM_014251chr74818 692 314 62 ------
NM_014252chr131126 ------
NM_014253chrX5714 632 555 537 513 12516 11775 --
NM_014267chr111786 ------
NM_014268chr1861336 1162 565 306 160 28 21114 104 ----
NM_014271chrX1180 ------
NM_014275chr57931 892 818 811 781 751 663 ------
NM_014283chr11354 --1356 --
NM_014284chr181036 907 887 821 424 107 94 65 ------
NM_014286chr9213497 3301 3230 3112 2831 2811 2756 2680 2532 2437 2388 1393 1273 1228 1216 1173 973 924 726 156 41 --1311 --
NM_014289chrX81256 1242 1214 1181 1080 958 354 125 --21123 448 21004 152
NM_014292chr22161795 1679 1611 1578 1565 1493 1413 1205 733 668 549 501 412 90 65 40 --1285 11572
NM_014293chr22224003 3980 3743 3720 3701 3164 3102 1384 1046 1031 767 660 581 571 561 539 485 420 276 96 71 27 13368 63862 3797 3472 3448 3282 126 12725
NM_014297chr19287 24 ------
NM_014299chr19132075 2043 1946 1819 1594 1468 860 762 654 432 264 227 51 --31402 580 53 --
NM_014305chr132257 222 ------
NM_014309chr22185256 5190 5084 5071 4922 4912 4597 4494 4458 4370 3896 3464 3389 1211 871 701 598 590 11554 35077 4986 1375 --
NM_014313chr111419 2533 69 2629 602 --
NM_014316chr16111997 1933 1892 1783 1719 663 653 477 394 370 85 12197 22178 217 21860 123
NM_014319chr1211880 1446 ----
NM_014323chr221409 1164 2415 386 --
NM_014325chr1252263 2212 1387 1378 692 1178 ----
NM_014332chrX1101 1317 ----
NM_014333chr1162736 1987 851 440 395 360 11006 12254 --
NM_014335chr1511001 ------
NM_014342chr1131322 511 473 11483 ----
NM_014345chr64945 393 275 161 1955 ----
NM_014352chr1131289 1024 249 1199 21015 226 11175
NM_014360chr144642 206 197 102 ------
NM_014368chr961898 1615 1343 270 211 167 ----11623
NM_014372chr131941 662 379 ------
NM_014374chr751060 967 914 751 696 1199 2763 680 --
NM_014376chr5132254 2171 2081 1792 583 521 493 364 344 284 259 170 124 12581 --3560 349 336
NM_014382chr31455 ------
NM_014388chr1115846 4988 4802 4615 4520 4390 3863 3759 1522 340 262 12304 26034 3744 43710 2172 2036 2004
NM_014393chr831713 371 314 --12060 --
NM_014400chr193412 346 78 --128 --
NM_014409chr15990 851 302 293 105 ------
NM_014415chr331470 1383 1162 ------
NM_014417chr193385 116 59 --153 --
NM_014418chr1461788 1583 1454 1335 1302 472 1120 --1662
NM_014421chr421705 422 --11756 11394
NM_014423chr574689 4631 4585 4526 4304 1656 328 ------
NM_014426chr203666 541 252 ------
NM_014431chr1051582 1331 1146 578 361 ------
NM_014437chr1154 ------
NM_014445chr312206 12387 ----
NM_014447chr421597 1558 ------
NM_014450chr91205 171 ----
NM_014452chr621073 383 1975 ----
NM_014454chr61884 ------
NM_014458chr141274 1268 882 253 11107 1258 --
NM_014469chr111295 1662 ----
NM_014491chr71770 ------
NM_014494chr1692220 2074 2051 1999 1910 1857 1848 799 316 1215 11850 --
NM_014498chr32341 334 ------
NM_014501chr19251 39 --121 --
NM_014507chr224914 493 452 206 ------
NM_014515chr12131 ------
NM_014516chr192195 31 ------
NM_014517chr341588 1459 1265 734 --21267 1237 --
NM_014554chr1252015 1607 1411 550 87 ------
NM_014563chrX21674 1374 --2671 340 31408 704 505
NM_014567chr162186 62 ------
NM_014570chr223308 224 210 ------
NM_014572chr1321168 517 --137 --
NM_014573chr1761834 1483 1172 437 265 171 ----21569 295
NM_014587chr1631472 1252 198 ------
NM_014588chr20193 ------
NM_014591chr10121281 1070 1047 919 893 844 347 267 234 225 215 106 1209 41237 391 296 81 --
NM_014592chr52626 28 ----1746
NM_014600chr271543 1492 1216 427 356 264 225 --21300 1103 --
NM_014604chr178818 619 557 532 158 146 59 38 1541 ----
NM_014606chr471257 1119 1029 963 505 463 346 3591 545 334 ----
NM_014608chr152490 439 ------
NM_014613chr5112658 2542 2311 2166 2133 2070 1905 1148 716 341 253 12372 42168 708 279 26 --
NM_014614chr21110 21205 185 1589 1408
NM_014616chr363059 2785 2516 1323 1062 38 22949 275 --1177
NM_014620chr123693 192 45 --3611 202 130 --
NM_014621chr22172 28 ------
NM_014623chr6195 ------
NM_014630chr15123821 3769 3461 3433 3275 3070 982 974 929 530 421 51 --12685 1271
NM_014632chr11493 77 61 25 --170 --
NM_014634chr22173579 3262 3200 2907 2666 2594 2333 1225 1108 642 626 451 440 262 255 53 25 23625 1291 22840 35 --
NM_014640chr21113 ------
NM_014641chr6----2397 26 --
NM_014646chr18102962 2461 1063 646 286 242 147 138 94 41 --42832 650 290 149 --
NM_014647chr1672157 1557 1476 712 567 404 353 ------
NM_014659chr152847 229 --1129 --
NM_014662chr221463 ------
NM_014663chr121056 219 ------
NM_014665chr8153557 3528 3360 3294 3201 2679 2486 2370 2310 1220 922 830 365 350 152 13503 53317 2527 2287 843 706 --
NM_014666chr511257 ------
NM_014667chr332281 1703 413 11720 12315 --
NM_014670chr22259 92 --1297 --
NM_014671chr73345 136 62 2511 107 ----
NM_014674chr3143596 3506 3489 3475 3184 3166 2770 2662 1504 1464 1403 933 872 640 ----1476
NM_014676chr141411 449 441 131 --11385 --
NM_014677chr851110 1058 1035 1019 498 ------
NM_014678chr22146 1819 1190 --
NM_014682chr821659 538 ------
NM_014683chr1752127 1897 1886 1738 250 1579 11483 --
NM_014686chr1942564 2177 695 413 12527 21853 821 --
NM_014690chr7202927 2774 2758 2740 2732 2405 2247 2087 2038 1178 1170 941 835 819 409 377 133 125 66 33 32259 1148 437 62118 2043 1228 1189 1138 27 --
NM_014700chr1681536 1467 1000 617 547 396 358 273 --41261 1234 416 292 --
NM_014701chr1533241 1354 373 22630 116 11001 13257
NM_014702chr633292 2953 2462 13194 ----
NM_014712chr163412 178 59 --1504 --
NM_014723chr20173123 3082 2962 2700 2662 2636 2621 2581 2297 2078 1285 1277 1124 812 569 75 68 22927 429 12640 22965 883
NM_014726chr1791250 1238 1225 1151 978 394 284 154 39 --3980 913 276 --
NM_014727chr19136 --189 --
NM_014729chr82437 216 21577 614 ----
NM_014730chr12245242 5058 5051 4868 4763 4309 3742 3732 3649 3599 3444 3321 3241 1512 1486 1474 1307 1184 923 814 627 275 228 211 --45224 4963 4856 1904 1820
NM_014730chr12245242 5058 5051 4868 4763 4309 3742 3732 3649 3599 3444 3321 3241 1512 1486 1474 1307 1184 923 814 627 275 228 211 --45224 4963 4856 1904 1820
NM_014731chr2091441 1251 702 575 497 476 145 84 68 11804 61445 1357 1238 485 407 163 --
NM_014735chrX31537 1451 1416 2768 710 ----
NM_014739chr644063 3659 2740 335 11689 ----
NM_014743chr472616 2534 1186 1107 741 320 195 --12041 --
NM_014747chr1285418 5142 5124 5055 4919 4540 4442 4318 4118 3983 3966 3958 3689 3652 2105 2050 1938 1930 1782 1592 1467 1226 902 814 728 718 485 64 --34934 4611 3970 34662 3710 1836
NM_014751chr842147 2090 847 768 --12152 11429
NM_014754chr83791 712 160 --2830 637 1715
NM_014755chr293828 3450 3439 2874 2862 1564 1530 1237 49 21693 905 11437 --
NM_014757chr592046 1834 1803 1646 1634 943 831 747 715 32160 1764 1667 1752 1727
NM_014761chr1631056 823 285 ------
NM_014765chr142077 1060 542 174 --12534 --
NM_014766chr7153476 3354 2829 2388 1373 1265 1254 922 842 792 676 594 577 195 113 --3628 492 40 --
NM_014767chr10133447 3313 2861 2731 2711 2648 2251 1399 1331 1287 1164 490 299 23116 704 23574 3096 1586
NM_014770chr1291149 1100 1039 992 964 306 224 178 91 --3997 499 157 --
NM_014771chr164885 689 287 63 1861 1815 1692
NM_014776chr12102641 2621 2426 2128 2037 1988 1244 768 632 22 --12064 --
NM_014779chr33344 306 158 ------
NM_014784chr18976 812 740 430 389 206 96 40 1240 ----
NM_014786chr1161051 885 824 418 219 59 1194 --1421
NM_014791chr91268 ------
NM_014795chr22504 105 ------
NM_014798chr1791789 1782 1692 1510 1400 1287 1277 402 194 --1152 11552
NM_014800chr74763 469 459 323 --2295 227 130
NM_014803chr104868 365 357 299 2905 648 --12099
NM_014807chr119714 619 598 590 343 281 67 51 33 --157 --
NM_014810chr183631 3456 2609 1269 880 793 542 60 ------
NM_014812chr121935 1543 ------
NM_014820chr321905 1368 ------
NM_014824chr1141883 598 502 214 --1156 11400
NM_014826chr1123950 3656 3458 3451 1562 1425 1376 1104 159 71 52 24 22786 281 33468 1012 56 11150
NM_014827chr1--11265 ----
NM_014830chr12113667 3415 2879 2804 2615 2578 1574 927 312 302 77 33457 3000 33 13754 13781
NM_014836chr1021843 213 1529 ----
NM_014839chr121820 926 1492 ----
NM_014840chr1242739 2299 2174 831 --22442 247 --
NM_014841chr61968 1133 1403 --
NM_014846chr81249 --148 --
NM_014849chr191260 1094 911 887 343 307 280 233 57 --31187 970 475 --
NM_014850chr3224697 4556 4481 4403 4395 4303 4281 3471 1614 1603 1568 1494 1478 1445 1318 751 665 544 319 292 197 72 23700 845 44045 814 691 83 11882
NM_014858chr171186 978 849 813 298 168 99 --21090 870 --
NM_014859chr1721289 298 11267 1470 --
NM_014869chr341143 985 215 105 --2371 228 --
NM_014870chr1184618 4492 4183 4032 3818 3583 3537 3270 3169 2997 1393 1316 806 775 522 500 230 27 24630 4130 54497 3394 1321 1181 990 1660
NM_014871chr123572 99 30 ------
NM_014872chr972070 2041 1927 1639 1624 862 90 --11936 --
NM_014873chr123376 1188 --11290 11323
NM_014876chr2261937 1603 659 472 91 23 1794 --2826 692
NM_014877chr1797001 6777 5592 5584 2883 2856 2490 2051 901 16159 15992 16025
NM_014880chr232314 2055 322 22452 2109 12044 --
NM_014887chr135852 655 639 141 121 ------
NM_014888chr721499 526 ----1529
NM_014897chr1722292 1100 1542 --12584
NM_014899chr522711 2700 12954 1291 --
NM_014900chr2135 ------
NM_014901chr5102028 1887 1584 1573 1426 750 497 286 261 201 --21433 716 --
NM_014902chr2091560 1529 1369 1245 1134 576 528 410 293 11152 1173 --
NM_014903chr122430 364 ------
NM_014905chr281668 1654 1599 1545 684 491 279 193 --21579 790 --
NM_014909chr14143962 3900 3821 3644 3358 3140 3072 2770 2674 2570 2477 710 412 162 --33378 3360 993 --
NM_014912chr101931 ------
NM_014913chr181289 ------
NM_014914chr271273 1257 1165 1039 141 122 101 --1127 --
NM_014918chr1511304 --1532 --
NM_014920chr642535 2417 1517 1343 21093 823 11503 --
NM_014921chr19232962 2934 2838 2753 2741 2575 2492 2479 2284 2027 2020 1193 1181 882 871 816 766 688 506 436 317 308 202 12781 32946 1246 666 --
NM_014923chr1352270 1713 948 473 244 22302 2279 ----
NM_014924chr1462519 2240 2232 1970 1100 50 13160 --22120 1984
NM_014925chr123763 757 199 --2657 240 1381
NM_014926chr341036 799 747 175 --1181 --
NM_014931chr193666 589 52 --3670 214 42 --
NM_014932chr321936 1469 ------
NM_014936chr62980 856 1924 ----
NM_014938chr12122014 1994 1936 1853 1636 497 403 251 224 108 84 46 11919 ----
NM_014939chr1811224 --11284 --
NM_014944chr181116 1076 1069 379 292 223 120 60 --1256 --
NM_014945chr5132009 1851 1289 1279 1252 1236 1226 690 642 616 596 442 80 21416 710 1418 --
NM_014947chr132398 786 205 1231 21168 1001 11034
NM_014948chr2072427 2229 2207 2049 1644 511 225 --22090 121 11982
NM_014949chr12765 293 ------
NM_014950chr1421778 123 ------
NM_014952chr15102034 1984 1798 1373 1314 587 534 447 384 214 --41802 713 682 635 --
NM_014961chr451594 1377 826 731 190 ------
NM_014963chr196465 433 418 224 214 48 --1586 1231
NM_014969chr11187 --2428 414 1740
NM_014977chr145470 435 409 219 207 --1212 --
NM_014982chr1442140 807 663 149 ----23757 40
NM_014988chr422573 2186 21746 817 ----
NM_014989chr641356 619 562 336 1735 ----
NM_014990chr145435 375 95 59 30 1835 ----
NM_014991chr452331 2305 2146 255 45 ------
NM_014994chr15131996 1953 1900 912 838 783 760 631 624 489 466 324 134 --32040 472 136 --
NM_014996chr36844 802 210 186 147 126 ------
NM_014997chr782914 2893 2602 1949 1913 990 210 180 1925 11874 --
NM_015000chr1232411 2220 461 ------
NM_015001chr12926 851 --136 --
NM_015002chr122675 168 21432 46 2665 140 --
NM_015008chr353355 3139 3082 802 416 11436 ----
NM_015009chr3--1602 ----
NM_015017chr12342 310 ----1478
NM_015020chr1683726 3703 1390 1191 1133 612 544 353 23532 2388 23300 2880 2364 227
NM_015023chr1171816 1691 1675 1463 1431 1425 1270 1241 1218 1208 1148 1132 1125 648 614 506 91 2680 396 51716 1684 1455 1437 1274 --
NM_015024chr841124 974 265 147 ------
NM_015025chr21897 1777 ----
NM_015026chr1234468 3528 121 155 ----
NM_015027chr1651785 1239 674 632 531 ------
NM_015033chr9143287 3081 2692 1290 1044 893 857 800 506 349 308 254 62 34 --1170 21213 1078
NM_015035chr20186118 6034 6026 5032 4942 4846 4603 4468 4246 4148 4111 4052 1774 1629 1533 1153 130 97 15641 51712 1486 997 483 229 1258
NM_015039chr1143260 3138 2885 2682 1633 1521 1449 1428 1297 588 437 396 282 71 13855 4439 400 361 322 --
NM_015042chr15164260 4110 3845 3661 3640 3442 3283 3243 3226 1490 1433 881 855 609 489 242 11362 53323 3261 3100 2709 1496 23646 862
NM_015044chr16102991 2753 2276 2135 2067 2006 1220 719 600 431 22740 510 ----
NM_015050chr661200 1018 969 958 142 85 --11121 --
NM_015051chr933379 2850 144 11265 1788 --
NM_015052chr741234 493 350 50 ----11382
NM_015063chr19141348 938 498 490 445 383 297 218 207 196 185 139 123 103 --21271 1143 --
NM_015064chr1283022 2989 2728 2676 2451 2253 1036 707 2992 824 1701 --
NM_015068chr7113906 3872 2944 1524 1171 822 708 646 558 237 123 --13876 1902
NM_015069chr16125 ------
NM_015071chr5105273 5057 4714 2314 1477 1101 791 675 655 566 35499 4671 2295 44324 1081 660 472 25205 1042
NM_015074chr1164748 4155 3450 3227 3208 3153 3146 3139 3126 1972 1925 1910 1678 1451 150 121 13388 158 --
NM_015075chrX192247 2091 1986 1900 1727 1573 1477 1446 854 818 807 735 729 453 367 353 197 179 98 11870 5844 795 416 337 141 --
NM_015076chr641425 909 715 213 14080 22825 1816 22993 2858
NM_015077chr17274589 4360 4117 4002 3852 3729 3716 3542 3298 3060 3048 2884 1752 1687 1672 1614 1457 1362 1292 1063 819 796 710 650 125 82 36 11139 23866 1677 12898
NM_015079chr15132791 2632 2435 2309 2268 1196 1080 741 713 450 244 234 123 --32272 728 656 12551
NM_015080chr115404 173 96 70 38 --1226 --
NM_015082chr592478 2398 2093 1850 1660 873 677 484 435 11844 12108 22507 441
NM_015085chr17223790 3640 3475 3437 3395 3343 2999 1698 1656 1577 1396 1390 1380 1222 1015 852 832 614 500 441 253 237 --3268 218 208 --
NM_015086chr12111587 1441 1390 1170 1065 1049 1003 616 578 560 67 --21282 1008 --
NM_015090chr1255929 5912 5838 5804 5199 5133 4741 4721 4611 4597 4338 4217 2467 2086 1788 1741 1558 1375 1367 962 759 703 596 462 385 35811 5680 3843 46019 5178 4849 1130 25221 178
NM_015092chr1664528 3263 3194 2842 2836 658 13624 24134 3911 --
NM_015093chr61524 1309 ----
NM_015094chr22244470 4332 4321 4297 4248 4152 4097 3943 3898 3761 3448 2989 2957 2865 1633 1589 1512 1470 1121 815 779 551 483 219 23674 1696 24472 3936 --
NM_015097chr332295 1520 111 22310 32 1294 --
NM_015099chr177685 461 293 181 169 159 134 ------
NM_015100chr161719 1566 1353 747 628 154 --11646 --
NM_015102chr1487 79 59 23 ------
NM_015107chrX82443 1660 1630 1520 872 575 283 175 ------
NM_015113chr1752052 1881 1604 733 161 21721 337 41917 1705 573 499 --
NM_015115chr443133 2802 866 401 ------
NM_015125chr194521 211 154 106 --2171 84 1470
NM_015132chr751783 1767 1573 768 277 ------
NM_015133chr16111310 1140 1122 1013 967 938 925 552 440 258 202 --21160 341 1111
NM_015138chr15102598 2325 2110 800 792 479 197 186 166 62 1824 2940 813 12675
NM_015143chr441277 1069 558 219 ------
NM_015144chr1673788 3341 3225 957 870 854 657 23428 287 33264 823 314 --
NM_015150chr31126 --1152 --
NM_015155chr1072967 2765 1048 904 529 156 61 22268 2177 ----
NM_015156chr1461384 1302 636 627 283 135 43635 2700 2628 1568 2324 195 1643
NM_015157chr1191112 1099 1003 937 773 324 260 152 104 --31114 780 409 --
NM_015163chr145507 273 267 208 179 ------
NM_015171chr164414 211 111 77 --162 --
NM_015176chr131260 1212 534 ------
NM_015185chrX112748 2324 2212 2175 1900 1103 960 942 846 561 315 1265 22315 1010 --
NM_015191chr1142384 2358 170 99 22558 2027 ----
NM_015192chr2052989 1105 728 162 93 22746 1965 ----
NM_015194chr17112076 1671 1404 1358 1328 628 617 505 421 348 144 --61871 1821 1679 1360 619 113 21481 74
NM_015199chr342906 2193 1830 943 12105 12198 1619
NM_015200chr441994 433 241 235 ------
NM_015202chr1661601 1532 1426 1155 606 583 11399 51534 1446 1052 614 30 --
NM_015203chr12206 182 --1187 --
NM_015205chr13234215 4121 4083 3976 3954 3878 3736 3721 3699 3660 3609 3564 3522 3426 3412 3312 3205 1275 831 764 134 65 59 --11099 --
NM_015206chr1573883 3740 2799 2776 2734 2644 2609 --1873 --
NM_015213chr112298 262 167 ----
NM_015215chr132934 2694 2586 12797 --1748
NM_015233chr1332368 2354 137 12323 22430 507 --
NM_015235chr1072007 1988 1876 1367 838 779 111 1771 1115 1841
NM_015236chr42982 134 195 ----
NM_015239chr9162 ------
NM_015245chr682719 2333 2295 2261 2059 764 128 57 ----11757
NM_015250chr961701 1689 1588 453 253 54 ------
NM_015254chr8162932 2491 2447 2247 1277 1255 1109 1101 922 875 848 635 409 214 150 97 12306 2530 478 12270
NM_015256chr51723 ----1737
NM_015260chr1981551 1481 1468 1303 1104 377 162 104 --21472 472 --
NM_015261chr113389 135 89 ------
NM_015263chr151401 ------
NM_015264chr22164812 4546 3641 3588 1805 1568 1498 1252 1173 1087 939 887 655 504 191 140 11755 24375 830 --
NM_015265chr222065 586 ------
NM_015267chr1241655 1428 1343 45 11384 1599 --
NM_015270chr12102220 1926 1869 1683 1657 1643 512 349 256 246 --1536 --
NM_015271chr453834 3383 3171 894 27 1372 12925 --
NM_015272chr1681930 1725 1645 1604 1314 329 189 27 ------
NM_015278chr651344 687 655 165 22 12218 --11378
NM_015282chr292581 2503 2410 2340 2057 932 705 664 412 --3656 142 52 --
NM_015284chr1102089 2058 2029 1933 1897 1873 1571 566 441 187 --31536 1312 414 11574
NM_015288chr5163819 3783 3392 3379 3296 2831 2589 2579 2483 1293 1151 993 855 708 697 637 22723 739 1207 1998
NM_015289chr15111929 1829 1803 1761 1516 1333 1325 606 599 571 45 11912 ----
NM_015291chr162946 2580 1121 935 409 312 1454 22413 2281 12295
NM_015293chr61128 ------
NM_015299chr14123960 3814 3747 3595 3445 3301 3291 3272 1592 1320 893 372 23431 195 33555 3402 3245 --
NM_015305chr1471421 1292 267 140 124 113 33 --1272 --
NM_015310chr8167558 7223 7153 7024 6990 6224 5472 3109 2730 2491 2111 1762 1714 1518 987 833 11236 32802 1946 881 --
NM_015313chr1184799 3540 3471 3241 3162 2946 1623 792 --34824 3526 687 --
NM_015315chr5123166 3124 3100 2311 989 867 639 560 549 394 206 199 ----12685
NM_015317chr212487 1747 --12520
NM_015321chr19274761 4340 4179 4035 3862 3760 3681 3505 3393 3203 3156 3029 1887 1642 1485 1469 1448 1411 1346 1276 823 672 436 427 338 265 48 11254 34087 248 160 23548 3408
NM_015326chr1112810 2709 2688 2480 2298 2072 781 540 201 177 133 32316 1101 143 22785 185 11019
NM_015327chr1101309 1252 1125 975 965 867 505 479 257 54 ----11216
NM_015328chr792698 2683 2548 2187 1223 1023 623 419 259 1478 --12241
NM_015335chr1261914 519 508 216 198 41 --11004 --
NM_015336chr1212651 ------
NM_015338chr2071852 1513 768 403 391 305 123 11519 21376 1267 --
NM_015343chr171125 --1117 --
NM_015344chr841925 1765 1395 855 1480 11767 --
NM_015346chr1451594 1567 526 389 149 1609 31325 1225 532 --
NM_015349chr692258 2249 2114 2071 1226 1010 997 649 546 ------
NM_015355chr1711764 ------
NM_015359chr8112512 1054 928 825 819 739 488 308 239 230 220 32751 2030 530 32211 863 490 --
NM_015361chr23694 100 45 ----1257
NM_015365chrX134115 3668 3603 3257 3205 3074 615 391 382 363 333 320 33 --54123 4097 3480 1389 49 --
NM_015367chr2231663 636 481 --2647 360 --
NM_015374chr224515 474 209 64 --1236 --
NM_015375chr1114847 4046 3599 3399 3368 1762 1688 1490 1411 138 42 43775 3668 3204 102 23181 140 --
NM_015378chr193018 2763 2710 2386 2323 1824 1815 515 70 129 ----
NM_015385chr1062453 1248 778 361 335 269 ------
NM_015393chr462971 2963 675 635 166 141 12495 32561 2381 1129 --
NM_015396chr321328 39 --11056 1957
NM_015397chr961496 1388 1280 778 384 39 --2739 698 --
NM_015401chr125819 798 722 436 256 ------
NM_015404chr94563 529 487 465 --124 --
NM_015426chr31584 ----1512
NM_015435chr821330 444 ------
NM_015439chr6188 ------
NM_015443chr1761007 541 516 465 429 323 --2435 218 --
NM_015444chr32172 111 ------
NM_015447chr92289 178 ------
NM_015455chr553292 1514 1080 404 388 11534 --13894
NM_015457chr116849 829 800 227 67 21 --191 --
NM_015460chr392082 1534 1325 725 622 580 566 459 217 1256 ----
NM_015464chr7--1367 ----
NM_015465chr51205 ------
NM_015470chr2121201 1115 1103 1054 1004 950 289 232 124 75 64 57 --2974 397 --
NM_015472chr32125 100 ------
NM_015472chr32125 100 ------
NM_015475chr23984 746 404 ------
NM_015477chr153984 677 113 1221 ----
NM_015481chr12121086 1074 1011 928 844 811 764 313 229 110 80 67 --41018 882 84 22 1289
NM_015488chr2111683 1599 1571 1547 1517 1505 683 638 535 405 294 --1526 --
NM_015493chr194147 137 79 63 ------
NM_015508chr331558 1370 979 11489 ----
NM_015511chr2061124 984 746 278 61 36 --3899 77 38 1863
NM_015514chr143432 229 102 ------
NM_015516chr1171404 1217 1011 296 268 261 209 --11061 --
NM_015520chr322150 1714 ------
NM_015526chr1981130 1077 934 371 311 267 166 91 ----1486
NM_015527chr163737 593 206 --4699 527 265 200 --
NM_015530chr23920 604 344 ------
NM_015534chr1197 ------
NM_015535chr2103516 3000 2968 1211 1179 996 965 856 210 123 13014 23743 1489 33910 3776 2601
NM_015541chr331285 576 114 ------
NM_015542chr101196 ------
NM_015548chr62305 27 ------
NM_015550chr7113583 3570 3510 2984 2971 2729 2634 860 644 405 376 --23552 821 --
NM_015560chr362666 2385 2303 1877 489 172 --22494 953 --
NM_015564chr522665 1365 1992 22577 553 13253
NM_015568chr20204286 4190 3876 3786 3686 3666 3649 3220 2851 1678 1655 1524 1506 1467 1394 1323 1130 992 888 236 23342 450 43917 3651 1193 1183 --
NM_015569chr141725 1443 1347 402 ------
NM_015570chr73570 225 118 ------
NM_015575chr2113149 3133 2994 2808 2421 2259 805 709 523 310 30 22382 2287 12518 33398 2532 1205
NM_015576chr322261 619 --11985 --
NM_015577chr561321 713 351 294 152 124 --2552 370 --
NM_015584chr1771150 483 350 236 198 84 53 --3501 456 413 --
NM_015589chr141127 ------
NM_015605chr1051079 617 588 459 84 --2257 53 --
NM_015609chr1112922 2759 2459 2446 2100 866 733 196 190 180 46 --72651 2505 2490 2094 1086 873 198 12173
NM_015642chr32224 217 ------
NM_015645chr114335 324 36 30 ------
NM_015649chr195351 307 288 124 75 ------
NM_015652chr102627 484 --1631 --
NM_015660chr7----1222 --
NM_015670chr173107 84 58 --197 161
NM_015680chr29617 593 577 565 540 473 273 171 117 --1609 --
NM_015686chrX122503 2419 2380 2231 2222 2084 2077 1831 1762 491 446 254 1938 181 1247
NM_015689chr7----130 --
NM_015694chr72142 128 ----1147
NM_015695chr6131824 1803 1723 856 737 705 538 462 443 359 208 133 98 --3762 723 105 --
NM_015704chr221129 ------
NM_015711chr198684 668 655 223 144 76 33 21 --1270 138
NM_015713chr833106 3057 499 22897 1007 ----
NM_015716chr1713774 717 710 699 607 585 515 279 246 184 86 63 45 --1253 1203
NM_015719chr197740 595 578 523 273 245 200 --1204 --
NM_015726chr181850 1704 1691 1675 1300 1136 335 247 11872 ----
NM_015831chr78917 884 680 592 356 350 103 38 --2598 160 --
NM_015834chr214915 397 342 198 ------
NM_015844chr182210 156 ----1396
NM_015845chr18------1174
NM_015846chr182210 156 ----1396
NM_015847chr182210 156 ----1396
NM_015850chr871731 1717 271 183 171 134 21 --1248 --
NM_015855chr115770 358 269 197 141 ------
NM_015864chr6146 ------
NM_015866chr111043 --21416 1031 --
NM_015872chr1161773 1726 1709 1702 1456 1417 1411 1392 1333 1159 730 720 601 447 431 129 --41764 1461 1161 134 --
NM_015874chr43568 487 143 ------
NM_015879chr18168345 8269 7890 7632 7292 5748 5332 3431 2721 2655 2343 1389 941 903 501 468 58279 7854 7125 6678 1427 23061 301 16058
NM_015898chr19242491 2452 2443 2312 2253 2118 1933 1915 1844 1656 944 898 882 761 628 601 589 577 544 442 251 238 215 197 1902 32260 1746 1685 --
NM_015904chr24697 676 283 233 --1713 --
NM_015906chr184509 4487 3721 3663 3349 793 430 121 13262 --1763
NM_015913chr12588 138 --1226 1547
NM_015915chr14188 ------
NM_015926chr32266 82 ------
NM_015933chr3159 ------
NM_015941chr81305 1124 ----
NM_015955chr21158 ------
NM_015974chr13122 --131 --
NM_015980chr551474 1467 1451 1338 262 --21223 1185 --
NM_015981chr5202968 2961 2583 2455 2352 2228 1190 1037 583 553 519 463 428 420 409 279 223 201 102 77 --42036 1224 610 210 --
NM_015982chr172298 100 ------
NM_015986chr17----1289 --
NM_015987chr12152 ----183
NM_015990chr421071 898 ------
NM_015994chr141662 ------
NM_015995chr15155419 5214 4565 4410 3807 3613 2103 1491 1268 1255 1234 984 699 292 30 13596 25216 4902 12224
NM_015999chr13296 228 188 ----137
NM_016009chr174565 4246 3811 3322 3112 1737 85 43996 3123 1653 1515 14727 --
NM_016021chr652165 2074 1893 766 712 ------
NM_016022chr16874 854 711 432 314 292 ------
NM_016025chr1652006 1408 1385 749 310 ------
NM_016026chr1411178 --1118 1377
NM_016032chrX71194 1185 1105 1059 1003 319 295 --1560 1382
NM_016035chr93418 49 33 --1296 --
NM_016037chr131117 867 163 --1457 31040 901 471
NM_016041chr171389 ------
NM_016045chr20----1375 --
NM_016057chr12101150 1124 995 952 524 375 213 169 157 89 ------
NM_016061chr221110 29 --11452 --
NM_016072chr1221990 1639 11501 --22430 722
NM_016073chr152422 151 ------
NM_016076chr141232 831 621 110 11137 1601 1880
NM_016081chr432014 1756 1467 ------
NM_016083chr623047 1278 33566 3294 2864 ----
NM_016099chr8278 27 11039 1504 --
NM_016107chr531183 275 238 ------
NM_016120chrX2437 350 ------
NM_016129chr41323 ------
NM_016131chr261975 1823 1659 947 795 769 ------
NM_016132chr153519 121 50 23337 661 ----
NM_016133chr211549 ------
NM_016138chr1651680 1471 1355 1242 1165 1606 31563 541 391 2555 424
NM_016147chr117948 270 239 207 118 86 22 11187 21098 360 --
NM_016151chr166363 344 163 105 89 52 ----1350
NM_016152chr321058 954 11032 ----
NM_016156chr1152267 2171 2125 2033 521 --11758 --
NM_016169chr10143266 3096 3013 2538 2481 2327 1303 1291 1196 1174 1126 643 260 58 22813 1166 62352 1249 1119 1019 731 417 --
NM_016170chr21570 1152 ----
NM_016192chr21252 ------
NM_016201chr392275 2181 2175 2159 814 770 125 62 38 --1758 12069
NM_016203chr72672 128 1775 ----
NM_016206chr3147799 7506 7279 6466 3348 3276 3201 2355 1822 1595 1520 1507 1394 507 37159 2236 788 37475 7212 1915 17641
NM_016227chr11354 --1356 --
NM_016231chr1711124 ----11225
NM_016242chr42219 110 ------
NM_016248chr13124001 3249 3226 1405 1338 1318 1312 1298 1291 1285 1266 1246 1898 21302 1275 --
NM_016250chr143785 237 43 --1779 --
NM_016252chr21883 ------
NM_016255chr682789 2746 2540 1134 1091 880 598 495 12195 ----
NM_016257chr192881 2332 996 679 607 438 140 108 66 22443 1370 3467 227 80 21406 52
NM_016260chr276590 5668 5637 5611 5557 2947 564 46067 5679 2184 526 25077 1082 --
NM_016269chr41322 130 1345 --
NM_016272chr22142564 2459 2426 1953 1876 1767 1736 1020 883 791 620 439 375 356 --11957 --
NM_016277chr6--1104 --11574
NM_016281chr126978 903 895 883 183 104 1946 ----
NM_016284chr164796 731 151 100 ------
NM_016287chr161802 1610 803 447 274 108 1325 --21377 837
NM_016289chr221950 1561 12295 --11605
NM_016293chr12124 ------
NM_016298chr372774 2761 2683 2516 2036 1075 999 12540 --12686
NM_016308chr1--1611 ----
NM_016312chr122533 91 ------
NM_016316chr21532 ------
NM_016320chr116836 802 705 368 360 117 --1856 --
NM_016322chr942797 2640 899 322 11970 32928 797 384 --
NM_016337chr141325 ------
NM_016338chr53974 791 26 ------
NM_016340chr531087 1034 932 ------
NM_016352chr771440 1180 1081 936 533 291 134 --1251 --
NM_016357chr12--1308 ----
NM_016373chr162823 288 ----181
NM_016374chr1----1250 --
NM_016374chr1----1250 --
NM_016396chr1572564 2528 2172 2061 2050 1146 1037 22985 1119 12518 --
NM_016422chr1141054 731 297 174 11216 1165 --
NM_016427chr18--183 1169 --
NM_016436chr2032015 932 783 22050 815 ----
NM_016441chr21178 1694 ----
NM_016453chr33492 454 21 ------
NM_016456chr16679 138 132 104 82 52 --1329 --
NM_016463chr52120 28 ------
NM_016476chr173417 263 45 ------
NM_016484chrX4600 456 441 89 2557 462 1449 --
NM_016486chr11184 --1141 --
NM_016489chr7126 1182 ----
NM_016505chr14512 294 134 118 --198 1522
NM_016506chr112129 44 ------
NM_016507chr1753066 2274 2197 685 556 --149 --
NM_016513chr642535 2417 1517 1343 21093 823 11503 --
NM_016516chr2----1638 --
NM_016522chr1141545 1474 423 334 1242 ----
NM_016525chr95795 711 604 260 223 --2713 262 --
NM_016531chr474186 3996 813 756 586 182 149 24106 1340 166 --
NM_016532chr1731180 1141 1043 --1132 --
NM_016544chr283799 3423 2864 2834 1444 1251 1167 86 --188 --
NM_016547chr12640 255 --1513 --
NM_016559chr331463 1446 326 21399 603 ----
NM_016569chr1241542 344 287 102 ------
NM_016574chr116936 921 320 310 107 41 --41119 942 265 35 --
NM_016575chr12125234 5178 5078 5028 4967 3862 3789 2091 786 660 576 432 31475 515 149 24844 1340 33381 1507 1373
NM_016577chr3154369 4247 3741 3543 3357 3302 2965 1494 1475 1282 970 697 691 435 394 13166 44033 1355 440 25 --
NM_016578chr11146 ------
NM_016596chr125819 798 722 436 256 ------
NM_016598chr311482 --1418 --
NM_016603chr52621 221 1556 --1177
NM_016605chr5122585 2539 2347 1921 1878 1864 1746 1681 722 394 232 44 22766 1975 --12173
NM_016620chr1--1975 ----
NM_016621chr11184431 4348 4321 4290 4232 4118 4076 3839 3790 3746 3620 3482 3130 3018 1687 769 717 657 --34649 4278 3808 --
NM_016623chr81131 ------
NM_016626chr182689 418 21171 1090 ----
NM_016631chr21--144 1264 --
NM_016652chr2021781 383 11690 ----
NM_016654chr1531122 980 454 --1873 --
NM_016733chr2251512 1194 1150 525 144 11122 11107 --
NM_016819chr37518 409 372 347 190 138 39 --1214 1146
NM_016824chr101172 ------
NM_016829chr35308 233 175 164 40 ------
NM_016830chr123520 166 75 --1391 133
NM_016929chr6124013 3992 3972 3728 3672 3344 1735 1456 982 673 382 186 33780 1551 1381 11065 --
NM_016930chr42383 71 ------
NM_016946chr1103194 2725 1384 1311 1290 947 566 289 185 173 --43412 1269 528 497 33361 3228 2347
NM_016950chr431379 302 80 ------
NM_016952chr11124039 4021 3906 3751 3611 3046 2904 2886 557 544 207 197 --42710 824 526 277 1684
NM_016953chr2106025 5941 5928 5577 4566 4411 1668 862 715 591 15305 25071 3999 14581
NM_017409chr127589 515 179 88 52 36 22 --2599 532 1145
NM_017410chr1271108 1066 794 787 504 419 290 1874 21114 481 --
NM_017412chr831400 979 970 --11405 --
NM_017413chrX132046 1820 1669 1556 968 948 940 351 277 239 203 156 100 --1766 1667
NM_017415chr5114564 4217 4011 3467 3389 1585 1252 1062 953 705 439 43534 3106 1795 1668 11731 --
NM_017420chr1442533 2470 2440 80 1893 ----
NM_017423chr442039 785 492 123 21581 833 ----
NM_017437chr1462408 2373 2079 1864 614 552 32215 893 215 12379 12247
NM_017447chr2163981 3948 3146 790 217 45 53952 1623 1180 1117 872 ----
NM_017450chr1761309 1197 498 198 74 49 --21187 1070 --
NM_017452chr2041301 1272 529 283 1566 --11410
NM_017453chr2041301 1272 529 283 1566 --11410
NM_017454chr2041301 1272 529 283 1566 --11410
NM_017455chr152144 88 ------
NM_017456chr17101569 1298 1288 1235 760 592 520 270 229 55 ------
NM_017459chr12163 33 ------
NM_017481chr11271 48 ------
NM_017488chr291460 1303 587 393 380 368 361 294 260 11604 --1253
NM_017491chr43966 857 341 1789 ----
NM_025027chr1941162 1144 315 110 ------
NM_025047chr32408 362 ------
NM_025054chr842839 2740 1629 241 ------
NM_025057chr143220 150 45 1845 --11120
NM_025058chr19776 636 605 555 188 131 107 94 37 --1146 --
NM_025061chr194895 393 314 293 2432 73 ----
NM_025074chr472760 2457 2363 2159 640 413 393 23036 761 42862 2267 890 663 --
NM_025090chr1771367 1251 1124 1079 997 566 546 21391 1141 ----
NM_025104chr1721464 1161 --124 --
NM_025106chr191892 1806 1686 748 719 679 279 197 130 --31266 706 332 --
NM_025115chr81125 --141 --
NM_025134chr1641964 1927 1811 371 21684 558 1818 --
NM_025140chr124489 474 454 423 ----1445
NM_025146chr32104 69 --11889 --
NM_025151chr852128 1865 1448 774 114 1197 ----
NM_025160chr183608 3309 3301 1658 1459 1444 1295 304 1595 ----
NM_025179chr1214915 4437 4392 4209 4139 3976 3731 3551 3486 3261 3011 1980 1939 1755 1366 958 703 481 472 456 147 13280 54487 3214 1628 1379 461 --
NM_025181chr21783 ------
NM_025182chr98830 743 430 415 306 280 222 210 --4834 749 424 388 --
NM_025187chr1661344 1319 1301 1294 1155 524 21199 278 11226 --
NM_025191chr143113 2967 2809 1255 23045 2915 2799 787 --
NM_025211chr92272 42 ------
NM_025222chr372601 1988 1155 927 800 465 128 31936 989 299 1130 --
NM_025224chr20112206 2177 2068 2035 1486 931 848 451 121 112 100 --1668 --
NM_025237chr1741565 1415 1021 988 --1140 1971
NM_025248chr17173268 3188 2744 2121 2070 1101 730 605 466 447 377 369 285 265 143 57 37 --42943 2890 2772 609 1390
NM_025251chr871047 470 452 396 339 320 70 --1434 --
NM_025256chr63108 55 23 ------
NM_025261chr6_qbl_hap27387 333 154 106 97 52 26 --2156 30 --
NM_030576chr1782534 2467 681 672 397 248 175 161 --22536 1753 11724
NM_030594chr1551329 1213 1015 854 261 --11172 1102
NM_030623chr261432 1423 1340 1191 641 32 1623 --11214
NM_030625chr1022668 2014 22281 477 1802 --
NM_030627chr533166 888 69 ------
NM_030629chr1641432 1390 1215 760 --1638 --
NM_030634chr162086 1791 882 472 327 102 12343 --2885 478
NM_030640chr121868 1200 ----
NM_030645chr1131187 1134 982 971 930 467 412 317 187 181 121 95 75 --1441 1470
NM_030647chr7116044 5305 5159 4754 4556 4543 4253 1989 1303 709 28 24860 1496 11991 --
NM_030648chr465201 4310 4257 1831 1686 919 34758 3661 609 1114 24881 1487
NM_030651chr64656 557 334 43 --1703 1760
NM_030653chr126811 624 298 246 169 37 1706 1770 1634
NM_030661chr751625 1551 1139 106 36 1368 ----
NM_030664chr102957 298 12425 ----
NM_030674chr12175338 5112 4686 4553 4490 4291 3890 3867 3798 1745 1714 1302 1241 644 301 248 69 35132 4352 1392 23879 3773 --
NM_030755chr1432761 2527 418 1311 --12561
NM_030761chr172566 2223 2192 1772 1033 188 70 21663 505 32198 1885 607 --
NM_030762chr121238 11998 ----
NM_030763chrX----1842 --
NM_030766chr122932 107 ----11001
NM_030784chr6174 ------
NM_030786chr131723 280 272 31328 648 87 ----
NM_030791chr1411744 ------
NM_030802chr173920 96 60 1757 ----
NM_030803chr261157 1125 1057 497 320 38 1481 31127 280 109 1391
NM_030806chr1219171 8879 8603 8427 8322 7990 7745 7433 7384 3497 3267 2943 2052 1878 1461 1078 1028 840 785 432 425 --48350 3458 2092 886 28511 8430
NM_030808chr1791089 1042 897 732 721 428 419 392 35 1782 ----
NM_030809chr1241740 657 550 100 1375 ----
NM_030810chr651182 576 85 38 24 --31489 1298 1257 --
NM_030815chr201705 --1540 1315
NM_030816chr121088 666 1837 13506 --
NM_030881chr2262243 2233 1979 639 629 286 --1792 --
NM_030884chr3161703 1590 1577 656 622 540 533 368 340 291 206 182 166 67 54 32 --2344 82 --
NM_030913chr14527 255 111 47 1131 1272 --
NM_030915chr2162295 2194 2183 1930 1879 1865 1808 1704 1475 945 932 877 774 707 699 63 21753 909 1797 1896
NM_030918chr1345240 4989 4790 4712 4677 4610 4514 4495 4273 4263 4254 4211 4094 3987 3618 3612 3437 2123 1943 1930 1691 1658 1399 1328 1122 835 740 606 537 160 141 134 97 41 11528 --33310 2085 743
NM_030920chr12791 214 1822 1813 --
NM_030923chr21221 ------
NM_030926chr24905 155 137 69 ------
NM_030927chr1051323 1185 1076 359 142 ------
NM_030935chr71337 ------
NM_030937chr13948 105 37 --11356 --
NM_030939chr6----1343 --
NM_030948chr6183 ------
NM_030953chr511556 1473 11302 --
NM_030962chr111519 ------
NM_030963chr61566 ------
NM_030964chr5183535 3063 2680 2553 2332 1501 1379 1062 695 647 637 505 413 388 361 355 344 94 21417 1383 42999 1110 819 346 1701
NM_030981chr1161128 1020 935 807 390 76 --1319 --
NM_031212chr103236 118 79 ------
NM_031216chr1831678 104 84 1108 ----
NM_031231chr204520 130 102 46 --2742 496 --
NM_031232chr204520 130 102 46 --2742 496 --
NM_031262chr9--11148 ----
NM_031263chr9--11205 ----
NM_031268chr16154688 3924 3673 3453 2139 2019 2010 1945 1867 1860 1519 1418 970 547 79 --23931 442 1946
NM_031283chr25877 804 672 364 310 ----1607
NM_031289chr121972 --1945 --
NM_031309chr8192218 1756 1557 1480 1470 744 678 666 587 531 453 398 388 344 338 247 216 103 35 12084 22259 627 1401
NM_031314chr1461923 367 197 135 120 85 --1137 --
NM_031369chr41723 1621 ----
NM_031370chr41723 1621 ----
NM_031371chr1----1250 --
NM_031371chr1----1250 --
NM_031372chr421367 473 ------
NM_031407chrX2183 149 ------
NM_031411chr522059 59 --1286 --
NM_031417chr19152096 1862 1837 957 930 869 798 705 591 514 486 361 307 231 23 12533 1712 1601
NM_031418chr1151882 1843 1812 1768 880 12765 1289 --
NM_031426chr9142249 2205 2194 2105 1780 1082 1071 931 298 218 206 92 43 28 --21025 30 149
NM_031427chr14105763 5708 5589 5555 5501 5351 5211 3803 1085 170 15005 --13623
NM_031432chr951025 956 130 93 30 ------
NM_031438chr531337 689 507 ------
NM_031439chr871652 1553 1463 1258 270 186 40 1384 195 1510
NM_031442chrX2596 330 1236 ----
NM_031443chr73355 55 33 --157 --
NM_031445chr293313 2605 2411 1269 1226 674 478 386 74 --1146 --
NM_031450chr117570 393 251 231 110 69 58 ------
NM_031453chr1042275 1733 910 342 --22245 805 --
NM_031468chr7307990 7911 7614 7449 7101 6920 6553 6517 6422 6410 5582 3300 2943 2838 2817 2546 2519 2350 2250 2093 1629 1601 1515 1479 1093 883 849 736 656 510 37798 7525 1828 57960 6607 2650 1523 888 --
NM_031469chr643046 2768 1201 516 13714 ----
NM_031475chr15778 613 310 127 105 --1525 --
NM_031478chr166570 464 204 186 28 22 --2572 248 1676
NM_031483chr2053339 2409 2360 482 151 --1487 --
NM_031492chr112544 181 ------
NM_031844chr152797 1550 1250 848 489 11118 13589 --
NM_031845chr221033 925 12601 ----
NM_031847chr221033 925 12601 ----
NM_031849chr522059 59 --1286 --
NM_031857chr522059 59 --1286 --
NM_031860chr522059 59 --1286 --
NM_031866chr1071000 944 749 414 389 322 90 --2247 202 --
NM_031886chr1952451 2270 532 187 35 ----12363
NM_031890chr22252906 2859 2633 2595 2467 2390 2249 2240 2166 2145 2072 2017 2007 1114 983 957 945 702 616 582 451 341 299 225 212 12831 41900 1221 1155 1070 --
NM_031892chrX3859 776 181 ------
NM_031911chr421947 91 21909 981 11734 --
NM_031922chr61425 ------
NM_031935chr11139 --166 1248
NM_031953chr42463 118 ------
NM_031954chr1261944 1050 921 894 97 27 --32667 997 31 22112 1978
NM_031990chr1971400 1153 1099 545 521 351 43 11000 ----
NM_031991chr1971400 1153 1099 545 521 351 43 11000 ----
NM_031992chr751479 1175 279 237 112 1470 11484 1639
NM_032012chr984976 1812 1382 1238 901 631 510 127 13672 2773 82 13592
NM_032013chr2041386 251 195 123 ----21351 1216
NM_032017chr1201868 1765 1747 1515 1435 1383 1361 1319 846 783 736 698 672 583 482 449 432 341 97 42 11428 11815 11927
NM_032028chr53224 162 132 ------
NM_032040chr192266 33 ----1281
NM_032041chr852349 2265 2068 532 133 --12351 --
NM_032042chr572512 1147 610 390 384 81 55 22915 419 21901 108 --
NM_032050chr221409 1164 2415 386 --
NM_032052chr22--1549 128 --
NM_032088chr5141704 1669 1651 1485 1396 1374 1258 717 538 502 482 355 174 37 1324 2542 440 1648
NM_032092chr5141704 1669 1651 1485 1396 1374 1258 717 538 502 482 355 174 37 1324 2542 440 1648
NM_032102chr112752 341 11246 ----
NM_032104chr1130 --1694 1212
NM_032105chr1217763 7695 7510 7363 6813 6800 6593 6351 5334 5056 2859 2122 1832 1737 1132 1049 1037 849 764 737 30 37239 4926 321 57111 6774 5816 2952 694 1212
NM_032108chr196982 969 954 895 647 176 ------
NM_032109chr512487 460 422 373 345 315 298 244 228 189 140 64 --2464 250 --
NM_032121chrX42569 2056 592 402 1898 2729 228 1762
NM_032139chr194720 362 337 95 ----1345
NM_032143chr2--1330 ----
NM_032153chr322548 2147 11867 ----
NM_032154chr10----1290 --
NM_032160chr18173730 3718 3344 3296 3279 2868 2702 2690 1528 1517 1502 1470 792 757 636 544 203 34235 3576 854 11519 13865
NM_032174chr161033 511 491 451 229 145 --1496 1386
NM_032181chr22574 241 ------
NM_032182chr1011214 2570 113 ----
NM_032186chr1--1975 ----
NM_032192chr176709 553 532 464 92 21 --1734 --
NM_032195chr211193 ------
NM_032199chr1032968 1347 607 53838 3693 2885 2606 1335 --1220
NM_032204chr224324 242 75 59 --1148 --
NM_032208chr263435 2899 1348 618 385 30 1281 --1941
NM_032211chr103835 319 21 ------
NM_032214chr2061252 1095 939 274 157 63 11263 1188 1892
NM_032217chr42941 249 182 ----
NM_032221chr202308 68 1300 1690 --
NM_032239chr41909 ------
NM_032242chr3173058 2911 2827 2704 2595 2544 2391 2201 2163 2105 956 920 742 720 558 424 134 12607 33180 2808 674 --
NM_032246chr154115 103 86 54 1339 ----
NM_032256chr12--1776 ----
NM_032268chr16122681 2559 2199 2173 1097 663 569 491 471 221 151 136 --23031 1198 130
NM_032271chr1671125 569 511 336 203 167 143 11531 11313 --
NM_032281chr19152940 2880 2856 2830 2812 2708 2581 2554 2527 2520 2511 1163 409 222 31 --2387 22 --
NM_032283chr191811 1591 1373 1279 1161 703 192 127 67 --21184 338 --
NM_032289chr591746 1377 749 619 473 419 348 231 210 --31829 479 319 --
NM_032291chr131710 1344 252 ------
NM_032294chr1771539 659 243 228 213 127 119 --21841 393 --
NM_032299chr11140 ------
NM_032312chr2----1940 --
NM_032325chr11101896 1858 1502 1287 621 597 517 306 121 69 --11651 21517 1381
NM_032345chr125394 168 157 120 114 ----1181
NM_032352chr1421241 991 11023 ----
NM_032353chr173405 379 348 --3444 355 34 --
NM_032360chr1145 ------
NM_032364chr1271005 878 644 227 214 195 79 ----1373
NM_032373chr1045131 3593 1877 1232 1706 ----
NM_032375chr194710 116 106 67 1124 1161 --
NM_032387chr173309 243 27 ------
NM_032389chr1161081 1069 989 883 758 59 11048 1219 --
NM_032403chr5141704 1669 1651 1485 1396 1374 1258 717 538 502 482 355 174 37 1324 2542 440 1648
NM_032408chr751165 1112 998 932 139 --21122 162 --
NM_032420chr59756 292 281 234 217 197 179 158 30 152 ----
NM_032431chr115388 299 221 168 85 1395 ----
NM_032434chr271629 1224 321 180 154 128 24 ----2540 255
NM_032436chr133873 714 681 ------
NM_032438chr6--21137 83 ----
NM_032439chr1021593 40 21185 465 21623 190 --
NM_032440chr1012146 --12293 12971
NM_032442chr172357 147 ------
NM_032445chr1562292 2110 1929 1601 899 353 --11608 --
NM_032449chr191952 844 836 714 563 526 515 354 42 --12345 21877 189
NM_032452chr1491441 1350 1306 1229 1072 622 283 226 99 --21151 344 11459
NM_032457chr443470 2409 262 252 33095 2740 234 ----
NM_032458chrX1987 22558 854 13336 11147
NM_032486chr16102588 2557 2521 2203 2045 1958 1672 720 358 113 21699 285 31677 1640 424 1584
NM_032494chr22208 151 ------
NM_032499chr151421 --1364 --
NM_032505chr341768 976 598 429 ------
NM_032511chr62375 63 ------
NM_032521chr2052585 2414 1095 960 606 1453 21215 594 31119 994 740
NM_032538chr6252749 2738 2678 2587 2514 2451 2439 2413 2362 2333 2295 2179 1819 1783 1140 1089 944 893 850 833 517 437 419 228 79 12191 52751 1900 1099 259 251 11841
NM_032550chr1031141 327 27 ----1914
NM_032552chr9141857 1775 1735 1683 1577 1545 1503 1244 693 336 278 169 157 109 --1789 --
NM_032569chr1671840 1786 1473 793 439 428 166 --2430 387 --
NM_032574chr21109 ------
NM_032575chr16141951 1529 1439 1360 1347 712 459 422 398 360 325 308 294 43 --51433 602 465 298 166 --
NM_032576chrY193 ------
NM_032580chr173379 367 214 ------
NM_032581chr73378 239 21 ------
NM_032582chr1721659 431 --2756 685 --
NM_032595chr1791341 1183 1169 546 465 372 139 83 54 --3512 90 43 --
NM_032603chr22210 158 ------
NM_032632chr1441655 1497 815 129 --21660 1622 --
NM_032638chr351214 634 493 123 34 ----11217
NM_032645chr112161 29 ------
NM_032646chr1781508 1373 1159 698 549 192 113 26 11367 ----
NM_032664chr841303 1185 571 237 1362 1609 11364
NM_032673chr2134 ------
NM_032682chr363486 2374 1267 1170 516 267 --1885 --
NM_032687chr8179 --153 --
NM_032689chr1921359 352 ------
NM_032711chr17133756 3513 3321 3136 3045 2826 2759 2728 1716 1514 1129 124 98 23008 394 23827 3050 --
NM_032737chr1972263 1678 1094 1011 585 149 138 12540 1889 11048
NM_032741chr66948 880 874 268 102 45 --3931 239 25 --
NM_032758chr222145 23 ------
NM_032765chr51184 1722 ----
NM_032772chr102208 194 --1450 --
NM_032777chr861416 1053 1045 410 319 307 --21265 247 1469
NM_032778chr331086 497 129 ------
NM_032781chr113810 772 102 --1774 --
NM_032784chr61127 1800 ----
NM_032786chr123177 171 78 ------
NM_032789chr84256 116 42 26 --134 --
NM_032800chr1122628 2612 2511 2402 2084 1936 969 896 549 380 305 281 --12298 --
NM_032801chr1142242 1980 1954 1790 --1939 --
NM_032804chr1092529 1644 1029 934 730 631 349 306 274 2971 910 ----
NM_032808chr156882 765 175 123 91 83 --2128 85 --
NM_032812chr101261 ------
NM_032813chr1311122 ------
NM_032827chr271091 804 791 741 385 162 42 --2134 46 --
NM_032830chr16125 ------
NM_032832chr661131 623 583 427 416 388 ------
NM_032833chr152223 2209 1682 772 223 1427 --21852 1716
NM_032836chr19