TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-369-5p
miRNA Sequence: AGAUCGACCGUGUUAUAUUCGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001018065chr945825 5066 4398 4052 1248 --16036
NM_001024956chr1124989 1979 ----11113
NM_001042510chr811844 --1806 21564 98
NM_001149chr1021320 540 ----11407
NM_004852chr18712609 11699 10731 5457 3601 3195 2871 213232 2944 314089 12708 672 11027
NM_006252chr177222 6381 5957 4684 1037 1024 904 ------
NM_152608chr182391 1811 924 882 699 382 251 88 ------