TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-373-5p
miRNA Sequence: ACUCAAAAUGGGGGCGCUUUCC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000168chr793015 2851 1348 1324 718 683 477 214 72 11187 22542 1108 22580 2567
NM_000216chrX93496 3423 2627 2562 1561 1061 821 474 416 --13078 --
NM_000232chr442979 2122 2080 1279 ----32298 2106 2063
NM_000314chr1062591 2312 2306 2131 1187 171 11109 --12332
NM_000332chr6136492 5754 5116 5101 4475 2842 2591 2181 2000 1704 1604 1202 1089 25437 5078 ----
NM_000337chr596260 6032 5830 5821 4214 2606 1474 670 48 15324 36013 5225 5183 25497 1771
NM_000408chr2103335 3254 3121 3061 2911 2842 2474 1287 964 341 11268 22130 1006 --
NM_000555chrX137813 7553 7042 6699 6197 6121 4923 2908 2455 1557 1178 235 130 ----11401
NM_000809chr4168936 8771 7552 7125 7002 6458 5976 5968 5614 3708 3004 2721 2568 2155 1722 1224 --28303 5777 25664 1283
NM_000813chr5125147 5133 5014 4880 2056 2018 1753 1355 899 634 539 156 14215 12147 --
NM_001001419chr5125179 5136 4918 4408 3803 3762 1905 1846 1756 826 799 64 33366 1374 1336 14047 --
NM_001001420chr5125179 5136 4918 4408 3803 3762 1905 1846 1756 826 799 64 33366 1374 1336 14047 --
NM_001001484chr1051933 1668 1530 610 553 --12102 1488
NM_001001890chr2163292 1679 722 658 535 428 13228 23274 667 23396 704
NM_001001928chr22127241 7169 7066 6983 6407 5864 2728 2398 1923 934 588 380 48282 6297 1979 630 27955 2913 --
NM_001001974chr1061988 1905 1595 532 514 302 --11500 32071 929 738
NM_001002860chr1494057 3995 3664 3414 3284 3092 1599 1571 1346 11698 14603 12929
NM_001003652chr18108717 6547 6152 5410 3280 3123 2166 1795 1571 600 --17258 --
NM_001005386chr252485 2379 2121 1992 854 22295 2115 2621 562 11790
NM_001007278chr1384928 4676 4085 4051 3717 1092 701 216 ----35299 3925 380
NM_001008925chr493503 3283 3026 2989 2316 1417 679 431 401 --21234 809 --
NM_001009899chr366383 5635 5052 4997 1497 971 14595 --24360 1894
NM_001010867chr156309 4886 1130 898 731 46338 4404 968 444 11245 25157 1998
NM_001010888chrX64407 3822 3525 1802 1796 1595 1999 13978 23914 429
NM_001011666chr764693 2414 1990 979 655 423 26117 6056 12129 11348
NM_001012755chrX65090 4974 4876 3558 1779 766 --12007 11198
NM_001013620chr12127155 7113 6399 5723 3171 2839 2458 2434 2227 2159 1538 1328 15640 22194 2181 --
NM_001014380chr1374787 4653 4397 3985 3705 1457 461 11025 --12263
NM_001015048chr1463163 2686 2378 393 149 23 33206 2915 669 23028 3007 --
NM_001015049chr1463163 2686 2378 393 149 23 33206 2915 669 23028 3007 --
NM_001017395chr393388 3224 2312 1366 1072 982 867 579 474 --22661 199 11031
NM_001018067chr175292 4423 3681 3463 1669 1575 1092 24846 1101 45395 4786 4640 558 --
NM_001018068chr175292 4423 3681 3463 1669 1575 1092 24846 1101 45395 4786 4640 558 --
NM_001018069chr175292 4423 3681 3463 1669 1575 1092 24846 1101 45395 4786 4640 558 --
NM_001024647chr12117261 6194 6162 5638 5087 2852 2632 1638 1001 948 578 57624 5174 2761 2176 2127 ----
NM_001024948chr163417 3380 3178 1230 909 192 21200 654 42767 2445 1351 671 1760
NM_001024956chr1174987 4736 3975 3796 1306 865 490 13573 --11885
NM_001025072chr341923 906 642 198 12528 --22198 1169
NM_001025073chr341923 906 642 198 12528 --22198 1169
NM_001025076chr1095407 4246 4212 4096 2022 1660 1493 1426 552 1476 35580 1504 648 21795 1679
NM_001025077chr10106765 5604 5570 5454 4749 4697 3018 2851 2784 1910 11834 36938 2862 2006 24960 3037
NM_001025580chrX84282 4058 3883 3586 2940 2629 1276 485 2877 500 21031 246 --
NM_001025595chr431155 1063 325 11176 31503 1122 1089 21359 229
NM_001029858chr653333 3160 3122 1135 264 12724 13149 21209 776
NM_001030055chr1474709 4157 3939 3503 2876 1060 419 13971 44306 3462 2894 1222 --
NM_001031804chr16134279 3956 3902 3860 3512 3308 1434 1427 1397 1321 1183 1036 824 --11110 --
NM_001033045chr254135 3900 2878 1684 1091 33097 1231 386 --14265
NM_001037165chr778131 7417 6622 2745 2733 2387 1610 58780 8383 7867 7832 3200 25593 652 26996 5690
NM_001039199chr20114954 4909 4282 3916 3502 1777 1573 1248 1115 891 284 44297 4255 3543 1298 1155 --
NM_001039547chr3157327 7216 6673 6025 6000 5181 3180 2518 2121 2054 1424 1254 980 482 275 48036 7415 5518 5293 --23204 2630
NM_001039590chrX63568 3355 2653 1506 1494 1340 --33737 2896 2805 --
NM_001039591chrX63568 3355 2653 1506 1494 1340 --33737 2896 2805 --
NM_001039618chr11135976 5451 5331 5104 4533 3885 2384 2361 1931 939 726 422 396 25756 1634 13936 14663
NM_001039840chrX75291 5096 3897 3720 2418 1172 417 21105 1084 --11003
NM_001039937chr1373044 2726 2638 1246 472 438 175 --23778 383 13396
NM_001040284chr16115325 5152 4357 4300 4186 2337 1938 1864 1403 1386 1210 24927 4887 14761 --
NM_001042599chr2187714 7487 7383 7364 7163 6957 6049 2955 2916 2728 2643 1635 1563 1136 1129 700 642 105 37643 5781 2177 15286 16545
NM_001042601chr343177 2801 2206 839 13088 --2295 211
NM_001042603chr12155311 4706 4621 4448 4270 4017 4010 3901 3558 2011 1865 1693 1291 736 241 122 23575 2003 --
NM_001106chr3189536 9160 9030 8809 7828 6843 6458 6362 6169 3251 3217 3120 2943 2903 2712 1405 183 74 1320 --17763
NM_001113490chrX62882 2681 2440 1080 648 181 11211 42969 2405 538 79 11457
NM_001167chrX86491 6393 6339 4432 2666 1090 1012 574 11722 --26621 1870
NM_001173chr1474709 4157 3939 3503 2876 1060 419 13971 44306 3462 2894 1222 --
NM_001204chr265814 4689 2674 2300 2239 618 14863 11277 26798 837
NM_001206chr972674 2157 1991 1100 841 780 281 --21166 273 1563
NM_001241chr221949 460 11572 11553 12264
NM_001241chr221949 460 11572 11553 12264
NM_001259chr7135765 5755 5326 5273 4356 4302 4048 2464 2295 1713 1006 806 172 --35952 1952 398 15159
NM_001304chr1783383 3247 3204 3192 2900 2630 1147 163 22718 113 23430 3234 --
NM_001390chr1883625 3588 3334 3173 2657 1008 905 726 21347 500 22695 2641 --
NM_001412chrX92910 2773 767 524 438 427 319 142 61 --22670 869 --
NM_001527chr6124864 4571 4525 4070 3867 3808 3780 3519 3375 1685 636 71 1481 14418 11099
NM_001616chr273153 2885 2444 916 804 288 239 --23373 2503 12286
NM_001695chr863431 2711 1631 887 797 692 1578 --12886
NM_001754chr2163292 1679 722 658 535 428 13228 23274 667 23396 704
NM_001759chr12105296 4771 4719 4527 3777 3583 3566 1935 1927 908 1530 --14648
NM_001806chr1982497 2128 1846 1131 999 838 826 727 --1571 1717
NM_001858chr685110 4889 3622 1753 909 490 457 186 ----1117
NM_001859chr964006 3514 2980 820 548 353 63642 3599 2582 2448 1033 909 --11312
NM_001918chr179047 9005 8486 7670 3658 2196 1097 87168 3294 2398 1653 1560 1071 374 334 23471 31 36914 6143 776
NM_002025chrX107503 7222 6032 3472 2637 1774 1460 1179 799 700 16790 ----
NM_002035chr18103932 3841 2929 2672 2572 1513 1340 1169 1153 75 13166 --13493
NM_002092chr4105069 4702 3922 3709 3212 3175 3119 750 744 120 34170 2020 197 24465 129 14544
NM_002126chr17124030 3320 2879 2565 1610 1492 1262 1204 1090 845 565 132 --13991 --
NM_002158chr263651 2743 850 573 136 129 --21136 945 12431
NM_002210chr253527 3366 3023 2694 2317 1900 --12461
NM_002214chr775092 3763 3747 3680 2098 992 973 24213 216 --11178
NM_002336chr12115029 4543 4093 3826 3578 3352 3209 1908 1854 1516 471 13112 13235 14054
NM_002387chr563970 2027 1623 804 705 378 ----23717 1713
NM_002481chr1127406 6517 6488 6310 5532 4976 4909 4816 2609 1622 951 101 27928 6152 27904 7843 15148
NM_002543chr1231525 180 38 ----31542 1411 600
NM_002577chr384030 3901 3557 3455 2501 1563 1478 340 21319 1092 33356 449 82 --
NM_002581chr975399 4561 4221 2260 2018 1546 1198 1570 24355 3470 14043
NM_002645chr1132906 207 199 21240 292 --22647 2045
NM_002886chr3145225 4967 4501 4470 4346 4046 3867 3511 3306 2008 1729 946 442 253 44056 3425 1912 86 23640 2001 13496
NM_002977chr273394 3070 2991 2963 1384 1229 258 --2540 70 --
NM_003034chr12107650 7573 5906 5617 5146 3235 2963 2831 2062 485 --22092 1039 --
NM_003099chr1585097 4373 2236 1767 1696 1446 1329 725 34522 2501 1909 --14482
NM_003108chr296631 6425 6041 5565 1044 920 653 501 211 56829 6674 6033 5041 4888 14655 --
NM_003144chr662192 2145 1544 609 428 332 ----21584 827
NM_003189chr142504 2240 1205 307 2321 141 23104 811 22938 2130
NM_003199chr18105612 5562 5422 4416 4100 2149 1924 1229 788 346 15648 11471 1935
NM_003262chr395263 3977 3777 3219 989 922 853 306 251 14424 11678 --
NM_003298chr3115882 5478 5365 5205 4256 3917 2198 1956 227 209 79 11532 22496 956 --
NM_003478chr11103319 3300 3214 2658 2204 2172 989 723 470 40 --12116 --
NM_003566chr1222824 136 --13254 22737 887
NM_003574chr1885120 5106 4617 3853 3692 1509 1481 1268 24660 2082 --22295 798
NM_003672chr15711 409 361 285 261 11637 --1592
NM_003774chr1293229 2485 2433 1320 1175 582 428 413 146 ------
NM_003958chr663931 2499 914 357 322 276 ----21294 409
NM_003966chr5116769 6584 5866 5574 5464 5246 5011 4914 4897 1799 748 17515 22044 285 11332
NM_004124chr14103543 3305 3089 2501 2350 2341 1358 713 432 357 13348 21399 1006 --
NM_004171chr11119441 8913 8452 8151 7499 6781 6053 3770 3313 1787 917 43197 2825 2416 1495 39496 8667 6681 --
NM_004331chr862364 1867 1725 1676 489 198 11834 --1799
NM_004397chr1184023 3779 3657 2657 1372 1059 578 102 --32760 681 59 11332
NM_004432chr981901 1649 1556 1505 964 718 538 479 1734 --1836
NM_004437chr1153137 2982 2902 1292 1253 1246 1219 1193 1036 881 842 669 657 591 191 12648 1263 21316 929
NM_004454chr3102152 1971 865 816 781 769 752 725 111 86 ------
NM_004464chr4114281 4128 3707 3633 1558 1233 1143 791 381 362 163 23060 1254 ----
NM_004485chr164362 3828 2845 1681 1070 410 ----32920 1312 570
NM_004612chr984624 4434 3765 3530 1936 1732 1327 776 163 11309 13479
NM_004719chr12102909 2693 2385 2326 2220 1877 1792 736 301 107 22154 810 12087 12634
NM_004725chr1061464 1190 1119 271 222 147 ----1260
NM_004726chrX124716 4462 3601 2172 1632 1621 1413 1402 677 581 66 57 11312 1750 11846
NM_004815chr1144815 4674 4339 4306 3819 3657 3517 3350 1768 904 840 372 177 80 21043 352 --14007
NM_004866chr5104094 4063 4056 3804 1931 1336 726 634 574 32 24136 1612 44856 3460 919 246 23137 1105
NM_004873chr1463163 2686 2378 393 149 23 33206 2915 669 23028 3007 --
NM_004904chr764693 2414 1990 979 655 423 26117 6056 12129 11348
NM_004956chr783686 3486 1436 1341 777 678 257 183 14555 1303 --
NM_004972chr921030 870 ----2837 309
NM_004985chr12104208 3480 3233 1432 1022 954 346 270 210 203 14027 31560 1256 761 --
NM_004999chr681495 967 960 952 495 451 177 139 13869 --1755
NM_005036chr22127241 7169 7066 6983 6407 5864 2728 2398 1923 934 588 380 48282 6297 1979 630 27955 2913 --
NM_005056chr12165555 4950 4865 4692 4514 4261 4254 4145 3802 3478 2255 2109 1937 1535 980 485 1266 23819 2247 --
NM_005063chr1023808 2909 13690 53484 3203 2515 1458 921 13518
NM_005065chr1474130 3364 1811 1519 785 507 324 23737 2056 25219 5032 --
NM_005156chr9105117 4522 4026 3667 3321 1345 1231 1158 946 325 14111 --25060 1276
NM_005164chr1272607 2500 2106 951 600 402 369 ----1985
NM_005188chr1167944 6019 5670 2440 1827 867 21344 898 42715 2553 2317 2064 --
NM_005207chr2273621 3257 3051 2400 516 505 224 --13691 1590
NM_005235chr2187714 7487 7383 7364 7163 6957 6049 2955 2916 2728 2643 1635 1563 1136 1129 700 642 105 37643 5781 2177 15286 16545
NM_005359chr18166553 6425 5938 5923 5621 5369 5337 5217 4858 4805 4633 4257 4110 1151 1060 953 --25703 1367 22577 2094
NM_005596chr976265 6039 5458 5444 1814 1762 978 --11007 12438
NM_005722chr252485 2379 2121 1992 854 22295 2115 2621 562 11790
NM_005759chr264061 3831 3762 1737 1562 131 13523 1894 14328
NM_005798chr1384928 4676 4085 4051 3717 1092 701 216 ----35299 3925 380
NM_005901chr18108717 6547 6152 5410 3280 3123 2166 1795 1571 600 --17258 --
NM_005903chr5125179 5136 4918 4408 3803 3762 1905 1846 1756 826 799 64 33366 1374 1336 14047 --
NM_005935chr494727 3582 3482 1429 1322 1198 1178 970 442 --23962 477 1485
NM_005955chr1135507 5408 5209 5119 5043 4787 4622 4552 4502 4195 2159 1027 434 ----11862
NM_005999chr131526 1255 229 1582 --21499 35
NM_006007chr954011 2890 1678 887 154 43648 3228 1726 1702 33807 3433 3057 1341
NM_006139chr282843 2822 2492 1146 813 619 433 409 1865 --1169
NM_006166chr1282329 2099 2028 1859 1737 530 449 420 22114 2073 1716 11886
NM_006203chr544904 4411 4302 3835 ----25593 3633
NM_006206chr4102766 2431 2275 1853 1817 1160 776 609 512 173 ------
NM_006252chr1137075 6960 6594 5886 5867 5684 5382 5203 4843 3022 2225 2004 74 44900 2786 1730 1706 11863 22123 1894
NM_006282chr2073381 2946 1779 1266 880 684 44 34677 664 580 --13051
NM_006283chr883710 3216 1969 1789 663 623 353 276 11767 --1957
NM_006306chrX24106 104 25773 712 14602 21684 1472
NM_006393chr10104467 4097 3971 3868 3462 1737 1359 1166 947 22 24452 3731 1433 --
NM_006544chr1486067 5911 4706 4412 1906 1598 1347 162 35229 2102 907 14488 26129 5216
NM_006547chr741649 771 613 146 --21499 763 11355
NM_006561chr1095407 4246 4212 4096 2022 1660 1493 1426 552 1476 35580 1504 648 21795 1679
NM_006572chr1753205 2402 2283 708 43 23316 1085 32245 2169 1172 --
NM_006599chr16167886 7816 7337 7055 5915 5589 2765 2192 1954 1919 1891 1512 1440 423 243 113 36083 5715 5204 11360 --
NM_006628chr15104177 3877 3788 1843 1522 1109 1029 403 311 167 1100 12844 13453
NM_006629chr1872745 2291 2119 1091 856 147 133 1108 11077 12544
NM_006729chrX55260 4740 1891 1833 515 11950 15084 2795 59
NM_006731chr94502 282 258 35 25825 5048 45011 4085 3560 1884 --
NM_006775chr692879 2501 2474 2451 2229 2198 978 645 211 --22984 2942 --
NM_006777chrX52635 2320 869 818 33 --31891 951 175 12191
NM_006915chrX42389 2124 1597 969 --11725 1376
NM_006918chr1174987 4736 3975 3796 1306 865 490 13573 --11885
NM_006924chr17124419 3953 3727 3450 3409 3347 3012 2713 1681 1631 1387 1352 --11275 --
NM_006963chr1021202 440 --2342 245 2323 29
NM_007006chr16113484 3380 3157 3080 2624 2194 1188 1013 895 796 94 ----13433
NM_007007chr12114845 4249 4094 3567 3044 1819 1597 1064 917 636 564 11411 ----
NM_007011chr15116823 6674 6589 6313 4631 2740 2453 1689 1327 741 536 11075 26635 1186 --
NM_007038chr21105409 5140 5072 4570 2064 1856 1640 1319 652 625 35997 1895 1519 14953 --
NM_007114chr362455 2228 788 673 611 201 11237 --12842
NM_007124chr661948 1552 1435 1390 1291 476 --11269 1741
NM_007249chr1388518 8131 5794 3183 2765 2679 2579 156 27660 2846 --11781
NM_007345chr1882187 2037 1892 1821 1480 1452 920 506 --12305 --
NM_007350chr1242948 1165 840 306 --34600 562 34 11683
NM_007373chr1031542 722 520 1458 11622 1451
NM_012081chr582848 2758 2599 1436 1416 1320 1083 409 13485 13608 11021
NM_012096chr332802 2368 1016 ----32934 2587 2391
NM_012141chr1373044 2726 2638 1246 472 438 175 --23778 383 13396
NM_012164chr9117073 6241 6098 5781 5609 5460 4911 2813 2168 404 33 --2272 55 12222
NM_012214chr2105897 5483 5046 4177 3961 2067 1053 515 498 256 34986 1298 310 1353 12552
NM_012262chr174943 4206 3724 3409 1132 408 335 ----14851
NM_012297chr472587 2419 2023 1864 304 102 75 --21927 1896 --
NM_012300chr51484 1194 1421 21847 578
NM_012330chr1071584 1399 1392 712 695 563 207 11733 --11339
NM_012334chr5104017 3628 3299 3211 1763 1467 1459 952 790 505 12991 ----
NM_012388chr15112959 2729 2610 2525 2371 2244 527 490 235 181 43 32704 1946 1022 33142 3085 819 --
NM_013231chr1463571 3088 2805 1409 931 913 ----22838 1599
NM_013255chr7147969 7063 7041 6893 6508 5991 5566 3184 2744 2089 1033 745 394 56 57399 5857 5804 3420 946 26247 1512 --
NM_013302chr1694686 4063 3096 1877 1581 1388 1044 143 87 23576 3126 34551 4014 219 1306
NM_013943chr193122 2980 2861 2737 2638 2218 2133 2111 444 22403 1151 1344 --
NM_014155chr11117032 7011 6674 6488 6061 2567 1202 848 734 304 70 --17503 --
NM_014181chr242631 1986 765 600 11946 22590 2029 1743
NM_014331chr4117731 7688 6313 6304 3058 2586 2411 2067 1888 1792 1024 26388 1385 15575 14909
NM_014388chr196112 4537 1621 1195 1156 785 501 452 192 1835 --11931
NM_014447chr431154 1062 325 11175 31502 1121 1088 21358 229
NM_014701chr1573194 2753 2432 2369 2093 404 307 1905 --12313
NM_014730chr12134512 4391 3940 3695 3372 3306 1756 1217 1124 870 726 606 65 23215 1798 24615 1658 --
NM_014730chr12134512 4391 3940 3695 3372 3306 1756 1217 1124 870 726 606 65 23215 1798 24615 1658 --
NM_014739chr683909 3039 2793 1363 1057 944 745 484 --14048 1631
NM_014746chr244394 4198 1518 661 ----23128 1062
NM_014774chr1103230 3187 3167 3054 2914 2509 2503 2125 1013 503 12385 1290 --
NM_014830chr1263647 3350 2771 1486 839 594 1649 1252 2456 265
NM_014873chr164793 3907 3739 1511 954 931 44784 4100 1658 146 13155 21757 737
NM_014877chr17187635 6550 5304 5054 4832 3062 2711 2633 2532 1468 1247 1049 972 945 705 666 534 191 35192 5096 1628 --27359 6508
NM_014897chr1792639 2218 2168 2125 2057 1284 1017 873 450 --22478 1161 --
NM_014906chr1763825 3755 3203 1565 1224 724 23520 696 34035 2959 501 --
NM_014912chr1093441 3395 2914 2429 2333 2204 645 570 380 ------
NM_014918chr1531361 1285 77 --11378 2596 278
NM_014923chr1351946 1909 938 670 314 ----12200
NM_014942chr652638 2334 2048 898 882 21660 841 2552 221 12646
NM_014947chr162865 2756 2350 2268 663 129 ----1929
NM_014950chr1421607 1559 ----21435 1112
NM_015008chr393388 3224 2312 1366 1072 982 867 579 474 --22661 199 11031
NM_015017chr151263 1257 1131 898 871 ----21038 239
NM_015035chr20146709 6164 4889 4873 4609 4370 4364 4159 2658 1900 1867 1731 1589 1302 25305 1007 16323 --
NM_015045chr1062240 1935 1740 1443 639 541 1736 1848 1666
NM_015176chr151666 1512 1104 640 500 --21219 242 11328
NM_015206chr1583343 3016 2928 1455 1426 1103 1015 327 22919 1507 ----
NM_015265chr262680 971 607 566 159 111 --31703 695 102 --
NM_015271chr474226 3845 3586 3052 1629 1616 492 --12645 21489 764
NM_015310chr8108082 8030 6968 5607 5506 3264 3087 2358 1850 280 36683 6484 2625 37917 5977 5123 --
NM_015313chr11124519 4513 4496 4243 3769 3493 3210 2931 1494 826 287 253 31894 1433 1040 13017 --
NM_015365chrX84282 4058 3883 3586 2940 2629 1276 485 2877 500 21031 246 --
NM_015412chr341923 906 642 198 12528 --22198 1169
NM_015554chr1531940 868 704 ----2857 842
NM_015569chr194772 4173 4027 3631 3172 1271 904 262 176 --14607 13453
NM_015640chr175292 4423 3681 3463 1669 1575 1092 24846 1101 45395 4786 4640 558 --
NM_015886chr895450 5369 5296 4993 3945 1928 1298 853 622 24230 2299 --15468
NM_015906chr194828 3883 3689 3108 3012 1745 1000 390 250 1852 11122 --
NM_015975chrX31858 500 460 --149 21289 261
NM_016021chr663023 2721 2662 2251 323 121 ----32750 2693 832
NM_016206chr3118309 7404 6497 6196 5648 2802 2696 2682 1371 709 296 13555 21791 447 28118 3310
NM_016248chr13102788 2619 2577 2495 1383 1011 881 546 479 39 13882 21446 891 --
NM_016260chr297060 5542 5014 2841 2671 2309 2218 1665 710 1868 --32485 2151 2005
NM_016271chr1881740 1528 1452 551 380 314 288 128 22334 1932 ----
NM_016287chr162086 1840 1631 604 584 79 1548 --21659 736
NM_016507chr17113110 2783 2708 2460 2240 2105 1949 930 866 485 423 --2445 391 23021 2424
NM_017420chr1483518 3323 2909 1397 1320 907 666 28 ----1516
NM_017447chr21134257 3851 3522 3169 3153 1687 1600 1587 966 603 472 202 192 12675 ----
NM_017563chr3116284 6214 5379 5324 4309 2265 2039 1245 992 542 501 ----25732 1505
NM_017580chr1072400 2346 2141 1684 656 650 638 ------
NM_017594chr982921 2686 2569 2184 2124 1060 802 419 ----12484
NM_017637chr9119386 8292 7342 6799 5703 3318 2591 2472 488 348 194 ----1225
NM_017650chr785819 5304 5024 4385 3765 3719 2374 1109 12072 11561 11316
NM_017658chr14144389 3759 3476 3343 3330 3072 1511 1157 1005 971 820 636 510 167 ------
NM_017754chr675022 4936 4604 3439 1569 1063 269 34191 1852 968 --1577
NM_017902chr1065546 5401 4845 4653 3503 280 24363 617 25186 1752 25478 1904
NM_017944chr1173001 2453 1234 979 173 80 37 --12389 11074
NM_018126chr431147 529 439 ----2412 185
NM_018155chr393350 3270 3106 2799 1164 1099 861 576 518 3998 664 103 1905 --
NM_018323chr471543 1359 718 595 570 378 132 ----21624 1462
NM_018373chr14105268 5168 4677 2513 2421 1595 1187 1035 984 254 44013 2538 2162 1318 12044 25433 5316
NM_018374chr795034 4907 4269 1592 1181 1037 919 633 337 34052 3310 356 ----
NM_018440chr8138438 8126 3380 3275 3071 2931 2811 2741 2193 1804 1172 1139 681 36216 6176 2525 27322 7207 --
NM_018566chr174999 3661 3424 1929 1488 1176 1032 --33872 452 345 13365
NM_018638chr12175651 5291 5009 4946 4519 4260 4076 3924 2230 2103 2030 1833 1569 1327 890 856 153 --1620 12269
NM_018999chr1064642 4459 3855 2995 1483 915 14630 --21920 1791
NM_019072chr544270 4158 625 219 --14237 21345 394
NM_019084chr1062323 1888 1853 1020 493 438 ----32406 2196 317
NM_020133chr6116066 5643 5436 5134 4841 4667 4647 4328 2358 1931 1423 26324 4691 ----
NM_020141chr142226 1622 1599 398 31833 1770 656 --12068
NM_020205chr193338 2978 2583 2310 2218 1224 1116 873 240 22851 700 12765 13052
NM_020390chr363581 3504 1882 1247 521 195 --34471 3653 1542 1935
NM_020432chr731521 633 476 --1800 21943 1851
NM_020640chr3101940 1608 1447 877 868 820 517 511 431 187 --21891 314 --
NM_020651chr271689 1583 1487 1369 1312 286 224 --1238 --
NM_020673chr20127366 7058 6911 5786 5704 5475 5464 4711 2619 2608 843 240 ----15980
NM_020718chr16115495 4998 4857 4705 4694 4618 4144 4094 1917 1224 341 14846 24179 103 14821
NM_020772chr17118040 7470 7197 6361 5920 3391 1975 1632 1539 1243 505 12799 22749 1587 25824 2598
NM_020774chr18115987 5947 5566 4900 4731 4143 3880 1758 1342 1260 64 15098 36171 3831 2243 --
NM_020810chr1453534 2511 2423 1036 281 --23009 912 13090
NM_020830chr263135 3059 2356 1230 990 983 --21147 154 13290
NM_020844chr8127333 7273 7229 5866 5846 5278 2815 2584 1867 1834 1769 159 26188 709 --37704 6553 2021
NM_020921chr1473352 3204 2564 713 461 310 290 22643 367 13418 12361
NM_021033chr1393342 3315 2942 2756 2132 1288 1260 1107 172 --22772 2273 --
NM_021097chr253085 2790 497 435 293 ----22598 373
NM_021148chr772022 1762 810 804 753 694 282 --1817 1849
NM_021163chr793701 3485 3044 2979 1078 932 805 597 261 23774 2439 13496 --
NM_021238chr1271865 1795 1718 1380 727 361 51 ----2609 93
NM_021622chr1061988 1905 1595 532 514 302 --11500 32071 929 738
NM_021629chr3134068 3911 3903 3643 3529 3401 1712 1688 1472 769 666 616 220 33547 3228 1754 24352 382 13081
NM_021911chr5125147 5133 5014 4880 2056 2018 1753 1355 899 634 539 156 14215 12147 --
NM_021914chr1451897 1740 1692 735 80 32249 1819 955 --1795
NM_021961chr1157418 5458 2640 590 158 36355 5016 1446 11539 15081
NM_021964chr3144835 2518 2167 2121 2087 1786 1627 1470 1463 1442 1034 948 796 580 --14212 --
NM_021977chr643583 1369 1088 750 43096 1378 741 384 11475 13823
NM_022048chr15116134 5317 4618 4599 4573 2312 1933 1753 1399 676 95 12442 24697 842 --
NM_022340chr383633 3006 2539 1342 1081 278 159 26 32742 2702 813 --22292 1394
NM_022456chr12117261 6194 6162 5638 5087 2852 2632 1638 1001 948 578 57624 5174 2761 2176 2127 ----
NM_022459chr13106043 5479 5216 4859 4242 4236 1699 554 113 106 15544 11073 --
NM_022781chr993307 3095 2995 2943 2924 2737 2391 1331 30 12438 12844 12352
NM_022898chr1494423 3689 1659 1626 824 598 445 420 255 --44730 3807 969 612 11870
NM_024423chr1893657 3574 3522 3450 3040 1664 1156 624 327 11718 ----
NM_024524chr373205 2859 2321 2276 2248 1989 1115 --1969 1344
NM_024665chr384739 4352 3304 800 594 487 327 261 --21694 990 1836
NM_024761chr975225 4914 4827 4538 1764 1251 443 23940 1724 14126 23669 351
NM_024770chr255216 4781 985 681 521 25935 1953 14367 21432 308
NM_024818chr351467 1142 283 275 133 ----11296
NM_024831chr81536 ----2239 163
NM_024884chr1474341 4095 3925 3831 3441 1422 1295 2407 370 34284 3753 1520 --
NM_024947chr3188960 8916 8650 7171 6520 5927 3686 3603 3443 3305 3024 2754 2305 1733 1385 722 685 368 11509 16314 28069 7319
NM_024989chr2158162 8087 7654 7515 6975 6638 5147 5014 2701 1650 1569 520 407 218 157 26762 1750 --12195
NM_025054chr864134 1567 1442 917 867 711 13703 13337 13050
NM_025073chr154599 4477 3581 3501 311 24347 571 --13880
NM_025146chr372649 2530 2320 2076 737 640 435 1453 11719 11069
NM_025160chr164287 3533 3463 2730 1190 1035 --13584 11355
NM_030627chr593754 3597 3420 3320 2661 1141 1042 991 920 13564 2635 337 --
NM_030650chr283429 2805 1624 1459 645 409 332 212 11106 11513 --
NM_030664chr1051933 1668 1530 610 553 --12102 1488
NM_030755chr14113125 2852 2609 2435 961 897 823 294 224 92 36 11970 --12455
NM_030806chr1119429 9349 9308 6732 6180 2907 2167 1894 1741 1467 714 17312 22220 1761 --
NM_030912chr106829 604 169 157 151 139 ------
NM_031296chr462596 1733 1707 764 50 32 12614 --1801
NM_031427chr1485452 4842 4480 4023 3733 2164 1073 781 24171 1562 13870 1971
NM_031453chr1052461 2322 2311 646 112 --1482 11747
NM_032012chr9115283 5068 4919 4752 4246 4094 3840 3626 3380 1906 1763 34397 4361 1499 1464 --
NM_032102chr1173088 2363 1080 1042 952 301 260 12055 12990 11098
NM_032116chr1374787 4653 4397 3985 3705 1457 461 11025 --12263
NM_032160chr1864140 3473 3361 2935 1166 443 --1609 13627
NM_032199chr1083874 3809 3607 2742 1472 1363 770 486 --31285 760 703 --
NM_032228chr1173563 3142 2518 2347 1037 820 707 22196 677 1243 13261
NM_032440chr1062953 2796 2630 2609 1991 1904 42260 2219 746 544 12846 --
NM_032446chr5123695 3509 3003 2772 2584 2572 2390 1400 1266 977 852 119 11025 ----
NM_032457chr453047 2749 2605 1315 1051 --21540 1450 21344 578
NM_032892chr154320 294 287 281 ------
NM_032900chr10113827 3458 3447 2597 2469 1261 537 494 431 324 110 1545 22426 415 --
NM_032975chr1883625 3588 3334 3173 2657 1008 905 726 21347 500 22695 2641 --
NM_032980chr1883625 3588 3334 3173 2657 1008 905 726 21347 500 22695 2641 --
NM_033020chr194828 3883 3689 3108 3012 1745 1000 390 250 1852 11122 --
NM_033143chr4104612 4459 4038 3964 1564 1474 1122 712 693 494 23391 1585 ----
NM_033224chr797087 6512 5513 2828 2099 1770 1724 878 481 37613 6500 5073 57413 7126 6038 3167 2194 27865 6605
NM_033360chr12104329 3601 3354 1553 1143 1075 467 391 331 324 14148 31681 1377 882 --
NM_033389chr17144508 3940 3665 3634 3093 3004 2946 1828 1236 1104 954 655 139 104 13198 14712 --
NM_033505chr2105356 4897 2660 2039 1999 1312 1044 901 213 160 36322 5049 658 25905 2467 --
NM_033644chr51484 1194 1421 21847 578
NM_033645chr51484 1194 1421 21847 578
NM_033656chr21115576 5447 4613 4576 2335 2194 2060 2042 1681 695 236 35593 3875 3850 35845 5639 220 --
NM_052811chr1384928 4676 4085 4051 3717 1092 701 216 ----35299 3925 380
NM_052879chr1273549 958 649 398 273 137 75 11182 33579 2998 314 --
NM_052932chr1182481 1980 1621 272 183 177 94 59 --2671 388 --
NM_052937chr872399 1932 1826 1808 1081 1025 603 12678 12233 --
NM_053016chr966620 6458 5535 1927 1545 1330 26491 6368 35148 5020 2940 --
NM_058241chr221849 360 11472 11453 12164
NM_058241chr221849 360 11472 11453 12164
NM_080743chr651744 892 677 352 116 41864 1824 968 688 12117 1662
NM_080832chrX61762 580 207 119 104 53 ----1396
NM_130446chr3104266 4195 3619 3137 1737 1440 993 162 137 101 12861 --11136
NM_133265chrX62882 2681 2440 1080 648 181 11211 42969 2405 538 79 11457
NM_133477chr452972 2754 944 304 99 --22912 957 1548
NM_133493chr663889 3583 3050 1522 258 92 1911 13208 14499
NM_133646chr2105609 5550 5294 4842 4535 4462 3680 1633 1453 378 23825 3654 14921 --
NM_138444chr13134554 4172 3512 3116 3051 3031 1352 1321 1283 1097 618 526 516 14821 24376 1210 --
NM_138468chr296042 6002 5922 4300 2249 1351 1277 479 433 32224 1397 537 22156 515 --
NM_138473chr12105129 4916 4621 4042 3914 3862 3660 3633 1227 1178 23958 684 13533 15108
NM_138576chr1494423 3689 1659 1626 824 598 445 420 255 --44730 3807 969 612 11870
NM_138638chr1451897 1740 1692 735 80 32249 1819 955 --1795
NM_138713chr16167886 7816 7337 7055 5915 5589 2765 2192 1954 1919 1891 1512 1440 423 243 113 36083 5715 5204 11360 --
NM_138714chr16167886 7816 7337 7055 5915 5589 2765 2192 1954 1919 1891 1512 1440 423 243 113 36083 5715 5204 11360 --
NM_138959chr1116561 5572 5514 5091 5025 4232 4217 4205 2701 2277 1214 26270 5592 16742 11898
NM_139281chr5113614 3567 3398 3233 3167 2565 2440 2202 1061 335 254 11096 21076 434 --
NM_144571chr4116916 6229 5191 4486 4362 4249 1895 1071 470 342 294 11054 56158 2714 2589 2154 661 25898 2275
NM_144578chr14145481 5414 4355 3944 3744 3447 2044 1974 1606 1454 1382 817 509 38 64740 4694 2151 2071 1653 778 1461 12103
NM_144664chr1152405 2287 1963 1685 44 1834 --1455
NM_144973chr12114743 4600 4293 4194 3525 3467 3363 3244 1229 784 587 35317 1671 795 ----
NM_145259chr296495 6435 6392 6015 5309 4522 2450 1498 217 24802 1992 12526 11110
NM_148955chr1585097 4373 2236 1767 1696 1446 1329 725 34522 2501 1909 --14482
NM_152265chr181207 1022 283 273 245 238 228 198 ------
NM_152407chr5102533 2409 2321 2307 2300 2293 2286 795 400 110 1649 ----
NM_152529chr254135 3900 2878 1684 1091 33097 1231 386 --14265
NM_152556chr7102352 1951 1876 1870 1838 1828 1008 1000 844 715 ------
NM_152624chr5197318 7307 6949 6221 5842 5429 5421 5148 2393 2176 1871 1626 1538 1270 1220 758 475 243 53 46594 5558 2516 2374 45673 5458 5185 668 16660
NM_152699chr3103766 3637 3256 3037 2657 2583 556 465 399 326 1639 12997 12699
NM_152754chr793840 3762 3407 3131 3119 2938 1203 876 275 13667 1269 23683 2847
NM_152756chr533992 2982 1406 23293 1475 1207 11304
NM_152787chrX62912 2842 1457 1438 505 41 13708 --13873
NM_152826chr1585097 4373 2236 1767 1696 1446 1329 725 34522 2501 1909 --14482
NM_152835chr172847 2621 2470 2021 1069 949 505 ----1514
NM_152924chr15116823 6674 6589 6313 4631 2740 2453 1689 1327 741 536 11075 26635 1186 --
NM_153207chr1263991 3227 1349 1127 770 267 --23983 862 13966
NM_153607chr583015 2530 2471 2431 1246 1072 738 290 --23038 614 --
NM_153689chr242280 1630 884 459 --4834 395 108 54 11752
NM_172069chr252198 2174 1954 1572 758 11615 11871 11910
NM_172071chr1147426 7031 6672 6639 6246 2759 2632 2541 2410 2208 2032 2014 716 385 1661 26453 1602 27223 6323
NM_172373chr1331332 1067 132 ----2968 243
NM_173214chr16167886 7816 7337 7055 5915 5589 2765 2192 1954 1919 1891 1512 1440 423 243 113 36083 5715 5204 11360 --
NM_173468chr4115452 4879 4822 4471 3941 2439 1914 729 246 126 108 ------
NM_173470chrX51148 366 355 273 58 ----22891 1998
NM_173582chr1174301 3817 2454 1536 1002 575 141 45134 1627 1314 1276 25910 1234 --
NM_173808chr154405 3463 1476 453 175 33136 1703 792 13168 13119
NM_175623chr12117261 6194 6162 5638 5087 2852 2632 1638 1001 948 578 57624 5174 2761 2176 2127 ----
NM_175854chr1352658 2026 1863 1831 1115 197 42634 2389 2009 897 2439 382
NM_175861chr12105268 4843 4712 4495 2309 2068 1440 1424 924 813 --24441 603 31087 308 138
NM_177538chr278184 7032 6834 3506 2661 2642 2236 167829 7073 6589 6549 5426 5384 2728 1927 1888 1541 1281 831 695 558 462 422 28867 5912 28315 6114
NM_178151chrX137813 7553 7042 6699 6197 6121 4923 2908 2455 1557 1178 235 130 ----11401
NM_178152chrX137813 7553 7042 6699 6197 6121 4923 2908 2455 1557 1178 235 130 ----11401
NM_178153chrX137813 7553 7042 6699 6197 6121 4923 2908 2455 1557 1178 235 130 ----11401
NM_178313chr242146 148 60 52 --11894 1588
NM_178509chr17104104 3597 3182 2885 2726 1030 457 234 160 140 ----11471
NM_181521chr16126736 6328 6279 5978 5584 4994 2802 2696 2585 1068 736 203 34921 4681 1832 37037 6857 5971 1131
NM_181705chr545740 4920 4641 4502 53894 3854 1877 1476 322 11199 12255
NM_182493chr16105139 4726 4289 4043 4035 3974 588 408 256 95 23369 1154 11550 35165 1737 520
NM_182503chr6135598 5466 4686 4215 3868 3490 1975 1899 1725 1220 1194 956 248 12055 ----
NM_182515chr19136493 6217 6016 5957 5891 5615 4447 2535 2119 1587 1116 792 446 36711 4584 872 --11731
NM_182762chr776107 5652 5104 5074 4548 1349 21 66049 5733 5436 4919 2018 904 13849 22500 1845
NM_182898chr764693 2414 1990 979 655 423 26117 6056 12129 11348
NM_182899chr764693 2414 1990 979 655 423 26117 6056 12129 11348
NM_183078chr663837 2405 820 263 228 182 --11517 21200 315
NM_194291chr862954 2903 2594 2588 1996 727 --21830 757 1451
NM_194314chr185356 3996 2226 2128 913 582 384 29 14353 24680 3850 --
NM_194328chr993307 3095 2995 2943 2924 2737 2391 1331 30 12438 12844 12352
NM_194329chr993307 3095 2995 2943 2924 2737 2391 1331 30 12438 12844 12352
NM_194330chr993307 3095 2995 2943 2924 2737 2391 1331 30 12438 12844 12352
NM_194332chr993307 3095 2995 2943 2924 2737 2391 1331 30 12438 12844 12352
NM_194434chr1885120 5106 4617 3853 3692 1509 1481 1268 24660 2082 --22295 798
NM_198128chr1881740 1528 1452 551 380 314 288 128 22334 1932 ----
NM_198329chr351467 1142 283 275 133 ----11296
NM_198484chr386087 5583 4839 2507 1888 1543 1233 366 56068 5224 5184 1590 799 --172
NM_198513chr851857 1315 794 340 85 ----11388
NM_198581chr266784 5643 5315 4588 1235 398 26826 4854 25891 1654 46442 5483 5157 385
NM_198715chr1165779 5700 4952 4584 4407 4324 2502 1706 1501 1349 926 897 783 683 116 36 16229 14315 11108
NM_199072chr772796 2080 1256 1152 1095 380 247 12012 156 22141 459
NM_199188chr1273549 958 649 398 273 137 75 11182 33579 2998 314 --
NM_199190chr1273549 958 649 398 273 137 75 11182 33579 2998 314 --
NM_199324chr493567 3393 2569 2295 1364 813 684 677 154 --12523 --
NM_199355chr162322 305 175 --21720 1288
NM_201624chr151263 1257 1131 898 871 ----21038 239
NM_203342chr1153137 2982 2902 1292 1253 1246 1219 1193 1036 881 842 669 657 591 191 12648 1263 21316 929
NM_203343chr1153137 2982 2902 1292 1253 1246 1219 1193 1036 881 842 669 657 591 191 12648 1263 21316 929
NM_203463chr294936 4070 3322 3068 954 776 611 492 131 ----11965
NM_203504chr472587 2419 2023 1864 304 102 75 --21927 1896 --
NM_203505chr472587 2419 2023 1864 304 102 75 --21927 1896 --
NM_206853chr6133895 3362 3199 3138 2682 1564 1307 1257 1177 1109 1092 996 674 --23915 2653 --
NM_206854chr695156 4623 4460 4399 3943 3735 3481 3431 1935 --25176 3914 --
NM_206855chr6106121 5588 5425 5364 4908 4700 4446 4396 726 42 1332 26141 4879 --
NM_206909chr8108082 8030 6968 5607 5506 3264 3087 2358 1850 280 36683 6484 2625 37917 5977 5123 --
NM_207321chr1051024 864 856 840 366 31091 948 380 1278 --
NM_207406chr4115924 5335 5123 4311 4204 2224 1703 1358 972 510 193 35720 2061 164 11411 11637
NM_213589chr294521 4480 4441 4069 2234 2053 1980 1969 942 --32130 1087 286 --
NM_213590chr1384928 4676 4085 4051 3717 1092 701 216 ----35299 3925 380