TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-374b-3p
miRNA Sequence: CUUAGCAGGUUGUAUUAUCAUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr52974 54 --11261 --
NM_000038chr551548 728 344 50 38 --11504 --
NM_000044chrX164 ------
NM_000074chrX1760 --184 --
NM_000081chr151850 1702 1629 1549 1365 ------
NM_000084chrX106752 6505 6470 2454 2384 1857 1657 587 541 251 26866 2564 26038 2655 15648
NM_000089chr71243 1529 ----
NM_000091chr232307 69 26 32917 2606 2395 1506 --
NM_000092chr294320 3918 3078 1693 1417 1241 921 275 72 13635 --14332
NM_000093chr91612 ------
NM_000109chrX41802 1070 248 236 --11074 --
NM_000112chr574773 4518 4442 4323 3705 3667 1667 --25566 1929 --
NM_000127chr81285 ------
NM_000129chr641142 1093 1066 229 21456 1027 ----
NM_000138chr1531938 424 289 1701 --12621
NM_000141chr1031488 1147 313 1522 21443 1198 --
NM_000142chr471604 1561 1433 1378 1046 231 52 ------
NM_000151chr1731916 1786 1646 1463 ----
NM_000161chr14--1429 1231 --
NM_000163chr552099 2088 933 813 276 1162 ----
NM_000165chr631533 1073 79 21623 493 --1477
NM_000189chr262378 2229 1973 1928 1778 884 --11494 --
NM_000192chr1231517 401 156 ------
NM_000194chrX1386 ------
NM_000212chr1762371 2092 1952 882 869 504 ------
NM_000217chr1244562 3516 3432 905 --14725 --
NM_000222chr421342 624 ------
NM_000227chr18--2374 318 ----
NM_000232chr453177 2778 2677 2659 119 23085 3053 12901 --
NM_000238chr74370 326 306 52 ------
NM_000240chrX62282 1717 1670 650 585 227 1142 11991 12094
NM_000245chr742210 2086 1431 764 ------
NM_000248chr332964 2948 701 ------
NM_000251chr2194 1243 ----
NM_000252chrX21522 1126 ------
NM_000253chr4--1304 ----
NM_000259chr1576270 4761 4399 4024 2366 1743 639 2585 492 11847 --
NM_000264chr973176 3075 2799 2734 2297 998 356 22460 162 1495 --
NM_000267chr1763337 3204 2653 1259 1247 329 42602 1182 1044 801 --22549 2178
NM_000276chrX22077 801 --12204 --
NM_000280chr112106 42 ------
NM_000291chrX1621 ----1273
NM_000293chr16--1696 --1658
NM_000297chr42124 105 1578 ----
NM_000301chr61161 1201 ----
NM_000304chr1721046 835 ------
NM_000310chr121044 182 --11213 --
NM_000314chr1073240 2472 2263 1252 1020 959 474 31315 944 685 12926 13079
NM_000319chr123866 435 314 --11085 --
NM_000321chr1331810 1754 1617 ------
NM_000322chr661605 1588 1550 1408 1362 1155 --11657 --
NM_000332chr634864 792 461 25460 1284 ----
NM_000333chr31267 1247 ----
NM_000337chr576199 5448 5387 5022 2533 1904 692 16213 ----
NM_000346chr1711655 21251 353 ----
NM_000349chr851288 1102 977 347 319 ------
NM_000362chr2233438 2806 2310 33517 2499 451 --11080
NM_000368chr954533 4019 3796 3191 24 1907 13428 --
NM_000376chr1223184 2548 --2596 322 13060
NM_000378chr11----1419 --
NM_000386chr171780 2808 167 --1183
NM_000387chr32678 308 --1551 --
NM_000390chrX53325 2918 2291 546 302 13258 ----
NM_000397chrX31838 1711 61 1727 ----
NM_000399chr102414 319 ------
NM_000408chr263245 2672 2580 1279 762 274 22967 1076 12159 13048
NM_000411chr2122230 103 --12579 --
NM_000428chr1462480 2217 2194 1981 1737 268 1923 ----
NM_000430chr1763628 2639 2539 2480 2310 357 23592 1205 12314 --
NM_000437chr14710 360 205 135 1778 ----
NM_000451chrX1320 ------
NM_000458chr172355 143 ------
NM_000461chr344455 3678 1004 918 24469 1329 ----
NM_000462chr1551741 1418 1396 1320 564 21626 1214 ----
NM_000463chr2--178 ----
NM_000489chrX42795 2416 986 846 31332 737 31 --22379 2248
NM_000495chrX5782 436 406 140 98 ------
NM_000503chr811271 ----11655
NM_000522chr721302 441 1924 ----
NM_000525chr1161647 1612 1518 1341 370 114 11576 --11632
NM_000533chrX21513 1349 ----1226
NM_000555chrX97561 6876 6433 6205 4834 2638 1586 864 265 17758 11777 --
NM_000560chr11684 ------
NM_000565chr122135 1735 2710 680 ----
NM_000575chr241001 423 97 85 ------
NM_000586chr4191 1225 ----
NM_000596chr71208 1522 --1498
NM_000602chr721242 86 1129 ----
NM_000617chr1232179 749 236 21957 339 22242 1858 --
NM_000618chr1286352 4949 4920 4885 4628 4602 1412 366 21964 1535 16013 26062 73
NM_000618chr1286352 4949 4920 4885 4628 4602 1412 366 21964 1535 16013 26062 73
NM_000619chr12--1539 ----
NM_000627chr22663 266 1793 2908 653 --
NM_000673chr42317 210 1854 ----
NM_000681chr1061347 1152 1026 1001 441 158 ------
NM_000685chr32828 320 --1832 --
NM_000685chr32828 320 --1832 --
NM_000686chrX11000 ------
NM_000687chr202151 33 1723 1560 --
NM_000693chr151298 11475 ----
NM_000702chr1--22163 2051 ----
NM_000726chr261125 567 131 117 107 54 1968 ----
NM_000743chr1521170 85 11110 ----
NM_000745chr153822 140 123 191 ----
NM_000794chr53387 121 68 ------
NM_000800chr531068 1057 315 11324 ----
NM_000806chr541797 1725 1369 1360 ------
NM_000807chr43618 163 59 --2477 85 --
NM_000809chr4118160 7500 6899 6404 6034 3719 2820 2383 2178 1393 539 47761 1218 745 26 16376 1475
NM_000813chr555260 4802 4244 4027 1741 21688 698 21509 169 --
NM_000814chr1573129 2909 2771 1121 1065 996 491 12808 --11632
NM_000817chr21962 2134 79 ----
NM_000818chr102210 191 ------
NM_000826chr462453 2447 2349 2251 800 710 11910 ----
NM_000827chr53754 412 216 22223 1745 11716 --
NM_000828chrX21978 118 22054 603 1533 --
NM_000829chr1131602 885 414 194 ----
NM_000833chr1641526 1478 1022 201 --193 --
NM_000840chr7140 1162 ----
NM_000859chr5--3640 631 256 ----
NM_000868chrX32220 1805 1689 22365 1828 ----
NM_000872chr102579 38 21549 1486 ----
NM_000875chr1586938 2303 2069 1797 1613 1275 725 564 26764 5082 11876 --
NM_000891chr1743447 2662 2649 673 1568 33240 999 393 11194
NM_000899chr1241197 1018 135 24 33869 921 362 11537 13983
NM_000901chr412156 1633 ----
NM_000910chr451774 1705 578 328 129 11347 ----
NM_000912chr882652 2484 976 883 871 599 316 291 21288 1175 11246 13568
NM_000919chr51593 ----1458
NM_000921chr12--1174 ----
NM_000924chr1231365 1279 1080 1951 ----
NM_000926chr11129226 8895 8267 8002 7935 7855 5890 3184 2883 1729 1271 596 69378 7234 6691 2381 804 257 18053 26262 3371
NM_000933chr2041205 1181 1172 269 ----21154 457
NM_000937chr173390 332 56 ------
NM_000944chr452393 2081 504 370 281 2822 598 --11884
NM_000945chr261664 1338 782 715 666 569 ------
NM_000949chr53838 611 220 ------
NM_000950chrX83035 2693 2615 1445 1160 1109 492 189 13649 12735 --
NM_000958chr52503 302 ------
NM_000964chr1711361 ------
NM_000965chr32858 82 ------
NM_000990chr1142740 1028 954 32 13745 ----
NM_001001132chr2131195 942 395 ------
NM_001001323chr1282042 2023 1119 927 830 683 304 236 1908 1694 12727
NM_001001331chr321867 953 --11662 --
NM_001001342chr1041449 1353 1081 411 --1402 --
NM_001001344chrX32495 2251 2164 ------
NM_001001394chr22536 494 ------
NM_001001395chr1262788 2728 2320 2089 892 242 ------
NM_001001396chr194476 4454 3903 3891 3807 3800 1725 391 385 11006 --13604
NM_001001419chr585223 5130 5057 4435 4195 3232 1043 541 13453 --14628
NM_001001420chr585223 5130 5057 4435 4195 3232 1043 541 13453 --14628
NM_001001433chr2063163 2851 2440 627 385 233 --22952 578 --
NM_001001436chr16--1293 1750 124
NM_001001481chr811043 --2900 889 --
NM_001001483chr111359 ------
NM_001001484chr1032294 1994 413 ------
NM_001001549chr732484 976 182 22526 631 1701 --
NM_001001550chr732484 976 182 22526 631 1701 --
NM_001001555chr732484 976 182 22526 631 1701 --
NM_001001556chr151114 21506 1205 ----
NM_001001664chr234056 629 98 34092 870 782 ----
NM_001001668chr1921370 294 33878 3677 284 ----
NM_001001706chr641046 964 810 168 --1230 --
NM_001001715chr133550 417 119 1431 ----
NM_001001787chr1--1407 ----
NM_001001890chr2154220 3554 3106 983 210 13619 11673 --
NM_001001933chr1----186 --
NM_001001936chr10--166 ----
NM_001001971chr1031403 564 73 --1526 --
NM_001001974chr1011555 ----12343
NM_001001995chrX41744 1306 286 135 1613 1633 --
NM_001002026chr342501 2215 616 433 ------
NM_001002243chr21787 ------
NM_001002257chr2103366 3333 3308 3226 2882 1379 1367 585 379 163 53102 2663 2639 2421 125 --1798
NM_001002258chr231526 1269 754 ----11778
NM_001002269chr91446 ------
NM_001002294chr1160 ------
NM_001002759chr10--1539 ----
NM_001002838chrX31757 659 379 11572 11774 --
NM_001002843chr1531270 472 298 ----11070
NM_001002860chr1454654 4368 3978 709 164 24400 344 --13888
NM_001002914chr1741083 1061 505 201 ------
NM_001003396chr62623 119 ------
NM_001003397chr62623 119 ------
NM_001003407chr1075023 4770 1906 1705 1247 967 331 ------
NM_001003408chr1075023 4770 1906 1705 1247 967 331 ------
NM_001003652chr18128657 8077 6231 6169 5448 2323 1835 1436 1190 817 459 442 38103 7570 992 12934 1691
NM_001003674chr18126671 6637 5472 5052 4668 4644 4597 4369 2358 2203 1312 897 26283 2697 16596 --
NM_001003675chr18126671 6637 5472 5052 4668 4644 4597 4369 2358 2203 1312 897 26283 2697 16596 --
NM_001003679chr112095 11919 ----
NM_001003688chr41894 --11127 11033
NM_001003712chr1264048 3011 2620 872 353 211 23775 755 --22518 504
NM_001003794chr363009 2954 2501 2362 2112 1134 1261 ----
NM_001003800chr953228 2894 1451 616 79 12796 13162 --
NM_001003810chr41220 1286 2752 92 --
NM_001003845chr2--1429 ----
NM_001004051chrX3277 116 110 1340 ----
NM_001004065chr963905 3256 3099 2943 2911 1155 13297 ----
NM_001004128chr12688 128 ------
NM_001004304chr1263119 3031 2848 2708 2152 2030 ------
NM_001004317chr683606 3567 3313 2998 1681 1406 485 190 13850 --11623
NM_001004346chr431016 403 391 --2892 171 11113
NM_001004360chr231255 287 182 ------
NM_001004419chr1253272 3166 2814 1050 256 11456 21057 280 --
NM_001005242chr1221480 1300 ------
NM_001005266chr15--1540 1674 --
NM_001005267chr15--1540 1674 --
NM_001005268chr15--1540 1674 --
NM_001005269chr15--1540 1674 --
NM_001005360chr192853 582 ------
NM_001005361chr192853 582 ------
NM_001005362chr192853 582 ------
NM_001005366chr122240 153 ------
NM_001005375chrY31842 1161 336 ------
NM_001005386chr262227 2008 903 487 239 169 21805 159 32413 1626 316 1438
NM_001005404chr1734088 1528 789 13907 12931 --
NM_001005463chr1061929 1863 1758 773 329 82 --1736 22537 724
NM_001005473chr525936 4142 34639 4180 812 ----
NM_001005502chr1243177 1666 1583 1164 24263 3301 ----
NM_001005609chrX33222 407 79 23062 1497 12744 --
NM_001005746chr261125 567 131 117 107 54 1968 ----
NM_001005747chr261125 567 131 117 107 54 1968 ----
NM_001005781chr21450 ------
NM_001005782chr22899 174 ------
NM_001005849chr171489 ------
NM_001005910chr31432 ----1185
NM_001005911chr31432 ----1185
NM_001006115chr372629 2517 2412 2074 2013 1926 856 --21045 354 --
NM_001006600chr541693 1582 746 483 ------
NM_001006610chr16------1142
NM_001006612chrX1104 1438 ----
NM_001006613chrX1104 1438 ----
NM_001006614chrX1104 1438 ----
NM_001006617chr931363 1253 934 ------
NM_001006618chr9258 36 ------
NM_001006619chr931363 1253 934 ------
NM_001006620chr931363 1253 934 ------
NM_001006621chr931363 1253 934 ------
NM_001006634chr162667 557 ----1291
NM_001006684chrX149 ------
NM_001006935chrX2136 79 ------
NM_001006936chrX2136 79 ------
NM_001006937chrX2136 79 ------
NM_001006938chrX3749 561 504 ------
NM_001007024chr1774174 3807 3801 3196 2834 2717 510 11623 23003 1765 --
NM_001007025chr1774174 3807 3801 3196 2834 2717 510 11623 23003 1765 --
NM_001007026chr121343 ------
NM_001007097chr974343 4059 1174 1076 1015 670 84 25083 253 13348 --
NM_001007098chr14899 328 101 65 ------
NM_001007102chr63518 482 469 21061 642 ----
NM_001007226chr1711054 1509 ----
NM_001007227chr1711054 1509 ----
NM_001007228chr1711054 1509 ----
NM_001007229chr1711054 1509 ----
NM_001007230chr1711054 1509 ----
NM_001007237chr162645 2140 2017 2001 1865 1806 --1852 12587
NM_001007243chr851288 1102 977 347 319 ------
NM_001007246chr2181865 1263 687 636 531 517 497 207 1343 1604 11935
NM_001007257chr141237 1202 1062 177 ------
NM_001007278chr1375254 3562 3480 3426 3211 975 581 14970 ----
NM_001007466chr6114955 3981 2073 1667 1641 1440 1257 1035 436 356 346 --1847 --
NM_001007471chr91138 1744 ----
NM_001007527chr51279 ------
NM_001007553chr12792 330 --11204 --
NM_001007559chr1832051 1367 295 --1495 --
NM_001007793chr102285 273 ------
NM_001007794chr11605 ------
NM_001008225chr71618 ------
NM_001008239chr1823582 1370 --11525 12760
NM_001008392chr383462 3060 2866 2612 2261 1037 999 555 13098 11085 --
NM_001008401chr1921384 948 21353 301 ----
NM_001008407chr71624 ----2629 325
NM_001008408chr786420 6278 5718 5437 4646 2546 2155 2122 --11635 --
NM_001008491chr251900 1810 1625 691 549 --1590 --
NM_001008492chr251900 1810 1625 691 549 --1590 --
NM_001008495chr822234 1656 21452 809 ----
NM_001008530chr142169 56 ------
NM_001008539chr875355 4489 4213 4104 3721 1714 664 23522 1224 11891 --
NM_001008541chr1071905 1890 1665 1565 1548 717 653 ------
NM_001008541chr1071905 1890 1665 1565 1548 717 653 ------
NM_001008564chr13--1407 ----
NM_001008566chr22194 --1119 --
NM_001008660chr112214 84 --1277 --
NM_001008701chr1952791 2608 1910 1040 424 ----12009
NM_001008711chr81673 ----163
NM_001008738chr522706 2454 1672 1510 --
NM_001008783chr61878 ----1594
NM_001008895chr1321407 234 11206 ----
NM_001008925chr421321 978 33266 2886 2338 22823 694 1613
NM_001009185chr5--1483 --1219
NM_001009567chr102590 202 ------
NM_001009571chr731132 1056 501 1440 ----
NM_001009814chr13279 36 ------
NM_001009880chr2284859 4834 4756 4241 3536 3388 1150 201 --14409 --
NM_001009899chr376237 5975 5298 5153 2418 1836 376 16467 --25468 1290
NM_001009909chr1163682 3508 937 550 501 36 13941 1564 --
NM_001009958chr7----1611 --
NM_001009993chr21794 24371 453 23045 1233 --
NM_001010852chr61110 ------
NM_001010861chr122778 2377 42625 2172 949 330 ----
NM_001010862chrX43162 985 362 279 ----12008
NM_001010888chrX34622 4051 447 11769 23777 229 11758
NM_001010895chr911650 11303 --22054 295
NM_001010908chr101517 ------
NM_001010971chr11929 ------
NM_001010980chr142720 2534 528 491 13236 2817 353 --
NM_001011546chr203747 252 54 ------
NM_001011553chr7------1705
NM_001011645chrX164 ------
NM_001011658chrX32027 1702 1654 ------
NM_001011663chr102182 88 1441 ----
NM_001011666chr756571 6435 6243 1744 593 25552 343 11121 26016 1293
NM_001011724chr131113 1292 ----
NM_001011725chr131113 1292 ----
NM_001011885chr151105 11515 --11128
NM_001012267chr92739 77 ------
NM_001012393chr1163461 3275 3161 495 262 108 13721 ----
NM_001012398chr161994 1283 --21042 40
NM_001012420chr1532914 2692 420 ----128
NM_001012423chr1532914 2692 420 ------
NM_001012478chr191606 ------
NM_001012732chr43357 330 57 ------
NM_001012751chr1031532 1489 787 1182 --11695
NM_001012755chrX94624 3879 3858 3597 3523 1923 1841 1824 694 --1719 --
NM_001012761chr552262 704 599 418 260 22712 839 ----
NM_001012968chrX82724 2463 2341 1961 693 230 181 37 22552 2166 ----
NM_001013031chr1022628 1321 23238 880 ----
NM_001013406chr721571 1505 11125 ----
NM_001013415chr431241 335 213 1342 2603 364 --
NM_001013437chr181305 ------
NM_001013438chr3--2696 319 ----
NM_001013439chr3--2542 165 ----
NM_001013615chr12890 249 --2894 802 --
NM_001013620chr1277665 7000 6016 5738 3154 2235 2130 --15480 16301
NM_001013629chr1022145 151 11895 --1365
NM_001013635chr1211191 ----1460
NM_001013699chr121201 --1374 --
NM_001013734chr62701 611 ------
NM_001013746chr742110 1865 1845 687 174 ----
NM_001014286chr131328 1110 ----
NM_001014797chr10107457 7438 6241 6203 2638 2082 1431 1316 975 823 25539 211 16217 --
NM_001014812chr151378 ------
NM_001014972chr2--1222 ----
NM_001015045chr431785 1606 741 11569 ----
NM_001015048chr1433218 2563 142 12882 11063 11157
NM_001015049chr1433218 2563 142 12882 11063 11157
NM_001015508chr83658 622 592 1674 ----
NM_001015877chrX53031 2804 2180 778 321 2537 512 --21153 561
NM_001015882chr9188 1223 --11079
NM_001015887chr351599 698 654 228 142 ------
NM_001017368chr1762567 1042 1015 771 722 486 2633 475 --12190
NM_001017395chr363436 3247 2653 2474 1313 1058 --13588 --
NM_001017396chr24831 582 392 158 22174 1458 21332 474 --
NM_001017415chr11167 ------
NM_001017416chr11167 ------
NM_001017424chr131526 1493 1343 11773 ----
NM_001017425chr131526 1493 1343 11773 ----
NM_001017440chr7128017 7255 7248 6846 6384 6063 5723 5258 2865 2354 1965 1934 16793 1430 26433 2590
NM_001017535chr1223184 2548 --2596 322 13060
NM_001017923chr1411674 11649 --21243 1235
NM_001017926chr841775 1696 1587 680 --11456 --
NM_001017969chr91617 ------
NM_001017989chr193951 900 36 ------
NM_001017999chr15928 917 422 281 23 21826 818 22135 1774 --
NM_001017999chr15928 917 422 281 23 21826 818 22135 1774 --
NM_001018000chr15928 917 422 281 23 21826 818 22135 1774 --
NM_001018000chr15928 917 422 281 23 21826 818 22135 1774 --
NM_001018001chr15928 917 422 281 23 21826 818 22135 1774 --
NM_001018004chr15--1631 ----
NM_001018006chr15--1631 ----
NM_001018007chr15--1631 ----
NM_001018009chr341037 972 821 801 --21088 955 --
NM_001018020chr15--1631 ----
NM_001018053chr141824 1371 459 262 11943 ----
NM_001018064chr931796 751 500 11822 11948 --
NM_001018067chr163939 1920 1706 1684 1196 593 33665 608 478 14433 14453
NM_001018068chr163939 1920 1706 1684 1196 593 33665 608 478 14433 14453
NM_001018069chr163939 1920 1706 1684 1196 593 33665 608 478 14433 14453
NM_001018108chr1552017 1844 1791 668 640 ----11808
NM_001018111chr783799 3486 2991 1426 1166 949 413 228 ------
NM_001018159chr16130 ----197
NM_001018160chr16130 ----197
NM_001018676chr82440 157 ------
NM_001018677chr82440 157 ------
NM_001020818chr1951856 1728 1712 1445 597 ------
NM_001020819chr1951856 1728 1712 1445 597 ------
NM_001020820chr1951856 1728 1712 1445 597 ------
NM_001020821chr1951856 1728 1712 1445 597 ------
NM_001023567chr1552306 2247 2079 420 409 ------
NM_001023587chr331104 1036 204 ------
NM_001024226chr11276 ----11031
NM_001024227chr11276 ----11031
NM_001024228chr11276 ----11031
NM_001024401chr1622899 2273 --12090 --
NM_001024455chrX82243 2220 2190 2170 1920 1745 88 60 22683 492 ----
NM_001024463chr151777 1431 --1454
NM_001024593chr10----158 --
NM_001024647chr12107722 7639 6450 5474 4982 4925 2671 935 783 509 11284 26559 939 --
NM_001024649chr562923 2276 988 920 809 799 22835 960 ----
NM_001024660chr31282 1371 ----
NM_001024668chr122742 208 --196 --
NM_001024809chr1711361 ------
NM_001024847chr342079 1809 1791 1572 ------
NM_001024934chr6----1662 --
NM_001024935chr6----1662 --
NM_001024936chr6----1662 --
NM_001024937chr172750 129 ------
NM_001024947chr52941 82 1863 ----
NM_001024948chr112946 --12656 --
NM_001024956chr1185881 5831 5638 3839 3752 2234 1211 935 35785 4598 4549 1145 --
NM_001024959chr31149 ------
NM_001024960chr31149 ------
NM_001025068chr321621 1271 174 --1531
NM_001025069chr321621 1271 174 --1531
NM_001025076chr10106025 5677 5516 5431 4326 2432 2273 2109 1242 1235 1683 15861 --
NM_001025077chr1087383 7035 6874 6789 5684 2600 2593 920 12041 17219 --
NM_001025079chr354017 3712 3348 755 742 --11674 --
NM_001025100chr1841462 1377 731 668 1242 21172 414 --
NM_001025105chr511168 3595 423 334 ----
NM_001025108chr242708 1647 1600 1073 21388 375 ----
NM_001025201chr21460 ----1637
NM_001025233chr1242563 694 445 257 ------
NM_001025248chr151919 ----11291
NM_001025249chr151919 ----11291
NM_001025266chr354790 4092 3067 1385 146 --11205 --
NM_001025356chr1262973 2931 2520 2211 1838 1191 --12279 --
NM_001025366chr641639 1467 488 451 ----1285
NM_001025366chr641639 1467 488 451 ----1285
NM_001025367chr641639 1467 488 451 ----1285
NM_001025367chr641639 1467 488 451 ----1285
NM_001025368chr641639 1467 488 451 ----1285
NM_001025368chr641639 1467 488 451 ----1285
NM_001025369chr641655 1483 504 467 ----1301
NM_001025369chr641655 1483 504 467 ----1301
NM_001025370chr641639 1467 488 451 ----1285
NM_001025370chr641639 1467 488 451 ----1285
NM_001025579chr1721107 422 ------
NM_001025580chrX63755 3555 3516 2976 566 187 34329 3566 2696 22731 1679 --
NM_001025595chr411051 --1168 --
NM_001025616chr431878 1285 434 1306 --11212
NM_001025777chr2160 --190 11629
NM_001025780chr91135 143 ----
NM_001029858chr683233 3100 2510 2125 1048 543 323 317 --1722 12922
NM_001029863chr653110 2796 2760 1072 73 ------
NM_001029875chr532662 924 377 2862 389 12255 --
NM_001029999chr181382 21075 217 1386 --
NM_001030007chr1633983 2988 2856 1169 32916 151 124 --
NM_001030055chr1451554 1214 1036 413 242 11844 33533 1489 748 --
NM_001031623chr62373 170 21708 609 11640 --
NM_001031679chr1223268 631 1565 ----
NM_001031695chr2231523 1099 546 1425 25152 2077 11663
NM_001031716chr241161 442 131 78 1737 1165 --
NM_001031717chr32772 257 --176 --
NM_001031732chr483559 3267 3211 2310 980 741 584 421 ------
NM_001031746chr1011376 11408 2497 284 --
NM_001031803chr171284 ------
NM_001031804chr1673530 1723 1626 1502 902 304 73 24205 748 13433 --
NM_001031812chr531669 532 49 ----1929
NM_001031848chr18160 ----1320
NM_001032221chr941661 1233 482 282 ------
NM_001032280chr62110 98 ----11662
NM_001032282chr821103 1079 --11009 --
NM_001032283chr121804 ----1414
NM_001032284chr121804 ----1414
NM_001032293chr17------1555
NM_001032296chr1372876 2637 2440 2290 2074 1064 887 ------
NM_001032380chr1051967 1532 1391 631 278 11253 ----
NM_001032393chrX1560 1766 ----
NM_001032999chr2065054 4089 3248 3242 1004 539 --23434 986 15332
NM_001033025chr131272 1116 589 ------
NM_001033044chr121640 1273 1724 --11283
NM_001033047chr422675 1914 12067 12209 1596
NM_001033056chr121640 1273 1724 --11283
NM_001033059chr61603 --1699 --
NM_001033081chr141775 1703 1497 1425 ------
NM_001033082chr141775 1703 1497 1425 ------
NM_001033085chr21279 ------
NM_001033087chr202815 787 23180 2043 --13152
NM_001033112chr54735 327 161 153 ------
NM_001033117chr374878 4430 4262 4245 4167 3562 1557 ----12976
NM_001033503chr5--1348 ----
NM_001033518chr752474 2422 2245 557 72 ------
NM_001033519chr752474 2422 2245 557 72 ------
NM_001033520chr752474 2422 2245 557 72 ------
NM_001033557chr221061 523 ----1570
NM_001033566chr172984 814 ----174
NM_001033568chr172984 814 ----174
NM_001033578chr82397 284 --22316 544 --
NM_001033602chr1332346 2122 423 12096 --12056
NM_001033659chr1711661 123 ----
NM_001033677chr122391 279 ------
NM_001033723chr832373 2306 2219 --12547 --
NM_001033756chr641573 1401 422 385 ----1219
NM_001033756chr641573 1401 422 385 ----1219
NM_001033925chr1021981 1879 ------
NM_001034845chr4----31442 1202 277 --
NM_001034850chr51416 11433 ----
NM_001034954chr106968 846 609 464 339 200 43047 2905 2542 2432 1553 --
NM_001034955chr106968 846 609 464 339 200 43047 2905 2542 2432 1553 --
NM_001034956chr106968 846 609 464 339 200 43047 2905 2542 2432 1553 --
NM_001034957chr106968 846 609 464 339 200 43047 2905 2542 2432 1553 --
NM_001035chr131298 1211 89 ------
NM_001035003chr431340 551 346 ------
NM_001035004chr431340 551 346 ------
NM_001035005chr182603 235 ------
NM_001035260chr1021249 314 ------
NM_001035505chr2185 ------
NM_001035511chr121608 194 ------
NM_001035512chr131715 1397 301 ------
NM_001035513chr131715 1397 301 ------
NM_001037132chr76627 588 528 274 170 110 1559 ----
NM_001037133chr76627 588 528 274 170 110 1559 ----
NM_001037164chr741817 1407 422 406 31860 1673 1543 ----
NM_001037172chr351303 1216 910 398 78 1935 ----
NM_001037290chr11--1664 --1358
NM_001037317chr122778 2377 42625 2172 949 330 ----
NM_001037332chr532492 1674 672 12472 ----
NM_001037333chr532492 1674 672 12472 ----
NM_001037494chr12196 ------
NM_001037495chr12196 ------
NM_001037535chrX21132 528 ----1191
NM_001037536chrX21132 528 ----1191
NM_001037540chrX21132 528 ----1191
NM_001037553chr2174706 4477 3838 3777 3130 1029 427 --24550 957 --
NM_001037637chr5151 ------
NM_001037872chr22509 186 ------
NM_001037954chr1142502 837 710 327 32511 614 562 --12291
NM_001039350chr761665 1622 1352 1319 1295 494 ------
NM_001039372chr72448 255 1458 ----
NM_001039465chr142490 349 176 ----
NM_001039479chr1462375 1806 1682 1573 1508 259 12007 1383 2879 583
NM_001039538chr223594 3547 43333 1252 1044 343 12929 --
NM_001039547chr387717 7076 6893 6218 6170 2949 2876 1740 17998 ----
NM_001039585chr173779 3682 3395 2962 2645 1616 216 22952 2929 ----
NM_001039590chrX73764 3111 2469 934 506 478 220 33476 3097 1439 23787 267 --
NM_001039591chrX73764 3111 2469 934 506 478 220 33476 3097 1439 23787 267 --
NM_001039618chr1195502 4677 4143 3959 2145 2139 1469 1395 327 31917 1619 1352 35394 4978 3720 --
NM_001039690chr1611825 --1570 --
NM_001039693chr233980 3561 201 23584 72 ----
NM_001039709chr2065054 4089 3248 3242 1004 539 --23434 986 15332
NM_001039802chr121244 976 11006 ----
NM_001039840chrX96097 6017 4869 4577 4275 4215 1766 1306 740 34846 4252 1419 1702 --
NM_001039844chr1062992 2808 2578 2466 2286 112 --185 12442
NM_001039916chr121294 ------
NM_001039917chr121294 ------
NM_001039918chr121294 ------
NM_001039919chr121294 ------
NM_001039920chr121294 ------
NM_001039937chr1351638 1227 1016 900 653 23811 1666 1336 --
NM_001040001chr632005 1987 1911 --11722 1772
NM_001040020chr741287 339 250 153 11458 ----
NM_001040033chr11684 ------
NM_001040057chr751419 1404 978 507 180 11320 --11299
NM_001040092chr8----2370 363 --
NM_001040101chr491424 1409 545 473 467 414 362 231 129 ------
NM_001040134chr1921429 584 ------
NM_001040135chr71808 1615 1259 --
NM_001040142chr212157 ----1241
NM_001040143chr212157 ----1241
NM_001040144chr1611825 --1570 --
NM_001040146chr1611825 --1570 --
NM_001040152chr7135122 5105 4768 4431 4137 4057 3840 3825 3740 3711 3616 1876 1558 11227 11761 14927
NM_001040153chr132971 779 ------
NM_001040157chr41309 12020 ----
NM_001040158chr51212 1590 ----
NM_001040159chr431237 1087 343 1464 ----
NM_001040167chr731173 304 172 --1388 --
NM_001040202chr442210 2068 1625 35 12030 12122 --
NM_001040214chr632329 638 338 ------
NM_001040284chr1655615 3876 1428 730 552 34014 3646 1718 34327 4269 2023 22325 1559
NM_001040402chr473153 2135 1113 1037 434 138 34 1664 22352 825 22891 2649
NM_001040424chr2152361 915 806 775 591 12181 ----
NM_001040429chr1353295 2628 2427 390 320 11402 1167 --
NM_001040450chr1552457 2397 2289 1868 825 2925 429 ----
NM_001040453chr1552457 2397 2289 1868 825 2925 429 ----
NM_001040458chr541342 1302 154 28 ------
NM_001040624chr842454 1756 1722 1082 11930 ----
NM_001040625chr842454 1756 1722 1082 11930 ----
NM_001040626chr842454 1756 1722 1082 11930 ----
NM_001040627chr842454 1756 1722 1082 11930 ----
NM_001040628chr842454 1756 1722 1082 11930 ----
NM_001040629chr842454 1756 1722 1082 11930 ----
NM_001040630chr842454 1756 1722 1082 11930 ----
NM_001040653chr331936 1740 897 12209 12628 12456
NM_001040655chr1521627 479 11240 ----
NM_001040656chr1521627 479 11240 ----
NM_001040657chr1521627 479 11240 ----
NM_001040658chr1521627 479 11240 ----
NM_001040659chr1521627 479 11240 ----
NM_001040660chr1521627 479 11240 ----
NM_001040665chr7104910 4474 3813 3138 1673 1407 1396 931 884 759 33307 322 115 ----
NM_001040694chr1151080 938 914 358 159 --1854 --
NM_001040697chr11196 ------
NM_001040708chr83841 455 437 1221 --1902
NM_001040712chr933575 2335 666 13449 2886 529 --
NM_001040876chr421758 324 --11661 --
NM_001042355chr1665370 4176 3982 3356 1360 497 25342 4397 33813 1470 517 13728
NM_001042357chr1041499 1440 580 93 31388 205 82 --1599
NM_001042358chr1041499 1440 580 93 31388 205 82 --1599
NM_001042360chr1041499 1440 580 93 31388 205 82 --1599
NM_001042361chr1041530 1471 611 124 31419 236 113 --1630
NM_001042363chr1041499 1440 580 93 31388 205 82 --1599
NM_001042364chr1041530 1471 611 124 31419 236 113 --1630
NM_001042365chr1041530 1471 611 124 31419 236 113 --1630
NM_001042383chr343185 2943 981 284 2545 232 1680 --
NM_001042387chr1041530 1471 611 124 31419 236 113 --1630
NM_001042389chr1041499 1440 580 93 31388 205 82 --1599
NM_001042390chr1041499 1440 580 93 31388 205 82 --1599
NM_001042392chr1041499 1440 580 93 31388 205 82 --1599
NM_001042393chr1041530 1471 611 124 31419 236 113 --1630
NM_001042395chr1041499 1440 580 93 31388 205 82 --1599
NM_001042396chr1041530 1471 611 124 31419 236 113 --1630
NM_001042397chr1041530 1471 611 124 31419 236 113 --1630
NM_001042404chr1--21698 425 ----
NM_001042412chr1665370 4176 3982 3356 1360 497 25342 4397 33813 1470 517 13728
NM_001042413chr933456 543 279 ----12941
NM_001042414chr13295 69 ------
NM_001042424chr4--1871 11142 12310
NM_001042425chr62110 98 ----11662
NM_001042481chr1442437 2298 2217 858 145 --1774
NM_001042486chr20188 ------
NM_001042492chr1763337 3204 2653 1259 1247 329 42602 1182 1044 801 --22549 2178
NM_001042493chr691956 1498 787 777 758 748 384 268 105 ----1308
NM_001042510chr831993 1351 540 ------
NM_001042511chr831993 1351 540 ------
NM_001042517chr131980 --1952 --
NM_001042537chrX72457 1995 1739 1664 463 374 259 ----12287
NM_001042555chr1231289 1015 375 14785 14089 --
NM_001042599chr266650 6298 6096 5962 4880 1308 37229 6776 1798 12771 16655
NM_001042601chr353081 2662 864 377 260 1763 11139 13156
NM_001042603chr12115149 4906 4606 4538 3532 1247 993 530 469 403 319 1591 13998 --
NM_001042604chr343168 1519 824 562 24861 1048 11396 --
NM_001042616chr42366 211 ------
NM_001042669chr431878 1285 434 1306 --11212
NM_001042683chr631651 1422 593 1744 ----
NM_001042724chr19----1693 --
NM_001042749chrX3423 391 250 --11672 --
NM_001042750chrX3423 391 250 --11672 --
NM_001042751chrX3423 391 250 --11672 --
NM_001043318chr14114089 3962 3730 3724 3553 3477 1188 1121 777 769 396 ------
NM_001043351chr152271 2220 1917 876 23 ------
NM_001044305chr631220 1168 658 152 ----
NM_001044385chr273814 3275 3201 2819 2570 1424 1210 23434 151 11256 --
NM_001044722chr531669 532 49 ----1929
NM_001044723chr531669 532 49 ----1929
NM_001046chr582561 2262 1155 880 526 506 285 259 12599 12904 --
NM_001071775chr1331570 330 245 ------
NM_001072chr2--178 ----
NM_001076chr41128 ------
NM_001076chr41128 ------
NM_001079874chr121499 155 11604 ----
NM_001083620chr462451 2445 2347 2249 799 709 11908 ----
NM_001100108chr1108104 7130 7088 5162 3332 3324 1856 523 494 322 28277 1830 28267 6505 --
NM_001105518chr12807 648 ------
NM_001106chr3119383 9355 8384 8022 7246 6954 1286 836 442 260 115 49138 8413 1328 291 39639 8648 7443 --
NM_001109977chr4--167 ----
NM_001116chr1623060 2592 --12484 --
NM_001117chr1832489 2207 467 1533 ----
NM_001121chr1031909 1802 311 11920 ----
NM_001122631chr11------2618 265
NM_001122679chr52974 54 --11261 --
NM_001126chr11229 21023 710 ----
NM_001128chr1633983 2988 2856 1169 32916 151 124 --
NM_001146chr831790 936 540 --21471 268 --
NM_001148chr441845 677 412 288 21602 653 ----
NM_001149chr1031266 1035 943 11434 1284 --
NM_001153chr2173 2830 691 ----
NM_001156chr10--1414 ----
NM_001157chr10------1235
NM_001167chrX106709 6554 5117 1430 1252 1209 916 645 213 105 26114 2347 --1758
NM_001173chr1451554 1214 1036 413 242 11844 33533 1489 748 --
NM_001177chr1242430 2353 864 237 191 1735 --
NM_001186chr2162786 2638 2061 1224 453 285 ------
NM_001200chr20--11123 ----
NM_001201chr453397 3224 1331 545 287 22697 445 13310 --
NM_001204chr2117517 7403 7190 6023 2911 2635 2588 2286 1257 330 246 22953 1916 ----
NM_001206chr912176 1960 ----
NM_001207chr5151 ------
NM_001211chr15------1364
NM_001219chr742198 1664 547 89 12031 ----
NM_001220chr7--1153 ----
NM_001235chr112644 212 ------
NM_001238chr191492 ------
NM_001241chr232307 724 195 --2980 77 1863
NM_001241chr232307 724 195 --2980 77 1863
NM_001256chr1722667 46 11944 22953 188 --
NM_001257chr161299 ------
NM_001259chr7116378 5468 4918 2240 1397 1387 1150 838 642 119 97 1744 1273 14909
NM_001260chr132324 236 ------
NM_001262chr11104 182 ----
NM_001270chr511115 ------
NM_001271chr1553243 2237 1097 416 113 --2969 480 --
NM_001274chr11145 ------
NM_001278chr102997 45 --11138 --
NM_001284chr51389 ------
NM_001289chrX--11224 ----
NM_001298chr211291 ------
NM_001304chr1723019 808 42816 2644 477 128 11231 11417
NM_001310chr1232565 2299 727 --1965 13073
NM_001315chr622216 301 11648 --1658
NM_001329chr1051188 537 444 239 228 11433 ----
NM_001331chr1162388 2309 2178 2086 706 271 --1764 --
NM_001332chr521577 483 1101 ----
NM_001343chr521070 655 11605 ----
NM_001351chr321821 1131 ------
NM_001356chrX32431 984 302 12365 11781 --
NM_001364chr1111032 --24579 878 --
NM_001386chr821641 340 12171 --12147
NM_001387chr533080 2057 1956 12673 13189 --
NM_001389chr211488 ------
NM_001390chr181375 --43523 3210 2830 2417 --
NM_001395chrX4861 727 704 205 ------
NM_001399chrX33222 407 79 23062 1497 12744 --
NM_001400chr131074 108 91 11000 ----
NM_001402chr662011 1731 1505 1350 598 521 1588 ----
NM_001407chr331591 1082 1070 ------
NM_001412chrX53487 3080 2613 1099 191 2170 111 ----
NM_001418chr11144 1509 ----
NM_001418chr11144 1509 ----
NM_001419chr1974856 3464 3305 3254 3044 752 419 14843 11129 --
NM_001420chr1962952 2562 2184 2133 2127 1927 12096 ----
NM_001429chr22--11101 --11074
NM_001431chr61264 ------
NM_001432chr463584 2807 1472 1344 601 171 53605 3351 1390 894 526 ----
NM_001438chr163242 2705 2628 2409 2353 532 13577 --1537
NM_001439chr131272 1116 589 ------
NM_001448chrX31815 508 146 1224 ----
NM_001449chrX21034 295 1886 ----
NM_001453chr621674 1479 21750 1181 ----
NM_001463chr24781 690 324 290 ------
NM_001465chr562125 610 593 523 192 24 21836 1789 ----
NM_001483chr72948 110 ------
NM_001497chr952279 1877 808 71 50 1326 12601 1402
NM_001498chr631200 869 854 ------
NM_001508chr2----1930 1945
NM_001514chr11446 ------
NM_001530chr142928 804 ------
NM_001542chr162645 2140 2017 2001 1865 1806 --1852 12587
NM_001543chr574347 3757 3631 3436 3100 2983 1409 24812 3567 14858 --
NM_001546chr631201 1075 248 ------
NM_001557chr21933 11315 ----
NM_001560chrX72589 2247 2188 2073 1058 974 393 ------
NM_001584chr1111151 1137 ----
NM_001587chrX22077 801 --12204 --
NM_001604chr112106 42 ------
NM_001609chr1054403 4181 3786 2956 39 --11395 --
NM_001614chr174652 520 176 87 ------
NM_001614chr174652 520 176 87 ------
NM_001616chr263410 2601 1134 509 374 120 43482 2752 2371 612 154 --
NM_001621chr762762 2730 1191 986 796 450 1476 1990 --
NM_001621chr762762 2730 1191 986 796 450 1476 1990 --
NM_001622chr32320 92 --1340 --
NM_001634chr61603 --1699 --
NM_001649chrX82292 1996 1813 495 351 248 200 130 ----11799
NM_001655chr11----1226 --
NM_001656chr542074 1853 1485 560 11673 ----
NM_001658chr11276 ----11031
NM_001660chr31166 --1726 --
NM_001663chr1412313 32202 679 270 ----
NM_001664chr31131 ------
NM_001668chr151857 1513 852 816 301 ------
NM_001677chr1--11045 ----
NM_001682chr124833 641 544 397 1622 1408 12441
NM_001683chr321867 953 --11662 --
NM_001684chr1114193 4171 3620 3608 3524 3517 1605 1531 1442 108 102 1723 --13321
NM_001689chr231526 1269 754 ----11778
NM_001690chr342304 2258 1917 883 32595 2575 2360 ----
NM_001693chr83915 822 496 21279 861 1171 --
NM_001699chr193677 379 251 ------
NM_001701chr911041 --21433 1218 --
NM_001709chr1122327 941 12540 12423 --
NM_001723chr64872 843 711 138 ------
NM_001730chr1321204 539 --11213 --
NM_001730chr1321204 539 --11213 --
NM_001731chr122677 241 ------
NM_001742chr721691 740 31667 1328 638 ----
NM_001743chr21465 124 ----
NM_001745chr531115 441 238 ------
NM_001746chr562923 2276 988 920 809 799 22835 960 ----
NM_001748chr11900 ----1956
NM_001753chr741543 1189 397 81 11798 ----
NM_001754chr2154220 3554 3106 983 210 13619 11673 --
NM_001755chr1632008 1725 671 --1561 --
NM_001759chr12155231 5107 4838 4348 3960 3726 3631 1771 1371 1213 914 848 748 626 563 21519 1026 21700 1163 --
NM_001777chr354017 3712 3348 755 742 --11674 --
NM_001786chr10159 ------
NM_001788chr7------1705
NM_001791chr121244 976 11006 ----
NM_001798chr1231102 852 384 21039 257 ----
NM_001806chr1962854 2533 2213 960 815 237 145 ----
NM_001822chr21460 ----1637
NM_001826chr11312 1439 ----
NM_001830chrX93875 3668 3467 1550 597 453 316 246 240 13432 ----
NM_001834chr5195 ------
NM_001839chr11504 ------
NM_001845chr1341327 551 315 57 1177 11374 --
NM_001851chr6----1628 --
NM_001854chr121174 407 21358 1150 ----
NM_001858chr695058 4028 3550 3537 2070 1623 1052 665 229 24488 437 14016 --
NM_001859chr911389 11225 33197 1437 1286 --
NM_001863chr19----1113 --
NM_001873chr42505 480 ------
NM_001874chr1243177 1666 1583 1164 24263 3301 ----
NM_001875chr221071 297 ------
NM_001881chr10--198 1386 --
NM_001892chr511168 3595 423 334 ----
NM_001893chr172105 55 1389 ----
NM_001894chr2211248 ------
NM_001901chr62338 204 ------
NM_001903chr52772 591 180 ----
NM_001904chr341034 723 704 363 ------
NM_001920chr123558 227 46 159 --1777
NM_001921chr43357 330 57 ------
NM_001935chr2------2815 260
NM_001936chr761665 1622 1352 1319 1295 494 ------
NM_001938chr121474 134 11578 ----
NM_001940chr121343 ------
NM_001942chr1821509 1410 11925 21322 163 --
NM_001945chr541386 1270 959 38 ------
NM_001948chr151919 ----11291
NM_001949chr653099 2498 2022 1053 382 --1457 --
NM_001951chr8125 ------
NM_001955chr61105 1996 ----
NM_001967chr32521 498 2606 44 ----
NM_001968chr41698 ------
NM_001969chr1463616 3508 3162 2844 1056 150 ------
NM_001970chr17--1610 ----
NM_001980chr123727 308 116 11460 11435 --
NM_001991chr1732088 839 70 --1691 --
NM_001995chr46511 401 372 354 268 75 1155 157 --
NM_001999chr541349 369 360 330 ------
NM_002006chr485762 5647 1838 1060 591 514 217 64 24931 1043 25607 5074 --
NM_002009chr1521872 377 22194 672 ----
NM_002014chr124456 433 263 64 1630 ----
NM_002015chr1353244 2869 2608 594 223 1624 --22279 607
NM_002017chr1121349 958 ------
NM_002023chr111077 --1183 --
NM_002024chrX41891 1875 292 133 22156 629 --11794
NM_002025chrX77642 6320 5756 3183 1839 1536 663 --26978 3105 18517
NM_002026chr22946 839 ------
NM_002027chr82440 157 ------
NM_002035chr1853953 2703 1243 945 615 13606 --23456 58
NM_002039chr43842 769 630 ------
NM_002040chr2152819 2657 2600 742 404 2608 202 ----
NM_002044chr151114 21506 1205 ----
NM_002052chr81975 --21459 1150 --
NM_002054chr2168 --143 --
NM_002056chr21896 ----1850
NM_002065chr121640 1273 1724 --11283
NM_002069chr711877 21160 224 ----
NM_002074chr141743 1281 411 302 1160 ----
NM_002076chr1233257 2523 2412 22267 175 12097 --
NM_002077chr922103 368 --1250 --
NM_002080chr1621017 52 --2936 704 --
NM_002092chr475025 4831 4496 3805 3068 1918 1426 1654 1106 --
NM_002094chr161421 ------
NM_002107chr12503 67 ------
NM_002111chr4103856 3298 3204 2713 1396 1169 1076 1023 379 299 1516 23376 1400 --
NM_002126chr1744149 3138 629 486 --14125 14058
NM_002128chr1332514 2469 1845 --1366 --
NM_002129chr42408 61 ------
NM_002130chr53627 239 187 21460 1218 --11306
NM_002136chr121113 ------
NM_002137chr7199 1333 ----
NM_002138chr41220 1286 2752 92 --
NM_002139chrX1231 2641 223 1125 --
NM_002141chr73677 563 230 ------
NM_002146chr1721455 1179 11265 --11084
NM_002147chr172642 200 ------
NM_002156chr21178 ----1323
NM_002158chr263312 3045 2960 2328 412 168 11315 1315 --
NM_002163chr162278 54 21244 1169 ----
NM_002182chr321730 925 12782 ----
NM_002188chr51569 ------
NM_002193chr2------11881
NM_002194chr21154 ------
NM_002196chr201339 ------
NM_002196chr201339 ------
NM_002203chr521072 474 22646 1179 --1780
NM_002207chr32640 298 1651 ----
NM_002210chr253515 3427 1015 440 115 --1106 --
NM_002211chr101464 1777 2436 356 1719
NM_002214chr7105712 4716 3851 2225 2191 1756 799 725 319 42 --34783 1462 178 --
NM_002221chr182918 2179 2123 2000 885 783 390 367 11898 1285 --
NM_002222chr341323 482 442 148 1102 ----
NM_002223chr1274026 3731 2992 2648 2549 1411 360 1712 11547 43449 2717 328 208
NM_002224chr62754 511 ------
NM_002226chr142749 219 ------
NM_002235chr1231692 1147 434 --11398 --
NM_002239chr22951 821 ------
NM_002240chr21------1612
NM_002241chr172578 2100 1970 1164 1129 560 396 ------
NM_002264chr364033 4013 3601 1975 1949 1448 34587 3344 664 11242 11680
NM_002265chr172432 193 194 ----
NM_002267chr1332465 817 763 11714 ----
NM_002268chr341659 677 448 132 ----11299
NM_002270chr5145697 5677 5506 5289 4453 4349 4336 3501 1894 1827 1645 1601 1361 1125 --15353 15558
NM_002274chr17135 ------
NM_002285chr242708 1647 1600 1073 21388 375 ----
NM_002293chr162610 2573 2155 905 230 107 11881 ----
NM_002296chr131530 1445 1402 1510 ----
NM_002310chr596383 5633 5326 4794 4694 4408 1903 130 60 16003 36530 1647 52 14196
NM_002313chr1075023 4770 1906 1705 1247 967 331 ------
NM_002349chr2--11177 --1167
NM_002350chr81493 1949 ----
NM_002351chrX152 1499 11368 --
NM_002356chr662688 2504 2494 2483 2235 1152 --1211 --
NM_002359chr1784045 3648 3385 3315 3163 1335 1294 893 24211 2663 13844 --
NM_002373chr1551342 1326 1296 844 554 --165 --
NM_002374chr223594 3547 43333 1252 1044 343 12929 --
NM_002376chr14--1379 1421 --
NM_002381chr22753 77 1665 196 --
NM_002397chr562227 2086 2030 884 399 190 11571 ----
NM_002398chr21560 1499 ----
NM_002399chr1541431 1353 1280 1265 21415 272 ----
NM_002401chr1751816 1583 1528 675 56 --1993 --
NM_002402chr731006 787 363 21077 919 ----
NM_002408chr143823 682 221 ----1230
NM_002430chr2282414 1903 944 879 734 373 252 112 --189 --
NM_002431chr14--1121 ----
NM_002438chr102590 202 ------
NM_002444chrX21441 1290 ------
NM_002445chr831594 375 33 ------
NM_002448chr4--1769 ----
NM_002449chr5--3967 828 450 1100 --
NM_002472chr17------193
NM_002479chr13730 669 103 1608 ----
NM_002480chr1241211 1147 952 236 21201 937 1248 --
NM_002481chr1116838 6550 6357 5326 5205 3194 3155 2461 1628 1406 308 22826 2523 11949 --
NM_002499chr1532379 2071 1876 --3835 598 227 11731
NM_002500chr231074 909 95 1432 ----
NM_002515chr1441930 1823 368 95 --11315 --
NM_002519chr11--31399 991 34 ----
NM_002520chr5--126 ----
NM_002524chr14440 395 241 126 ------
NM_002527chr12--1307 --1196
NM_002539chr2----281 22 1251
NM_002545chr1163461 3275 3161 495 262 108 13721 ----
NM_002576chr1121101 1091 ------
NM_002579chr1921429 584 ------
NM_002581chr984005 3722 2128 2051 1848 852 840 671 11145 1487 --
NM_002583chr12267 54 ------
NM_002586chr631081 635 161 11256 ----
NM_002588chr52632 236 ------
NM_002595chr1231848 1575 432 31797 1688 1552 --1324
NM_002597chr12319 108 ------
NM_002607chr731279 1123 911 ------
NM_002610chr232403 2124 396 2966 348 ----
NM_002613chr1674885 4340 3678 3563 1722 628 398 1981 34317 1615 909 --
NM_002628chr331125 991 151 1977 ----
NM_002645chr1172768 2390 1924 949 458 367 94 11901 ----
NM_002655chr884982 4338 4034 3821 3423 2115 1596 667 34165 3512 1132 25226 4446 24839 3230
NM_002656chr63756 325 271 ------
NM_002657chr2073436 1467 771 732 629 448 39 13859 ----
NM_002660chr2041164 1155 749 743 2953 141 ----
NM_002670chr341257 1211 377 345 --11215 --
NM_002687chr141871 11301 ----
NM_002698chr191649 ------
NM_002699chr111394 ------
NM_002703chr431282 654 83 ------
NM_002709chr243605 2486 200 38 13033 --13433
NM_002710chr12--1254 --11086
NM_002714chr6166 ----1237
NM_002715chr511101 21220 213 ----
NM_002716chr1143581 3154 1464 937 1201 1653 --
NM_002731chr143050 2907 1979 1146 23129 2817 ----
NM_002734chr1752245 1512 861 549 229 1821 ----
NM_002736chr731789 1518 1455 ----11689
NM_002737chr1796387 6331 5394 5193 5103 4499 1806 1201 1027 2737 379 --25108 4031
NM_002738chr1611137 ------
NM_002742chr141125 ----1119
NM_002745chr2264203 3171 3121 1673 1386 873 23664 1739 31605 1174 356 --
NM_002747chr1831871 1840 96 ------
NM_002753chr41755 ------
NM_002760chrY65782 5271 2265 2214 2156 1837 45727 4375 1668 1652 15059 14967
NM_002761chr16----1114 --
NM_002763chr1----1433 --
NM_002797chr142211 174 ------
NM_002811chr162376 205 ----169
NM_002814chrX--1701 1150 --
NM_002816chr17157 ------
NM_002819chr1911275 ------
NM_002822chr1231492 474 388 11677 ----
NM_002826chr13992 216 160 ------
NM_002828chr18--1237 ----
NM_002829chr931184 839 482 11251 ----
NM_002830chr21340 ------
NM_002833chr1531361 278 230 --11212 11221
NM_002835chr72256 233 ------
NM_002836chr20166 ------
NM_002838chr13391 45 38 2979 886 ----
NM_002839chr933575 2335 666 13449 2886 529 --
NM_002843chr1111326 22330 356 ----
NM_002848chr1211218 ------
NM_002849chr121831 ----2436 363
NM_002855chr1163467 3449 3392 3380 2487 599 --33172 776 629 12979
NM_002858chr11188 1160 ----
NM_002865chr8--1248 ----
NM_002867chr14514 136 98 64 1601 ----
NM_002869chr11--11936 --11636
NM_002874chr93962 935 614 1555 12249 --
NM_002886chr375100 4520 4139 3879 3463 3282 1113 24940 3160 2748 704 13831
NM_002890chr53932 808 153 2827 699 ----
NM_002892chr1441198 487 388 102 ------
NM_002897chr21161 1754 ----
NM_002901chr113369 64 45 ----1411
NM_002912chr62140 111 ------
NM_002922chr13644 582 450 ------
NM_002923chr1--2534 504 ----
NM_002940chr421758 324 --11661 --
NM_002941chr311074 --1456 --
NM_002942chr31301 ------
NM_002948chr321127 369 ----183
NM_002959chr183924 3480 1477 1368 1018 642 433 120 33449 1657 992 ----
NM_002968chr162996 450 --2809 320 --
NM_002973chr121145 ----1364
NM_002977chr263149 3019 2806 2232 844 55 13162 ----
NM_002982chr171130 1313 ----
NM_002994chr451823 452 259 247 237 --1316 --
NM_002998chr852169 2115 806 756 381 11606 ----
NM_002999chr2011930 1620 1775 --
NM_003001chr131715 1397 301 ------
NM_003016chr1731915 1287 84 1409 11640 --
NM_003017chr63956 547 436 ------
NM_003020chr15137 1179 ----
NM_003026chr931201 531 255 11374 ----
NM_003030chr32456 375 ----11942
NM_003031chr16------1142
NM_003032chr352695 2646 2180 1980 683 ------
NM_003042chr31387 11658 ----
NM_003043chr343871 2651 1353 38 ----1826
NM_003045chr1374954 4857 4832 4326 3209 3111 1453 13623 14456 --
NM_003046chr875355 4489 4213 4104 3721 1714 664 23522 1224 11891 --
NM_003051chr121864 519 31624 368 341 21868 569 --
NM_003069chrX2210 182 ------
NM_003071chr331852 625 275 ----1779
NM_003074chr342075 744 556 412 1706 ----
NM_003099chr1576479 4821 2402 2072 1294 523 337 35763 5112 4416 35234 4929 1215 --
NM_003101chr12493 447 --11603 --
NM_003106chr3------1766
NM_003107chr621769 879 ------
NM_003108chr297231 6236 5660 4680 4524 1261 614 515 154 --16769 --
NM_003110chr1711101 ------
NM_003112chr762918 2896 2696 2549 2388 298 ------
NM_003114chr8154 2284 236 ----
NM_003128chr242786 1139 884 599 1689 --11073
NM_003139chr112868 326 ------
NM_003144chr642160 1562 1459 560 1156 1652 --
NM_003150chr1742269 1605 467 141 11807 ----
NM_003155chr842404 1968 1954 1031 22671 435 ----
NM_003161chr1773330 2209 1304 1132 814 806 673 1207 ----
NM_003162chr21941 1427 --1110
NM_003165chr951760 1332 581 381 51 ------
NM_003174chr102268 244 2601 136 ----
NM_003178chr332054 1459 119 1607 ----
NM_003185chr2031311 1193 933 ------
NM_003188chr61332 ------
NM_003189chr152523 970 893 873 48 ----13155
NM_003194chr61517 ------
NM_003199chr1855061 4934 3941 3579 876 25045 4315 ----
NM_003202chr541853 750 529 50 --1310 --
NM_003203chr231977 1664 437 2305 25 ----
NM_003204chr1721578 591 ----11276
NM_003206chr61420 ------
NM_003211chr1241396 626 391 75 ------
NM_003216chr2243288 2145 730 124 --22985 2785 --
NM_003220chr62110 98 ----11662
NM_003221chr654184 4146 3972 3626 1205 ------
NM_003223chr162792 530 ------
NM_003234chr372366 1734 835 617 565 288 61 3407 103 71 --1353
NM_003236chr243421 2907 1177 710 1237 ----
NM_003238chr1--1179 ----
NM_003242chr342079 1809 1791 1572 ------
NM_003244chr181129 1115 ----
NM_003246chr152579 516 11686 ----
NM_003257chr15----11360 --
NM_003262chr374855 3733 3435 3413 2117 1494 330 23200 1378 14950 --
NM_003269chr631170 980 241 2955 846 ----
NM_003270chrX51036 450 401 357 237 ------
NM_003272chr12741 200 1286 ----
NM_003274chr211329 12240 ----
NM_003275chr921160 1106 --1974 --
NM_003286chr2011041 ------
NM_003298chr395823 5667 5040 4175 2430 1795 1642 1144 511 --21278 138 15547
NM_003300chr141399 ------
NM_003309chr63533 109 51 11246 --21793 1525
NM_003319chr21192 1880 ----
NM_003330chr1221359 393 ------
NM_003337chr5------1407
NM_003338chr101731 1315 1699 --
NM_003339chr511233 11131 ----
NM_003340chr42993 451 1350 ----
NM_003341chr32680 168 --1594 --
NM_003342chr1742265 1328 932 167 --12277 --
NM_003344chr731355 1102 463 --11383 11458
NM_003348chr1231497 1191 1158 ------
NM_003350chr8152 ------
NM_003352chr22899 174 ------
NM_003359chr42524 72 --21240 838 --
NM_003360chr4156 ------
NM_003368chr11167 ------
NM_003369chr1122128 910 --12486 --
NM_003373chr102724 546 --11406 11214
NM_003375chr102393 339 ------
NM_003376chr641639 1467 488 451 ----1285
NM_003376chr641639 1467 488 451 ----1285
NM_003385chr23838 334 185 ----1631
NM_003387chr242877 2694 242 49 12762 1442 --
NM_003390chr111166 1384 ----
NM_003392chr363057 1610 1275 860 755 138 --1531 --
NM_003399chrX2329 98 --21026 22 1729
NM_003400chr21741 ------
NM_003403chr145734 676 598 567 190 1315 ----
NM_003404chr201774 ----11678
NM_003406chr82641 619 ------
NM_003410chrX53029 2731 1899 572 226 12165 ----
NM_003411chrY11814 --1402 --
NM_003412chr352351 2311 2027 1166 1056 --12532 --
NM_003413chrX61747 1663 1597 649 437 124 1361 122 --
NM_003418chr3--1228 ----
NM_003423chr1931674 1018 824 ------
NM_003439chr733055 2671 565 11063 13017 23255 1284
NM_003442chr111589 1676 --1562
NM_003457chr17------1555
NM_003463chr623330 3111 32225 2089 293 11022 --
NM_003468chr233968 3318 1544 33975 1100 985 ----
NM_003469chr21170 --190 --
NM_003470chr163710 121 114 1687 1458 --
NM_003471chr351762 1620 823 462 148 ------
NM_003472chr631379 979 103 --1129 --
NM_003473chr1021052 423 1407 --137
NM_003478chr1163013 2992 2581 2285 657 412 32825 2252 674 ----
NM_003483chr1242083 972 612 238 --12312 --
NM_003489chr2152973 2634 2336 2268 459 22745 529 11033 1412
NM_003506chr82123 83 2999 363 11225 --
NM_003507chr251370 742 369 315 75 ----1661
NM_003557chr121494 1429 183 ----
NM_003563chr1711054 1509 ----
NM_003574chr1884695 4540 4197 3901 1159 488 400 369 11725 33557 753 598 --
NM_003576chr1372876 2637 2440 2290 2074 1064 887 ------
NM_003583chr1283777 3623 3577 3103 2808 2734 1144 47 13314 1878 13896
NM_003589chr1321407 234 11206 ----
NM_003590chr253550 3504 3296 3172 2694 43105 2931 2643 1195 1767 --
NM_003592chr71381 ------
NM_003595chr22194 --1119 --
NM_003607chr164255 4145 3296 2838 1694 1655 13225 --13899
NM_003613chr151626 2673 512 ----
NM_003615chr352925 2630 1367 1117 229 13593 --12837
NM_003620chr171809 1936 1834 --
NM_003622chr1252637 2229 2080 1806 120 ------
NM_003629chr163131 3039 2960 1301 1142 404 13352 ----
NM_003633chr572555 2523 1575 990 445 290 141 1697 1647 --
NM_003642chr21279 ------
NM_003644chr17126576 6507 5900 5531 4645 2420 2223 2188 1881 1324 1081 32 46533 6310 6285 1573 15066 --
NM_003651chr121167 1443 ----
NM_003663chr352973 2512 389 226 177 1792 ----
NM_003664chr53198 151 64 ------
NM_003670chr351437 1221 1149 464 21 11035 1547 --
NM_003671chr963124 2790 2381 2276 1235 524 --1533 11144
NM_003672chr141239 700 433 426 11410 11970 --
NM_003673chr172413 79 ------
NM_003685chr19--1985 ----
NM_003690chr23606 505 473 1447 ----
NM_003692chr91785 1976 ----
NM_003701chr1311058 ------
NM_003702chr84686 300 147 95 ------
NM_003704chr42648 587 ------
NM_003716chr33284 64 24 ------
NM_003722chr332678 2137 984 32585 2531 1976 ----
NM_003728chr41509 ------
NM_003735chr52632 236 ------
NM_003736chr52632 236 ------
NM_003743chr222100 1997 ------
NM_003746chr12196 ------
NM_003749chr1362353 2270 2183 964 380 149 42256 2113 2008 1609 --11884
NM_003750chr101957 1911 --1390
NM_003758chr153259 216 153 --11243 --
NM_003758chr153259 216 153 --11243 --
NM_003763chr2063163 2851 2440 627 385 233 --22952 578 --
NM_003768chr131482 1398 1257 ------
NM_003772chr111390 ----11152
NM_003774chr1272601 2455 2153 1248 842 422 183 --1975 --
NM_003778chr3198 --1611 --
NM_003783chr12752 283 146 ----
NM_003787chr1841474 436 358 158 11738 ----
NM_003794chr35969 845 413 219 150 ------
NM_003797chr11170 ------
NM_003800chr62527 460 ------
NM_003819chr12217 199 ------
NM_003822chr172690 1229 1025 970 831 753 713 1842 12759 --
NM_003829chr91307 --1794 --
NM_003850chr13--134 ----
NM_003861chr1442733 958 666 205 22228 821 --22860 470
NM_003870chr1521954 1827 1704 11332 --
NM_003872chr231903 1887 246 12499 ----
NM_003878chr8268 55 ------
NM_003885chr1772684 2537 2102 1733 1700 1667 659 --12456 --
NM_003887chr242309 1600 411 202 --22122 1916 --
NM_003895chr2131604 369 192 21926 1471 11585 12014
NM_003902chr11704 159 ----
NM_003905chr16130 ----197
NM_003907chr32346 332 ------
NM_003909chr852724 2071 1200 973 532 22954 846 11077 --
NM_003913chr693130 2788 2749 2741 1657 1563 795 286 244 24111 820 ----
NM_003916chrX1119 ----11314
NM_003927chr18------1693
NM_003930chr752385 2379 341 227 128 3494 480 464 ----
NM_003931chr6----1662 --
NM_003932chr2251785 1709 1681 1496 1463 131 1282 --
NM_003936chr221072 87 ------
NM_003938chr1931133 1092 112 ------
NM_003941chr741848 1698 625 205 11572 --11703
NM_003943chr42280 126 ------
NM_003948chr45858 805 314 217 72 --12191 --
NM_003951chrX1361 ------
NM_003958chr683922 3882 3825 3142 3045 2912 2442 178 --1661 --
NM_003971chr17----1131 --
NM_003972chr101199 1229 252 32 --
NM_003980chr621110 72 --21266 1076 --
NM_003983chr16104461 4034 3851 3489 3075 1101 1069 926 741 319 13218 43591 3422 1536 839 --
NM_003994chr1241197 1018 135 24 33869 921 362 11537 13983
NM_003998chr42599 276 1566 ----
NM_004006chrX41802 1070 248 236 --11074 --
NM_004007chrX41802 1070 248 236 --11074 --
NM_004009chrX41802 1070 248 236 --11074 --
NM_004010chrX41802 1070 248 236 --11074 --
NM_004011chrX41802 1070 248 236 --11074 --
NM_004012chrX41802 1070 248 236 --11074 --
NM_004013chrX41802 1070 248 236 --11074 --
NM_004014chrX41802 1070 248 236 --11074 --
NM_004015chrX41802 1070 248 236 --11074 --
NM_004016chrX41716 984 162 150 --1988 --
NM_004017chrX41802 1070 248 236 --11074 --
NM_004018chrX41716 984 162 150 --1988 --
NM_004020chrX41802 1070 248 236 --11074 --
NM_004021chrX41716 984 162 150 --1988 --
NM_004022chrX41716 984 162 150 --1988 --
NM_004023chrX41716 984 162 150 --1988 --
NM_004027chr2128 ------
NM_004034chr10--1414 ----
NM_004036chr23691 676 170 ----1636
NM_004050chr1442061 991 784 677 --1444 11942
NM_004055chr1171692 1678 1393 901 691 297 213 --1256 --
NM_004056chr83884 349 249 1184 1253 --
NM_004067chr711420 1107 --1401
NM_004075chr121565 --1492 --
NM_004080chr731505 530 430 ------
NM_004081chrY31842 1161 336 ------
NM_004086chr14--1195 2814 206 --
NM_004087chr351876 1850 1704 749 630 ------
NM_004093chr1392054 1132 915 842 767 686 659 512 247 12532 ----
NM_004098chr1021227 1090 ------
NM_004113chr321787 554 21532 824 ----
NM_004114chrX31011 973 317 31138 890 821 ----
NM_004116chr23426 107 39 ------
NM_004124chr1463593 3558 2976 786 620 94 22666 2478 13520 --
NM_004130chr32187 89 2599 100 1492 --
NM_004133chr851980 646 309 169 116 12654 ----
NM_004136chr1573206 3044 2680 2567 2339 1109 978 2869 209 ----
NM_004157chr35865 829 723 348 114 --1569 --
NM_004161chr231419 1023 451 ------
NM_004162chr32979 49 --11248 --
NM_004170chr931849 1670 289 --31853 1363 635 --
NM_004171chr11138694 7331 6909 6366 6244 6101 3100 2985 2397 1613 638 248 125 17526 13659 --
NM_004172chr531894 1671 418 21828 41 ----
NM_004177chr1161845 1492 1461 1359 1242 21 ------
NM_004185chr11102 ------
NM_004187chrX21123 120 ------
NM_004205chr11----1488 --
NM_004226chr21257 ------
NM_004227chr753014 2889 2272 208 115 --32372 993 927 --
NM_004229chrX11863 ------
NM_004231chr71218 1242 ----
NM_004232chr1841302 622 400 309 --13183 --
NM_004235chr92655 545 ------
NM_004238chr2131 ------
NM_004241chr10--1741 ----
NM_004255chr15142 ------
NM_004267chr31388 ------
NM_004272chr511485 --1492 --
NM_004274chr1433104 2660 2081 12917 12855 --
NM_004276chr122391 279 ------
NM_004279chr752284 1982 1574 1532 728 ----11710
NM_004290chr52883 479 ------
NM_004293chr963829 3820 3647 3403 3285 1194 23735 1055 --21041 1011
NM_004294chr13--1597 1587 --
NM_004311chr1062702 1182 1113 972 525 389 ------
NM_004319chr142220 1065 570 24 11049 12758 --
NM_004323chr942310 2240 836 95 ------
NM_004327chr2232001 943 423 ----11621
NM_004329chr1041286 1195 559 89 --1135 --
NM_004330chr154877 166 104 40 1245 ----
NM_004331chr832249 1927 944 ------
NM_004338chr18126671 6637 5472 5052 4668 4644 4597 4369 2358 2203 1312 897 26283 2697 16596 --
NM_004342chr732136 936 564 1750 22021 541 --
NM_004349chr83398 372 294 11088 ----
NM_004354chr41277 --2724 618 --
NM_004356chr112165 112 ------
NM_004364chr19------11019
NM_004370chr641843 1729 1697 1590 ------
NM_004379chr231194 508 351 --127 --
NM_004380chr1642491 2185 1639 701 2878 166 ----
NM_004384chr531669 532 49 ----1929
NM_004388chr12334 82 ------
NM_004392chr1352631 2179 1788 519 267 ------
NM_004395chr5----1803 --
NM_004397chr1164309 3958 3543 2960 242 216 22686 657 24264 1636 --
NM_004404chr251900 1810 1625 691 549 --1590 --
NM_004412chr1095925 5738 5663 5491 5098 5036 2244 1138 367 ----25294 1863
NM_004415chr63667 231 23 ------
NM_004427chr1----1950 --
NM_004430chr842742 2716 1743 758 12091 153 --
NM_004431chr1166 1763 ----
NM_004432chr942007 880 454 160 11982 ----
NM_004438chr242802 2629 1179 835 1162 ----
NM_004440chr62643 576 31212 493 366 --183
NM_004441chr321295 150 ------
NM_004457chr2127 ------
NM_004458chrX52009 1932 1763 1012 85 1761 11981 12578
NM_004459chr1751992 1832 1579 1531 569 ------
NM_004464chr484301 4148 3812 3573 3224 1304 1008 403 ------
NM_004469chrX1365 189 ----
NM_004481chr142578 2044 796 563 ------
NM_004487chr31931 ------
NM_004491chr1974291 3883 3150 3026 3008 1256 874 13923 23702 548 --
NM_004492chr15138 ------
NM_004496chr1451376 1250 1171 533 171 ------
NM_004499chr51410 ------
NM_004500chr1451820 1684 1492 1271 210 ------
NM_004501chr173904 3737 2612 2581 2506 1457 1350 --21471 986 1653
NM_004504chr252962 1208 782 590 443 --12848 --
NM_004505chr1731871 810 115 --11975 122
NM_004515chr12307 59 ------
NM_004521chr10--128 ----
NM_004524chr171256 ------
NM_004525chr261477 1462 1349 1147 296 284 11367 1313 11524
NM_004529chr921236 888 ------
NM_004535chr2031164 1155 505 ------
NM_004538chrX2661 313 ------
NM_004540chr212210 201 ------
NM_004543chr23336 330 78 ------
NM_004561chr1131709 723 599 ------
NM_004571chr2143001 684 548 417 12599 --1913
NM_004575chr431230 620 593 ------
NM_004582chr11361 1114 193 --
NM_004586chrX95123 4735 4241 3592 3403 750 388 136 127 ------
NM_004588chr1173987 3690 3156 3082 2671 640 412 1533 ----
NM_004596chr191180 ------
NM_004602chr2021367 940 --21394 1113 --
NM_004607chr5177 ------
NM_004612chr944287 3824 3103 311 3707 692 354 13442 --
NM_004615chrX2764 701 ------
NM_004617chr3--1562 ----
NM_004620chr113496 438 153 ------
NM_004622chr242022 1941 728 29 199 ----
NM_004637chr31547 ------
NM_004645chr171753 ------
NM_004654chrY2467 256 11400 1270 --
NM_004655chr1711031 ------
NM_004660chrY41892 1447 864 300 12233 11713 11902
NM_004663chr1511521 ------
NM_004671chr18--1317 ----
NM_004673chr131549 1513 564 --11058 --
NM_004681chrY2512 193 ----1254
NM_004685chr1342603 2586 606 292 21116 457 ----
NM_004687chr1721465 745 --2825 687 --
NM_004690chr61165 ------
NM_004703chr1722580 2526 12361 11802 --
NM_004709chrX31736 622 125 1404 ----
NM_004713chr143519 227 123 ------
NM_004718chr22621 283 2465 67 ----
NM_004719chr1252750 2479 1820 1769 1161 ------
NM_004725chr1031506 1494 414 ----1532
NM_004726chrX85586 5552 5539 5315 4916 4757 898 214 15771 ----
NM_004731chr1231895 1284 752 1730 ----
NM_004733chr31503 1581 ----
NM_004734chr1342659 2328 855 429 22521 549 2859 317 --
NM_004735chr22721 153 ------
NM_004736chr152070 1980 1800 839 820 ------
NM_004738chr202813 687 ----1784
NM_004741chr1031526 1207 1068 11460 1537 --
NM_004742chr341877 1667 1527 424 --1534 --
NM_004744chr433670 3280 958 --23779 1209 --
NM_004745chr854801 4783 2553 2113 1316 56120 5591 4695 2043 1134 14995 22558 2280
NM_004748chr1554051 3786 1501 920 136 23642 1051 12749 --
NM_004751chr153322 132 23 --1425 --
NM_004760chr752017 998 420 402 48 --22202 969 --
NM_004762chr173400 143 78 ------
NM_004772chr5------21505 1322
NM_004775chr1832193 2071 553 2808 709 ----
NM_004776chr2033321 2649 962 12864 12841 --
NM_004779chr52377 55 ------
NM_004781chr14115 91 67 26 1600 ----
NM_004781chr14115 91 67 26 1600 ----
NM_004788chr1142499 2446 450 344 22409 153 --11972
NM_004792chr2159 ----1192
NM_004796chr1432031 255 97 2963 782 ----
NM_004798chr2012649 --23293 3186 --
NM_004799chr1198 ------
NM_004804chr222712 2571 1257 ----
NM_004808chr1062277 1251 1218 1046 362 44 1180 ----
NM_004814chr12449 113 ------
NM_004817chr91258 ------
NM_004831chr1921046 197 ------
NM_004834chr243364 2972 2774 2375 33267 2094 445 ----
NM_004835chr32828 320 --1832 --
NM_004835chr32828 320 --1832 --
NM_004836chr24943 837 246 191 ------
NM_004841chr12302 95 ------
NM_004842chr62496 414 21265 161 157 --
NM_004844chr341037 972 821 801 --21088 955 --
NM_004845chrX43669 3285 377 258 14074 21364 134 --
NM_004849chr62449 117 11308 ----
NM_004855chr151175 ------
NM_004856chr151438 ------
NM_004857chr1424656 3366 43798 1366 254 143 ----
NM_004859chr1732373 1226 633 1164 23028 2932 --
NM_004863chr1475047 5041 4522 3971 3897 1130 377 1197 --1579
NM_004866chr553382 3256 1328 856 24 54472 3150 1942 1514 223 ----
NM_004869chr1811129 1396 ----
NM_004871chr1774174 3807 3801 3196 2834 2717 510 11623 23003 1765 --
NM_004873chr1433218 2563 142 12882 11063 11157
NM_004874chr8130 ------
NM_004884chr1521234 373 ------
NM_004887chr511072 1956 ----
NM_004893chr51212 1590 ----
NM_004896chr1021164 229 ------
NM_004897chr101884 ------
NM_004898chr462864 2647 1969 1929 1904 804 11856 ----
NM_004902chr202149 126 ------
NM_004904chr756571 6435 6243 1744 593 25552 343 11121 26016 1293
NM_004905chr14890 653 220 117 1938 ----
NM_004906chr6--1239 1629 --
NM_004912chr721571 1505 11125 ----
NM_004926chr1421695 1212 11268 ----
NM_004927chr1121413 1041 --21266 429 --
NM_004929chr821104 25 ------
NM_004932chr511642 1577 ----
NM_004938chr921127 85 ------
NM_004945chr192853 582 ------
NM_004956chr763724 3692 3323 1112 1101 1061 41311 1146 839 70 23403 3066 --
NM_004965chr211732 ------
NM_004966chr1021009 355 2783 281 1905 --
NM_004985chr1273870 3632 3134 3089 2776 562 123 11593 21165 715 --
NM_004987chr21397 1267 ----
NM_004992chrX97999 7618 7148 6894 6791 6362 5659 2177 1383 --22536 1437 36231 5835 5555
NM_004992chrX97999 7618 7148 6894 6791 6362 5659 2177 1383 --22536 1437 36231 5835 5555
NM_004993chr1421522 572 ------
NM_004999chr663996 3703 3641 1168 1075 663 ------
NM_005006chr2--2974 369 ----
NM_005010chr76627 588 528 274 170 110 1559 ----
NM_005025chr31191 ------
NM_005028chr1032174 2160 1829 ------
NM_005032chrX41020 909 412 313 ------
NM_005034chr8--1630 ----
NM_005054chr21694 --11392 --
NM_005056chr12115393 5150 4850 4782 3776 1491 1237 774 713 647 563 1835 14242 --
NM_005063chr10103255 2920 2605 2461 1208 799 721 252 182 110 2487 96 22803 1478 13441
NM_005065chr1485292 5191 5090 4894 4251 1917 663 51 25299 3635 23972 1202 --
NM_005066chr11569 1850 ----
NM_005068chr621376 993 ------
NM_005087chr3--2542 165 ----
NM_005093chr2065054 4089 3248 3242 1004 539 --23434 986 15332
NM_005097chr101263 ----1125
NM_005105chr142075 1845 645 596 62205 1951 1935 1875 1467 1392 ----
NM_005109chr332492 2241 646 31684 1023 595 22067 1646 --
NM_005116chr2043790 3150 147 59 ----13544
NM_005119chr111219 ------
NM_005121chr1763179 3083 2608 1104 986 168 1314 ----
NM_005124chr6--11022 ----
NM_005126chr331712 1655 643 153 --1491
NM_005149chr131009 267 174 11419 11199 1355
NM_005156chr965323 4631 3736 3308 1614 1451 13859 23813 721 24794 3299
NM_005160chr22106530 5838 5793 4822 4590 1880 1582 980 419 218 15463 1391 26783 4325
NM_005168chr211656 11190 ----
NM_005180chr1051537 1223 551 334 83 11121 ----
NM_005187chr162774 150 1698 ----
NM_005188chr11128023 7372 6917 6740 5113 3192 1565 1278 774 671 433 423 --27032 3032 --
NM_005197chr1485989 5104 4702 4613 2465 2352 1918 736 --24936 956 --
NM_005202chr152289 908 374 284 21 --11545 --
NM_005206chr173250 153 97 ----11301
NM_005207chr2263451 3159 2821 2716 966 24 12865 ----
NM_005208chr17150 ----1113
NM_005219chr551681 1219 629 294 142 --11812 --
NM_005222chr71673 ------
NM_005226chr92595 256 22634 2433 1234 --
NM_005230chr121104 ------
NM_005233chr331908 1585 863 12443 ----
NM_005235chr266650 6298 6096 5962 4880 1308 37229 6776 1798 12771 16655
NM_005238chr1131314 1225 800 22565 567 132 --
NM_005241chr321343 1156 11196 2220 81 --
NM_005242chr52136 75 ------
NM_005249chr142808 727 ------
NM_005256chr111832 ------
NM_005257chr182894 287 1158 ----
NM_005259chr241456 1380 1142 570 ------
NM_005276chr1241622 1490 546 499 21481 1170 1363 1397
NM_005276chr1241622 1490 546 499 21481 1170 1363 1397
NM_005277chr42712 624 ------
NM_005295chr7--1202 ----
NM_005296chrX2846 404 ----21071 694
NM_005302chr71288 ------
NM_005308chr10----1432 --
NM_005311chr732484 976 182 22526 631 1701 --
NM_005313chr151511 ----1140
NM_005316chr112973 812 ------
NM_005318chr2221041 238 ------
NM_005328chr82203 108 ------
NM_005329chr1641884 1854 1803 799 2706 310 ----
NM_005339chr474094 4024 3855 3754 3655 3581 62 21577 689 13832 --
NM_005342chrX52276 2196 1785 788 597 1815 ----
NM_005347chr931713 1100 128 ------
NM_005359chr18126114 5788 5363 4927 4565 2626 2535 2451 1963 799 374 258 34496 976 286 14003 2964 753
NM_005370chr1931178 1075 215 ----1238
NM_005375chr61249 ------
NM_005376chr121097 231 ------
NM_005378chr23561 552 162 --1764 --
NM_005381chr2162 ------
NM_005382chr8--1443 ----
NM_005387chr11--1255 --2665 617
NM_005388chr92539 258 1158 11224 --
NM_005389chr61163 --1743 --
NM_005392chr91214 --1334 --
NM_005397chr783799 3486 2991 1426 1166 949 413 228 ------
NM_005399chr154276 2886 1714 1297 393 1426 13494 13176
NM_005400chr21382 --22621 692 --
NM_005402chr711296 11552 ----
NM_005406chr1821449 1112 ----11235
NM_005412chr121360 1555 ----
NM_005415chr23622 616 83 1163 1222 --
NM_005433chr1812698 ------
NM_005436chr1073509 3367 3055 2824 2557 821 722 24118 3345 12708 --
NM_005442chr33622 611 459 ------
NM_005443chr41504 ------
NM_005455chr121343 629 1197 2540 205 --
NM_005458chr921851 65 ----1996
NM_005460chr53553 409 51 ------
NM_005475chr1253290 3273 2444 2067 465 --1118 --
NM_005476chr921372 1240 ------
NM_005493chr62577 557 --170 --
NM_005494chr71562 131 ----
NM_005497chr1756066 5046 3748 988 366 ------
NM_005499chr192512 154 1147 ----
NM_005509chr511183 21489 267 ----
NM_005513chr321563 187 ------
NM_005517chr11974 1590 ----
NM_005520chr51556 ------
NM_005522chr731385 1179 891 ------
NM_005530chr1531462 1204 274 ------
NM_005542chr711740 ------
NM_005544chr23810 711 379 ----1384
NM_005559chr18135 ------
NM_005561chr133210 189 181 ------
NM_005563chr13894 665 351 ------
NM_005569chr2251450 1063 366 285 69 --11355 --
NM_005578chr345043 3923 3446 111 1740 13823 --
NM_005587chr151889 ------
NM_005595chr1--1965 ----
NM_005596chr966353 6002 5121 4753 4000 1983 24893 1313 26373 5848 --
NM_005598chr131266 251 224 --11070 --
NM_005604chr61437 12545 ----
NM_005606chr142169 56 ------
NM_005607chr8126 --1951 --
NM_005610chr11891 ------
NM_005611chr1631295 1217 111 ------
NM_005614chr72966 153 1376 2747 102 --
NM_005618chr62615 109 --1113 183
NM_005626chr12406 94 1136 ----
NM_005627chr61666 ------
NM_005629chrX1517 11331 11064 --
NM_005637chr1832051 1367 295 --1495 --
NM_005638chrX61794 1180 645 572 395 258 ------
NM_005648chr81176 --127 --
NM_005655chr821103 1079 --11009 --
NM_005664chr15150 1172 133 --
NM_005665chr184869 4652 4363 4280 3149 3066 1653 1339 13486 ----
NM_005667chr22170 131 ------
NM_005668chr554480 4091 3621 3400 1213 13409 --11439
NM_005669chr552330 2270 2017 860 264 ------
NM_005688chr351236 1093 931 449 384 11308 ----
NM_005717chr11402 1203 ----
NM_005718chr31149 ------
NM_005722chr262227 2008 903 487 239 169 21805 159 32413 1626 316 1438
NM_005724chr152306 67 ------
NM_005730chr1273238 3092 2283 1386 984 671 519 13033 ----
NM_005731chr2154 ------
NM_005734chr114750 734 574 262 ------
NM_005737chr242870 2487 1954 322 11116 ----
NM_005738chr741817 1407 422 406 31860 1673 1543 ----
NM_005739chr1542293 413 227 128 ------
NM_005742chr22693 285 ------
NM_005744chr151139 ------
NM_005746chr762797 2712 2462 2304 1969 993 1203 ----
NM_005748chr1243160 3120 2651 488 ------
NM_005749chr172702 593 ----1574
NM_005754chr53929 144 100 ------
NM_005756chrX31449 1235 1226 21523 1508 ----
NM_005759chr2134308 3786 3409 3351 3311 1514 1150 1074 1029 735 714 403 209 34408 1366 595 23343 1446 --
NM_005765chrX--155 ----
NM_005778chr3165 --1102 --
NM_005779chr553221 3105 2668 2400 706 53228 2749 2474 2461 500 ----
NM_005780chr133811 279 116 ------
NM_005785chr1211725 1730 ----
NM_005786chr181238 ------
NM_005795chr262334 2094 1851 1025 628 568 --12762 --
NM_005798chr1375254 3562 3480 3426 3211 975 581 14970 ----
NM_005806chr2111028 11284 ----
NM_005808chr383462 3060 2866 2612 2261 1037 999 555 13098 11085 --
NM_005813chr262144 1730 798 766 753 647 22341 2207 --1803
NM_005819chr193234 2390 1340 848 668 580 303 275 115 1865 23133 1192 --
NM_005828chr1764672 4174 3783 3559 1399 125 --14178 --
NM_005832chr321162 97 132 ----
NM_005833chr91167 ------
NM_005836chr8134 ------
NM_005839chr12666 112 167 ----
NM_005840chrX95273 2767 2220 1799 965 944 739 469 377 17695 16818 35567 5278 1804
NM_005841chr411172 ----11020
NM_005842chr13----199 --
NM_005843chr241835 1780 1269 630 ------
NM_005850chr1125 ------
NM_005859chr551575 1535 1319 1293 1150 1427 1134 21179 254
NM_005860chr1941218 364 335 54 ------
NM_005862chr31326 ------
NM_005863chr101390 11176 --21266 180
NM_005870chr1341411 1252 938 403 ----1244
NM_005871chr102922 168 ----1413
NM_005880chr1621460 408 ----11427
NM_005881chr162278 99 ------
NM_005885chr55665 556 330 191 161 11339 ----
NM_005898chr1143144 2018 1024 1002 ------
NM_005899chr172146 32 21198 1075 1367 --
NM_005900chr41894 --11127 11033
NM_005901chr18128657 8077 6231 6169 5448 2323 1835 1436 1190 817 459 442 38103 7570 992 12934 1691
NM_005902chr1554356 4290 3120 2809 1498 14566 1740 --
NM_005903chr585223 5130 5057 4435 4195 3232 1043 541 13453 --14628
NM_005904chr182923 914 --163 --
NM_005906chr621480 1273 11593 21443 1216 --
NM_005909chr573534 3498 2953 2748 1110 179 173 --1297 23826 253
NM_005910chr1763626 3354 2624 1538 958 716 13484 13292 --
NM_005911chr231496 1289 182 1357 ----
NM_005916chr72129 43 ------
NM_005917chr21175 ------
NM_005924chr73793 455 302 --1797 --
NM_005927chr52228 115 --1902 --
NM_005930chr142857 64 ------
NM_005933chr1142219 1089 815 251 --12680 --
NM_005935chr443897 2022 1087 977 34591 1964 707 ----
NM_005941chr874145 4094 3942 2735 2710 207 72 12854 12739 --
NM_005955chr164982 4656 4463 3916 1413 698 25149 3513 13936 15485
NM_005962chr1071905 1890 1665 1565 1548 717 653 ------
NM_005962chr1071905 1890 1665 1565 1548 717 653 ------
NM_005966chr242156 1733 1496 243 1849 1903 11642
NM_005968chr19159 ------
NM_005977chr133926 274 65 3225 190 153 ----
NM_005984chr22153 ------
NM_005986chr1341901 1072 1007 518 --12214 --
NM_006003chr191205 --1196 --
NM_006007chr944484 3410 3362 3173 1719 14107 --
NM_006011chr1554015 3693 3655 1181 934 1117 22655 792 14128
NM_006015chr111321 ----1463
NM_006016chr652238 1780 1566 843 245 --1790 --
NM_006022chr133787 64 30 ----1869
NM_006023chr101171 ------
NM_006024chr71592 1341 1202 --
NM_006033chr182184 47 --177 11670
NM_006036chr242573 2473 1834 344 ------
NM_006038chr2042130 1604 1507 243 ------
NM_006040chr1641375 1014 428 150 --1270 11229
NM_006041chr17----1171 --
NM_006047chr2032966 2417 1090 12241 23310 2424 1379
NM_006048chr11454 ----2407 28
NM_006049chr15--1272 ----
NM_006060chr741199 449 384 232 13693 ----
NM_006079chr63829 725 316 1525 ----
NM_006080chr722970 2674 23009 1940 11115 --
NM_006090chr11605 ------
NM_006094chr822443 937 12003 12285 --
NM_006095chr484298 3199 2896 1330 768 682 220 30 1437 173 24291 2949
NM_006106chr1162995 2974 497 243 184 169 --2819 173 --
NM_006107chr171474 ------
NM_006113chr121499 155 11604 ----
NM_006122chr1542711 2680 816 152 11113 ----
NM_006133chr1172147 809 743 536 470 361 261 --21785 137 --
NM_006134chr2111330 --1186 --
NM_006135chr15979 344 206 200 99 ------
NM_006136chr721148 226 ----1445
NM_006139chr222777 717 12375 ----
NM_006141chr1632611 2022 202 --159 22478 2317
NM_006148chr1752912 2352 2335 1868 589 ------
NM_006153chr32441 25 1422 ----
NM_006154chr1522046 659 32778 2446 2315 ----
NM_006155chr251900 1810 1625 691 549 --1590 --
NM_006158chr831558 1392 329 1336 ----
NM_006159chr121115 ----132
NM_006160chr171155 ------
NM_006166chr1262626 2393 2383 1692 921 154 --1668 1622
NM_006178chr1731526 1293 1186 11544 ----
NM_006180chr931796 751 500 11822 11948 --
NM_006183chr121524 ----1574
NM_006186chr241235 482 327 182 ------
NM_006192chr202888 823 ----11140
NM_006194chr1431083 963 148 ------
NM_006195chr9--1196 1489 --
NM_006196chr22286 36 ------
NM_006197chr831944 1606 479 12057 12264 --
NM_006203chr545319 4757 3929 447 22179 1325 ----
NM_006206chr441948 673 547 473 31027 687 564 ----
NM_006209chr8----2370 363 --
NM_006216chr23697 266 44 1603 --187
NM_006218chr3----153 --
NM_006224chr1742399 2101 1904 1680 ------
NM_006226chr211304 ----1315
NM_006238chr672016 1957 1894 1807 796 690 613 ------
NM_006241chr332349 1592 927 ----11652
NM_006242chr2061778 1763 1726 379 130 66 22090 1339 1329 --
NM_006246chr141292 1299 1395 1404
NM_006247chr19--1484 ----
NM_006252chr166070 5945 5621 1824 954 24 37409 4780 1648 --16557
NM_006256chr142173 1869 903 731 1698 ----
NM_006258chr1031275 640 569 2537 33 ----
NM_006259chr41929 3777 744 282 21015 882 1237
NM_006265chr821338 1119 --1473 --
NM_006267chr211248 1270 ----
NM_006275chr2042279 2038 484 333 ----21673 977
NM_006277chr2----1550 --
NM_006281chr83811 260 180 ------
NM_006281chr83811 260 180 ------
NM_006282chr2074562 4486 3752 2904 1669 1315 512 --11013 --
NM_006283chr864831 4680 1961 909 544 136 31947 1442 334 24487 269 11903
NM_006293chr1531018 998 373 --1360 --
NM_006294chr82493 33 ----1179
NM_006306chrX55106 4237 2078 1816 224 21487 1107 54743 4252 3954 1118 132 --
NM_006310chr1721013 32 --1315 1904
NM_006313chr1231347 274 40 1332 ----
NM_006320chr43887 370 95 ------
NM_006323chr4198 ----1724
NM_006325chr121255 1134 --1826
NM_006328chr111208 --2536 156 --
NM_006330chr851557 1465 1421 1367 1356 1105 ----
NM_006343chr22140 48 ------
NM_006352chr132080 1701 692 21823 580 ----
NM_006359chrX72457 1995 1739 1664 463 374 259 ----12287
NM_006366chr631241 887 351 11063 ----
NM_006367chr1----1940 --
NM_006371chr385191 4871 4352 3989 1735 1636 1075 319 --11502 --
NM_006375chrX11595 21566 272 1341 --
NM_006377chr931239 969 446 ------
NM_006380chr1743620 1652 1351 697 24386 2717 --11446
NM_006393chr1054558 4296 3239 1394 928 13938 24220 235 --
NM_006400chr12----155 --
NM_006403chr621562 1221 21655 387 ----
NM_006416chr62774 654 1289 1171 --
NM_006420chr2062598 2563 1234 1190 564 398 33006 2132 791 12882 --
NM_006434chr106968 846 609 464 339 200 43047 2905 2542 2432 1553 --
NM_006439chr4165 1476 ----
NM_006449chr232062 801 145 1476 ----
NM_006451chr51287 --21017 977 --
NM_006459chr1041373 617 265 237 1291 ----
NM_006464chr254204 4059 4027 3863 3840 24705 3888 32926 374 107 --
NM_006466chr201129 ------
NM_006467chr542337 2182 1592 359 12010 1338 --
NM_006469chr121451 101 --11095 --
NM_006476chr112747 75 ------
NM_006478chr221183 ------
NM_006480chr51497 ------
NM_006482chr1283777 3623 3577 3103 2808 2734 1144 47 13314 1878 13896
NM_006489chr1441930 1823 368 95 --11315 --
NM_006494chr191630 ------
NM_006495chr17165 ------
NM_006504chr1041888 359 140 63 22879 153 1230 --
NM_006520chrX41688 1572 1271 223 193 ----
NM_006526chr202602 498 --1186 1336
NM_006527chr43743 735 106 2507 129 ----
NM_006534chr2073414 2836 2594 1307 700 331 211 12731 13179 --
NM_006538chr264185 4147 3482 3211 992 867 --13741 --
NM_006544chr1495809 5507 5144 4218 4102 3881 1987 1675 467 24658 926 14748 --
NM_006546chr17116429 6132 5852 4265 2432 2043 2033 1942 1736 1097 502 ------
NM_006547chr721923 443 31789 520 404 ----
NM_006548chr31424 ------
NM_006549chr1252724 2347 2294 639 55 --11039 --
NM_006555chr761950 1556 1530 1489 1328 423 --21406 608 --
NM_006557chr961714 1560 612 538 409 371 --1353 --
NM_006558chr82481 376 ------
NM_006559chr12390 338 ------
NM_006561chr10106025 5677 5516 5431 4326 2432 2273 2109 1242 1235 1683 15861 --
NM_006565chr1621271 240 --1889 --
NM_006572chr1773461 3287 3100 2193 1037 645 478 ------
NM_006574chr32271 245 1102 ----
NM_006575chr1421161 1154 1400 ----
NM_006577chr221127 1098 21116 410 ----
NM_006580chr31121 --1198 --
NM_006591chr1141920 1399 431 201 --21284 779 --
NM_006593chr21549 ------
NM_006595chr1131367 519 153 --1396 --
NM_006599chr16167877 7283 6067 5755 5738 5627 5390 3278 3253 3174 2930 2888 2847 1997 342 190 48205 6698 5189 3145 11564 --
NM_006600chr11191 ------
NM_006601chr121447 ------
NM_006602chr20--1541 1771 --
NM_006603chrX3423 391 250 --11672 --
NM_006609chr243003 2573 1867 616 11856 ----
NM_006612chr172476 42 ------
NM_006614chr353053 2762 2239 909 344 13371 ----
NM_006621chr191783 1736 1677 814 749 743 560 474 323 11471 --21911 393
NM_006622chr52490 136 ------
NM_006624chr1022135 162 ------
NM_006625chr121085 989 ------
NM_006625chr121085 989 ------
NM_006625chr121085 989 ------
NM_006628chr1564487 4389 4297 2976 1297 137 24630 4598 --131
NM_006629chr1832527 2418 952 32500 1886 959 ----
NM_006633chr51164 1740 ----
NM_006640chr1721845 1380 --1759 --
NM_006646chr13--11904 12168 23005 577
NM_006654chr1231289 1015 375 14785 14089 --
NM_006662chr16----169 --
NM_006667chrX2231 113 ------
NM_006670chr6----1174 --
NM_006675chr1263042 2206 1263 1003 873 35 ----11091
NM_006693chr73803 298 147 ------
NM_006699chr13862 719 274 ------
NM_006700chr122761 224 ------
NM_006703chr61163 ------
NM_006706chr51308 2796 783 ----
NM_006717chr911101 12695 13339 --
NM_006718chr63756 325 271 ------
NM_006720chr1075023 4770 1906 1705 1247 967 331 ------
NM_006722chr332964 2948 701 ------
NM_006726chr42198 137 ------
NM_006727chr5----1504 --
NM_006729chrX105275 5215 4677 4143 1965 1931 1646 1583 1137 824 25232 669 ----
NM_006731chr965494 4770 4748 1391 855 196 25600 1783 --12134
NM_006734chr621122 117 ------
NM_006735chr71366 ------
NM_006746chrX21132 528 ----1191
NM_006750chr1657252 4894 2447 1313 439 15132 11185 47349 6701 283 134
NM_006751chr23969 343 87 1848 1347 --
NM_006754chr71928 ------
NM_006756chr841370 1012 358 348 31544 1235 1114 ----
NM_006763chr131551 753 277 ------
NM_006766chr842292 1768 977 556 ------
NM_006769chr11577 1690 ----
NM_006775chr612183 12296 163 --
NM_006777chrX32781 2115 539 22529 2478 21992 513 1381
NM_006800chrX1162 ------
NM_006802chr131126 888 99 ------
NM_006805chr551656 1339 1307 609 349 --1686 --
NM_006807chr171372 ------
NM_006823chr821286 476 1142 ----
NM_006826chr22926 204 ------
NM_006827chr1442317 2211 1174 1074 --12200 12180
NM_006832chr142971 952 ------
NM_006833chr72144 125 ------
NM_006838chr1241429 1325 706 207 ------
NM_006846chr51109 ------
NM_006852chr1752746 2269 1115 1071 516 11051 12236 --
NM_006861chr1232071 1957 361 ------
NM_006868chr1833176 2541 2083 22356 267 --162
NM_006870chr203747 252 54 ------
NM_006873chr252417 947 928 267 73 22464 1293 ----
NM_006874chr43891 194 33 --1468 --
NM_006875chrX2600 270 ------
NM_006884chr32456 375 ----11942
NM_006885chr1664078 3353 1296 608 437 244 23464 469 22750 1575 1695
NM_006888chr1452974 2399 2160 851 277 1904 22679 1236 --
NM_006892chr2021384 953 1389 ----
NM_006892chr2021384 953 1389 ----
NM_006894chr1160 ------
NM_006897chr121638 ------
NM_006908chr741468 1344 1338 940 ------
NM_006910chr161373 1355 ----
NM_006915chrX52491 2227 2162 1688 703 32582 750 106 ----
NM_006918chr1185881 5831 5638 3839 3752 2234 1211 935 35785 4598 4549 1145 --
NM_006920chr242036 1623 421 400 22027 1563 --1240
NM_006922chr251944 1885 1757 843 617 11952 1233 --
NM_006924chr1774324 3129 2975 2879 2763 893 787 --1773 21308 856
NM_006925chr142490 349 176 ----
NM_006930chr52771 209 --11675 --
NM_006937chr171489 ------
NM_006939chr1431083 932 835 --1787 --
NM_006940chr1251279 641 265 115 103 ------
NM_006941chr2211093 ------
NM_006947chr461595 1483 1219 1206 719 277 ------
NM_006948chr2132378 814 789 --1568 11577
NM_006963chr1031232 1183 126 ------
NM_006965chr1821063 921 ------
NM_006981chr942949 2493 278 51 12608 12861 --
NM_006982chr12186 2305 103 ----
NM_006996chr121579 1345 11798 11222 1748
NM_006997chr103404 183 61 ------
NM_007005chr921265 160 --11244 11167
NM_007007chr1244121 3888 1564 1539 53309 1480 1442 726 351 11424 --
NM_007008chr21210 ------
NM_007011chr15116664 5873 4545 4486 4367 2723 2049 1990 1497 1021 593 2621 451 25131 597 --
NM_007013chr83986 750 369 ------
NM_007023chr21947 1271 ----
NM_007026chr172555 187 --1533 --
NM_007030chr5105183 5068 4407 4327 4029 3935 1497 1355 1284 354 15233 15017 --
NM_007034chr12953 806 2920 304 1755 --
NM_007036chr5--2232 205 1626 --
NM_007038chr21105963 5490 4914 4759 4070 3916 3850 3681 1167 559 11602 ----
NM_007042chr342066 577 532 196 2672 116 ----
NM_007047chr642550 2541 2432 889 22410 72 12440 --
NM_007050chr2086920 5240 2864 2782 2049 1306 464 41 28077 6849 ----
NM_007054chr523080 427 23306 2562 ----
NM_007064chr31282 1371 ----
NM_007067chr1721240 272 ----11460
NM_007068chr22--21045 974 ----
NM_007073chr634061 3466 1641 --13329 12608
NM_007078chr1082918 2549 1944 1902 1189 1183 47 23 ----12999
NM_007097chr5195 ------
NM_007106chr1352786 2576 2184 1932 51 21889 1106 ----
NM_007114chr322563 402 22463 486 ----
NM_007115chr2175 ------
NM_007118chr5----151 --
NM_007120chr2--178 ----
NM_007124chr671842 1796 1651 1487 685 414 123 ------
NM_007125chrY21429 179 ------
NM_007129chr132915 732 196 1295 --
NM_007137chrX105098 4816 4454 4279 4041 3716 3698 1849 1188 986 15319 ----
NM_007146chr1762732 2134 2124 2032 760 541 ------
NM_007158chr12792 330 --11204 --
NM_007159chr341565 1072 599 254 --11089 --
NM_007166chr112214 84 --1277 --
NM_007172chr2242303 463 164 42 --12066 12082
NM_007174chr1242034 1798 816 332 11885 173 --
NM_007175chr873534 3443 2685 2412 1426 813 584 ------
NM_007176chr1431126 464 393 --1690 --
NM_007178chr121310 ------
NM_007184chr32545 153 --1400 --
NM_007187chr131272 196 1238 --
NM_007191chr12152 ------
NM_007192chr141904 --1252 --
NM_007197chr122665 346 1874 ----
NM_007203chr963905 3256 3099 2943 2911 1155 13297 ----
NM_007212chr11793 21637 389 --1713
NM_007217chr31400 ------
NM_007220chrX53413 3090 1604 254 66 14942 --14822
NM_007222chr841775 1696 1587 680 --11456 --
NM_007236chr1562045 1808 709 367 264 115 12161 11916 1269
NM_007246chr41946 ------
NM_007249chr1389022 7498 7415 6300 1347 1151 474 87 21701 234 17890 25955 2431
NM_007269chr11190 1219 ----
NM_007279chr191606 ------
NM_007282chr331003 961 788 --1745 1802
NM_007283chr363009 2954 2501 2362 2112 1134 1261 ----
NM_007294chr171288 31205 1170 924 11350 --
NM_007295chr171288 31205 1170 924 11350 --
NM_007296chr171288 31205 1170 924 11350 --
NM_007297chr171288 31205 1170 924 11350 --
NM_007298chr171288 31205 1170 924 11350 --
NM_007299chr171288 31205 1170 924 11350 --
NM_007300chr171288 31205 1170 924 11350 --
NM_007302chr171288 31205 1170 924 11350 --
NM_007303chr171288 31205 1170 924 11350 --
NM_007304chr171288 31205 1170 924 11350 --
NM_007305chr171288 31205 1170 924 11350 --
NM_007308chr4--1257 137 --
NM_007324chr1198 ------
NM_007325chrX21978 118 22054 603 1533 --
NM_007331chr452642 2149 2100 939 620 22091 1806 --12004
NM_007345chr18--31740 1558 97 ----
NM_007347chr152605 337 23113 2658 32856 1209 250 12817
NM_007349chr73334 288 72 1356 ----
NM_007350chr1264439 4205 3782 3571 3365 1183 11348 11560 --
NM_007358chr121621 758 ------
NM_007363chrX2800 707 ------
NM_007373chr1021789 1236 1205 1132 21137 569
NM_007374chr141354 ------
NM_007375chr152121 2018 1102 1058 238 ------
NM_009585chr32828 320 --1832 --
NM_009585chr32828 320 --1832 --
NM_012062chr122360 45 --1280 --
NM_012074chr142790 455 --1973 --
NM_012081chr573765 2575 1068 910 814 651 225 23616 2424 ----
NM_012082chr8--1624 --1712
NM_012089chr11305 --11121 1310
NM_012090chr141060 960 834 386 196 ----
NM_012095chr1053484 2536 2212 712 575 --23414 2647 --
NM_012096chr342862 2500 823 727 11257 21296 255 --
NM_012104chr1173689 2992 2588 472 437 271 223 11060 13010 --
NM_012104chr1173689 2992 2588 472 437 271 223 11060 13010 --
NM_012106chr163322 123 101 2936 882 ----
NM_012110chr41238 ------
NM_012120chr642944 2757 2705 2405 1750 2812 369 --
NM_012129chr732198 1921 1904 52331 2314 2006 304 23 1151 --
NM_012137chr142570 2227 700 684 2803 207 12240 --
NM_012141chr1351638 1227 1016 900 653 23811 1666 1336 --
NM_012153chr1132515 457 329 ------
NM_012154chr81835 1230 ----
NM_012156chr2033124 1344 210 13454 --11349
NM_012158chr1341652 1301 1152 412 11847 --1698
NM_012164chr9117211 6247 6015 5243 4703 1800 1073 960 533 369 206 27058 484 26347 338 --
NM_012175chr11--1931 --147
NM_012193chr1185423 5290 4292 2003 976 741 718 541 25315 3497 ----
NM_012197chr951535 1515 1394 1251 647 --1204 1571
NM_012199chr134152 3075 1467 1323 11032 13627
NM_012208chr5124 1737 ----
NM_012214chr256312 5931 998 935 42 35678 5371 1753 35637 1652 236 24693 4434
NM_012218chr1952996 2137 2118 2018 350 ----11877
NM_012223chr21386 21174 399 1521 --
NM_012229chr10176 --1489 --
NM_012233chr221186 901 --1423 --
NM_012234chr383662 3649 3516 3414 3376 2615 1287 290 33541 3176 613 12423 --
NM_012238chr102643 469 21093 376 11107 --
NM_012247chr101177 1994 ----
NM_012248chr161665 1721 1577 --
NM_012250chr1151409 1301 858 456 378 11391 --11161
NM_012252chr755244 5215 1914 1153 176 44950 4890 1777 349 ----
NM_012253chrX2644 462 ------
NM_012259chr6--21335 1227 --1551
NM_012261chr201549 ------
NM_012262chr194677 3783 2110 1636 1316 530 514 435 85 23508 593 24070 1092 --
NM_012279chr551677 650 612 303 171 ------
NM_012281chr742282 1825 733 196 1486 --1386
NM_012286chrX1192 ------
NM_012287chr374348 4191 4123 3661 3517 3203 2770 ------
NM_012288chr665480 4806 1381 739 545 337 13899 ----
NM_012290chr231409 275 250 21301 1041 --21562 484
NM_012294chr783722 3647 3257 2883 2533 1594 872 97 24096 1370 --11351
NM_012297chr492544 2530 2401 2393 2206 1757 325 194 63 --1362 --
NM_012300chr532458 2257 2226 ----12369
NM_012302chr11262 --11202 --
NM_012304chr511675 11814 --12490
NM_012308chr112762 669 ----11776
NM_012309chr1143906 3711 3301 718 43067 1921 1781 62 11114 --
NM_012310chrX2534 213 1589 ----
NM_012316chr195556 4263 4106 4077 3427 2248 1953 1449 114 14476 --11468
NM_012320chr164905 512 248 44 --1234 --
NM_012328chr751421 1311 1132 496 190 21074 62 ----
NM_012329chr1721306 1230 ------
NM_012330chr103592 511 224 1659 --1310
NM_012334chr594461 3221 3102 2951 1769 1511 1132 849 30 ----13707
NM_012338chr72765 400 2463 213 ----
NM_012342chr102422 58 --1448 --
NM_012347chr632392 2034 1197 12935 ----
NM_012382chr594553 3910 3445 1822 1528 1236 1171 1018 803 24450 1315 13961 --
NM_012388chr1552604 2364 593 433 399 ------
NM_012394chr12103 83 ------
NM_012399chr2241770 1622 1498 518 ------
NM_012414chr13537 296 224 1288 ----
NM_012416chr951247 483 354 305 279 --1104 --
NM_012417chr17----1446 1432
NM_012428chr151361 1256 1706 2334 56
NM_012429chr2221393 871 1451 ----
NM_012431chr773347 3256 3033 2984 918 513 257 ------
NM_012434chr621650 674 --1238 --
NM_012449chr7174 ------
NM_012463chr1241673 1648 1492 474 2253 161 ----
NM_012464chr452846 2121 918 884 432 12811 ----
NM_012465chr1013076 1248 23138 740 1240
NM_012471chrX11625 --11347 --
NM_012479chr742434 2241 929 653 21090 291 ----
NM_012482chr11562 ------
NM_013231chr1474356 4256 3839 3072 2784 1065 1031 2556 254 11304 --
NM_013233chr241353 938 930 419 --11111 --
NM_013243chr1521493 970 1116 ----
NM_013254chr122450 174 ------
NM_013255chr7118771 6267 6060 5942 5883 5722 2298 1951 1783 1537 547 47678 2845 1866 1307 26446 5349 28809 1806
NM_013257chr82397 284 --22316 544 --
NM_013261chr411056 43628 3270 1093 838 13564 21189 201
NM_013262chr611443 1119 ----
NM_013269chr1243199 3093 977 183 11383 2984 207 --
NM_013277chr121686 1921 --1979
NM_013281chr2021217 187 11407 ----
NM_013282chr1911115 134 ----
NM_013286chr363493 3115 2779 2672 428 246 11267 13059 --
NM_013293chr72669 590 ----1551
NM_013316chr71431 ------
NM_013354chr811020 ------
NM_013357chr82841 808 ------
NM_013358chr141668 1386 666 38 --11323 --
NM_013372chr1511308 13390 11134 1216
NM_013374chr392774 2716 2698 2258 1995 958 737 671 193 23156 2885 22865 2125 --
NM_013377chr121532 ------
NM_013381chr124902 860 611 111 --12123 --
NM_013382chr1452293 1611 1529 882 117 ------
NM_013386chr121606 1295 ----1673
NM_013390chr911190 21125 194 184 --
NM_013396chr2131382 562 88 ----11513
NM_013434chr23610 318 121 ------
NM_013434chr23610 318 121 ------
NM_013436chr21680 1535 ----
NM_013437chr851351 1276 939 434 425 21304 335 --1297
NM_013438chr941662 1546 1186 106 11468 ----
NM_013444chrX11094 ------
NM_013448chr141177 ------
NM_013449chr1231966 757 284 12025 2883 77 --
NM_013960chr81653 --1297 --
NM_013995chrX62373 2116 1871 1673 207 26 --12239 --
NM_014000chr102724 546 --11406 11214
NM_014007chr941018 862 396 90 1376 ----
NM_014010chr91560 ------
NM_014011chr252594 895 727 144 26 22409 2353 1590 --
NM_014016chr331536 1512 1202 --21598 1451 --
NM_014021chr173073 3005 2839 2617 2268 1287 517 23293 2814 ----
NM_014023chr1062465 2297 2264 1779 670 526 --11156 --
NM_014034chr6--21519 1379 --11465
NM_014043chr311384 21638 339 ----
NM_014056chr362356 1682 1447 930 748 440 11950 1648 --
NM_014059chr132241 87 ----166
NM_014071chr20--1502 ----
NM_014089chr13--1407 ----
NM_014106chr1532733 2683 415 12726 --11989
NM_014112chr8105486 5293 4494 4241 4155 3917 1746 1311 1290 993 --1242 --
NM_014153chr161218 2513 453 ----
NM_014154chr331452 1132 392 ------
NM_014155chr11117369 6543 5400 2881 2455 2396 1782 1513 824 689 217 22038 559 15612 11787
NM_014181chr242182 1074 728 501 42888 2734 2707 316 --12916
NM_014186chr1162333 1973 1765 1607 840 569 ------
NM_014217chr131526 1493 1343 11773 ----
NM_014228chr521429 1094 ------
NM_014232chr1751188 617 593 327 153 ------
NM_014232chr1751188 617 593 327 153 ------
NM_014240chr354131 3148 3099 2931 54 13222 ----
NM_014241chr101275 --1355 --
NM_014243chr432158 1843 250 ------
NM_014245chr311039 ------
NM_014253chrX41960 1751 1616 465 22417 566 ----
NM_014263chr1011399 11217 ----
NM_014264chr41656 ------
NM_014271chrX2731 82 ----190
NM_014278chr41461 ------
NM_014279chr93635 337 64 1825 ----
NM_014283chr12610 419 ------
NM_014294chr82170 116 --21352 1322 --
NM_014296chr331267 1006 313 ------
NM_014309chr2231513 1089 536 1415 25142 2067 11653
NM_014317chr10--1318 1273 --
NM_014319chr1261950 1594 1246 489 176 30 --11861 11964
NM_014322chr111142 ----11072
NM_014323chr222754 45 ------
NM_014325chr121458 --11921 --
NM_014338chr222826 422 --127 --
NM_014342chr1131067 587 540 ------
NM_014345chr621061 249 11002 ----
NM_014350chr531156 434 390 --157 1930
NM_014361chr111352 ------
NM_014363chr1321259 101 21131 950 ----
NM_014368chr951732 1457 1362 1348 1312 --21974 174 --
NM_014372chr142067 796 607 287 22102 1906 --11706
NM_014376chr532492 1674 672 12472 ----
NM_014382chr331660 1171 156 1134 ----
NM_014392chr491424 1409 545 473 467 414 362 231 129 ------
NM_014393chr842177 1730 1602 450 --187 --
NM_014399chr7--2845 181 165 1968
NM_014408chr12541 441 ------
NM_014415chr311282 11252 ----
NM_014421chr462015 1865 1500 541 495 356 1466 ----
NM_014423chr5135158 4679 4539 4091 3896 3811 2077 1723 1340 1087 871 707 522 13701 15377 --
NM_014426chr202459 183 ------
NM_014445chr331780 355 238 21634 925 --21774 860
NM_014447chr411050 --1168 --
NM_014454chr65839 418 409 162 138 1315 ----
NM_014456chr1031212 1175 418 ----1400
NM_014458chr11899 ------
NM_014469chr111201 --1130 1228
NM_014470chr121789 ------
NM_014472chr10--1108 ----
NM_014491chr731021 938 673 ------
NM_014494chr1632010 1720 561 32357 1993 235 ----
NM_014496chrX------193
NM_014497chr2--1222 ----
NM_014500chrX--1244 ----
NM_014504chr72499 477 ------
NM_014521chr23228 64 23 --11840 --
NM_014547chr15------1203
NM_014547chr15------1203
NM_014563chrX32027 1702 1654 ------
NM_014570chr222833 108 ------
NM_014572chr1331643 1133 333 1553 ----
NM_014573chr17--11689 11429 1638
NM_014584chr1441602 655 381 171 ------
NM_014585chr231234 1162 27 ------
NM_014586chr2164294 3174 1034 839 668 340 --14492 --
NM_014600chr221667 1265 ------
NM_014602chr31349 ------
NM_014606chr431128 1008 295 11452 ----
NM_014607chr21772 --31476 808 192 1222
NM_014612chr931470 1275 1072 1538 1597 --
NM_014613chr562813 2286 2272 2154 1234 149 ------
NM_014615chr1643409 2259 1196 981 ------
NM_014616chr362695 2487 2209 1261 529 297 32474 417 207 169 --
NM_014620chr121254 --1209 --
NM_014629chr881339 1332 1249 953 937 498 288 22 1317 --11139
NM_014630chr1583479 2578 822 739 631 462 306 217 13165 ----
NM_014633chr111585 1169 ----
NM_014635chr231215 697 658 --11360 --
NM_014636chr923363 820 33914 3719 3262 13148 14108
NM_014637chr831029 430 63 ------
NM_014644chr11914 1993 1104 --
NM_014646chr1841264 508 437 270 32543 2280 2227 22134 75 --
NM_014647chr1611999 1243 11728 --
NM_014655chr141473 722 408 26 1166 --1707
NM_014659chr151777 1431 --1454
NM_014665chr893426 3083 2725 2535 1440 1431 849 602 116 --22709 2408 --
NM_014666chr531328 1126 76 11049 ----
NM_014667chr342044 1869 947 290 ----1554
NM_014670chr231225 1011 549 21520 1294 ----
NM_014673chr8--1292 1115 --
NM_014677chr8--1960 ----
NM_014682chr862175 2037 1887 1615 1606 62 11954 181 --
NM_014686chr1952484 805 775 348 251 ----22058 745
NM_014689chr21107 ------
NM_014699chr162391 320 ------
NM_014701chr1543095 2155 1269 820 21136 489 ----
NM_014702chr621110 371 12497 13312 --
NM_014705chr732097 595 168 31660 818 189 --12127
NM_014707chr752276 335 301 265 199 ----21611 457
NM_014709chr21600 ------
NM_014712chr161585 ------
NM_014713chr22352 185 ----1163
NM_014717chr194868 791 309 78 ------
NM_014719chr7------11104
NM_014720chr1051360 607 406 329 277 11513 ----
NM_014721chr6107380 7239 5301 4987 4940 1680 1339 1086 431 314 --25129 2395 --
NM_014726chr172881 127 ------
NM_014729chr832320 1607 111 ------
NM_014733chr542234 2014 1525 289 144 ----
NM_014735chrX52055 2012 1480 332 89 ------
NM_014738chr1721050 749 ------
NM_014742chr2031435 666 246 --11371 --
NM_014743chr472749 2571 1966 1081 936 809 654 --22597 74 32551 204 181
NM_014747chr165212 3677 3662 1249 107 49 11618 --1887
NM_014751chr842066 1587 822 641 ------
NM_014752chr1141738 742 545 372 3264 106 42 1219 --
NM_014755chr243748 3709 1309 535 ------
NM_014757chr542397 2262 1823 217 ------
NM_014761chr1621024 170 --21187 112 --
NM_014764chr1211202 ------
NM_014765chr132581 2241 519 1308 22407 752 --
NM_014766chr743108 2559 265 138 --12477 --
NM_014779chr31456 ------
NM_014781chr81492 21157 360 --1331
NM_014784chr131082 1005 249 --11086 --
NM_014786chr1111235 ------
NM_014795chr23216 76 70 1182 --11312
NM_014802chr123455 389 52 1765 ----
NM_014803chr1072766 2456 2269 2252 2052 1914 1030 11986 12305 1498
NM_014810chr153659 1334 910 254 33 ------
NM_014812chr1--21698 425 ----
NM_014819chr562281 1980 1936 1854 493 465 22391 1718 11826 --
NM_014820chr3--21440 232 ----
NM_014824chr1141674 1244 1234 28 --11844 --
NM_014826chr164255 4145 3296 2838 1694 1655 13225 --13899
NM_014827chr141275 609 601 423 1484 ----
NM_014830chr1253384 1133 1095 167 52 --2572 347 13158
NM_014832chr1351694 1572 743 212 121 ------
NM_014835chr2032214 2087 186 22267 629 ----
NM_014836chr1051967 1532 1391 631 278 11253 ----
NM_014839chr172500 2300 2124 1941 977 459 143 22539 536 1777 --
NM_014840chr1282982 2907 2880 2111 2103 723 716 684 --1782 --
NM_014841chr651158 1102 433 190 76 --1926 --
NM_014849chr12398 287 ------
NM_014850chr374878 4430 4262 4245 4167 3562 1557 ----12976
NM_014857chr1--1228 ----
NM_014872chr92577 161 --21561 833 22051 1982
NM_014873chr123676 3467 14248 24036 195 --
NM_014877chr17127769 7244 6394 5679 5601 5353 4741 2776 2425 1805 1034 739 25263 3097 11712 1143
NM_014883chr431785 1606 741 11569 ----
NM_014888chr741287 339 250 153 11458 ----
NM_014893chrY22052 231 11772 12267 12329
NM_014897chr1742930 2271 1235 1042 ------
NM_014898chr192310 146 1189 --12144
NM_014900chr22930 772 --1976 --
NM_014901chr562274 2222 2052 1787 544 296 ------
NM_014902chr20188 ------
NM_014903chr1222103 1869 21593 170 ----
NM_014904chr1073779 3486 2937 2748 2726 1330 718 --11494 --
NM_014905chr241683 1476 545 263 --1329 --
NM_014906chr1783722 3352 2631 2490 1629 1243 789 712 23589 426 12625 12775
NM_014912chr1073471 3354 3185 2871 2764 1171 696 12572 ----
NM_014915chr1021372 1032 ----11075
NM_014917chr1168 --2785 190 --
NM_014918chr1531204 614 379 1195 ----
NM_014920chr633564 3459 587 ------
NM_014921chr1952791 2608 1910 1040 424 ----12009
NM_014923chr1312237 1429 ----
NM_014924chr1453089 2579 2183 2128 368 ----22951 2665
NM_014925chr12--1111 ----
NM_014932chr311756 1503 2653 477 --
NM_014933chr4--155 1139 --
NM_014937chr10--21324 1101 ----
NM_014938chr1292459 2379 2358 2217 2067 1998 915 697 311 --22024 179 --
NM_014942chr61425 21991 476 --12412
NM_014945chr541823 1676 794 374 ----11505
NM_014946chr232683 881 644 32562 2420 2316 1811 --
NM_014947chr173157 3006 2967 2624 838 283 95 ------
NM_014949chr11804 ----2931 201
NM_014950chr141313 --1672 1243
NM_014952chr151806 --11301 --
NM_014962chr2062257 2200 2171 2019 1832 1105 12906 --11137
NM_014965chr342193 2170 2035 337 ----1149
NM_014974chr1061761 1255 1230 1142 459 331 41791 1678 577 480 ----
NM_014978chr101213 --11547 --
NM_014982chr1474161 3859 3846 2131 1152 916 714 14400 --1263
NM_014988chr412292 ------
NM_014989chr641903 1552 548 498 1631 ----
NM_014990chr1411083 ----2924 879
NM_014991chr443005 2031 1197 840 1128 ----
NM_014992chr141229 ------
NM_014996chr32692 430 --1153 --
NM_014997chr752575 2246 2183 979 37 ------
NM_014999chr1221624 539 1162 11189 --
NM_015000chr1243133 3025 1935 217 13102 ----
NM_015001chr11183 ------
NM_015002chr1262181 1881 1539 910 98 32 22216 2208 ----
NM_015008chr363436 3247 2653 2474 1313 1058 --13588 --
NM_015012chr111360 ------
NM_015017chr111152 21296 955 ----
NM_015020chr1633407 2376 513 23848 61 32927 1181 707 --
NM_015023chr141527 1512 157 31 11318 1585 --
NM_015024chr83946 434 195 --21360 1263 --
NM_015025chr262696 2613 2419 2329 930 60 --1254 --
NM_015026chr12114642 3577 3159 2971 2960 1869 1202 1092 773 475 319 44504 1859 1770 571 ----
NM_015027chr1621989 596 21351 1337 --1476
NM_015032chr1322898 2472 21106 575 --1113
NM_015035chr20156585 6514 6243 6040 5184 5038 4451 2532 2217 831 817 659 585 110 81 36284 1559 343 ----
NM_015039chr144382 2978 1179 115 14336 13363 --
NM_015040chr263172 3042 2965 2439 1059 314 ----1415
NM_015045chr1052276 1823 817 356 341 1173 1234 1768
NM_015049chr212567 12843 1503 --
NM_015051chr923259 2141 --1203 --
NM_015052chr7--11015 1220 --
NM_015055chr1122897 882 --11183 22641 752
NM_015057chr132459 170 ------
NM_015061chr91717 ------
NM_015068chr7183974 3957 3620 3283 2989 2909 2692 2677 2592 2563 2468 1599 1565 1547 1495 1455 728 410 179 1613 13779
NM_015069chr162218 141 ------
NM_015071chr576368 6038 4529 2279 1893 386 118 35260 5048 1780 255 25 11161
NM_015074chr1114972 4421 4328 4149 3817 3577 3358 3107 2003 405 198 13350 ----
NM_015076chr654072 3624 3174 1802 520 11126 --24493 3668
NM_015077chr1794696 4613 4021 3806 3390 3283 2953 2933 27 11011 1336 11526
NM_015079chr1553206 3134 2865 2427 204 --32895 2614 2561 --
NM_015080chr113942 883 730 --1365 --
NM_015091chr142739 524 ------
NM_015092chr1654417 4177 3661 1424 1334 13089 1766 --
NM_015093chr63729 292 82 21493 137 1130 1218
NM_015094chr22104685 4285 4169 3151 3037 2871 1716 1428 1160 588 ------
NM_015097chr322299 429 1465 22351 1555 --
NM_015100chr11456 1348 --1240
NM_015115chr473153 2135 1113 1037 434 138 34 1664 22352 825 22891 2649
NM_015124chr2232534 2165 735 12324 ----
NM_015129chrX21501 636 --11780 --
NM_015130chr441365 1308 1155 353 ------
NM_015137chr852292 2255 1738 518 209 --1277 --
NM_015138chr1522101 775 11913 12065 --
NM_015143chr421448 574 ------
NM_015144chr1623359 3008 43956 2867 1375 1360 ----
NM_015153chr61672 --182 143
NM_015155chr1053022 2600 2474 510 40 ----11194
NM_015156chr1454017 3693 2936 1123 928 --23176 1342 --
NM_015158chr9--1690 2166 47 --
NM_015163chr1421322 1295 --21903 391 1484
NM_015170chr821590 799 11455 2264 231 1156
NM_015172chr141391 1370 531 168 ------
NM_015173chr411767 ------
NM_015176chr11616 --11393 --
NM_015185chrX42696 2674 2556 362 12978 ----
NM_015191chr1142362 934 851 443 --22462 536 --
NM_015192chr2042806 854 575 536 11182 1208 --
NM_015197chr1473445 3347 2912 2412 958 823 241 --165 --
NM_015199chr342470 2159 1188 125 ----12319
NM_015200chr432366 964 597 22581 1826 ----
NM_015206chr1513392 13212 1752 21307 1227
NM_015208chr1822658 1417 22989 1067 1290 11422
NM_015209chr15928 917 422 281 23 21826 818 22135 1774 --
NM_015215chr133185 3109 2868 11078 ----
NM_015225chr953076 2906 2470 2426 2091 --1338 --
NM_015231chr112688 187 ------
NM_015233chr1332346 2122 423 12096 --12056
NM_015236chr41256 21212 579 137 1194
NM_015239chr92472 22 ------
NM_015245chr652604 1898 995 902 555 ------
NM_015247chr1665370 4176 3982 3356 1360 497 25342 4397 33813 1470 517 13728
NM_015250chr921530 213 --11464 --
NM_015252chr2----1813 --
NM_015256chr5--1483 --1219
NM_015264chr2284859 4834 4756 4241 3536 3388 1150 201 --14409 --
NM_015265chr232669 2297 838 22688 2167 11798 --
NM_015268chr31745 ------
NM_015270chr1211827 --2906 110 --
NM_015271chr411497 --12660 --
NM_015272chr162529 508 --11339 --
NM_015275chr1231802 1726 569 21335 49 1596 --
NM_015278chr643086 1216 1206 61 ------
NM_015282chr253017 3006 2772 2497 2226 13028 2837 271 --
NM_015284chr141795 1461 431 157 ----12123
NM_015285chr1832211 867 539 22567 2540 ----
NM_015286chr1521880 404 42468 2194 523 508 ----
NM_015288chr593772 3515 3204 2436 2420 2388 1534 950 445 --187 11539
NM_015291chr1103203 3117 2234 1251 1053 942 895 734 435 427 1915 --13313
NM_015294chr1731156 1052 959 11104 ----
NM_015310chr8117536 7500 6795 5765 3315 3102 2210 1627 1217 657 582 28062 752 27266 6112 1338
NM_015313chr1144295 1601 1002 584 --33567 1536 1104 --
NM_015315chr593302 3184 2871 2291 2247 1165 1123 554 132 12894 12754 --
NM_015317chr232778 2503 1093 11857 ----
NM_015319chr12----1175 --
NM_015326chr131826 1082 52 11994 ----
NM_015328chr752448 2003 1194 880 707 ------
NM_015329chr1932753 1911 975 11887 1783 --
NM_015332chr763477 3166 2811 2798 1353 197 --32802 2452 1125 --
NM_015335chr1242230 849 814 68 ------
NM_015336chr1242591 610 575 31 11955 1735 --
NM_015338chr2041859 1322 1191 423 1579 1512 1144
NM_015339chr20--1341 ----
NM_015344chr851963 1506 658 575 284 4704 320 173 87 --1256
NM_015346chr1421503 1366 ------
NM_015347chr1222534 846 ----1786
NM_015349chr643034 2783 2273 898 --12173 13006
NM_015350chr1----1493 1172
NM_015355chr1721232 110 11614 ----
NM_015358chr2111083 ------
NM_015361chr21933 --183 --
NM_015365chrX63755 3555 3516 2976 566 187 34329 3566 2696 22731 1679 --
NM_015375chr154589 1529 1451 644 500 34760 4475 368 11094 --
NM_015378chr142504 1176 377 293 12240 ----
NM_015380chr22--1137 ----
NM_015382chr14195 --1162 --
NM_015385chr106968 846 609 464 339 200 43047 2905 2542 2432 1553 --
NM_015387chr211879 11685 2453 242 1278
NM_015393chr453699 3677 3575 2449 157 ------
NM_015394chr1262441 2215 2062 1956 573 358 21752 262 1785 --
NM_015396chr331371 1175 549 --11218 --
NM_015397chr91258 11856 ----
NM_015416chr122742 208 --196 --
NM_015419chrX41075 806 412 205 ------
NM_015423chr1131547 697 252 ------
NM_015435chr821495 547 1941 11172 --
NM_015436chr421140 797 33085 2705 2157 22642 513 1432
NM_015439chr61486 ------
NM_015442chr3124 ------
NM_015443chr1731471 455 252 --11035 --
NM_015446chr11491 31416 501 246 ----
NM_015455chr533969 2528 162 ----1204
NM_015458chr865349 4421 1784 592 234 198 45303 4977 3293 1724 21794 1180 --
NM_015459chr111219 ------
NM_015460chr361838 1548 1456 1389 392 305 11749 11486 1590
NM_015461chr182708 86 ------
NM_015464chr7185 ----11000
NM_015466chr31222 ------
NM_015469chr94592 119 107 37 1641 154 --
NM_015475chr22914 156 2777 27 11110 --
NM_015477chr152844 177 ------
NM_015483chr74893 788 759 357 158 1792 --
NM_015490chr103369 38 21 ------
NM_015497chr155980 928 713 449 231 1874 11035 --
NM_015508chr321445 210 1138 ----
NM_015509chr1231023 547 203 11458 ----
NM_015525chr611072 3982 780 771 ----
NM_015534chr121002 60 ------
NM_015542chr10----11010 --
NM_015550chr763319 3262 2902 2403 1342 508 ----13018
NM_015554chr1542661 2471 324 35 22734 2461 ----
NM_015555chr62373 170 21708 609 11640 --
NM_015560chr331139 382 87 --1755 1457
NM_015564chr533295 2754 1437 33484 523 185 --11442
NM_015565chr2121837 648 ------
NM_015568chr2033762 250 196 --44319 3291 1517 523 --
NM_015569chr1104743 4477 4198 4122 3639 1616 1475 1338 935 689 34490 3761 649 44674 1845 514 197 --
NM_015571chr631963 884 181 --1256 --
NM_015577chr531180 717 343 ------
NM_015584chr1721290 1163 ------
NM_015601chr102944 878 --1178 --
NM_015605chr1041530 1471 611 124 31419 236 113 --1630
NM_015610chr752474 2422 2245 557 72 ------
NM_015622chr7--1276 ----
NM_015626chr172922 264 11024 ----
NM_015630chr231137 221 30 1135 ----
NM_015634chr101144 1208 1361 --
NM_015635chr942229 2212 2119 581 --136 --
NM_015640chr163939 1920 1706 1684 1196 593 33665 608 478 14433 14453
NM_015652chr101586 ------
NM_015657chr22237 195 ------
NM_015676chr141369 ------
NM_015678chr131195 ------
NM_015691chrX1254 2567 497 ----
NM_015693chr43263 244 234 2130 63 ----
NM_015702chr21256 ------
NM_015713chr842874 2486 1246 433 23433 916 11039 --
NM_015716chr172750 129 ------
NM_015726chr131733 1560 291 ------
NM_015850chr892417 1893 893 817 753 531 195 103 65 12372 12151 12003
NM_015866chr141237 1202 1062 177 ------
NM_015872chr121552 1309 ------
NM_015878chr81822 12051 ----
NM_015879chr1898563 8246 8169 7869 6910 6524 3196 1124 550 22970 1460 1247 18432
NM_015885chr113865 308 44 ------
NM_015886chr885391 5351 3935 2200 1811 1229 838 104 84132 4075 4023 4009 3904 2150 1759 1351 1741 --
NM_015888chr143052 2946 2718 706 11117 --1893
NM_015902chr84323 285 204 147 ------
NM_015904chr22668 264 ------
NM_015906chr163560 3236 3075 1555 1461 1021 --14420 13572
NM_015908chr7----196 --
NM_015913chr1----1158 --
NM_015915chr141239 ------
NM_015920chr152588 522 ------
NM_015941chr82130 109 ------
NM_015955chr21515 ------
NM_015975chrX2604 140 11220 ----
NM_015986chr1711366 ----1219
NM_015995chr1575036 4418 4164 3859 3551 2006 339 24087 147 ----
NM_015999chr13707 677 668 166 ----
NM_016003chr752474 2422 2245 557 72 ------
NM_016009chr1114707 4602 4552 3735 3088 1505 1432 1058 1036 99 91 ------
NM_016018chr821960 732 --11000 --
NM_016019chr75988 892 676 275 245 ------
NM_016023chr841984 1963 1657 205 144 ----
NM_016025chr1651634 1414 774 485 454 ----11617
NM_016040chr141999 890 872 60 22332 938 1175 11880
NM_016045chr2031841 707 396 11268 ----
NM_016048chr53999 226 104 1729 1628 --
NM_016061chr23652 431 312 ------
NM_016066chr1123 ------
NM_016072chr1232356 1776 240 --22145 1851 --
NM_016073chr151887 --1976 --
NM_016076chr123169 2499 1495 22360 266 --
NM_016078chr171857 11041 ----
NM_016081chr462091 1980 1689 1472 776 385 1223 ----
NM_016083chr663355 2692 1118 902 669 150 --13901 --
NM_016084chr17148 ------
NM_016087chr721397 541 21529 1142 ----
NM_016090chr111340 ------
NM_016096chr831993 1351 540 ------
NM_016100chr202337 283 --1374 --
NM_016103chr5--1348 ----
NM_016106chr141130 ------
NM_016107chr5--128 11088 --
NM_016120chrX1249 ------
NM_016121chr13904 816 771 ------
NM_016131chr261915 1742 1564 885 687 165 12148 11573 --
NM_016132chr1593079 2843 2627 2618 2219 1362 1229 758 169 42641 2117 147 43 --32385 905 701
NM_016133chr21329 11142 --11670
NM_016138chr161114 ------
NM_016144chr51166 1710 ----
NM_016152chr32858 82 ------
NM_016201chr31284 1799 ----
NM_016205chr431048 563 539 1946 ----
NM_016206chr388287 8262 7015 3414 2894 2424 1478 694 49016 8600 2204 755 28356 1435 --
NM_016211chr4--155 1139 --
NM_016213chr15155 ------
NM_016220chr742110 1865 1845 687 174 ----
NM_016221chr562112 601 407 176 128 72 --1411 11710
NM_016224chr621738 1491 --1594 11762
NM_016226chr12----1137 --
NM_016227chr12610 419 ------
NM_016230chr6--1450 1409 --
NM_016231chr1721163 254 ----11357
NM_016234chr101212 --1753 1114
NM_016239chr172838 778 ------
NM_016248chr1333678 2794 960 13704 --32612 797 332
NM_016250chr143798 255 143 169 ----
NM_016252chr24894 717 357 270 ------
NM_016255chr642997 1309 699 693 22360 301 1741 21177 190
NM_016257chr152758 2515 1088 1063 538 ----12417
NM_016260chr2187670 7156 6800 6759 6204 5586 4854 4807 4707 4611 2530 2451 2329 1891 1728 1184 1000 970 46825 6355 6034 1776 36147 5774 5223 --
NM_016269chr421161 289 11061 --1167
NM_016271chr1811522 32316 1462 457 ----
NM_016272chr2242506 2264 341 317 ------
NM_016275chr322595 101 11837 1790 1382
NM_016287chr131541 1526 160 11756 ----
NM_016289chr272264 1554 932 684 170 105 47 124 2109 98 --
NM_016302chr31627 1335 ----
NM_016303chrX1104 1438 ----
NM_016308chr121485 57 21946 816 ----
NM_016312chr12----1216 --
NM_016315chr221766 699 21358 33 11476 --
NM_016316chr22509 186 ------
NM_016322chr943074 2027 1169 998 --32778 1173 960 1162
NM_016333chr161177 ------
NM_016337chr142339 120 ------
NM_016338chr5----2285 82 --
NM_016339chr1741710 1572 1319 1310 --11579 1171
NM_016340chr53311 101 83 ------
NM_016353chr832381 1798 631 32142 1566 748 11902 11699
NM_016356chr622818 506 32874 2591 85 ----
NM_016374chr121350 329 1369 11210 --
NM_016374chr121350 329 1369 11210 --
NM_016376chr1753625 3524 2662 1246 754 21274 1071 1290 --
NM_016377chr62496 414 21265 161 157 --
NM_016395chr1521353 159 197 --1423
NM_016396chr1542443 1029 943 406 12132 1466 --
NM_016422chr1152310 477 196 126 27 1278 ----
NM_016424chr1731979 1731 1445 --1486 --
NM_016436chr2012119 191 ----
NM_016441chr232017 875 237 11835 ----
NM_016454chr151300 1106 --1305
NM_016467chr221124 350 ------
NM_016470chr202501 344 ------
NM_016472chr1441199 1126 443 205 ----1394
NM_016480chr54735 327 161 153 ------
NM_016485chr662070 1968 860 787 493 383 ----1665
NM_016488chr122747 709 11730 ----
NM_016507chr1753223 2541 765 505 151 12998 11063 --
NM_016513chr633564 3459 587 ------
NM_016525chr94939 653 385 339 ------
NM_016529chr1321002 60 ------
NM_016530chr1542621 1387 737 100 23523 398 21491 104 --
NM_016531chr463758 3365 3079 2620 1353 247 23257 2949 31188 1132 388 --
NM_016570chr123490 315 184 ------
NM_016577chr384443 3971 3307 2820 1506 1480 1138 193 12888 11099 1262
NM_016578chr112498 25 ------
NM_016588chr66936 815 752 687 657 371 2809 112 ----
NM_016603chr512014 11924 ----
NM_016605chr542610 2592 1951 1069 12698 22295 917 --
NM_016607chrX51104 527 348 245 133 ------
NM_016625chr32161 102 1496 ----
NM_016626chr1851582 1365 601 158 103 1260 ----
NM_016628chr103791 656 298 1926 1768 --
NM_016651chr1431141 199 166 11049 11145 --
NM_016733chr2251450 1063 366 285 69 --11355 --
NM_016823chr172120 23 ----11171
NM_016824chr1031909 1802 311 11920 ----
NM_016834chr1763626 3354 2624 1538 958 716 13484 13292 --
NM_016835chr1763626 3354 2624 1538 958 716 13484 13292 --
NM_016836chr21161 1754 ----
NM_016839chr21161 1754 ----
NM_016841chr1763626 3354 2624 1538 958 716 13484 13292 --
NM_016929chr643906 3747 636 151 --11022 --
NM_016937chrX2814 302 ------
NM_016946chr122982 2766 22880 1071 1206 --
NM_016950chr431237 1087 343 1464 ----
NM_017413chrX42481 1706 1694 114 --11698 --
NM_017415chr584448 3632 3556 3271 2829 1822 1376 111 31512 645 417 --13234
NM_017420chr1443678 3465 3261 2893 33847 3270 3222 ----
NM_017423chr451992 1669 1377 671 77 ------
NM_017435chr121681 1735 ----
NM_017440chr122473 151 2539 68 ----
NM_017447chr2174448 4328 4278 4248 3820 1510 266 11519 --11347
NM_017452chr2021367 940 --21394 1113 --
NM_017453chr2021367 940 --21394 1113 --
NM_017454chr2021367 940 --21394 1113 --
NM_017455chr151361 1256 1706 2334 56
NM_017456chr173400 143 78 ------
NM_017519chr631368 1341 379 ------
NM_017540chr532876 2651 625 12084 1250 23272 3144
NM_017544chrX1923 ------
NM_017548chr331563 494 83 ----1607
NM_017563chr3146299 6143 5297 4840 2513 1998 1951 1735 1426 1237 842 769 376 39 22200 531 26102 4626 1982
NM_017569chr131365 1147 ----
NM_017572chr19169 ------
NM_017577chr321660 172 ----11502
NM_017580chr1021629 171 21659 1558 11806 12126
NM_017582chr151640 1627 733 449 245 11450 --1587
NM_017586chr99719 706 667 602 473 306 256 197 176 ------
NM_017593chr43411 190 179 ------
NM_017594chr942200 576 564 369 2266 104 ----
NM_017596chr134541 3777 1692 --13944 21180 875
NM_017599chr124816 419 318 229 ----11444
NM_017610chr1562085 1711 767 698 506 126 1147 ----
NM_017613chr211354 ------
NM_017626chr10--1645 11795 --
NM_017628chr441222 1022 770 418 2840 731 34191 2086 1315 --
NM_017632chr41469 ------
NM_017633chr653711 3575 2592 1526 555 33885 3605 3377 12596 11493
NM_017634chr8--1439 ----
NM_017635chr1131613 541 425 1468 ----
NM_017637chr9109316 8830 8078 7974 6981 6478 3114 980 727 619 67296 3461 2484 2375 1485 741 25979 2095 --
NM_017641chr1211188 --1136 1858
NM_017643chr1732564 2486 278 33146 708 104 12447 1367
NM_017644chr364642 4383 4253 2015 1512 479 1205 11157 11621
NM_017645chr912044 22777 2724 ----
NM_017649chr103923 908 413 ------
NM_017651chr61317 --21186 366 --
NM_017657chr21787 ------
NM_017658chr14114230 3392 3371 3256 3156 1655 1458 1077 930 806 435 22961 1179 12923 1571
NM_017661chr1531270 472 298 ----11070
NM_017666chrX41731 797 638 261 22228 2186 ----
NM_017673chr12807 648 ------
NM_017694chr211807 1530 ----
NM_017709chr172829 1372 1179 927 678 443 359 23243 2991 ----
NM_017715chr72231 97 ------
NM_017719chr312442 ----1177
NM_017737chr131655 702 606 --11365 --
NM_017738chr91397 1155 11251 --
NM_017740chr1621745 320 --21482 397 --
NM_017741chr432768 338 37 --12438 1235
NM_017745chrX140 ------
NM_017752chrX72038 2029 1878 1694 827 650 373 52086 1777 1713 1634 310 2642 629 --
NM_017754chr664569 4444 1660 1544 875 650 24754 88 24895 4563 --
NM_017758chr172484 157 ------
NM_017761chr121372 421 1945 --21047 438
NM_017762chr1582229 2173 2151 2128 1841 825 261 66 --1609 --
NM_017769chr1453187 1260 1070 1010 42 22792 184 12487 --
NM_017770chr642623 882 392 150 --21855 167 --
NM_017778chr821332 555 ----1543
NM_017780chr81890 ------
NM_017786chr8----1574 --
NM_017799chr1431637 738 177 --11308 --
NM_017801chr332334 310 87 --1458 --
NM_017811chr9103154 2686 2381 2246 2210 2046 1060 872 771 609 22312 2154 1133 --
NM_017813chr864215 3907 1359 989 722 338 24290 1395 15045 --
NM_017824chr1042664 2338 458 103 ------
NM_017830chr41177 ------
NM_017831chr1864766 4559 4002 3328 1483 1297 ----23444 1254
NM_017848chrX64646 3984 3866 3828 3154 1150 --24640 3873 --
NM_017866chr821144 235 2890 95 ----
NM_017873chr963111 3054 2569 2458 617 461 --13058 1670
NM_017880chr22316 71 1397 ----
NM_017893chr1011261 ------
NM_017902chr10104982 4835 4703 4011 3925 2077 2065 1994 1400 38 15265 11200 --
NM_017907chr111104 ------
NM_017913chr92431 349 --1165 --
NM_017919chr9115813 4491 4080 3712 2011 1684 1239 1071 377 184 58 15708 14694 15100
NM_017933chr23427 337 194 11268 ----
NM_017938chrX31819 1387 781 ------
NM_017944chr1162986 2109 1949 1107 923 893 23131 1195 ----
NM_017946chr72517 424 1554 ----
NM_017952chr293409 3147 2985 1269 677 598 391 355 44 24068 3853 23953 176 --
NM_017954chr731132 1056 501 1440 ----
NM_017955chr143962 934 475 1975 1112 --
NM_017974chr211306 ------
NM_017987chr1012039 1585 ----
NM_017994chr762951 2276 2205 2079 1959 809 11822 --159
NM_017998chr92436 400 11065 ----
NM_018011chr13--2648 471 ----
NM_018015chrX21118 1014 ------
NM_018023chr341968 1783 712 68 ------
NM_018030chr182257 203 21108 791 ----
NM_018043chr111998 11329 ----
NM_018045chr163134 2026 1060 816 627 167 12959 --11998
NM_018046chr521216 595 11692 ----
NM_018048chr1211959 2691 231 ----
NM_018054chr162667 557 ----1291
NM_018061chr131561 548 193 31683 1198 424 ----
NM_018078chr421014 858 ------
NM_018084chr233147 3089 1023 12100 2409 268 --
NM_018085chr1116926 6526 5295 3243 2466 2181 2141 2113 1351 478 288 35197 3212 2251 22389 2323 16931
NM_018086chr23409 324 59 --1689 --
NM_018094chrX--1379 ----
NM_018098chr341176 341 269 171 ------
NM_018103chr1------1324
NM_018105chr811157 ------
NM_018110chr166968 956 477 404 45 31 --1226 --
NM_018112chr94754 430 65 54 ------
NM_018117chr101550 1757 ----
NM_018120chr821354 1197 ----1278
NM_018121chr1032245 1001 203 23167 309 ----
NM_018124chr1682525 1857 1674 949 692 182 51 33 --12503 --
NM_018126chr431605 1209 209 21164 163 163 --
NM_018133chr351838 645 490 379 129 11359 ----
NM_018155chr353343 2990 1203 1177 633 12911 1589 11284
NM_018156chr142504 1176 377 293 12240 ----
NM_018157chr1212836 --23146 2338 11028
NM_018159chrX41300 1117 689 426 21647 32 ----
NM_018178chr131497 1444 34 --1540 1441
NM_018182chr1721858 409 ------
NM_018184chr331801 1676 1387 --1858 1144
NM_018191chr1352152 1971 476 458 443 ------
NM_018193chr152453 169 ------
NM_018195chr111617 1184 --11354
NM_018200chr15101992 1804 1744 1055 838 739 608 579 336 327 ----1283
NM_018211chr142173 481 231 51 ------
NM_018214chr631083 139 42 --21171 814 --
NM_018216chr11104 ----1208
NM_018221chr2270 63 148 ----
NM_018227chr422495 893 21287 882 ----
NM_018229chr142325 199 ------
NM_018237chr10--134 ----
NM_018243chr483871 3773 3528 3510 3069 3009 976 285 1151 24014 3076 --
NM_018246chr872703 2352 1965 1834 545 331 169 --1404 --
NM_018247chr682879 2497 2470 2406 2015 1259 420 74 22634 2045 13135 1230
NM_018252chr1--2539 532 ----
NM_018257chr2041668 983 117 43 21915 1861 ----
NM_018287chr10--21183 1031 ----
NM_018293chr352808 2454 668 503 80 32871 2445 2082 ----
NM_018299chr811043 --2900 889 --
NM_018307chr172984 814 ----174
NM_018310chr8157 ----1572
NM_018312chr1141955 881 653 96 --123 --
NM_018313chr32906 734 11717 ----
NM_018315chr431241 335 213 1342 2603 364 --
NM_018323chr451668 1392 482 349 76 197 ----
NM_018330chr1031698 1648 1069 2553 109 1211 --
NM_018339chr911265 11712 --11651
NM_018351chr1244736 3809 1769 838 24309 3379 1454 --
NM_018354chr201250 ----1255
NM_018360chrX156 ------
NM_018361chr852498 1460 1074 360 209 ------
NM_018362chr1133822 1277 505 21616 681 1370 --
NM_018364chr1114055 3440 2858 1638 1172 1158 1136 1024 721 616 223 24048 2582 ----
NM_018368chr6386 47 33 1276 ----
NM_018369chr53261 244 186 128 ----
NM_018374chr785211 4740 4648 4510 1738 1635 983 176 ----24076 3218
NM_018375chr1451848 1718 1221 1214 406 1516 ----
NM_018388chrX21030 313 21432 192 ----
NM_018394chr341594 1477 1178 180 ------
NM_018403chr373748 3583 1367 1102 961 795 257 ------
NM_018409chr442711 797 754 36 1929 22058 159 --
NM_018416chr1242246 545 409 313 ------
NM_018424chr941758 1549 522 387 ------
NM_018427chr1631477 498 291 ----11126
NM_018429chr552242 2085 2066 1855 284 1891 --12505
NM_018433chr22568 554 ------
NM_018434chr51130 ------
NM_018439chr1832646 2247 577 ----1394
NM_018440chr8118420 8410 7359 6908 5629 2183 1219 1015 551 421 247 ----16714
NM_018448chr121500 1336 ----
NM_018452chr6_random103640 3365 2854 2825 2702 1241 1134 869 562 114 --12994 21288 1225
NM_018462chr32635 21 1865 ----
NM_018471chr21107 1555 ----
NM_018477chr142834 679 ------
NM_018482chr872565 2404 1702 1630 305 89 49 ------
NM_018489chr132285 797 595 11864 12232 --
NM_018490chr1141834 1687 626 414 11290 1354 11511
NM_018509chr1751707 1466 1443 67 21 ----11204
NM_018527chr131164 ------
NM_018553chr1741867 1473 395 133 ------
NM_018557chr221465 161 31709 1417 266 1240 1492
NM_018559chr131223 2237 86 ----
NM_018566chr195014 4136 3127 2063 1766 1085 982 228 154 11422 ----
NM_018569chr431481 1107 386 31016 546 46 11300 --
NM_018584chr121022 107 ------
NM_018590chr1011230 ------
NM_018602chr1531242 691 134 11590 1470 --
NM_018638chr1295341 5307 5027 4827 3759 3708 2056 882 191 2758 222 25606 5427 --
NM_018640chr1262788 2728 2320 2089 892 242 ------
NM_018650chr11362 --1764 --
NM_018660chr822904 1145 12640 21891 364 13043
NM_018667chr1642629 2611 1862 366 12835 11845 --
NM_018682chr72728 250 --2180 69 --
NM_018685chr72816 805 1226 ----
NM_018695chr541693 1582 746 483 ------
NM_018700chr541398 630 610 305 --11485 11576
NM_018703chr161373 1355 ----
NM_018704chr142021 803 664 292 21600 490 ----
NM_018712chr1121180 409 --1413 11364
NM_018715chr111641 21659 1418 --1687
NM_018719chr711359 41019 240 230 139 ----
NM_018834chr541042 1016 151 60 ------
NM_018841chr133511 2499 794 13305 33255 2651 99 --
NM_018844chr731565 714 625 31944 1339 223 ----
NM_018890chr741468 1344 1338 940 ------
NM_018898chr582386 2380 2140 1998 1713 1596 1484 198 ------
NM_018899chr582386 2380 2140 1998 1713 1596 1484 198 ------
NM_018900chr582386 2380 2140 1998 1713 1596 1484 198 ------
NM_018901chr582386 2380 2140 1998 1713 1596 1484 198 ------
NM_018902chr582386 2380 2140 1998 1713 1596 1484 198 ------
NM_018903chr582386 2380 2140 1998 1713 1596 1484 198 ------
NM_018904chr582386 2380 2140 1998 1713 1596 1484 198 ------
NM_018905chr582386 2380 2140 1998 1713 1596 1484 198 ------
NM_018906chr582386 2380 2140 1998 1713 1596 1484 198 ------
NM_018907chr582386 2380 2140 1998 1713 1596 1484 198 ------
NM_018908chr582386 2380 2140 1998 1713 1596 1484 198 ------
NM_018909chr582386 2380 2140 1998 1713 1596 1484 198 ------
NM_018910chr582386 2380 2140 1998 1713 1596 1484 198 ------
NM_018911chr582386 2380 2140 1998 1713 1596 1484 198 ------
NM_018912chr52632 236 ------
NM_018913chr52632 236 ------
NM_018914chr52632 236 ------
NM_018915chr52632 236 ------
NM_018916chr52632 236 ------
NM_018917chr52632 236 ------
NM_018918chr52632 236 ------
NM_018919chr52632 236 ------
NM_018920chr52632 236 ------
NM_018921chr52632 236 ------
NM_018922chr52632 236 ------
NM_018923chr52632 236 ------
NM_018924chr52632 236 ------
NM_018925chr52632 236 ------
NM_018926chr52632 236 ------
NM_018927chr52632 236 ------
NM_018928chr52632 236 ------
NM_018929chr52632 236 ------
NM_018945chr64887 852 619 375 --33359 1252 387 --
NM_018947chr724633 986 34889 4881 1003 13157 --
NM_018948chr12166 160 ----11295
NM_018955chr171122 ------
NM_018963chr2151535 1094 478 381 250 ------
NM_018970chr743158 659 618 284 2737 298 2188 50 --
NM_018976chr1232814 1956 737 ------
NM_018979chr1222399 50 ----12488
NM_018999chr1043646 3429 3236 805 11552 23707 1669 --
NM_019000chr51416 11433 ----
NM_019001chr343168 1519 824 562 24861 1048 11396 --
NM_019004chr751695 812 629 224 51 --12391 1817
NM_019008chr2293717 3137 2624 1138 636 521 139 113 97 --21309 663 --
NM_019022chr1832059 382 117 --1758 --
NM_019027chr432511 2453 558 ------
NM_019028chr111359 ------
NM_019040chr11157 ------
NM_019042chr72468 317 ------
NM_019045chrX1143 ------
NM_019058chr10--1845 ----
NM_019063chr232266 1858 385 1713 --11731
NM_019071chr7--1793 ----
NM_019072chr563704 3639 3480 3393 1268 593 1752 ----
NM_019075chr2--178 ----
NM_019076chr2--178 ----
NM_019077chr2--178 ----
NM_019078chr2--178 ----
NM_019084chr102819 205 22561 995 22316 1842 --
NM_019091chr23850 51 37 ------
NM_019093chr2--178 ----
NM_019096chr6194 ------
NM_019106chr2262257 2108 2098 1096 703 678 23423 1333 --12208
NM_019114chr922510 1578 21792 396 1295 --
NM_019116chr1633713 1346 660 --13311 13586
NM_019117chrX73218 3173 1080 1018 1012 931 839 23511 282 ----
NM_019556chrX41169 1056 426 319 ------
NM_019590chr1021222 196 2130 119 ----
NM_019592chr91588 1611 ----
NM_019593chr2073170 3106 1142 818 795 768 556 42554 1168 646 271 ----
NM_019594chr911142 ------
NM_019595chr2----1550 --
NM_019597chrX1560 1766 ----
NM_019600chr152564 111 2772 751 ----
NM_019610chr121474 237 31992 650 229 1130 --
NM_019842chr6----1441 --
NM_019845chr23749 268 50 ------
NM_019854chr121672 ------
NM_019859chr102610 69 21580 1517 ----
NM_019860chr102658 117 21628 1565 ----
NM_019891chr12942 369 ------
NM_019903chr1031909 1802 311 11920 ----
NM_020066chr11984 1307 ----
NM_020116chr411431 1551 ----
NM_020120chr2160 --190 11629
NM_020122chr2105874 5821 4863 4546 4474 1041 961 725 640 311 21931 819 ----
NM_020123chr1021204 611 1373 ----
NM_020132chr2174706 4477 3838 3777 3130 1029 427 --24550 957 --
NM_020137chrX1151 ------
NM_020141chr141692 835 782 138 1827 11583 --
NM_020144chr72423 199 11651 ----
NM_020147chr153893 357 71 ------
NM_020148chr1812800 12920 21058 510 --
NM_020150chr1022094 358 --1520 --
NM_020151chr241364 502 106 65 --1332 --
NM_020156chr71429 1180 ----
NM_020159chr461508 1346 1337 1297 500 295 1458 --1604
NM_020177chr51919 1778 --129
NM_020178chr171970 ------
NM_020182chr2033391 3067 985 --12764 --
NM_020184chr22696 76 12305 ----
NM_020193chr111862 11297 ----
NM_020200chr101876 ------
NM_020205chr183367 2601 1150 973 712 690 575 477 ------
NM_020214chr15131 ------
NM_020225chr4----1132 --
NM_020228chr1162526 2480 2332 1762 959 579 12441 --1499
NM_020238chr1151080 938 914 358 159 --1854 --
NM_020242chr32436 201 ------
NM_020243chr221567 --165 --
NM_020244chr12235 22 ------
NM_020245chr6114861 3887 1979 1573 1547 1346 1163 941 342 262 252 --1753 --
NM_020307chr31168 ------
NM_020310chr1742643 1872 365 181 --1942 --
NM_020336chr2073142 2890 2640 2475 1209 1147 1061 --1214 --
NM_020337chr413105 188 ----
NM_020338chr1013740 13690 12897 --
NM_020341chr2031561 1337 1254 ----11580
NM_020346chr1131732 1560 1542 ------
NM_020347chr332192 2121 1713 2406 342 12196 --
NM_020348chr1042620 613 595 408 2880 237 11817 --
NM_020354chr101226 1323 --1909
NM_020357chr331341 550 203 11557 ----
NM_020366chr14176 ------
NM_020374chr1211555 141 11424 --
NM_020378chr191594 ------
NM_020390chr334815 4590 1309 23426 3296 24901 3854 14218
NM_020401chr121187 ------
NM_020403chr1361569 1419 1356 420 281 44 1521 1483 --
NM_020416chr472679 2331 2067 2035 738 728 578 11987 ----
NM_020420chrY31842 1161 336 ------
NM_020425chr691956 1498 787 777 758 748 384 268 105 ----1308
NM_020429chr742925 1149 960 287 --1923 1459
NM_020431chr1452728 1898 1694 416 172 22716 207 ----
NM_020432chr732114 1877 765 ------
NM_020437chr221328 ------
NM_020438chr931189 245 207 11232 --11194
NM_020440chr143064 2289 1296 1110 --1450 --
NM_020443chr186443 6204 5490 2741 2319 2193 1662 1143 12295 26532 2203 14930
NM_020445chr71808 1615 1259 --
NM_020448chr143696 2956 2656 365 23314 1365 53208 3182 2960 1208 369 11335
NM_020449chrX2244 170 1681 ----
NM_020456chr1312355 11985 --140
NM_020457chr162601 23 --1552 --
NM_020463chr21191 11493 ----
NM_020466chr655023 4023 1768 1135 769 13964 1991 --
NM_020474chr1811783 21749 694 --1365
NM_020482chr62595 240 1199 ----
NM_020530chr2231013 832 108 ------
NM_020532chr21210 ------
NM_020640chr33884 453 76 ------
NM_020644chr112697 164 ------
NM_020655chr1631448 1406 225 ------
NM_020666chr51161 ----1908
NM_020673chr20107780 7575 7149 2819 2277 1973 1350 1301 418 409 37740 1830 250 ----
NM_020689chr2011554 11363 1301 11346
NM_020697chr831042 289 37 --11375 --
NM_020699chr154398 1984 1299 1231 201 --15326 --
NM_020708chr2012324 ------
NM_020715chr1452211 2105 1606 772 292 21488 211 1882 --
NM_020717chrX63364 1854 1839 1698 1521 1417 --11614 13425
NM_020718chr1696460 5773 5688 4653 4430 4296 4023 1461 1139 14075 11697 --
NM_020727chr2173965 3723 3381 3024 3009 2660 1137 ------
NM_020728chr752517 1124 889 719 547 ----11223
NM_020732chr631368 1341 379 ------
NM_020734chr1263306 2933 2684 889 816 358 22759 264 2782 162 --
NM_020739chr1554051 3786 1501 920 136 23642 1051 12749 --
NM_020742chrX12534 11086 22401 2337 1251
NM_020747chr52294 80 1348 ----
NM_020748chr1732064 1981 208 11988 ----
NM_020750chr63611 522 467 21444 530 ----
NM_020752chr1062496 2194 1990 1795 723 656 --1453 12273
NM_020754chr32418 315 1168 ----
NM_020766chrX74380 4348 4201 3965 881 608 571 1915 13587 --
NM_020771chr641245 1022 325 235 21181 343 ----
NM_020772chr1798478 6673 6050 5685 5497 5404 2234 355 280 58461 8351 6928 5478 1320 25905 2700 --
NM_020774chr18106010 5614 5219 5068 4982 4870 4299 2313 2133 1655 45622 5429 4534 2021 --11359
NM_020776chr1872739 2603 2347 1146 917 347 128 1240 12971 1338
NM_020778chr1574636 3301 1678 1488 724 474 304 14376 ----
NM_020782chr1274392 3703 2959 1902 1816 1120 1051 34713 4479 1917 1741 --
NM_020783chr1812194 1124 ----
NM_020794chr131447 1015 161 ------
NM_020796chr542707 1957 1857 1222 22836 1017 12641 --
NM_020805chr181512 ------
NM_020808chr131099 930 763 1447 11059 1282
NM_020809chr1152226 2034 1958 589 120 1182 12230 22298 904
NM_020810chr1453464 2598 1148 863 183 33451 3439 2675 13576 22735 774
NM_020818chr142333 171 ------
NM_020819chr641216 468 247 83 51040 939 893 755 358 ----
NM_020824chr10143 ------
NM_020825chr1631285 573 426 --1702 23791 2447
NM_020830chr263160 2994 2896 2661 2243 562 13233 1755 --
NM_020839chr31584 --11434 --
NM_020841chr1264048 3011 2620 872 353 211 23775 755 --22518 504
NM_020843chr153392 362 38 ------
NM_020844chr897608 5554 5129 5106 2710 2519 665 219 97 --12523 22488 353
NM_020845chr1282520 2468 2228 2206 2150 1751 430 38 --1549 --
NM_020850chr1672563 2244 2055 1160 1008 922 357 --1372 --
NM_020853chr1262789 2717 2102 2096 1000 897 --11713 --
NM_020856chr1921599 1248 ------
NM_020858chr1521732 837 1486 22207 1647 --
NM_020859chr473967 3876 3856 3654 1188 520 202 23842 1243 13269 --
NM_020868chr231255 287 182 ------
NM_020870chr422206 490 --12069 --
NM_020871chrX42444 2332 1642 807 ------
NM_020873chr33863 693 103 1279 ----
NM_020888chr152065 1801 1774 1552 299 --128 --
NM_020905chr21369 --1123 --
NM_020920chr142373 37 ------
NM_020922chrX31757 659 379 11572 11774 --
NM_020924chr93433 374 78 ------
NM_020935chr243069 1280 973 49 --12892 174
NM_020940chr1042628 2262 2220 334 42866 2787 1053 769 ----
NM_020948chr183596 3143 3037 1106 1092 1019 823 532 32670 1420 1409 12468 --
NM_020949chr3--1214 ----
NM_020952chr91138 1744 ----
NM_020956chr1963990 3820 3163 1326 1052 185 --1258 11776
NM_020962chr1532465 1830 764 ------
NM_020977chr441845 677 412 288 21602 653 ----
NM_020981chr22234 127 ------
NM_020983chr1211827 --2906 110 --
NM_020987chr1031266 1035 943 11434 1284 --
NM_021003chr142809 787 ------
NM_021005chr152813 242 2314 116 181 --
NM_021007chr212157 ----1241
NM_021012chr1753003 2967 2166 697 336 12445 --11116
NM_021027chr2--178 ----
NM_021032chr321787 554 21532 824 ----
NM_021033chr1373069 2954 2195 763 684 583 99 23444 1410 ----
NM_021038chr372539 2103 2080 746 650 234 150 22238 29 --13224
NM_021064chr621687 1643 --1482 --
NM_021072chr552529 2429 1826 598 457 --11921 --
NM_021076chr221156 ------
NM_021083chrX43613 3403 2822 362 1744 21372 110 --
NM_021088chr24831 582 392 158 22174 1458 21332 474 --
NM_021090chr22104656 4379 4181 3883 3601 1157 480 420 313 37 22017 1894 34617 1414 1103 23697 1405
NM_021097chr221234 1079 12607 1106 --
NM_021101chr332151 1892 1685 2167 152 12172 --
NM_021111chr931308 938 71 21269 190 ----
NM_021116chr7117826 7667 7633 7608 7113 7050 2326 2195 1602 678 654 39017 8948 7266 ----
NM_021120chrX73112 2411 2371 1953 982 845 438 --11211 1987
NM_021136chr141646 1248 ----
NM_021137chr1732226 601 82 12404 22230 292 --
NM_021140chrX31145 97 38 ------
NM_021144chr91520 ------
NM_021145chr73795 320 145 --148 --
NM_021165chr12843 635 ------
NM_021180chr12759 97 ------
NM_021183chrX1746 11027 ----
NM_021190chr161271 378 329 196 190 139 ------
NM_021191chr1242333 2168 1784 945 --12179 --
NM_021200chr1131180 1110 246 144 ----
NM_021215chr2042136 2060 1739 1588 ----11656
NM_021219chr211160 ------
NM_021229chr1211235 2472 423 ----
NM_021239chr1411358 --1287 --
NM_021240chr92694 247 1217 ----
NM_021242chrX1640 ------
NM_021244chr6152 1118 ----
NM_021249chr1421592 73 ----124
NM_021252chr1041972 1349 327 75 ------
NM_021253chr631277 1102 72 ------
NM_021255chr1473495 3319 1575 1222 1176 958 861 --12959 --
NM_021260chr1441018 447 327 93 11173 ----
NM_021574chr2232001 943 423 ----11621
NM_021614chr51209 ------
NM_021622chr1011555 ----12343
NM_021629chr354558 4217 2029 1545 1465 14628 --14856
NM_021637chrX31073 946 916 1162 ----
NM_021638chr453096 3049 1732 1283 924 24094 229 13306 --
NM_021639chr11181 ------
NM_021643chr241706 746 630 375 ------
NM_021722chr71218 ------
NM_021728chr141637 1947 ----
NM_021738chr102268 244 2601 136 ----
NM_021785chrX191 ------
NM_021809chr2052221 1716 1652 268 259 2492 24 1190 12330
NM_021813chr675813 5806 5725 5257 3570 2333 81 1583 23989 603 --
NM_021814chr631580 263 86 21688 297 ----
NM_021815chr243006 920 379 238 32500 530 227 12121 1946
NM_021818chr1441497 1020 986 314 1293 ----
NM_021871chr4166 1207 ----
NM_021911chr555260 4802 4244 4027 1741 21688 698 21509 169 --
NM_021912chr1573129 2909 2771 1121 1065 996 491 12808 --11632
NM_021913chr193677 379 251 ------
NM_021914chr1462339 1594 638 606 561 194 12142 12374 --
NM_021925chr241696 1457 710 424 11368 ----
NM_021931chr2061135 441 425 407 57 34 ------
NM_021940chr631220 1168 658 152 ----
NM_021942chr41640 1836 ----
NM_021943chr641904 1760 613 293 22044 377 2508 208 12208
NM_021946chrX21359 222 11465 ----
NM_021949chrX32790 2546 2459 ------
NM_021951chr93837 802 70 1829 ----
NM_021954chr1352742 900 885 872 379 12785 ----
NM_021956chr62974 255 11099 1220 --
NM_021959chr62644 152 ------
NM_021960chr142505 1709 553 392 32149 1948 828 ----
NM_021961chr11107122 6947 6119 5794 5254 5166 4603 1288 1280 1178 1604 25170 2374 --
NM_021963chrX2526 298 ------
NM_021964chr375687 5166 4551 4518 4142 2237 247 35463 5228 4808 16271 --
NM_021965chr921359 73 --21256 303 1221
NM_021967chr521171 1000 ------
NM_021979chr141399 ------
NM_021998chrX31464 1029 369 --1583 --
NM_022037chr21844 1394 ----
NM_022041chr1662446 1672 1042 893 360 291 11704 12432 --
NM_022048chr1566395 5446 3952 2320 320 227 15820 ----
NM_022051chr13167 56 45 ----1630
NM_022059chr173693 149 52 ------
NM_022062chr1121788 1211 ------
NM_022068chr182424 32 ------
NM_022072chr32245 64 ------
NM_022073chr143547 217 110 21143 643 ----
NM_022075chr11212 --1840 --
NM_022079chr102944 878 --1178 --
NM_022091chr642059 772 735 635 12269 --12064
NM_022114chr154075 3074 1631 1622 1512 11664 24519 315 --
NM_022121chr62431 33 1130 2391 37 --
NM_022124chr104481 422 245 214 ------
NM_022129chr10125 21442 118 ----
NM_022130chr541373 1328 252 166 ------
NM_022133chr851553 1434 539 245 180 1341 21807 1225 --
NM_022136chr212656 218 ------
NM_022143chr741426 1111 300 258 --1356 --
NM_022145chr5----1625 --
NM_022153chr1093525 3225 2862 2801 2442 2418 987 752 224 11385 11366 --
NM_022154chr42934 26 1174 ----
NM_022166chr1695996 5648 5391 4354 4237 3905 2056 2027 386 14317 14646 --
NM_022170chr721653 1209 --1153 --
NM_022173chr21844 1394 ----
NM_022336chr211767 1891 1620 11531
NM_022337chr113626 280 224 ------
NM_022351chr852793 1095 327 231 89 23444 221 12886 --
NM_022361chr63545 429 390 ------
NM_022456chr12107722 7639 6450 5474 4982 4925 2671 935 783 509 11284 26559 939 --
NM_022459chr1396288 4925 4536 4040 1962 986 519 386 184 45287 5260 4083 58 21742 188 15999
NM_022465chr1283078 2591 2363 2181 2147 2065 1127 481 ------
NM_022474chr1492791 2754 2321 2279 2047 1997 1019 886 709 1391 --1277
NM_022475chr4284 76 ------
NM_022476chr161994 1283 --21042 40
NM_022477chr2051499 1406 1129 697 621 --11673 --
NM_022482chr2062246 1845 1789 315 274 27 --2642 141 12584
NM_022484chr71104 11459 ----
NM_022491chr1253092 2295 1227 1050 89 1679 ----
NM_022497chr372546 1422 777 747 555 410 208 1892 1633 1188
NM_022574chr741717 815 426 293 1264 ----
NM_022576chr12319 108 ------
NM_022650chr53932 808 153 2827 699 ----
NM_022658chr122928 445 11241 ----
NM_022716chr153022 2736 1274 83 68 12284 ----
NM_022719chr2263858 3117 1184 933 734 708 --21551 1041 --
NM_022726chr651785 1752 1301 493 155 31248 1216 1206 1567 --
NM_022730chr23741 684 160 ----1888
NM_022735chr131724 1528 226 2275 253 ----
NM_022751chr18--152 --1248
NM_022763chr342676 2333 1998 846 ------
NM_022771chr1221072 255 ------
NM_022776chr3--11086 --11455
NM_022778chr141406 1342 1181 88 --3373 200 42 --
NM_022780chr231452 416 140 11762 ----
NM_022781chr943108 2908 1298 637 12029 11109 --
NM_022782chr121138 ------
NM_022784chr1551139 939 249 208 39 --1922 --
NM_022802chr1051188 537 444 239 228 11433 ----
NM_022810chrX1361 ------
NM_022824chr551512 1451 1420 761 598 ------
NM_022826chr22370 189 1175 ----
NM_022831chr151810 1677 1388 1358 486 1368 ----
NM_022838chrX1313 1330 ----
NM_022841chr1542333 2223 825 269 ----12697
NM_022845chr1631962 1679 625 --1515 --
NM_022893chr243101 2583 1966 414 12208 --12521
NM_022894chr241405 459 224 196 ------
NM_022897chr521043 988 1850 --1426
NM_022898chr1463967 3330 1505 1100 920 63 --11348 11912
NM_022900chr711043 ------
NM_022905chr1521627 479 11240 ----
NM_022912chr263047 2593 2561 2019 1106 937 --21934 392 --
NM_022918chr1111832 ----11565
NM_022965chr471604 1561 1433 1378 1046 231 52 ------
NM_022970chr1031488 1147 313 1522 21443 1198 --
NM_022977chrX52009 1932 1763 1012 85 1761 11981 12578
NM_022978chr521171 1000 ------
NM_023000chr1441198 487 388 102 ------
NM_023001chr1441198 487 388 102 ------
NM_023009chr1------1696
NM_023010chrX------1789
NM_023012chr122550 482 ------
NM_023016chr21727 11123 ----
NM_023033chr121531 ------
NM_023037chr131785 ----1772
NM_023039chr51360 ------
NM_023071chr1221092 263 ------
NM_023076chr162126 28 1532 ----
NM_023105chr892417 1893 893 817 753 531 195 103 65 12372 12151 12003
NM_023106chr892417 1893 893 817 753 531 195 103 65 12372 12151 12003
NM_023110chr892417 1893 893 817 753 531 195 103 65 12372 12151 12003
NM_023111chr892417 1893 893 817 753 531 195 103 65 12372 12151 12003
NM_023927chr54952 924 544 90 1881 11205 --
NM_023929chr842540 857 790 601 --12320 --
NM_023934chrX41872 1581 1450 147 ------
NM_024007chr5148 23106 752 ----
NM_024019chr41446 ------
NM_024040chr101128 ------
NM_024052chr1772704 2626 2135 1064 570 546 142 --32736 614 599 --
NM_024061chr7----1611 --
NM_024076chr1972367 2192 1921 1873 1761 772 370 --1146 --
NM_024077chr91208 1563 1308 1183
NM_024087chrX1633 ------
NM_024117chr931363 1253 934 ------
NM_024122chrX1251 ------
NM_024295chr841353 466 314 204 ------
NM_024315chr72136 123 183 --1341
NM_024345chr9135059 4991 4948 4361 4287 2392 2201 2098 1117 1070 937 577 527 26049 4397 24980 234 25288 618
NM_024415chr51209 1171 ----
NM_024424chr11----1419 --
NM_024425chr11----1419 --
NM_024426chr11----1419 --
NM_024492chr631133 480 337 ------
NM_024494chr11102 ------
NM_024511chr4103208 3154 2982 2877 2777 2671 1420 1097 756 724 ------
NM_024524chr362932 2781 2549 2344 449 29 12405 --1757
NM_024539chrX--11171 1170 --
NM_024545chr2----1729 1221
NM_024546chr131361 158 ----
NM_024548chr3--31764 1277 1083 ----
NM_024557chr1131580 1519 522 ------
NM_024561chr132396 385 11152 --1181
NM_024563chr521265 748 ------
NM_024567chr82584 124 ------
NM_024581chr62205 36 ------
NM_024582chr42720 68 21010 412 --1155
NM_024590chr441197 398 356 280 ------
NM_024593chr831294 1010 330 ------
NM_024612chr172834 419 11143 ----
NM_024613chr841766 1223 510 327 ------
NM_024618chr111551 ------
NM_024620chr1921237 140 --1153 --
NM_024625chr73572 158 25 ------
NM_024630chr62816 176 ------
NM_024632chr5------186
NM_024640chr12960 168 1907 ----
NM_024646chr143988 3253 939 713 1796 ----
NM_024652chr151143 1930 2227 133 --
NM_024665chr394560 3512 3456 1856 1792 1316 1202 231 78 14480 11383 --
NM_024670chr1041418 426 107 52 --21487 344 --
NM_024674chr142424 1256 562 31 12898 --12971
NM_024686chr1--2565 381 ----
NM_024689chrX21798 279 --21262 623 11235
NM_024692chr231184 755 720 11480 --11682
NM_024700chr13394 312 143 21094 188 ----
NM_024704chr2011121 --2760 194 1109
NM_024713chr1541616 1238 1115 1050 ------
NM_024721chr822068 330 2449 221 ----
NM_024740chr1163853 3389 3349 3192 872 39 24079 493 ----
NM_024744chr242241 1726 1067 470 ------
NM_024757chr92797 301 ----11081
NM_024761chr954676 4455 4383 2140 1654 11490 1189 14578
NM_024770chr276442 5362 4879 4077 1215 1129 600 35160 4708 2341 ----
NM_024771chr1121729 991 21870 196 21619 517 --
NM_024779chr1221323 444 1104 ----
NM_024780chr163701 392 197 ------
NM_024811chr1141686 762 727 493 ----11322
NM_024814chr71367 1330 ----
NM_024817chr15105657 5496 5405 5315 5164 4979 4901 1227 453 76 45760 3886 1561 973 1255 12337
NM_024824chr1421420 281 11139 11066 21231 253
NM_024828chr911195 11486 ----
NM_024834chr1031285 570 286 1342 ----
NM_024835chr17--1384 ----
NM_024837chr152235 62 ------
NM_024852chr12541 147 ------
NM_024854chr121442 11498 ----
NM_024859chrX2796 342 ------
NM_024863chrX2136 79 ------
NM_024900chr481555 934 865 849 628 598 556 163 1814 ----
NM_024900chr481555 934 865 849 628 598 556 163 1814 ----
NM_024911chr11256 1677 --1861
NM_024920chr41647 11391 --11471
NM_024921chrX31426 1363 122 --11502 --
NM_024922chr1652093 1602 1378 724 480 --189 1523
NM_024930chr572126 2117 2018 856 756 611 402 12100 12742 12374
NM_024941chr511089 ----11228
NM_024944chr211188 1219 ----
NM_024945chr941104 802 475 389 ------
NM_024947chr3149449 9085 8873 7968 7850 7200 5976 5954 3724 3110 2812 2552 2391 761 16112 --38566 3772 1000
NM_024948chr101749 1181 1639 --
NM_024949chr414631 ------
NM_024953chr1232307 2050 1766 1153 1704 --
NM_024969chr22654 344 ------
NM_024971chr91138 1744 ----
NM_024989chr2117892 7749 6057 3170 2985 2905 1480 920 730 663 415 1867 23226 1014 1735
NM_024991chr106968 846 609 464 339 200 43047 2905 2542 2432 1553 --
NM_024993chr221437 1361 1244 ----
NM_024997chr1651380 1044 352 279 237 ------
NM_025047chr31472 --1343 --
NM_025054chr893709 3136 3017 1246 896 590 378 216 179 --1226 --
NM_025058chr12723 710 --1699 --
NM_025073chr164749 4233 1874 1421 527 178 33176 1212 198 1585 --
NM_025083chr1541424 598 39 29 190 11686 --
NM_025106chr121520 695 11949 ----
NM_025129chr19141 ------
NM_025134chr1632368 710 585 --1507 --
NM_025137chr15135 189 ----
NM_025138chr1321112 194 11272 --1551
NM_025146chr332735 699 659 --12362 11018
NM_025147chr22996 785 2256 102 ----
NM_025154chr731507 1198 129 ----1409
NM_025160chr124307 3729 14066 13645 --
NM_025179chr194465 4307 3712 3204 3165 1850 839 530 306 --43787 3358 1923 417 --
NM_025180chr343184 2943 981 284 2545 232 1680 --
NM_025181chr21186 ------
NM_025191chr112206 12492 ----
NM_025203chr241341 1264 428 169 11526 11489 --
NM_025208chr1142199 712 153 132 ------
NM_025211chr9------187
NM_025221chr431340 551 346 ------
NM_025222chr352656 2083 1863 1227 256 12925 22910 330 --
NM_025244chr2168 1108 ----
NM_030579chr1673683 3522 2729 2684 2403 2267 1478 ------
NM_030621chr1464030 3552 3467 3251 3110 2980 --11176 --
NM_030623chr21130 ------
NM_030625chr1052321 860 745 385 32 1488 --163
NM_030627chr554061 2702 1640 1576 359 --23488 1108 13341
NM_030629chr1621535 500 ------
NM_030647chr786025 5807 4193 1662 1057 1028 678 656 26001 4827 24150 888 --
NM_030648chr455577 4349 1571 1420 904 24842 1096 ----
NM_030650chr283952 3527 3435 3315 3309 2597 1238 1203 21301 863 11474 --
NM_030652chr61292 ------
NM_030660chr1421522 572 ------
NM_030661chr721418 1146 ----11589
NM_030664chr1032294 1994 413 ------
NM_030665chr1711310 ------
NM_030667chr1211218 ------
NM_030668chr1211218 ------
NM_030669chr1211218 ------
NM_030674chr1225775 4265 1910 15869 1552
NM_030751chr1031546 752 554 1455 ----
NM_030751chr1031546 752 554 1455 ----
NM_030753chr17--1305 ----
NM_030756chr101295 ------
NM_030762chr1261518 1461 1383 1374 774 425 11561 ----
NM_030772chr11457 --1105 --
NM_030780chr8--41141 1116 311 238 1143 --
NM_030791chr141741 11854 ----
NM_030796chr721878 778 --21617 101 --
NM_030797chr23256 81 33 ------
NM_030799chr542184 1848 1813 82 1863 11914 --
NM_030802chr172891 834 ------
NM_030803chr211306 ------
NM_030806chr1129119 8406 7475 7132 6212 3481 3439 3142 1779 1136 518 204 47906 3653 2043 183 57050 6283 2628 1939 228 13510
NM_030808chr1721021 336 ------
NM_030816chr143391 3183 2639 1030 12964 12572 12909
NM_030820chr63824 287 251 ------
NM_030906chr112514 94 ----1593
NM_030917chr41164 ------
NM_030918chr164867 4781 3740 3318 1900 321 23627 3492 --15175
NM_030920chr142053 1576 1411 376 12135 1173 --
NM_030934chr131668 1418 1292 21578 426 ----
NM_030938chr1741053 1003 847 176 2835 346 --1859
NM_030939chr61447 ------
NM_030949chr621015 201 --1574 --
NM_030954chr8--1348 ----
NM_030958chr81425 ------
NM_030962chr1131351 1125 147 11134 ----
NM_030963chr61198 ------
NM_030964chr563442 2938 1169 950 444 110 23763 1426 ----
NM_031157chr121113 ------
NM_031203chr19159 ------
NM_031205chr122391 279 ------
NM_031216chr1842110 1720 1451 483 ------
NM_031243chr7199 1333 ----
NM_031244chr641112 919 357 283 ------
NM_031266chr51410 ------
NM_031268chr1674885 4340 3678 3563 1722 628 398 1981 34317 1615 909 --
NM_031291chr42634 115 2108 43 1602 --
NM_031305chr431878 1285 434 1306 --11212
NM_031314chr1451820 1684 1492 1271 210 ------
NM_031362chr212233 32843 2532 2321 1432 --
NM_031365chr232369 131 88 32979 2668 2457 1568 --
NM_031366chr232369 131 88 32979 2668 2457 1568 --
NM_031369chr41220 1286 2752 92 --
NM_031370chr41220 1286 2752 92 --
NM_031371chr121350 329 1369 11210 --
NM_031371chr121350 329 1369 11210 --
NM_031372chr451508 1471 1463 673 189 2252 36 ----
NM_031411chr582386 2380 2140 1998 1713 1596 1484 198 ------
NM_031427chr1425510 25 ----14784
NM_031431chr1321708 135 31740 398 305 ----
NM_031435chr1273369 3189 3067 2831 1291 415 226 22847 375 --1283
NM_031438chr531432 749 601 21750 205 ----
NM_031442chrX63018 2152 1177 1078 943 402 ----12205
NM_031445chr243180 1236 858 121 --22776 748 11364
NM_031459chr121640 1401 ------
NM_031461chr822166 233 21921 225 1510 2731 596
NM_031468chr7128017 7255 7248 6846 6384 6063 5723 5258 2865 2354 1965 1934 16793 1430 26433 2590
NM_031469chr662867 1538 1217 889 674 262 23919 1509 12547 12493
NM_031476chr1642699 1785 316 225 ------
NM_031483chr2053465 2636 2414 1035 696 1424 12649 --
NM_031492chr112442 399 ------
NM_031844chr173904 3737 2612 2581 2506 1457 1350 --21471 986 1653
NM_031845chr223594 3547 43333 1252 1044 343 12929 --
NM_031847chr223594 3547 43333 1252 1044 343 12929 --
NM_031849chr582386 2380 2140 1998 1713 1596 1484 198 ------
NM_031850chr32828 320 --1832 --
NM_031850chr32828 320 --1832 --
NM_031857chr582386 2380 2140 1998 1713 1596 1484 198 ------
NM_031858chr172146 32 21198 1075 1367 --
NM_031860chr582386 2380 2140 1998 1713 1596 1484 198 ------
NM_031862chr172146 32 21198 1075 1367 --
NM_031866chr102789 113 1870 ----
NM_031890chr2242864 2602 2382 2275 ------
NM_031911chr451850 701 438 352 262 12538 11067 --
NM_031938chr11--1664 --1358
NM_031990chr1911275 ------
NM_031991chr1911275 ------
NM_031992chr721653 1209 --1153 --
NM_032012chr9104869 4209 4135 3679 1261 1199 755 720 363 240 33902 823 416 --23285 368
NM_032013chr2051499 1406 1129 697 621 --11673 --
NM_032021chr111964 ----1925
NM_032025chr31757 ----158
NM_032041chr842454 1756 1722 1082 11930 ----
NM_032042chr552485 2108 945 826 378 12041 --2752 688
NM_032047chr322338 779 52358 2291 2087 1973 422 ----
NM_032049chr32828 320 --1832 --
NM_032049chr32828 320 --1832 --
NM_032050chr222754 45 ------
NM_032052chr2231139 430 396 --1995 --
NM_032088chr52632 236 ------
NM_032092chr52632 236 ------
NM_032102chr112924 649 32916 2808 1972 ----
NM_032104chr12441 53 ------
NM_032105chr1106971 6683 6490 5459 5338 2594 1761 1539 441 53 22959 2656 12082 --
NM_032121chrX52392 2348 1999 1889 415 ------
NM_032124chr1841189 320 182 104 11019 ----
NM_032128chr42900 341 1677 1839 --
NM_032138chr13136 ------
NM_032139chr192906 61 1356 132 --
NM_032144chr2--11792 --11492
NM_032145chr63772 496 435 31855 1652 1281 ----
NM_032153chr352425 2392 2344 1919 69 12297 --11953
NM_032154chr102182 88 1441 ----
NM_032160chr1843306 2957 340 248 --14358 2369 236
NM_032189chr1384914 4177 3686 1321 1192 703 330 185 ------
NM_032195chr211201 ----1409
NM_032199chr1043750 3485 3178 2482 13166 --1523
NM_032208chr242321 2312 2231 672 21294 856 33371 1161 842 --
NM_032221chr2061752 1441 1430 1248 232 155 11556 --21849 1583
NM_032228chr1163471 3052 2836 2148 740 267 23533 2923 ----
NM_032231chr151254 ------
NM_032233chr14181 ------
NM_032236chr12765 340 --125 --
NM_032239chr441275 929 587 411 ------
NM_032256chr121707 ------
NM_032271chr1651323 1110 619 550 443 11482 1522 --
NM_032281chr1962952 2562 2184 2133 2127 1927 12096 ----
NM_032291chr121645 209 21478 529 ----
NM_032312chr22660 617 267 37 ----
NM_032321chr262713 2194 599 305 176 39 ------
NM_032328chr1160 ------
NM_032352chr1411145 1441 --11306
NM_032373chr10105651 5508 5408 5011 3684 1224 1092 1027 863 196 25907 5109 --14638
NM_032375chr19----178 --
NM_032383chr31475 ------
NM_032403chr52632 236 ------
NM_032410chr831146 384 53 --11078 --
NM_032411chr2--1222 ----
NM_032412chr5139 --2338 87 --
NM_032413chr151103 ------
NM_032434chr221569 202 ------
NM_032435chr152293 2058 289 166 87 ------
NM_032438chr63518 482 469 21061 642 ----
NM_032440chr1032242 1844 929 12112 ----
NM_032445chr1552345 1955 1641 581 432 ------
NM_032446chr593666 3090 2766 1414 1179 1094 470 221 48 --13631 --
NM_032457chr443734 3713 3254 163 ------
NM_032458chrX63361 3134 2510 1108 651 136 2867 842 --1891
NM_032466chr811212 1432 ----
NM_032468chr811212 1432 ----
NM_032499chr1541383 1207 594 187 31626 1487 312 --11711
NM_032505chr341868 724 665 74 ----12266
NM_032509chr862445 2051 1805 889 867 582 ------
NM_032510chr1862307 2246 2229 1976 1845 446 --21890 420 --
NM_032520chr161220 ------
NM_032521chr2052723 748 339 220 162 1269 22751 2019 --
NM_032532chr6--1647 1213 1539
NM_032539chrX1108 1539 ----
NM_032547chr411119 11217 138 --
NM_032549chr7--3532 203 171 1416 1362
NM_032550chr10--166 ----
NM_032557chr42844 671 1377 --157
NM_032558chr921420 1111 ------
NM_032560chr141322 11001 ----
NM_032564chr111953 1122 ----
NM_032574chr2133 ------
NM_032582chr1711883 ----122
NM_032590chr122412 325 ------
NM_032594chr142885 828 ------
NM_032632chr141501 21474 63 ----
NM_032663chr1242052 1470 1389 218 12033 12016 --
NM_032679chr192917 178 21071 994 --1140
NM_032682chr373558 3434 2703 1431 1388 714 146 21424 302 ----
NM_032689chr1931639 570 198 1374 11247 --
NM_032704chr12183 ------
NM_032711chr1784045 3648 3385 3315 3163 1335 1294 893 24211 2663 13844 --
NM_032727chr1011105 31332 302 60 ----
NM_032731chr17--31500 1218 100 ----
NM_032747chr10----142 --
NM_032758chr222647 41 --1118 --
NM_032772chr101528 --188 --
NM_032777chr831432 1357 518 ------
NM_032784chr641021 748 137 39 ------
NM_032801chr1122135 761 2891 831 21915 520 155
NM_032810chr1031370 1185 1001 11015 ----
NM_032812chr102114 45 ------
NM_032826chr784606 3762 3653 2190 1427 376 104 81 32109 2092 2013 23411 1244 --
NM_032828chr1974908 4402 3488 3473 636 621 120 3466 398 31 ----
NM_032833chr122411 961 --11822 --
NM_032837chr1711889 --21692 1481 --
NM_032842chr731634 1569 149 21620 1603 --11685
NM_032857chr151227 ------
NM_032859chr1343901 2886 635 303 1287 --12847
NM_032867chr111557 ------
NM_032870chr61575 ------
NM_032873chr11104300 3652 1708 1585 1120 887 644 591 334 262 ------
NM_032876chr14244 22 --1653 21862 1754
NM_032906chr41680 ------
NM_032918chr122273 181 ------
NM_032968chrX52682 1374 1006 577 336 1754 ----
NM_032969chrX52682 1374 1006 577 336 1754 ----
NM_032973chrY52677 1374 1006 577 336 2754 435 ----
NM_032975chr181375 --43523 3210 2830 2417 --
NM_032980chr181375 --43523 3210 2830 2417 --
NM_033012chr1311058 ------
NM_033020chr163560 3236 3075 1555 1461 1021 --14420 13572
NM_033023chr731255 1099 887 ------
NM_033025chr192402 303 ------
NM_033030chr22556 239 21622 1610 11640 --
NM_033036chr1131514 1273 1169 ------
NM_033044chr141060 960 834 386 196 ----
NM_033055chr12352 314 --11131 --
NM_033058chr82925 130 ------
NM_033089chr2031444 1432 962 21481 444 11318 --
NM_033092chr11----1100 --
NM_033102chr13891 130 64 --1147 --
NM_033102chr13891 130 64 --1147 --
NM_033103chr1941351 1183 220 46 ------
NM_033105chr81144 ------
NM_033121chr122616 480 ------
NM_033124chr121111 ------
NM_033132chr1331544 804 553 ------
NM_033133chr1753627 1367 1245 1142 538 12851 --13220
NM_033135chr1142199 712 153 132 ------
NM_033136chr531249 1238 496 11505 ----
NM_033137chr531249 1238 496 11505 ----
NM_033138chr732136 936 564 1750 22021 541 --
NM_033139chr732136 936 564 1750 22021 541 --
NM_033140chr732136 936 564 1750 22021 541 --
NM_033143chr484632 4479 4143 3904 3555 1635 1339 734 ------
NM_033157chr732136 936 564 1750 22021 541 --
NM_033181chr663355 2692 1118 902 669 150 --13901 --
NM_033211chr53341 236 66 1464 ----
NM_033222chr931092 335 291 1238 --171
NM_033224chr788011 5530 3153 3084 2173 1371 1013 828 15877 17624 --
NM_033225chr852879 2691 2587 2261 329 22991 1972 --13112
NM_033228chr53644 423 55 1243 ----
NM_033274chr563299 3276 3070 2992 512 310 11415 12966 --
NM_033285chr854414 3550 3181 1468 1353 13874 --13503
NM_033315chr1722169 1738 ------
NM_033326chr1122118 977 --11652 --
NM_033331chr963124 2790 2381 2276 1235 524 --1533 11144
NM_033360chr1273991 3753 3255 3210 2897 683 244 11714 21286 836 --
NM_033379chr10159 ------
NM_033380chrX5782 436 406 140 98 ------
NM_033381chrX5782 436 406 140 98 ------
NM_033389chr1754629 4237 1636 767 753 --11119 --
NM_033394chr231276 1103 307 21269 197 ----
NM_033402chr8183 ------
NM_033407chr12204 154 ------
NM_033425chr1142502 837 710 327 32511 614 562 --12291
NM_033426chr14102692 2590 2153 2034 1886 915 310 155 55 23 12350 12290 --
NM_033427chr7--1551 ----
NM_033429chr1532207 499 294 12833 1834 1757
NM_033430chr473616 3321 1401 817 509 237 116 23375 1150 23858 3553 13653
NM_033437chr473616 3321 1401 817 509 237 116 23375 1150 23858 3553 13653
NM_033480chr632392 2034 1197 12935 ----
NM_033481chr632392 2034 1197 12935 ----
NM_033505chr2116671 6585 5621 4980 4227 2709 1776 1672 1438 1241 1084 11397 22564 2231 --
NM_033512chr883103 2647 1924 610 258 226 32 22 --13015 --
NM_033515chr62162 54 11127 11278 --
NM_033542chr2091864 1731 1588 1474 1410 664 592 528 394 --127 --
NM_033551chr593302 3184 2871 2291 2247 1165 1123 554 132 12894 12754 --
NM_033624chr1262181 1881 1539 910 98 32 22216 2208 ----
NM_033632chr431241 335 213 1342 2603 364 --
NM_033642chrX31011 973 317 31138 890 821 ----
NM_033644chr532458 2257 2226 ----12369
NM_033645chr532458 2257 2226 ----12369
NM_033656chr2185038 4015 3960 3789 1865 1784 987 151 24162 278 13759 24063 68
NM_044472chr15661 655 579 219 30 ------
NM_052811chr1375254 3562 3480 3426 3211 975 581 14970 ----
NM_052827chr1231102 852 384 21039 257 ----
NM_052832chr842700 2428 2063 111 --22491 2156 --
NM_052834chr1832211 867 539 22567 2540 ----
NM_052851chr1362046 1550 629 613 525 288 --1529 --
NM_052855chr17----2622 420 --
NM_052864chr452130 1740 1389 653 106 ------
NM_052867chr1331146 945 355 1494 --1975
NM_052874chr161564 ------
NM_052879chr1254000 3589 2879 1443 1402 44044 3052 1138 1104 ----
NM_052885chr1294186 4056 4004 3824 3285 1498 1050 488 353 14556 ----
NM_052886chr841592 774 332 168 --1523 11833
NM_052896chr152126 2103 1743 141 135 --1597 --
NM_052900chr821662 1363 21183 491 --174
NM_052904chr61324 11104 ----
NM_052905chr251732 1338 387 372 173 ------
NM_052910chr1341668 1504 281 243 11762 --11694
NM_052911chr182974 60 --2781 396 --
NM_052917chr243421 3220 1224 1080 33213 980 84 12672 --