TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-369-3p
miRNA Sequence: AAUAAUACAUGGUUGAUCUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX73102 2411 2380 2338 2189 2182 618 2941 85 13430 12986
NM_000109chrX42534 2434 959 237 22641 1006 --22646 205
NM_000112chr5105511 5431 4594 3875 3637 1444 1411 986 261 122 54911 4582 2178 2127 1401 23902 1040 --
NM_000115chr1382521 2365 2322 2259 2225 1845 488 477 ------
NM_000202chrX33105 2809 491 23064 1356 23050 1332 13178
NM_000216chrX93352 2973 2837 2741 2706 1592 962 772 747 53843 3651 3599 3582 1149 22528 1120 14037
NM_000259chr15106380 5938 5676 5356 4803 2170 1823 881 852 488 25917 5688 1197 25551 2135
NM_000267chr1763438 3194 2976 2654 650 412 33121 2558 1078 33201 3125 2124 23255 465
NM_000314chr1073228 2264 2198 2150 1994 1313 716 22414 2395 --13265
NM_000332chr6127176 6865 6304 6029 5376 4868 2607 1867 1858 1849 876 95 27099 6927 ----
NM_000489chrX42873 2439 1249 532 53441 3232 2797 2655 2319 22310 1042 --
NM_000814chr1593335 3085 3072 2806 2770 1122 972 488 356 14093 34150 3187 412 --
NM_000926chr11139459 9435 8894 2226 2165 1709 1566 1310 1208 1004 737 382 280 26350 376 1674 --
NM_001001395chr1252845 1956 1767 339 196 2623 290 1375 1304
NM_001003652chr18118656 8101 5880 2565 2482 2092 1757 1463 1260 460 443 57838 6236 6100 5493 701 1342 --
NM_001003674chr18106104 5899 5403 5012 2605 1564 1357 880 775 414 46753 5212 1343 408 ----
NM_001006600chr542401 1762 1583 418 32279 1933 1777 1829 22377 2261
NM_001008925chr431322 1066 842 23476 1126 23445 252 2590 477
NM_001009909chr1173110 1549 1395 1261 936 360 40 --33628 912 511 33903 3719 2741
NM_001009960chr752424 1084 252 196 190 1821 --12478
NM_001011515chr45752 435 397 142 84 ----21025 971
NM_001011666chr786467 6434 6242 6190 4138 4081 2541 140 45729 4993 2250 524 ----
NM_001024956chr1165867 4341 4290 3622 1384 737 25275 5150 15847 11142
NM_001025076chr1085957 4475 3894 3771 1282 1272 1167 285 --33976 2408 780 1374
NM_001025252chr873125 2579 2198 2119 2004 1284 1258 2711 596 1703 --
NM_001025580chrX84291 3515 3421 1310 953 711 269 203 24272 2887 --12661
NM_001030055chr14124742 4495 4398 4279 3739 1744 1639 1610 1473 1356 401 306 11575 23646 3317 31596 1504 1399
NM_001031695chr2255342 5270 4184 1488 690 15224 --24752 4688
NM_001037174chr281863 1806 1566 1394 788 569 348 319 --32263 1841 467 1622
NM_001037339chr111839 21833 1819 11826 --
NM_001037535chrX61431 1250 1223 594 532 199 41232 256 152 127 1359 --
NM_001039569chr252211 773 297 285 38 23296 358 1182 1209
NM_001039618chr1165808 5269 5122 4857 1562 1007 25828 4271 35497 4275 4015 --
NM_001039840chrX146056 5124 4844 4827 4806 4214 3974 2276 2268 1889 1752 820 802 28 25437 629 14864 --
NM_001040284chr16115932 5614 5430 4771 4012 2063 1859 1429 1330 1265 496 15225 11216 --
NM_001106chr368992 3546 1243 176 164 137 31492 156 147 ----
NM_001146chr832190 2142 98 1907 12199 31889 451 432
NM_001167chrX76588 5223 2345 879 214 185 25 36556 5213 1682 36595 1777 195 --
NM_001204chr2137696 7121 6046 6024 5826 5572 4711 2058 1447 1397 470 326 247 37147 1645 1091 47588 5785 5555 1318 11031
NM_001527chr6144849 4662 4408 4357 4255 3843 3834 3507 1467 880 808 708 247 165 ------
NM_001621chr741957 1190 1120 646 32644 2502 860 32886 2727 1920 11227
NM_001918chr1128779 7756 6854 6540 6120 5803 5753 3120 2296 2267 1349 730 37484 2691 95 18977 --
NM_002015chr1352713 2609 758 696 595 22624 2529 23016 2666 12629
NM_002025chrX79039 7480 6317 1218 1086 290 133 12327 27122 2937 17282
NM_002158chr263825 3595 3543 3044 2781 962 13365 33487 902 832 --
NM_002270chr595000 4524 4462 4181 4164 3515 1602 329 184 65620 5023 4693 3681 2255 1145 34973 3803 1149 --
NM_002310chr555634 5344 4793 4647 870 45011 4722 4558 1552 36598 5594 103 25996 5261
NM_002581chr9125677 5110 5095 4540 4417 3892 3723 2239 1206 1143 1115 60 55232 5102 5083 4918 1916 13780 1750
NM_002595chr1241602 1361 1349 1343 21610 390 21805 1430 --
NM_002655chr875190 4307 3418 2057 1373 1203 600 44429 3701 3562 1463 15268 --
NM_002667chr641283 993 508 153 2517 84 --21242 1233
NM_002709chr272448 2386 1313 1098 792 752 501 22488 202 12916 1183
NM_002834chr1254017 3910 3746 2881 2782 23857 3452 14052 13735
NM_003034chr12127609 7591 7104 6719 5944 5471 3129 2418 2102 2047 1046 465 11895 11254 --
NM_003112chr763150 2839 2558 1262 1186 297 52791 2698 2500 2252 374 ----
NM_003392chr363080 3056 1276 861 183 165 31318 757 175 ----
NM_003566chr1293056 3035 2991 2685 2342 710 537 399 144 23478 3146 13271 --
NM_003574chr1895729 5427 5237 5080 4679 4547 1802 1534 333 12149 21539 639 --
NM_003615chr3103939 3763 3673 1443 1276 1156 989 950 880 392 21078 83 ----
NM_003617chr184419 4385 4177 1758 972 614 533 222 15018 --1585
NM_003722chr352679 2551 1952 936 627 --1389 12625
NM_003966chr597553 6846 6296 6106 1767 1715 1684 984 944 --16606 17781
NM_004124chr1483342 3232 2527 2334 785 490 459 36 --22414 402 --
NM_004136chr1573159 2393 2350 2014 1054 880 672 12625 13306 13214
NM_004171chr11118145 7900 7597 7419 6913 6838 6804 6696 1813 1106 435 46993 6958 3011 2265 2401 228 28126 1590
NM_004293chr9103821 3648 1323 1310 1077 1051 811 738 710 605 11404 --13243
NM_004464chr4114305 4083 3877 3732 3494 3225 2927 2766 592 472 116 33884 3185 1729 ----
NM_004504chr292789 2505 2165 1141 1083 1007 636 349 137 23064 622 ----
NM_004745chr8105589 2711 2586 2388 2065 2037 1193 1162 1129 342 1814 16858 12671
NM_004815chr184295 3650 1897 1856 1669 1656 1560 1114 2699 387 43960 3755 54 41 11229
NM_004852chr181613724 13035 13010 12570 11944 11936 11832 11347 10604 10320 10151 8821 4862 2185 841 529 311668 9836 9603 314039 10166 1056 114234
NM_005065chr1464345 4262 3405 3394 1336 573 31919 1149 1030 1377 15212
NM_005121chr1753043 2982 2806 1077 135 22558 451 3856 650 609 1228
NM_005156chr983931 3853 3629 1618 1118 1062 1050 530 15204 14460 --
NM_005160chr22126521 6104 5662 5630 5584 5459 5357 5055 4868 2723 1583 968 26577 5414 15999 --
NM_005277chr441966 1809 1681 1659 11708 31571 1386 1244 1331
NM_005339chr4103962 3626 3556 3350 3197 3042 1647 1192 119 63 31569 1413 1069 11439 11107
NM_005359chr18146205 5804 5396 4514 4338 2595 1239 1094 1086 708 437 418 370 259 ----1537
NM_005504chr12186624 6578 5593 5541 5516 5007 4591 4568 2628 2537 2193 1385 1150 938 854 793 526 132 16212 15348 --
NM_005596chr976237 5432 4295 4159 1890 1581 1366 26355 1899 --16156
NM_005665chr184661 4420 3764 3640 3484 1506 495 258 24887 3195 ----
NM_005668chr5104572 3901 3825 3374 3326 1398 1206 1189 1001 859 34025 3960 3767 34596 4086 1478 13540
NM_005746chr782796 2605 2539 2461 1935 1789 621 254 3995 686 52 21758 545 1707
NM_005748chr1243318 733 581 521 22167 660 2382 257 12874
NM_005941chr884111 4060 3735 3697 3469 871 346 73 33944 3286 2717 23712 1598 --
NM_006154chr1562711 2347 1081 734 585 519 11064 --12022
NM_006251chr552682 2433 1181 1011 332 ----2357 343
NM_006313chr1211348 11069 --31417 1251 626
NM_006364chr142926 115 11261 --31229 956 220
NM_006420chr2093429 3049 3004 2924 2866 1388 1185 789 465 ----12743
NM_006534chr2083154 2971 2848 2555 809 543 423 290 22462 992 1996 --
NM_006544chr14105581 4794 4442 4101 2450 1986 1929 1893 1482 428 45364 3856 3742 822 13930 --
NM_006599chr16116661 5899 5812 2917 2413 2404 2309 2162 1292 337 270 27625 5941 ----
NM_006729chrX85500 5200 4727 3958 2075 1971 1304 489 11395 --11619
NM_006750chr1635377 2446 1326 --17544 38066 7290 5696
NM_006775chr652683 2645 2241 1130 604 43075 2919 2812 2340 22600 2532 11010
NM_006873chr232402 1229 750 33418 3080 1394 31192 856 612 --
NM_006915chrX92364 2189 2018 1700 1689 298 145 82 30 22457 2089 ----
NM_007214chr611276 1262 1291 21222 1032
NM_007231chrX52333 771 451 367 78 22307 193 --22448 2443
NM_007249chr13139467 9040 8044 7401 7307 6699 5774 2450 2044 1685 1505 324 86 29024 3772 49227 8278 8169 7210 19082
NM_012081chr5123660 3614 3555 3427 3117 3067 2976 2958 859 308 249 116 11355 21359 1346 --
NM_012158chr1331179 726 263 3414 343 304 --2590 46
NM_012214chr2105784 5084 4760 4452 4002 1792 1066 1046 440 290 75415 1856 1099 1003 851 835 375 12544 26201 263
NM_012382chr5134539 4413 3909 3637 3061 2954 1691 1612 1271 1185 1019 809 670 21204 157 ----
NM_012416chr961248 1181 1023 296 151 27 31097 76 35 2794 774 --
NM_013374chr3103025 2375 2211 957 793 647 611 542 505 495 13094 --12876
NM_013396chr2171381 1362 1330 1116 474 283 243 31434 1339 461 ----
NM_014021chr172895 2618 2549 1384 611 425 293 2778 325 33366 2690 972 --
NM_014028chr673188 2438 2042 1140 1048 985 218 43281 3144 709 459 1452 --
NM_014106chr1552886 2632 2460 1836 264 32265 417 242 32740 563 60 --
NM_014155chr1177354 5684 5114 2502 1774 825 769 27315 7217 --17291
NM_014253chrX72495 2011 1982 767 582 342 163 2467 67 --12434
NM_014331chr4126888 6869 6418 6208 6133 5447 3077 2156 1800 1329 796 677 26748 2860 15598 27751 5692
NM_014423chr595662 5452 4749 4041 2092 859 706 585 562 15435 --15396
NM_014701chr1543077 1195 1176 145 1549 13371 12782
NM_014795chr261174 1129 905 406 215 75 --41370 463 178 48 11038
NM_014877chr17127245 6356 6337 6223 4898 4785 4740 2873 2716 2034 1804 448 --26556 251 --
NM_014904chr1073151 2924 2752 1621 726 123 22 31318 948 659 22987 2769 --
NM_014912chr1083462 3418 3314 3164 2948 2454 1179 140 32771 1290 1173 2711 664 --
NM_014951chr1042635 1921 1854 1812 32123 1804 191 12181 --
NM_015000chr12102815 2701 2649 2633 2017 1210 473 408 290 208 42958 2522 2402 227 11058 1759
NM_015020chr1663898 3846 3408 2623 2535 512 23113 2550 --13798
NM_015025chr282539 2469 2439 2283 1042 931 578 518 32460 2383 703 1116 --
NM_015026chr12113671 3424 3327 2959 1768 1656 1441 593 560 455 318 54415 2981 1557 1518 821 21429 704 11122
NM_015040chr283361 3041 2445 2438 2318 533 458 384 12425 --33312 3129 2835
NM_015076chr674210 4146 4073 3288 3175 1093 903 11530 11162 24043 940
NM_015271chr463606 2777 1206 1072 1026 472 1400 11041 11154
NM_015310chr888240 8058 7627 5901 5167 5091 3316 1660 37715 5524 134 --16911
NM_015458chr895301 5106 5015 4913 4422 3475 1054 935 593 1839 --11149
NM_015460chr341747 1739 1732 427 22093 1927 11559 --
NM_015461chr183709 583 96 --2213 133 1115
NM_015886chr844836 4612 4204 3830 34923 231 89 55747 5663 4852 4823 4086 11305
NM_015888chr183330 3132 3051 2812 2108 1115 1057 323 12221 12445 22592 274
NM_015892chr1052345 2308 2076 2064 2039 --12052 --
NM_015906chr1114787 4541 4520 3824 3296 3235 3006 1836 1826 1183 152 34755 4071 1731 ----
NM_016023chr842179 1724 1700 749 11830 --11716
NM_016072chr1262388 2170 1799 928 478 36 12407 2827 41 --
NM_016073chr1561169 934 891 882 868 218 --11064 --
NM_016083chr6103938 3860 3790 3642 3078 1322 1300 901 570 72 33687 3369 2566 43691 1389 956 434 --
NM_016107chr531110 157 26 1433 1165 11337
NM_016132chr1583422 3391 3274 3239 2242 2218 1195 585 2327 81 ----
NM_016206chr3139014 8778 8288 7992 7791 7072 6709 6045 3565 3406 2202 1550 253 57962 5939 5801 5479 560 38737 6521 654 12514
NM_016255chr652725 1268 908 201 142 12309 23349 2120 12086
NM_016531chr4104131 4082 3886 3379 3366 3334 3045 2914 2621 364 23748 2777 ----
NM_017415chr594281 3753 3631 3315 3285 3062 1771 984 415 --34535 2800 789 --
NM_017628chr485015 3890 1527 805 727 560 380 226 23414 2042 24672 1717 --
NM_017637chr9119074 7655 6477 3281 2482 2152 2112 1122 979 973 569 26946 2134 --18408
NM_017650chr744858 1922 1881 697 44975 2327 2239 2042 36059 5384 1723 24226 2364
NM_017651chr63251 238 224 51122 1093 1043 388 206 ----
NM_017658chr1494654 4227 4180 3257 3007 1652 1489 623 414 24201 1620 33779 3248 1109 14371
NM_017752chrX72084 1833 1698 1449 531 427 228 32132 1763 1685 1415 11886
NM_017769chr1433063 991 490 31072 456 149 13182 22281 607
NM_017813chr864963 4918 2294 2233 1217 297 54756 4644 4637 3996 1826 35339 4707 203 --
NM_017919chr9125720 5704 5630 4671 4371 4211 4079 3717 2203 1759 1674 437 ----14446
NM_018227chr453172 981 934 275 263 1581 --1686
NM_018374chr7115122 5053 4969 4765 4605 3636 2099 2061 1542 668 175 34817 4650 463 ----
NM_018566chr1105133 4809 4112 3735 3230 1767 1483 1436 841 701 --23756 1443 2402 295
NM_018638chr12115263 5028 4165 3897 3769 1666 936 879 736 711 220 64613 4438 2093 1700 1278 298 ----
NM_020357chr31542 11294 11582 31189 1160 432
NM_020390chr3114918 4880 4767 4591 4485 4361 1857 1557 1381 499 365 24325 3780 --13147
NM_020673chr2047690 6974 480 194 37387 5396 2333 27562 1601 21481 1049
NM_020734chr1252806 2755 2688 2459 661 12417 12289 23199 452
NM_020774chr1885615 5012 4337 4104 4024 3820 1310 1025 32325 2103 1090 11134 --
NM_020871chrX52497 2204 1613 892 644 12131 21828 866 1530
NM_020917chr1973348 2816 1357 999 982 969 337 22801 2768 ----
NM_020918chr1063633 3497 1383 1353 1270 415 1668 --13258
NM_021038chr3103340 3253 3006 2942 2913 2877 2245 973 383 377 32285 2172 86 2711 697 --
NM_021072chr552111 1872 1827 947 888 --22511 676 1227
NM_021111chr931080 937 890 ----21253 1216
NM_021964chr386487 6158 5803 5668 5461 5039 1717 1682 46139 4618 4407 4384 25854 4936 --
NM_022483chr561610 1306 741 637 175 103 41459 1427 1372 115 ----
NM_022763chr363144 3100 2957 2065 847 459 1838 --13069
NM_022841chr1582430 2397 2332 2315 2163 1925 818 211 1467 12254 151
NM_024947chr3179574 9506 8997 8557 7707 7265 6779 6322 6110 6102 5975 3091 2277 1254 911 435 97 59597 9123 5956 3703 2228 38765 3415 974 23532 279
NM_024989chr2108144 6828 6633 6056 4988 3048 2986 2867 2075 777 36187 6029 982 37744 6352 2566 16653
NM_030627chr5104078 3830 3820 3618 2815 1530 1052 914 356 207 43930 3746 3668 1374 ----
NM_030647chr786227 5721 4190 2043 1590 1116 679 478 16141 --22114 953
NM_030648chr495608 5112 4902 3882 732 675 422 397 165 --35466 719 223 --
NM_030751chr1071597 1439 1320 1202 1164 476 57 --51541 1251 641 624 377 --
NM_030791chr1461825 1309 1278 1259 578 442 1327 1260 1377
NM_031438chr561853 1649 1429 750 600 429 1676 127 1568
NM_032047chr392369 2335 1833 856 711 592 390 304 228 1546 12284 --
NM_032373chr1075925 4216 3683 2326 1444 1162 864 35494 1909 1560 13718 --
NM_032457chr493827 3782 3727 3169 2850 1103 809 666 563 22924 2506 --11058
NM_032547chr451302 1212 1067 1023 1017 1297 1175 1207
NM_032869chr871840 1461 1426 1381 661 513 331 --11565 1409
NM_032968chrX154244 4218 3764 3658 3588 3488 3256 3119 3107 3004 2789 2610 1375 1094 611 24174 3580 14073 --
NM_032973chrY154236 4210 3756 3650 3584 3484 3251 3114 3102 2999 2784 2609 1375 1094 611 24166 3576 14065 --
NM_033224chr767120 6146 5459 3051 1922 1760 --11776 16071
NM_033285chr834413 3218 362 ----34151 1659 1077
NM_052832chr873051 2758 2699 2427 2380 310 286 --11971 12586
NM_052885chr1273786 3519 1964 1916 1134 1054 946 44696 3582 3287 280 --14841
NM_080764chr2283257 3196 2165 752 600 495 268 156 --22513 180 --
NM_080867chr1473913 1860 1526 961 882 532 353 13308 --1440
NM_080874chr451913 1219 224 166 156 41895 1624 390 332 --11881
NM_133334chr495382 5136 4490 4264 3861 1562 1281 550 117 16211 24686 600 24355 474
NM_133433chr54853 783 736 672 3833 702 644 --1225
NM_138286chr1964178 3914 3246 1671 1525 907 23352 845 12816 11064
NM_138459chr653663 2742 2260 1232 235 32439 933 877 12816 12531
NM_139321chr2021025 621 13009 --34128 4085 4052
NM_144578chr1495489 5248 4935 4318 4057 1805 1435 541 335 13988 21485 1342 24878 4717
NM_144599chr15105458 5365 5269 1266 1202 1067 1058 860 446 99 14879 11242 --
NM_144600chr1631363 574 63 --2206 40 21430 531
NM_144778chr1342392 1828 318 185 --21856 752 11814
NM_144973chr1295173 5100 4516 3739 1297 815 779 441 211 14212 35257 5188 481 1161
NM_145257chr1123929 3481 3314 3102 2972 2814 2623 1678 1670 1389 673 372 34182 3683 3305 24158 1516 --
NM_145307chr1053294 1717 1672 510 359 24030 3044 --13811
NM_152409chr543341 2943 2636 2375 23202 2442 22557 882 12755
NM_152641chr1232672 1780 582 1340 12630 32735 1114 893
NM_152723chr1141028 1010 152 146 2159 94 ----
NM_172071chr1136556 5902 5692 5644 5293 4795 2868 2580 2499 2478 2078 575 390 35420 1769 326 17256 --
NM_173468chr495745 5693 5231 4133 2273 1297 721 275 55 45479 1968 1224 69 ----
NM_173582chr11105982 5560 3812 2432 2077 2047 1183 496 464 80 55598 4264 2034 393 313 36310 1091 263 26234 251
NM_173829chr5136095 5879 5807 5709 4842 4049 4014 2285 1250 366 290 187 83 35838 2481 884 --15624
NM_175061chr751977 1822 605 317 305 12010 11697 22033 677
NM_175861chr1264887 1094 916 885 805 729 34813 1940 1847 21657 1214 --
NM_177968chr281759 1651 1416 884 545 516 506 246 1625 ----
NM_181358chr193947 3629 3453 1321 925 878 647 637 613 41624 904 685 594 33045 1390 401 --
NM_181723chr892112 1986 1519 1491 1421 891 676 492 319 22284 202 --1923
NM_182485chr4103739 3621 3510 3268 2595 2303 890 802 592 455 --1616 --
NM_194291chr882003 1886 963 472 299 273 209 147 --22457 127 --
NM_194314chr1105637 5495 5277 5120 4090 1348 744 686 628 287 32065 1921 1799 14009 14531
NM_198581chr2127542 7035 6192 5456 2218 2202 1887 1284 1215 736 555 545 56250 5969 5010 607 250 ----
NM_198715chr1116018 5795 5634 5620 5553 4379 4351 4248 2509 2235 1225 25667 5038 15311 13907
NM_198935chr2093155 2996 2714 2518 2454 2297 951 765 673 ----1227
NM_203406chr592738 2729 2233 837 723 673 663 566 500 32906 810 109 52827 882 877 404 368 --
NM_203459chr182408 2289 2157 1666 725 637 623 573 --1246 --
NM_213589chr285295 5228 4839 4043 2139 1818 1594 104 35511 4805 3642 1986 1431