TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3690
miRNA Sequence: ACCUGGACCCAGCGUAGACAAAG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX116910 6479 6387 6370 5764 5686 2600 2347 1723 986 750 25978 1872 ----
NM_000208chr1954346 4231 817 523 114 34492 3525 455 33594 3105 1272 --
NM_000217chr1294920 4696 4608 4484 4464 4294 2125 2115 2039 24191 3793 1292 --
NM_000332chr6107077 5615 2704 2409 2189 1664 1488 543 485 242 ------
NM_000368chr9103813 3016 1808 1135 1120 1074 565 544 385 89 23039 460 11637 24060 1197
NM_000555chrX117712 5534 4777 3152 3049 2143 993 903 541 248 26 37235 1129 979 15671 11879
NM_000615chr1152178 2021 542 424 359 1338 --1366
NM_000633chr1885238 3969 3574 3406 1542 1170 1050 180 13589 ----
NM_000719chr1286620 6465 5649 5249 4055 2384 1586 502 35890 460 168 24330 4243 --
NM_000831chr196191 6084 5091 5052 4037 2504 1922 1326 1204 25064 718 12024 --
NM_000875chr15155596 4751 4719 4588 2773 2173 2023 1905 1682 1324 1234 1012 642 521 376 ------
NM_000885chr222151 1772 31701 1654 1642 ----
NM_000912chr883260 3052 2692 691 463 303 220 59 ------
NM_001001481chr843240 1327 294 178 --1184 --
NM_001001664chr253713 1368 563 147 49 11623 13053 --
NM_001001890chr2143752 2935 784 53 ----24230 2675
NM_001001928chr22168325 8149 7698 7601 6929 6378 5853 2757 2469 1691 1547 1208 1142 1118 984 452 58077 5876 5188 3071 32 13345 12565
NM_001003652chr1862350 1929 981 624 407 194 12944 ----
NM_001003800chr942923 2354 874 121 43680 3170 1369 552 ----
NM_001007024chr1733341 3013 2840 2866 826 --31238 1188 1139
NM_001007025chr1733341 3013 2840 2866 826 --31238 1188 1139
NM_001007156chr1571942 1654 1646 741 376 96 74 --21754 1635 --
NM_001008408chr775975 5800 5356 4344 4015 1842 104 36295 5297 343 11747 --
NM_001010867chr196047 5735 5641 1940 1902 1365 841 501 339 1658 2415 67 24107 2397
NM_001011537chr332167 849 705 1328 --11758
NM_001012393chr1154839 4448 3384 1972 1759 25155 1598 ----
NM_001014797chr1097992 7274 6882 6469 6157 5809 5449 5201 2019 16834 ----
NM_001017440chr7107585 6563 6530 6151 5160 2295 1875 464 335 129 57631 6948 2740 2563 1204 17705 --
NM_001018050chr2273309 2431 2309 1375 1285 802 165 12792 12579 1755
NM_001018052chr2273309 2431 2309 1375 1285 802 165 12792 12579 1755
NM_001024680chr221315 323 1349 11327 11211
NM_001025077chr1065988 5783 2392 1892 1112 955 25910 997 11785 --
NM_001025079chr384087 3395 3136 2934 1453 797 330 307 13016 1353 --
NM_001025580chrX73300 2896 2845 1684 1091 521 75 ------
NM_001030055chr1474663 3769 1836 1497 489 71 65 1965 ----
NM_001033723chr862583 2418 1058 864 709 281 2735 126 --22060 702
NM_001034954chr1052629 2387 2259 930 642 1812 --1310
NM_001034955chr1052629 2387 2259 930 642 1812 --1310
NM_001034956chr1052629 2387 2259 930 642 1812 --1310
NM_001034957chr1052629 2387 2259 930 642 1812 --1310
NM_001039840chrX65736 5316 4361 3984 750 366 --11435 15936
NM_001040284chr1655681 5048 1514 424 102 21988 86 ----
NM_001042599chr277407 3060 2497 2473 1327 1260 995 22551 2051 --22261 975
NM_001100108chr1107383 7043 7023 5936 5880 5803 2678 2383 1342 1126 --22700 474 --
NM_001106chr3137537 7339 6948 6536 6499 6422 3892 3779 2950 2169 1903 1604 25 18363 11029 13058
NM_001173chr1474663 3769 1836 1497 489 71 65 1965 ----
NM_001219chr721689 556 1606 --1424
NM_001396chr2132546 2527 2437 --12733 11874
NM_001419chr1984212 3422 3236 1282 730 690 571 492 --13899 --
NM_001438chr143618 2565 891 855 23650 3394 ----
NM_001695chr863244 3207 2637 1246 808 451 1620 ----
NM_001754chr2143752 2935 784 53 ----24230 2675
NM_001777chr384087 3395 3136 2934 1453 797 330 307 13016 1353 --
NM_001938chr141683 460 205 123 11276 11829 --
NM_002006chr465243 5110 3655 3637 2162 1914 25503 741 ----
NM_002545chr1154839 4448 3384 1972 1759 25155 1598 ----
NM_002577chr364058 3159 3144 815 586 206 21045 828 ----
NM_002581chr9105029 4228 3987 1748 1697 1488 1241 1096 699 608 1794 --13750
NM_002613chr1695120 4938 4197 4185 4096 4036 3953 1814 212 21923 71 11936 --
NM_002645chr1142285 1018 1012 311 12863 ----
NM_002737chr1785082 2611 2368 1813 825 602 259 226 15118 25639 162 --
NM_002886chr374805 4236 4012 3326 1286 1016 185 23381 553 13612 1496
NM_003108chr296822 6305 5559 5229 2562 2455 1027 966 522 25245 2862 --12533
NM_003298chr394363 4319 4029 3985 2484 1591 1390 1006 696 21197 44 14925 --
NM_003413chrX31919 523 511 ----1140
NM_003468chr252864 2794 2716 668 638 --23903 361 11729
NM_003615chr32631 468 ----12905
NM_003644chr1796071 5450 4594 2288 2067 1803 1167 859 378 16615 --15784
NM_003663chr332801 1037 959 ----11132
NM_003713chr111221 ----2476 271
NM_004124chr1452601 1269 720 551 236 23409 2750 ----
NM_004274chr1482729 2705 2361 2258 1292 922 396 241 ------
NM_004504chr211955 22721 791 12679 12704
NM_004798chr2043394 1214 1152 534 ----13626
NM_004815chr174935 4119 3670 3440 1925 1087 272 13393 11443 --
NM_004871chr1733341 3013 2840 2866 826 --31238 1188 1139
NM_004992chrX158361 7755 6721 6506 6484 5841 5744 3262 2897 2803 2283 1714 1707 1312 155 16137 --12003
NM_004992chrX158361 7755 6721 6506 6484 5841 5744 3262 2897 2803 2283 1714 1707 1312 155 16137 --12003
NM_005036chr22168325 8149 7698 7601 6929 6378 5853 2757 2469 1691 1547 1208 1142 1118 984 452 58077 5876 5188 3071 32 13345 12565
NM_005156chr945307 4376 904 330 24143 234 ----
NM_005197chr1456047 5090 4390 4042 1588 24486 1865 1415 1938
NM_005235chr277407 3060 2497 2473 1327 1260 995 22551 2051 --22261 975
NM_005329chr1682336 1951 1870 1749 1488 833 767 603 ----1558
NM_005475chr1252362 1238 825 815 604 23034 2468 ----
NM_005840chrX76810 6223 2557 1309 891 445 256 26475 1405 ----
NM_005901chr1862350 1929 981 624 407 194 12944 ----
NM_005920chr173168 2955 2758 2569 2506 1250 992 ----11330
NM_006047chr2053420 3054 991 295 81 23110 1226 ----
NM_006095chr463735 3448 3088 818 562 542 1428 ----
NM_006371chr384656 4407 3911 3796 3733 1659 1350 1025 24240 785 14929 139
NM_006434chr1052629 2387 2259 930 642 1812 --1310
NM_006538chr273940 3635 3599 3218 3009 1084 785 34043 3526 1299 13364 --
NM_006546chr1765465 4337 4158 4086 337 280 26229 97 1814 131
NM_006614chr353450 1436 1333 216 188 ----1787
NM_006626chr942596 2407 1856 325 12478 12505 --
NM_006815chr12--21083 242 1911 21214 333
NM_006838chr1221436 1393 ----1232
NM_007007chr1263785 3737 3724 592 493 69 23590 1461 13639 --
NM_007011chr15115763 5161 2660 2494 1624 1418 1090 440 259 176 70 22232 1582 11735 --
NM_007038chr2166102 5969 4458 3902 1069 741 --13873 --
NM_007050chr20157700 7554 7210 7018 5780 5177 3038 2602 2531 1861 1741 1256 641 485 32 15922 12611 12218
NM_007249chr1398709 8469 7101 6150 3600 3568 3027 2740 2007 ----18918
NM_007350chr1224398 604 1268 1944 11079
NM_012193chr1164424 3660 3636 2039 1766 471 45224 3621 2052 308 1316 --
NM_012218chr1972365 2226 753 662 484 266 97 12691 21965 668 12184
NM_012287chr363442 3370 607 463 272 249 ------
NM_012294chr753347 2615 1023 484 289 --1542 1154
NM_012316chr175562 4295 4040 3817 3754 3748 3513 --23676 2014 --
NM_014028chr652671 2037 924 715 204 ----11209
NM_014048chr1674213 3442 1914 1772 934 527 178 --1704 --
NM_014155chr1135907 5789 4809 46363 5764 2289 1379 12031 --
NM_014331chr497152 7131 6218 4850 1306 1201 1094 613 81 1641 ----
NM_014388chr195865 5311 4938 4230 4004 3730 1212 1135 152 ------
NM_014701chr152703 89 21217 362 --1891
NM_014730chr12104787 4548 4344 4036 3689 3352 1777 1207 655 435 ------
NM_014730chr12104787 4548 4344 4036 3689 3352 1777 1207 655 435 ------
NM_014877chr1747585 7306 5344 1749 11668 --15369
NM_014906chr1764089 4040 3888 3331 2847 930 1145 ----
NM_014947chr122835 2517 ----22722 2527
NM_014982chr1433851 1273 1042 15161 --24413 971
NM_015064chr1253135 2951 2876 34 21 22793 235 1586 --
NM_015071chr576453 5702 5233 2262 1992 1929 420 32478 2362 1315 16391 --
NM_015077chr1784391 3587 1877 1657 1509 1470 839 622 14230 44308 3650 3523 3362 --
NM_015336chr1241677 626 404 350 22484 430 ----
NM_015365chrX73300 2896 2845 1684 1091 521 75 ------
NM_015385chr1052629 2387 2259 930 642 1812 --1310
NM_015458chr873755 3742 3423 1277 1214 758 372 14393 ----
NM_016019chr731009 843 694 --176 1685
NM_016206chr388731 8241 6544 5949 2669 1706 1631 582 48960 5843 2880 366 18016 --
NM_016231chr1711192 1459 --11318
NM_016258chr12747 220 ----1500
NM_016260chr276976 6129 6110 2892 1575 1381 377 ------
NM_016272chr2282512 2132 2110 1711 719 667 577 328 12379 --12073
NM_017415chr593963 3699 3484 3179 1238 774 738 523 500 ------
NM_017563chr356029 5763 4818 4415 4161 45898 5563 5445 2473 12464 --
NM_017637chr978481 6094 2985 1775 1558 1413 250 11240 18363 12249
NM_017658chr1443843 3029 979 913 23802 383 ----
NM_017712chr1986190 5132 2532 1754 1582 1442 1312 271 46317 6124 5622 5008 ----
NM_017813chr832342 818 703 25091 1764 --14780
NM_017919chr965541 3892 1958 1933 866 424 15504 14337 14639
NM_018027chr1082985 2617 2166 2078 2032 1027 507 63 11063 ----
NM_018133chr342120 1625 657 473 ----1412
NM_018247chr632872 2766 780 22221 431 22585 2505 --
NM_018299chr843240 1327 294 178 --1184 --
NM_018373chr1496392 6331 6140 5851 4270 3987 2436 2365 694 14494 1591 1795
NM_018590chr1031502 1382 326 ----1681
NM_018947chr784781 4734 4698 4605 3125 3063 1587 178 11025 --24994 3257
NM_020228chr1162413 2237 1728 1678 968 225 21808 1698 ----
NM_020336chr2053824 3789 3184 2469 784 1907 12678 1959
NM_020440chr152679 2413 1192 543 439 42430 2106 887 39 22275 785 --
NM_020717chrX64188 3948 3891 3878 1216 482 34437 4076 1908 1631 11052
NM_020718chr1652487 2447 2329 1999 1910 45607 5578 5027 2307 --1594
NM_020772chr1768560 8234 3062 2547 2023 1580 --11834 17887
NM_020853chr1241881 971 424 406 1231 12076 11013
NM_021097chr232167 254 233 12823 --12847
NM_021202chr2052642 1247 1232 1023 692 12348 11238 11194
NM_021238chr1241814 1538 546 408 ----11520
NM_021813chr685828 5209 4932 3770 1149 1129 294 44 --11850 --
NM_021815chr221232 397 ----1112
NM_021960chr12843 218 ----1538
NM_022048chr1574743 4497 4483 3903 1532 886 694 15969 1575 --
NM_022166chr1632244 2201 769 --36207 797 379 34445 2216 1122
NM_024665chr354722 4631 4496 3176 1575 ----14176
NM_024770chr296698 6617 5875 5766 2643 2394 613 442 170 14262 ----
NM_024947chr3117859 6569 6262 6185 5855 3596 3560 2465 772 455 80 12407 1749 --
NM_024991chr1052629 2387 2259 930 642 1812 --1310
NM_025134chr1662398 2218 867 861 645 522 11753 ----
NM_030648chr431757 1652 22 43910 3576 2014 1834 --13396
NM_030674chr1295652 4729 2036 1900 1810 1693 1088 615 390 25036 1014 ----
NM_030806chr1168163 7724 7391 6997 6817 6582 6487 6362 5935 5804 3081 2882 1869 1377 1205 457 22924 2003 66872 3365 2764 1861 1415 268 16112
NM_030918chr175090 4991 3457 1178 681 269 105 ----11499
NM_031268chr1695120 4938 4197 4185 4096 4036 3953 1814 212 21923 71 11936 --
NM_031468chr7107585 6563 6530 6151 5160 2295 1875 464 335 129 57631 6948 2740 2563 1204 17705 --
NM_032012chr984827 4476 3438 1119 775 583 208 56 131 --11635
NM_032105chr165207 3087 2638 1680 1506 47 37188 2220 571 11868 16168
NM_032288chr332167 849 705 1328 --11758
NM_033224chr787807 6935 6043 1627 1206 488 429 340 1717 36630 5153 547 --
NM_033225chr832725 2598 593 1263 --11235
NM_033285chr873977 3924 3881 3108 1246 1130 605 --1863 --
NM_053043chr775975 5800 5356 4344 4015 1842 104 36295 5297 343 11747 --
NM_080654chr112470 171 1480 --11183
NM_130436chr2132546 2527 2437 --12733 11874
NM_130438chr2143123 3104 3014 2235 --23310 2115 12451
NM_133170chr20157700 7554 7210 7018 5780 5177 3038 2602 2531 1861 1741 1256 641 485 32 15922 12611 12218
NM_133264chr1783569 3433 3195 3119 2628 1340 1292 769 11015 11380 --
NM_133443chr1632048 1975 1769 --12211 11896
NM_133445chr983810 3457 3036 2805 1368 423 193 185 33668 3534 1040 1112 --
NM_133634chr2141825 1229 591 368 ----21664 1299
NM_138338chr2273309 2431 2309 1375 1285 802 165 12792 12579 1755
NM_138426chr74945 882 507 408 1386 1835 --
NM_138473chr1253693 3215 3145 1929 1290 24511 804 14670 11120
NM_138621chr273940 3635 3599 3218 3009 1084 785 34043 3526 1299 13364 --
NM_144571chr455494 1885 520 433 107 14753 15750 --
NM_144578chr1464979 4206 2202 1189 1009 687 --14020 --
NM_144973chr1285310 4924 4330 3368 2016 1102 954 410 ------
NM_152384chr221267 221 ----71637 1588 1539 1461 1413 1364 1286
NM_152624chr577392 5958 5207 5107 4927 2151 217 11120 12326 --
NM_152838chr2053420 3054 991 295 81 23110 1226 ----
NM_152924chr15115763 5161 2660 2494 1624 1418 1090 440 259 176 70 22232 1582 11735 --
NM_173468chr456036 4656 2244 1231 773 11557 ----
NM_173851chr863869 3325 2990 2679 1327 1096 23690 1300 ----
NM_175736chr1275388 2248 1968 1107 567 411 400 --25633 1438 --
NM_177414chr111221 ----2476 271
NM_177966chr331508 666 112 ----11603
NM_178037chr1253135 2951 2876 34 21 22793 235 1586 --
NM_178038chr1253135 2951 2876 34 21 22793 235 1586 --
NM_178151chrX117712 5534 4777 3152 3049 2143 993 903 541 248 26 37235 1129 979 15671 11879
NM_178152chrX117712 5534 4777 3152 3049 2143 993 903 541 248 26 37235 1129 979 15671 11879
NM_178153chrX117712 5534 4777 3152 3049 2143 993 903 541 248 26 37235 1129 979 15671 11879
NM_181351chr1152178 2021 542 424 359 1338 --1366
NM_181521chr1696541 6534 6460 6307 4877 4791 4513 1998 1193 1667 --25718 993
NM_182526chr1493153 2416 2322 2116 2051 1100 1050 903 434 11953 1249 --
NM_182763chr12832 207 ----1527
NM_182970chr20104040 3406 3270 3065 2805 2615 966 641 369 261 33322 1438 629 21326 436 --
NM_194247chr233467 2994 402 --11208 23207 189
NM_198081chr672853 2639 2425 1940 1188 783 659 1627 ----
NM_198793chr384083 3391 3132 2930 1449 793 326 303 13012 1349 --
NM_198900chr1275388 2248 1968 1107 567 411 400 --25633 1438 --
NM_199437chr1162413 2237 1728 1678 968 225 21808 1698 ----
NM_199438chr1162413 2237 1728 1678 968 225 21808 1698 ----
NM_199439chr1162413 2237 1728 1678 968 225 21808 1698 ----
NM_201432chr1796071 5450 4594 2288 2067 1803 1167 859 378 16615 --15784
NM_201433chr1796071 5450 4594 2288 2067 1803 1167 859 378 16615 --15784
NM_206594chr143618 2565 891 855 23650 3394 ----
NM_206595chr143618 2565 891 855 23650 3394 ----
NM_213589chr273868 3553 1333 119 109 83 76 --11293 --