TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-374b-5p
miRNA Sequence: AUAUAAUACAACCUGCUAAGUG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX73430 3102 2594 2380 2189 2182 618 1898 42986 2339 941 85 --
NM_000084chrX96985 4374 2153 1088 711 568 527 264 192 36843 1575 606 25927 5456 --
NM_000091chr282882 2869 2816 2470 1904 778 296 70 22837 2527 42891 2820 1090 782 --
NM_000109chrX42534 714 281 237 3402 389 295 42646 2641 1006 205 --
NM_000112chr5105094 4798 4578 3902 3875 1444 1411 1040 317 122 34540 3844 1600 65512 4911 4582 2127 1401 987 12179
NM_000176chr583190 2784 2713 2586 2485 1537 809 106 --43610 3194 595 56 --
NM_000202chrX53105 2809 1416 1332 346 12882 43064 3051 1356 492 13179
NM_000259chr15115676 5387 5171 1823 1728 1395 852 742 488 478 197 24837 1429 26381 5917 35689 5552 2136
NM_000267chr1793438 3400 3268 3201 2976 2654 2124 1173 861 1302 13121 43256 2559 1079 466
NM_000314chr1063228 2386 2264 2198 2150 112 52768 2245 2143 904 863 22414 2395 13266
NM_000332chr6107176 6865 5641 5376 4868 1867 1858 1849 645 95 22718 1338 16927 17100
NM_000461chr3114255 4209 4165 4044 3794 3679 2936 2830 1849 1725 624 24608 3486 13772 --
NM_000462chr1551693 1610 1355 1168 235 11340 --1243
NM_000489chrX63244 2310 1042 728 648 532 --53441 3232 2797 2655 2319 --
NM_000555chrX117431 6425 5636 5567 5086 2977 1240 1100 306 125 52 2208 144 16912 --
NM_000633chr1875248 5017 3947 2067 2057 1848 1727 23525 3508 34904 4377 3992 --
NM_000719chr1296689 6506 6382 6012 5355 4861 1574 988 893 --16647 14866
NM_000793chr1495083 3421 1907 1688 1599 1167 1018 41 27 23476 1509 --21668 1392
NM_000809chr4239266 9116 8912 8873 8674 8293 8208 8200 8130 7940 7850 7404 7337 7231 7137 6531 6448 6093 6029 3375 2423 1037 655 48318 6975 6488 1760 28887 8618 --
NM_000813chr575270 4636 2012 1469 1386 1283 1201 25519 4773 --14059
NM_000814chr15104150 3335 3187 3085 3072 1122 990 972 412 130 --1357 14094
NM_000826chr492350 2102 2038 1638 852 756 451 222 80 1308 22009 1946 --
NM_000899chr1274398 4096 3676 2977 1297 858 698 43910 2871 2747 977 --14249
NM_000902chr363142 2849 2716 2693 2000 787 22231 1220 1791 11986
NM_000910chr451924 1276 1257 1221 314 1242 11528 11263
NM_000926chr11179459 9435 9011 7436 6874 3441 2761 2226 2165 1566 1208 767 674 661 412 382 280 167 36350 1005 376 --
NM_000950chrX53579 3370 2471 1104 975 --1161 33539 2349 556
NM_000959chr163970 3471 2938 2572 634 132 ----31118 639 523
NM_001001395chr1262485 1956 375 339 196 128 22136 904 1290 31769 624 305
NM_001001419chr5115217 5171 5131 4030 3907 3223 2021 1100 1044 343 25 34952 1821 1035 24288 230 14327
NM_001001420chr5115217 5171 5131 4030 3907 3223 2021 1100 1044 343 25 34952 1821 1035 24288 230 14327
NM_001001664chr253864 1005 716 265 99 23593 3193 13829 11333
NM_001002860chr1464501 3979 3070 1286 481 224 24581 3676 --14066
NM_001003652chr18128181 6792 6232 3303 3294 2688 2358 1757 1260 460 443 342 36082 1277 1133 36100 5493 1464 37839 6237 702
NM_001003674chr18136886 6676 6104 5899 5893 5680 5409 4787 4763 1564 880 775 414 1664 35013 1343 408 26754 5213
NM_001003675chr18136886 6676 6104 5899 5893 5680 5409 4787 4763 1564 880 775 414 1664 35013 1343 408 26754 5213
NM_001003679chr152163 1928 1801 318 149 62022 1957 1761 1393 796 439 21933 1841 11755
NM_001003712chr12104044 3981 3941 3639 3534 3410 3244 3008 1174 1111 41496 1436 895 732 13657 13997
NM_001004317chr694488 3641 3479 3076 2875 1507 1462 535 403 43753 1548 1542 770 1462 24029 2753
NM_001004441chr521573 1230 ----21217 1207
NM_001005473chr575904 4410 2321 2174 1570 1246 48 36091 1843 1591 1608 1488
NM_001006600chr551762 1583 829 282 112 12174 42377 2279 1933 1777 12262
NM_001007023chr1495083 3421 1907 1688 1599 1167 1018 41 27 23476 1509 --21668 1392
NM_001007024chr1774275 3892 3423 3254 3131 2928 2835 --14338 13902
NM_001007025chr1774275 3892 3423 3254 3131 2928 2835 --14338 13902
NM_001007257chr151525 1378 1159 1063 481 --21164 1088 11530
NM_001008539chr8115145 4617 4575 4527 4490 4433 4400 1898 1842 319 169 --22159 1394 --
NM_001008738chr572605 2247 1792 659 548 294 144 22479 516 12123 12918
NM_001008925chr463445 2759 1322 1066 704 252 --43476 843 590 477 11127
NM_001009554chr4104085 3446 3323 3309 1189 1169 1145 964 641 475 1829 24255 3134 --
NM_001009554chr4104085 3446 3323 3309 1189 1169 1145 964 641 475 1829 24255 3134 --
NM_001009899chr376463 6406 4168 1116 1076 1062 805 21096 590 25300 1774 14010
NM_001009909chr1193628 3609 3243 2715 1549 912 511 360 40 1166 33903 3111 2741 23720 1397
NM_001010853chr683155 3057 2628 2515 2441 2164 487 361 23235 205 22505 2171 13045
NM_001010861chr172277 1787 938 807 573 476 325 --32787 583 578 --
NM_001010888chrX64323 2999 1152 966 955 72 13219 14268 --
NM_001010891chr585354 4907 4828 2221 1676 1616 554 150 11823 11646 16878
NM_001011513chr493701 3464 3402 2677 2544 1498 829 335 199 12967 33414 913 421 --
NM_001011666chr776467 6190 4556 4081 2541 1595 169 25248 897 55729 4998 4993 2250 141 1525
NM_001011708chr282812 2512 2061 1926 1008 749 559 242 22483 815 --1677
NM_001012755chrX114944 4841 4822 4144 3771 1533 978 931 712 471 32 24206 3673 24332 2032 23764 3708
NM_001013620chr12248412 7922 7841 7652 7429 7379 7309 7118 6640 6530 6239 6217 5698 3301 2961 2575 2511 2222 2175 1837 1711 1284 1111 618 68063 5570 5238 2500 1321 702 21272 743 17668
NM_001014380chr1375877 5700 5386 4490 4402 4182 1094 11629 --24601 1665
NM_001015508chr83525 484 477 --1489 --
NM_001017371chr261312 1174 389 246 127 60 --31351 1143 435 21370 353
NM_001018067chr154966 4384 1200 812 255 24552 705 1595 11561
NM_001018068chr154966 4384 1200 812 255 24552 705 1595 11561
NM_001018069chr154966 4384 1200 812 255 24552 705 1595 11561
NM_001018074chr583190 2784 2713 2586 2485 1537 809 106 --43610 3194 595 56 --
NM_001018075chr583190 2784 2713 2586 2485 1537 809 106 --43610 3194 595 56 --
NM_001018076chr583190 2784 2713 2586 2485 1537 809 106 --43610 3194 595 56 --
NM_001018077chr583190 2784 2713 2586 2485 1537 809 106 --43610 3194 595 56 --
NM_001018091chr1562470 1135 567 345 307 197 2239 34 12475 12197
NM_001024094chr583190 2784 2713 2586 2485 1537 809 106 --43610 3194 595 56 --
NM_001024956chr1175847 4341 4290 3619 1384 737 711 35801 5457 2252 25150 1142 25869 5276
NM_001025076chr10156215 5957 5061 4475 3990 3976 3894 2408 1935 1313 1282 1272 780 302 285 --21168 374 --
NM_001025077chr10207573 7315 6419 5833 5348 5334 5252 5064 4795 4703 4644 2671 2640 2630 2138 1660 1643 1274 917 650 --22526 1732 --
NM_001025252chr873125 2661 1284 1258 1235 956 703 1234 2711 596 12200
NM_001025253chr873125 2661 1284 1258 1235 956 703 1234 2711 596 12200
NM_001029858chr673230 3139 2487 1002 324 303 282 1824 169 1293
NM_001030055chr14184742 4398 4325 3873 3646 3520 3317 3199 1744 1639 1610 1473 1356 1316 1268 897 401 306 14213 31596 1504 1399 11576
NM_001031732chr483671 3560 3410 3027 2477 1456 670 647 13131 1826 1133
NM_001033045chr263665 3398 2947 1618 953 784 11073 1775 13513
NM_001033557chr291343 1087 1073 1037 948 931 351 238 95 31430 975 143 11047 --
NM_001034841chr1685392 5261 5182 4960 4289 760 752 263 12105 23653 3593 --
NM_001037174chr272263 2206 1806 806 467 348 319 2903 549 31864 1842 622 --
NM_001037317chr172277 1787 938 807 573 476 325 --32787 583 578 --
NM_001037334chr1892153 978 893 647 616 606 376 244 44 32075 2052 1829 ----
NM_001037339chr121839 1826 11392 21833 1819 --
NM_001037340chr121839 1826 11392 21833 1819 --
NM_001037341chr121839 1826 11392 21833 1819 --
NM_001037341chr121839 1826 11392 21833 1819 --
NM_001037535chrX61431 1250 1223 532 359 139 --4595 256 152 127 11233
NM_001037536chrX61431 1250 1223 532 359 139 --4595 256 152 127 11233
NM_001037540chrX61431 1250 1223 532 359 139 --4595 256 152 127 11233
NM_001039538chr283052 2380 1192 1142 1105 550 488 271 22447 405 3836 770 78 --
NM_001039547chr3108094 6730 6627 6171 3007 1621 1548 842 393 381 48019 7936 1964 1531 21336 527 26221 5853
NM_001039577chr134529 1663 1173 14521 21138 463 14534
NM_001039585chr164227 3728 3195 2829 891 389 ----31375 896 780
NM_001039618chr1195808 5578 5122 4857 4139 4015 1820 1562 1252 45469 5193 4406 3817 35828 5498 4271 --
NM_001039693chr262781 2727 1490 1375 1223 104 --23735 3103 1155
NM_001039840chrX126056 4992 4860 4827 4806 4718 3974 2276 2268 1889 1860 802 21644 982 45125 4865 1753 629 15438
NM_001040157chr482742 2713 2475 2279 1975 1910 822 185 32526 1917 446 3680 390 51 --
NM_001040202chr442528 765 712 58 --22575 532 32085 2038 1818
NM_001040284chr16115932 5430 4771 3800 2229 1859 1429 1330 1216 496 326 1589 --15226
NM_001040441chr1105514 5482 4920 4840 3493 1132 671 633 557 157 34822 1952 1344 14197 --
NM_001040450chr1572593 2290 2233 2155 1881 585 520 21979 435 1329 --
NM_001040453chr1572593 2290 2233 2155 1881 585 520 21979 435 1329 --
NM_001040665chr7184850 4792 4018 3825 3427 1911 1716 1699 1266 1170 1006 961 899 680 608 564 546 210 44616 3210 1741 1548 23405 439 21271 215
NM_001040712chr983625 2822 2336 2188 1373 1254 832 667 ----21026 517
NM_001042406chr681230 1183 1114 995 850 474 431 370 1143 1424 --
NM_001042492chr1793438 3400 3268 3201 2976 2654 2124 1173 861 1302 13121 43256 2559 1079 466
NM_001042555chr12114579 4013 3911 3748 3726 3623 1397 1350 984 945 195 53789 3593 1726 1593 699 24549 3769 23759 3001
NM_001042599chr2137752 7733 7637 7503 7482 7416 6209 5997 5731 3136 2239 1543 625 1613 24903 1624 --
NM_001042604chr373674 3126 1809 1520 1231 841 221 --53591 3411 1708 1668 1285 --
NM_001044385chr263815 3640 1581 1150 565 111 3616 525 491 11072 32636 340 140
NM_001071775chr1371732 1653 1385 1341 717 516 64 3436 405 134 1454 --
NM_001083620chr492348 2100 2036 1637 851 755 450 221 80 1307 22007 1944 --
NM_001099678chr3126400 5961 5637 5382 5157 4523 4425 4379 2303 2287 1821 630 36175 4531 774 86408 5376 4608 4430 1449 1244 685 460 35878 5467 1717
NM_001100108chr1128199 7518 7404 7303 5787 3213 2314 1896 1824 1490 722 397 37273 2371 1436 12318 18204
NM_001106chr389549 9294 6377 5946 3543 176 164 137 19017 21492 1244 2157 148
NM_001121chr1031881 248 24 ----3384 253 29
NM_001146chr842190 2142 478 98 126 52200 1889 907 451 432 --
NM_001160chr1252733 1965 1826 494 368 ----22691 2334
NM_001167chrX146730 6595 6585 5988 5494 4783 4681 2269 1777 1743 1325 214 195 25 21532 526 36556 5213 1682 --
NM_001173chr14184742 4398 4325 3873 3646 3520 3317 3199 1744 1639 1610 1473 1356 1316 1268 897 401 306 14213 31596 1504 1399 11576
NM_001204chr2247693 7588 7142 7121 6024 5826 5785 5634 5572 5555 5415 4711 2582 2519 2313 2195 2058 1447 1397 1318 470 262 247 235 77225 6737 6490 5607 3006 2859 2350 37147 1645 1031 11092
NM_001233chr75767 577 504 220 52 22122 1853 21989 679 157
NM_001259chr786335 4834 4141 3869 1784 1158 959 940 11587 --36168 4081 3874
NM_001304chr17103450 3368 3133 3068 3011 2893 2575 1469 1058 702 33469 3403 2848 22751 1310 --
NM_001390chr1843530 2635 1434 846 13407 43582 3501 523 380 13483
NM_001432chr463864 3778 3761 3585 1556 940 --23127 603 12592
NM_001527chr6114662 4357 4255 3843 3834 3507 1467 880 808 335 165 1183 1248 --
NM_001609chr10114462 4379 4351 4325 3887 3621 3563 3328 1317 879 569 11336 44450 4163 3570 2958 --
NM_001616chr232294 1034 686 1618 33489 3387 2242 22133 468
NM_001621chr762727 2607 1920 1120 646 57 12616 12644 42888 2503 1228 861
NM_001621chr762727 2607 1920 1120 646 57 12616 12644 42888 2503 1228 861
NM_001742chr771855 1758 1683 1591 1581 1476 1438 1139 31729 1687 1191 --
NM_001759chr1285042 4892 1799 1362 849 363 256 247 11491 1853 1950
NM_001821chr174743 3683 3426 1736 1169 452 101 13822 34707 4418 1378 --
NM_001858chr6105136 4801 4434 4236 3884 3250 3205 1688 1607 1088 --14864 11744
NM_002006chr4105744 5079 5067 5029 4774 3876 2298 2268 2256 917 --35754 5715 4805 --
NM_002009chr1572683 2526 2165 1706 965 950 942 2514 244 22313 405 1563
NM_002015chr13123314 3279 3252 3016 2666 2609 2458 2344 758 696 595 357 11003 32629 2624 2529 --
NM_002025chrX129039 8547 7480 7198 7033 2937 2457 1218 1086 979 290 133 27358 158 27282 2327 17124
NM_002035chr1893807 3589 3467 2943 2456 1594 1313 182 97 43982 3111 2539 1537 13863 12953
NM_002040chr2163098 2791 2719 2308 2022 841 1754 43223 1071 1015 886 1745
NM_002069chr791797 1329 1307 1239 1232 1212 658 537 509 ------
NM_002158chr2103595 3543 2977 2781 2494 2374 1431 1328 962 832 43815 3657 3536 1513 23488 3365 1904
NM_002202chr541070 999 906 899 2886 53 11040 --
NM_002203chr584131 4034 3843 3756 3423 3345 2581 1228 23448 1650 23405 976 24097 3439
NM_002214chr7125479 5461 5268 4748 4477 4443 4130 4014 3852 3476 1036 320 25175 64 14458 14719
NM_002222chr361030 493 373 284 44 23 1855 --1177
NM_002270chr5104973 4462 4164 3803 3515 1602 1340 1239 809 340 13757 45620 4693 1145 330 35024 3682 2256
NM_002310chr5106598 6462 6416 5896 5634 5594 4647 4367 870 103 24620 384 45996 5011 4558 1552 25262 4723
NM_002336chr1264208 4184 4145 1435 1020 927 45057 4992 4177 126 --14919
NM_002374chr283052 2380 1192 1142 1105 550 488 271 22447 405 3836 770 78 --
NM_002395chr621266 1094 11162 --21009 970
NM_002398chr251469 1341 1259 561 112 11216 1554 1543
NM_002577chr373426 2904 2890 2460 1264 1157 495 --34004 3419 2908 11379
NM_002581chr995095 4615 4512 4417 4191 3892 3780 3723 1206 23916 3449 55111 5083 4918 1916 750 35679 5233 5103
NM_002600chr121839 1826 11392 21833 1819 --
NM_002645chr1193141 3047 2875 2682 2594 840 730 368 235 22229 41 --22263 2172
NM_002655chr8125323 5268 5190 4845 4360 4307 3418 3297 2107 1480 1203 405 25132 1870 34429 3562 1463 33702 2059 602
NM_002667chr651283 1056 993 508 153 --31242 1233 84 1518
NM_002703chr441914 1283 399 55 1696 21395 1390 11872
NM_002709chr273170 2916 2448 2386 818 752 501 43580 2720 2513 1147 1202 22489 184
NM_002718chr321757 1036 12297 12314 42445 2263 2218 605
NM_002731chr183063 2861 2034 1218 1106 454 411 350 12938 12455 12039
NM_002834chr1244052 683 324 260 12828 43911 3857 3735 3452 --
NM_002839chr983625 2822 2336 2188 1373 1254 832 667 ----21026 517
NM_002886chr3115112 4224 3624 3556 3337 1978 1939 1764 1495 1310 1203 23786 1404 13628 --
NM_002977chr2123477 3432 3421 3410 1212 944 848 699 394 383 231 22 33453 2113 328 33426 3415 3262 --
NM_002994chr461917 1875 1843 453 340 248 --31807 1783 353 --
NM_003034chr12137609 7104 6719 5944 5471 5428 3129 2102 1699 1254 1046 766 465 38059 5752 1940 27592 2419 11896
NM_003046chr8115145 4617 4575 4527 4490 4433 4400 1898 1842 319 169 --22159 1394 --
NM_003099chr15116607 6566 6413 6310 2537 2073 2032 1935 1619 1592 247 --21623 1518 11602
NM_003111chr261312 1174 389 246 127 60 --31351 1143 435 21370 353
NM_003112chr762294 1969 1262 817 606 101 42774 2056 1110 1031 12252 52792 2699 2501 1188 375
NM_003128chr22699 241 --21806 704 3928 864 491
NM_003199chr1895249 5058 4153 1991 1970 1946 1864 820 64 44111 1428 1020 410 23776 1974 25492 3912
NM_003262chr3125272 5246 5205 5099 4808 1241 1032 776 472 386 177 140 1465 ----
NM_003292chr142016 1803 824 153 1764 2370 282 21955 626
NM_003304chr371474 1450 1349 597 454 152 108 2627 311 11197 41613 1443 602 518
NM_003338chr1061790 1642 1619 1333 628 96 --3769 656 230 11795
NM_003392chr383489 3080 2787 2759 1276 861 183 165 33814 893 780 11318 2758 176
NM_003410chrX83030 2866 2732 2721 2109 2031 1978 861 --12895 12976
NM_003430chr1931403 1254 518 11183 31491 1258 1145 11097
NM_003463chr663369 2328 2266 2211 1182 878 --21107 58 1883
NM_003566chr12133271 3088 3056 3035 2991 2928 2685 2342 841 537 441 399 144 33376 2973 2811 13478 13147
NM_003574chr18115697 5427 5080 2304 2277 2187 1802 1534 1086 639 333 33962 806 679 --12150
NM_003590chr2103946 3274 3045 3007 2858 2803 1145 886 779 734 22664 1519 1809 --
NM_003615chr3123939 3885 3763 3673 3502 3144 1156 989 880 719 392 22 --21078 83 --
NM_003672chr1101907 1746 1576 1509 1471 688 387 339 329 300 11715 21328 304 21560 1550
NM_003759chr464301 4235 1255 988 839 723 21503 142 21699 993 --
NM_003772chr1181118 1108 971 530 521 452 261 145 1515 ----
NM_003822chr153118 2190 2042 1957 1281 32384 2036 262 22965 2097 11951
NM_003887chr281982 1900 1861 1433 687 583 543 388 --32226 1539 266 11452
NM_003913chr664365 4150 1490 1405 573 287 24296 3938 13268 11193
NM_003966chr597829 7776 7553 6846 6606 6106 5352 1715 984 37034 5073 961 17781 --
NM_003994chr1274398 4096 3676 2977 1297 858 698 43910 2871 2747 977 --14249
NM_004006chrX42534 714 281 237 3402 389 295 42646 2641 1006 205 --
NM_004007chrX42534 714 281 237 3402 389 295 42646 2641 1006 205 --
NM_004009chrX42534 714 281 237 3402 389 295 42646 2641 1006 205 --
NM_004010chrX42534 714 281 237 3402 389 295 42646 2641 1006 205 --
NM_004011chrX42534 714 281 237 3402 389 295 42646 2641 1006 205 --
NM_004012chrX42534 714 281 237 3402 389 295 42646 2641 1006 205 --
NM_004013chrX42534 714 281 237 3402 389 295 42646 2641 1006 205 --
NM_004014chrX42534 714 281 237 3402 389 295 42646 2641 1006 205 --
NM_004015chrX42534 714 281 237 3402 389 295 42646 2641 1006 205 --
NM_004016chrX42448 628 195 151 3316 303 209 42560 2555 920 119 --
NM_004017chrX42534 714 281 237 3402 389 295 42646 2641 1006 205 --
NM_004018chrX42448 628 195 151 3316 303 209 42560 2555 920 119 --
NM_004020chrX42534 714 281 237 3402 389 295 42646 2641 1006 205 --
NM_004021chrX42448 628 195 151 3316 303 209 42560 2555 920 119 --
NM_004022chrX42448 628 195 151 3316 303 209 42560 2555 920 119 --
NM_004023chrX42448 628 195 151 3316 303 209 42560 2555 920 119 --
NM_004109chr1152370 2285 338 187 55 2634 477 --1105
NM_004133chr852659 2616 2567 338 164 21642 438 12426 1119
NM_004136chr15103302 3159 2527 2350 2014 1272 1210 1054 880 764 --23214 2625 --
NM_004171chr11139326 8145 7968 7597 6913 6696 2927 2139 1136 1106 435 401 228 27122 7022 56993 6958 3011 2265 1590 18127
NM_004232chr1863863 3829 3254 1230 819 229 33603 3149 719 22842 1346 --
NM_004274chr1453223 2505 2332 798 676 ----23228 648
NM_004293chr993821 3648 3274 3072 1323 1051 811 738 490 11285 13243 11405
NM_004338chr18136886 6676 6104 5899 5893 5680 5409 4787 4763 1564 880 775 414 1664 35013 1343 408 26754 5213
NM_004342chr752367 2256 2137 689 148 2779 458 31431 758 592 12356
NM_004392chr1372632 2269 2229 2059 1726 419 277 --32636 843 30 22383 2234
NM_004464chr4124305 4083 3877 3719 3225 3105 2923 2766 1700 720 592 472 1522 23884 2928 23186 1730
NM_004504chr2102789 2578 2505 2165 2056 1196 1083 636 349 272 --13064 1623
NM_004748chr1573891 3420 2889 2850 2829 1116 260 22964 158 11121 --
NM_004795chr132617 41 21539 1517 31912 1661 1298 11694
NM_004815chr1134737 3960 3755 1897 1856 1656 1496 1195 1114 694 682 54 41 23746 3699 21229 699 1388
NM_004857chr1473767 3577 3411 3383 3057 2996 1121 11377 24817 3061 14674
NM_004871chr1774275 3892 3423 3254 3131 2928 2835 --14338 13902
NM_004904chr776467 6190 4556 4081 2541 1595 169 25248 897 55729 4998 4993 2250 141 1525
NM_004921chr132061 1989 212 32479 2082 1653 12013 12070
NM_004956chr784582 4541 4485 4409 3324 2794 1419 1067 --1947 11745
NM_004985chr1222853 963 --33471 747 594 24525 653
NM_005065chr1495304 4909 4666 4345 4262 1618 1336 573 377 14339 15212 43407 1920 1150 1031
NM_005079chr873125 2661 1284 1258 1235 956 703 1234 2711 596 12200
NM_005121chr1792806 2690 1077 899 856 650 609 404 135 13574 12558 31082 452 229
NM_005151chr1892153 978 893 647 616 606 376 244 44 32075 2052 1829 ----
NM_005156chr9115372 5199 4460 4264 3931 3853 3629 1618 1575 1118 481 24621 4210 31063 1051 531 15205
NM_005160chr22116521 6104 5999 5662 5630 5584 5459 5393 1764 1583 965 15489 26577 5414 14870
NM_005168chr241576 1345 1133 524 11650 --31659 1632 350
NM_005180chr1051652 1436 1411 676 380 11634 11053 21252 202
NM_005188chr1178258 7403 3199 1204 719 257 192 1410 2784 509 12157
NM_005235chr2137752 7733 7637 7503 7482 7416 6209 5997 5731 3136 2239 1543 625 1613 24903 1624 --
NM_005239chr2151866 670 543 520 463 ----2528 468
NM_005339chr484043 3962 3794 3197 1647 1439 119 63 23183 1455 23557 1069 31570 1414 1108
NM_005358chr1361717 1682 1335 517 349 154 --11629 1427
NM_005359chr18115694 5396 4511 2595 1094 1086 708 570 437 418 259 --15805 1538
NM_005400chr2103073 3032 3012 2943 2879 2768 2001 1140 1088 1017 13022 --12038
NM_005504chr12196624 6609 6578 6547 5593 5541 5348 4839 4151 2628 2537 2232 2193 1651 1572 1150 935 854 626 36159 5500 2500 16212 24570 795
NM_005509chr571844 1667 1559 1505 1308 1232 359 --11768 1246
NM_005578chr3124549 4004 3812 3714 3394 1902 1704 1631 1481 904 779 248 44908 4892 831 143 ----
NM_005596chr986237 5830 5772 4261 1845 1672 1581 1190 34058 1734 919 36355 6156 1899 --
NM_005613chr172071 1954 1792 1518 1504 1492 105 --31864 1528 465 11932
NM_005665chr1114895 4661 4522 4420 3764 3390 1562 1506 1397 1318 495 14852 13641 24888 3196
NM_005668chr5134596 4572 4086 3901 3825 3556 3374 3326 1478 1398 1206 1189 1001 24621 3171 44025 3960 3767 3540 --
NM_005715chr622710 2420 12370 12541 22715 2611
NM_005746chr782605 2539 2415 2055 1758 1040 565 545 12747 5995 707 686 549 52 --
NM_005748chr12103318 733 593 581 521 409 382 257 248 60 21306 790 22874 2167 1661
NM_005779chr563508 3065 2696 2225 1366 1349 1198 23562 2819 13568
NM_005840chrX97630 7084 5366 5062 4667 2901 2365 2199 1820 36681 5054 5038 ----
NM_005859chr561313 1200 961 432 381 287 1417 21009 565 --
NM_005898chr1182913 2693 2610 2336 1261 879 525 79 13047 --1113
NM_005901chr18128181 6792 6232 3303 3294 2688 2358 1757 1260 460 443 342 36082 1277 1133 36100 5493 1464 37839 6237 702
NM_005903chr5115217 5171 5131 4030 3907 3223 2021 1100 1044 343 25 34952 1821 1035 24288 230 14327
NM_005906chr631630 1511 1304 ----21527 1486
NM_005935chr4105147 4845 4773 4587 4284 4206 3908 2077 1411 598 --54795 4790 4785 4780 2024 23341 1913
NM_005941chr8113915 3892 3791 3712 3697 3085 2625 1598 1078 346 73 --13286 23945 2718
NM_005966chr282339 2196 1763 1752 1677 729 557 511 22217 1472 --2887 282
NM_005999chr151424 1054 381 136 90 21244 1027 21118 386 11326
NM_006007chr994055 3422 3278 3177 3166 3009 1749 1101 375 1623 53426 1465 1460 1037 678 11170
NM_006047chr2092934 2678 2216 2161 1348 1091 933 905 510 11310 2985 438 11354
NM_006080chr7112635 2571 2337 2227 2174 2133 1200 876 726 364 99 1147 ----
NM_006095chr4114510 4438 4422 4347 3560 3219 3034 2976 2784 1065 785 23243 1720 32776 2771 155 --
NM_006139chr252886 2781 2460 2029 2009 --12656 22786 2077
NM_006197chr851962 1869 1617 422 331 --1579 1431
NM_006203chr5105427 5029 4642 4184 2244 1895 1251 1234 880 602 25165 3803 31784 992 623 --
NM_006251chr572682 2433 1094 1011 332 241 85 196 1343 21183 358
NM_006252chr1157017 6012 5210 4688 3014 2519 2501 1844 1384 1312 1005 477 200 47 25 46188 5455 5397 1932 27389 5195 12494
NM_006265chr881528 1501 1409 1327 1256 1120 1081 578 ----21560 947
NM_006282chr2064118 3564 2905 1670 470 207 1391 24377 1831 13737
NM_006283chr854927 4714 4260 1035 451 33585 3339 1053 14239 14944
NM_006313chr1221348 289 11404 1626 31418 1252 1070
NM_006393chr1094546 4379 4047 4026 3814 3613 2976 826 519 1727 11625 13750
NM_006420chr2073386 3049 2924 2866 2738 2518 2207 12730 23430 1186 12744
NM_006457chr493701 3464 3402 2677 2544 1498 829 335 199 12967 33414 913 421 --
NM_006534chr2053318 3154 2272 2184 543 33435 2164 2112 2997 992 22850 2463
NM_006544chr14105983 5969 5820 5581 4442 3930 1893 1542 1231 428 14972 35364 3742 1930 23857 823
NM_006561chr10156215 5957 5061 4475 3990 3976 3894 2408 1935 1313 1282 1272 780 302 285 --21168 374 --
NM_006599chr16177046 6732 6661 6422 6015 5899 5553 5440 3287 2917 2413 2404 2162 1350 759 337 270 --37625 5941 5813 --
NM_006614chr3133656 3399 3193 2880 2600 2340 1378 1263 1182 896 520 209 138 23381 2467 33618 3600 905 --
NM_006620chr694575 4507 4492 3092 2994 1220 857 603 372 43425 3219 902 494 ----
NM_006628chr1574658 4067 3706 1424 842 336 141 24268 1544 34472 4423 376 --
NM_006629chr1831905 796 709 1804 12600 2747 714
NM_006646chr1343043 2545 2503 421 22517 2510 ----
NM_006654chr12114579 4013 3911 3748 3726 3623 1397 1350 984 945 195 53789 3593 1726 1593 699 24549 3769 23759 3001
NM_006717chr973105 3014 2925 2555 1114 1096 48 23366 285 12559 13092
NM_006729chrX95200 5009 4727 2075 1971 1462 1304 1283 748 --21619 490 11396
NM_006731chr995788 5512 4541 4426 4415 4393 4317 3544 991 15431 --23819 1350
NM_006746chrX61431 1250 1223 532 359 139 --4595 256 152 127 11233
NM_006750chr16108030 7260 5691 5377 5072 4975 2511 2219 2084 542 27578 1708 38066 7545 5696 17291
NM_006775chr662683 2645 2532 2241 885 764 --42919 2812 2601 2340 23076 1011
NM_006777chrX42747 2698 2395 2218 --21158 1128 22629 2044
NM_006785chr1852104 2008 580 513 334 41787 1434 701 616 2666 319 --
NM_006873chr231192 856 612 21111 906 11394 23419 3081
NM_006895chr252171 2054 1469 455 33 --2728 626 12179
NM_006914chr941540 1281 975 243 11010 3607 501 304 11218
NM_006915chrX82440 2189 2018 1696 1689 507 483 298 --22457 2089 --
NM_006918chr1175847 4341 4290 3619 1384 737 711 35801 5457 2252 25150 1142 25869 5276
NM_006948chr2182411 2247 829 687 487 403 373 317 11716 1531 --
NM_006981chr992295 1958 1929 1827 1074 923 366 249 194 22547 849 ----
NM_007006chr1693550 3489 3387 3332 2619 2594 720 419 137 --23192 3062 --
NM_007007chr1284440 4323 4211 3851 1788 1501 268 241 33607 3507 286 --13904
NM_007038chr21115964 5450 5272 4337 4204 3704 2125 1701 1598 1303 131 16127 11266 11675
NM_007042chr382687 2226 2179 1928 1730 578 536 366 12155 --32118 2069 1722
NM_007054chr5133926 3908 3546 2572 2557 2502 1598 1524 996 825 721 236 190 --33956 1138 429 1575
NM_007125chrY51184 1125 962 892 439 11387 --11020
NM_007146chr1782775 2360 2332 2135 1979 1016 703 463 ----21829 358
NM_007214chr631276 291 258 11235 11032 21223 263
NM_007231chrX82333 1989 801 771 367 337 262 29 --32443 2307 193 12449
NM_007249chr13179467 9227 8632 8305 8169 8044 7401 7210 6085 5774 3594 3370 2044 2017 1685 1193 324 48454 6834 1531 1088 49041 8279 6700 3772 29083 9025
NM_007287chr363142 2849 2716 2693 2000 787 22231 1220 1791 11986
NM_007288chr363142 2849 2716 2693 2000 787 22231 1220 1791 11986
NM_007289chr363142 2849 2716 2693 2000 787 22231 1220 1791 11986
NM_007347chr1541117 1005 479 196 --2971 594 2305 242
NM_012081chr573555 3470 3067 2976 1398 1346 308 33104 2559 1032 11355 --
NM_012096chr3123295 3267 2835 2818 2673 2616 2281 1307 1247 913 840 687 1318 13405 11099
NM_012097chr272263 2206 1806 806 467 348 319 2903 549 31864 1842 622 --
NM_012158chr1371768 1633 1589 1238 1179 726 256 --3730 590 343 3415 305 47
NM_012214chr2125781 4452 4002 3993 2544 1066 1046 624 440 406 290 165 35306 1040 225 86201 5415 1099 1003 851 835 375 263 11857
NM_012287chr3144505 3878 3363 3287 3009 2760 1754 1669 1610 1595 1081 835 603 580 64517 4466 4199 3931 3755 2916 11145 --
NM_012382chr5144413 4112 3802 3637 3061 1691 1612 1466 1185 1019 987 809 797 509 23153 2773 21204 157 14541
NM_012388chr1583114 2966 2605 2513 835 276 230 96 22588 2146 1919 12293
NM_012414chr13763 324 284 4691 313 39 33 --1227
NM_012416chr991248 1240 1181 1058 858 794 774 296 27 --11097 31025 77 36
NM_012420chr1041594 667 123 74 1162 2317 95 1249
NM_013229chr1252733 1965 1826 494 368 ----22691 2334
NM_013233chr241408 989 435 411 --11167 1422
NM_013255chr7128830 8822 8351 8248 8145 8053 7006 6422 3277 2586 2012 1025 56910 6725 5469 3137 2421 28893 3052 --
NM_013341chr282812 2512 2061 1926 1008 749 559 242 22483 815 --1677
NM_013374chr3133083 3025 2951 2289 2211 1087 793 647 611 505 495 420 299 23122 2616 13094 12877
NM_013386chr161587 1244 645 583 224 163 31676 1663 324 --11298
NM_013989chr1495083 3421 1907 1688 1599 1167 1018 41 27 23476 1509 --21668 1392
NM_013995chrX82386 2270 1906 1746 915 675 556 208 21918 246 1560 --
NM_014005chr582174 1067 1020 911 896 439 372 250 151 --1455
NM_014021chr183366 2929 2895 2690 2618 1384 972 513 23122 2505 1426 2779 326
NM_014028chr673225 2887 2438 2309 1048 452 218 --43281 3144 709 459 --
NM_014106chr1572886 2740 2632 2501 563 556 60 22923 2917 21837 417 22266 243
NM_014112chr884941 4854 4321 3702 1873 1355 369 141 1889 24945 373 13737
NM_014141chr7155328 5277 4006 3518 2142 2033 1633 1583 1444 1331 1079 928 891 738 544 ------
NM_014155chr1187310 6758 5114 5043 2068 1774 1384 825 22524 1962 37315 7291 770 17218
NM_014319chr1261816 1806 1547 1487 1343 31 --21835 1391 11821
NM_014331chr4136888 6869 6208 6133 5598 3084 2156 1898 1800 1639 550 451 191 33019 2514 176 27751 678 36749 5693 2861
NM_014372chr151550 1463 555 253 238 12113 11874 1610
NM_014399chr75945 740 359 321 132 ----2877 35
NM_014423chr585268 4749 3835 3438 2092 1934 859 562 11174 25435 5396 --
NM_014615chr1673663 3578 3566 3419 2678 843 45 ----23572 848
NM_014616chr383497 3456 1353 982 799 456 412 307 1137 23460 3359 --
NM_014702chr692878 2593 2242 2123 1316 1093 983 736 557 32293 805 391 32624 2483 251 --
NM_014707chr7102247 1845 1545 862 808 767 745 628 541 302 1213 1201 22279 2199
NM_014721chr6127240 6972 6659 6352 6125 2133 1980 1965 1329 1305 577 427 36202 5161 2483 47432 6855 6333 4840 26916 6131
NM_014739chr663663 3488 3149 1527 640 185 33871 3163 271 13170 --
NM_014787chr142487 1964 1821 388 12037 --22167 1719
NM_014795chr271370 1174 1129 406 194 178 48 1296 11038 1465
NM_014810chr163242 3211 968 961 646 427 --1550 13313
NM_014873chr184675 4597 4534 4429 3995 1718 360 327 23947 1664 11963 24590 4185
NM_014877chr17117426 7245 7081 6556 6282 6223 4913 2034 1010 448 251 37465 7206 363 --14900
NM_014897chr1763049 2998 2859 2437 502 413 --33170 2273 1297 11190
NM_014904chr10153996 3980 3151 2999 2987 2877 2769 2752 2599 1621 1211 1163 956 726 123 1425 1659 21319 949
NM_014906chr1763421 2651 1211 1061 740 713 33874 2575 101 --23771 3106
NM_014912chr10103418 3314 3164 2948 2493 2407 1210 1179 711 140 12718 32771 1173 665 11291
NM_014918chr1561629 1407 1215 1084 331 202 --11579 1336
NM_014920chr673539 3472 3140 917 747 734 275 22715 2322 33461 611 606 --
NM_014923chr1342262 2085 2051 149 2600 508 22345 2213 11544
NM_014951chr1042181 1854 1812 1634 32627 1797 1788 12123 32637 1805 192
NM_014953chr1363302 3291 2846 833 765 759 14161 13703 12933
NM_014962chr20102839 2369 2332 2264 1989 1844 1087 738 266 155 --12843 --
NM_014982chr1495311 4744 4700 4547 4203 1973 1687 1404 1097 --45335 4734 4446 1101 --
NM_015000chr1252649 1210 1058 841 208 --42958 2402 759 227 12523
NM_015025chr292539 2469 2439 2283 1797 1042 931 518 116 11029 22383 579 22461 704
NM_015026chr12103671 3327 3135 1656 1429 1322 1207 704 593 455 1988 22981 821 44416 1558 1519 1123
NM_015040chr263361 3201 2850 533 458 384 13245 33312 3129 2425 12836
NM_015051chr962192 1315 1234 835 713 648 1936 32704 2415 880 1794
NM_015076chr664332 4210 4073 3467 3175 3008 11431 44043 1530 1163 940 --
NM_015208chr18143279 2946 2624 2608 2534 879 534 500 470 458 212 120 54 26 31526 1076 986 ----
NM_015278chr693441 3369 3345 3189 3106 2927 2554 1393 1119 33359 3278 734 1454 --
NM_015310chr8138240 8058 7729 7627 6493 6352 5901 5167 3316 3214 1660 1126 263 --36911 5524 134 27716 1665
NM_015313chr1194251 4008 3791 3081 1807 1448 902 872 306 21426 1110 --14301
NM_015317chr242839 507 440 199 1193 22800 688 21993 1082
NM_015349chr673031 2986 2669 2390 516 478 264 32740 2447 860 11060 11970
NM_015431chr173459 2347 1184 1166 1141 310 181 42893 1253 793 302 11390 --
NM_015436chr463264 2578 1141 885 523 71 --43295 662 409 296 1946
NM_015455chr563970 3691 3473 2860 519 457 13676 11119 2568 525
NM_015458chr8105106 5015 4913 4422 3900 3475 1840 1049 935 593 --11149 1840
NM_015461chr185709 583 133 110 96 --2214 115 --
NM_015569chr1104823 4136 4063 3441 3230 1697 1588 896 813 41 44865 4439 4421 3620 14542 --
NM_015640chr154966 4384 1200 812 255 24552 705 1595 11561
NM_015678chr1391494 1418 1253 1174 1160 515 263 224 142 ----11658
NM_015866chr151525 1378 1159 1063 481 --21164 1088 11530
NM_015879chr18148500 8166 7735 7011 6854 6008 2362 2046 1730 1514 1309 1199 1019 841 21848 1825 --27248 3153
NM_015886chr8165743 5663 5011 4905 4852 4836 4823 4086 3826 1634 1450 1020 746 477 300 292 --44923 1305 231 89 --
NM_015888chr183330 3132 2918 2445 2269 901 233 179 32676 2550 1180 12109 32593 2222 275
NM_015891chr64731 686 467 191 2587 238 11961 21452 341
NM_015906chr1124541 4520 3824 3296 3178 3006 2927 1836 1183 755 719 533 --24071 1731 14756
NM_015912chr822427 1877 22445 2436 22405 1701 22279 2249
NM_016023chr861806 1724 1535 749 215 24 11617 22180 1830 21717 1702
NM_016072chr1272384 2170 1799 928 827 659 36 12339 --12408
NM_016078chr1731014 880 405 --1951 2983 874
NM_016083chr6103938 3790 3642 1389 1061 956 570 404 85 72 1800 33687 2566 435 13370
NM_016087chr741278 1202 1120 486 --31544 1362 1163 11269
NM_016132chr1573422 3172 2192 1195 1084 585 230 11140 53392 3240 2243 327 81 --
NM_016206chr3168737 8288 7072 6709 6521 6222 6045 5509 3573 3565 3406 1335 915 715 654 253 58876 6584 6215 1454 472 57962 5939 5801 2514 560 15480
NM_016255chr693349 3253 3052 2834 2401 2120 1096 148 44 --32309 2086 1269 --
NM_016260chr2157623 7490 7077 6175 5943 5907 5587 5189 4813 2691 1782 996 507 214 118 1357 15920 17496
NM_016271chr1882312 2241 1954 629 526 424 347 282 11590 41434 820 351 304 --
NM_016315chr251856 1678 646 85 62 31807 1259 563 31629 1433 265 --
NM_016422chr1183074 2934 2857 2539 2005 246 223 31 --12024 12010
NM_016441chr272204 2119 1975 1859 1807 1586 96 --2968 877 22160 1864
NM_016513chr673539 3472 3140 917 747 734 275 22715 2322 33461 611 606 --
NM_016530chr1543333 3094 2912 796 33170 2776 2723 13794 23350 2862
NM_016626chr1841605 1475 1124 104 31741 1635 582 11717 11354
NM_016824chr1031881 248 24 ----3384 253 29
NM_016953chr2126059 5951 5705 5277 4856 4498 3783 3707 2024 1851 1529 1124 36044 4287 1362 24790 3899 --
NM_017420chr14133583 3543 3499 3121 3094 2989 2622 2374 2327 1367 1228 1172 762 22550 1206 13142 --
NM_017447chr2164442 3730 3485 3337 1002 163 13198 24330 3791 1390
NM_017599chr1231910 1667 1538 11817 41619 1296 639 415 11436
NM_017628chr494672 3890 3726 3580 1717 727 560 380 226 24086 1349 23414 2042 15017
NM_017637chr989074 6560 2691 2152 2112 1186 1122 566 --38408 6946 2134 --
NM_017650chr786059 5384 4858 2393 1922 1832 1723 640 14170 24226 2239 44976 2365 2328 2043
NM_017651chr63384 251 224 --31093 1043 388 21123 207
NM_017658chr14124593 4475 4227 4180 3779 3288 3257 3248 1652 1489 1109 623 63896 3141 2985 2911 1858 1675 44655 4201 1620 1493 14372
NM_017752chrX92104 2014 1833 1718 1698 1449 531 415 228 --31886 1763 1685 12133
NM_017768chr1135 1825 --3930 362 104
NM_017769chr1463063 2757 2350 1035 991 588 32895 2862 656 53183 1072 607 456 149 12282
NM_017779chr192657 2512 2428 2097 1964 1825 579 122 21 12078 --11845
NM_017813chr885479 5339 4963 4707 3901 2230 297 203 1631 44756 4637 3996 1826 14645
NM_017831chr1864690 4410 4061 1351 1334 136 43229 3111 1111 1094 1140 23309 1165
NM_017847chr142289 2083 256 187 42259 2235 1705 55 --21878 912
NM_017919chr955704 4371 4211 3851 437 54626 3568 2140 1979 755 --14447
NM_018155chr373428 3403 2672 2195 1242 446 146 13302 22217 1014 1347
NM_018290chr41927 21082 283 11248 21156 882
NM_018339chr941690 687 140 79 --21793 704 21801 1352
NM_018351chr1273813 3251 912 818 636 188 80 44726 3562 961 350 23136 2903 2844 445
NM_018361chr873884 3692 3402 2726 711 478 361 --23056 562 33697 3527 1406
NM_018362chr1183724 3061 3047 3006 2795 1595 1521 1426 52546 1622 1052 780 90 23585 278 --
NM_018364chr1123352 3034 2980 2643 1602 1498 1188 1159 774 617 166 56 --23648 1386 --
NM_018373chr1476355 6326 4862 2565 412 234 183 --45715 4987 4201 532 25792 937
NM_018374chr7105122 4999 4765 3749 3636 2099 1876 1687 1542 674 35205 5115 3869 55054 4817 4650 2062 463 --
NM_018429chr5132912 2895 2788 2463 2345 2039 1981 1093 906 677 636 567 365 --11930 --
NM_018566chr1114127 4112 3756 3735 3462 3226 1767 1483 1443 1436 701 54406 1428 1245 627 555 23760 3739 2403 296
NM_018590chr1031526 1184 662 ----21544 1531
NM_018638chr1285028 4837 4664 3507 1104 1088 936 126 24275 459 54613 4438 3770 2093 1278 21701 299
NM_018640chr1262485 1956 375 339 196 128 22136 904 1290 31769 624 305
NM_018650chr162252 582 462 363 230 136 11909 21825 540 1817
NM_018685chr72806 211 1977 1134 21137 987
NM_018695chr551762 1583 829 282 112 12174 42377 2279 1933 1777 12262
NM_018841chr173934 3750 3220 3109 641 553 290 2651 49 33612 611 397 --
NM_018898chr572381 2147 1999 1955 1541 1522 670 12246 --11926
NM_018899chr572381 2147 1999 1955 1541 1522 670 12246 --11926
NM_018900chr572381 2147 1999 1955 1541 1522 670 12246 --11926
NM_018901chr572381 2147 1999 1955 1541 1522 670 12246 --11926
NM_018902chr572381 2147 1999 1955 1541 1522 670 12246 --11926
NM_018903chr572381 2147 1999 1955 1541 1522 670 12246 --11926
NM_018904chr572381 2147 1999 1955 1541 1522 670 12246 --11926
NM_018905chr572381 2147 1999 1955 1541 1522 670 12246 --11926
NM_018906chr572381 2147 1999 1955 1541 1522 670 12246 --11926
NM_018907chr572381 2147 1999 1955 1541 1522 670 12246 --11926
NM_018908chr572381 2147 1999 1955 1541 1522 670 12246 --11926
NM_018909chr572381 2147 1999 1955 1541 1522 670 12246 --11926
NM_018910chr572381 2147 1999 1955 1541 1522 670 12246 --11926
NM_018911chr572381 2147 1999 1955 1541 1522 670 12246 --11926
NM_018951chr721121 261 --11231 21174 1126
NM_018999chr10114833 4504 3910 3797 3564 3122 1629 1384 1085 989 320 34972 1752 1642 ----
NM_019001chr373674 3126 1809 1520 1231 841 221 --53591 3411 1708 1668 1285 --
NM_019036chr681230 1183 1114 995 850 474 431 370 1143 1424 --
NM_019072chr564287 4131 3973 3061 546 485 ----23811 1135
NM_019083chr161590 1450 1103 580 221 56 1408 --21485 1060
NM_019117chrX83488 3381 2609 1261 1154 673 589 407 1326 11020 12138
NM_019885chr222720 2587 ----42751 2671 2653 2623
NM_019903chr1031881 248 24 ----3384 253 29
NM_020119chr753183 2879 1408 1398 1080 11564 23832 1226 23639 1540
NM_020159chr431651 480 354 21265 71 51725 1667 1250 1198 453 --
NM_020177chr5102982 2959 2805 2649 2563 2088 2060 770 419 198 53372 2886 2540 2528 136 1691 --
NM_020297chr1283282 3222 2223 1347 1100 963 390 168 11304 33029 2830 1383 11105
NM_020342chr272466 2383 2073 1634 704 651 423 1833 --1709
NM_020390chr394880 4776 4591 4485 1857 1557 1381 499 432 34866 3364 677 34325 3780 3147 --
NM_020654chr381469 1365 1186 1143 1113 1079 603 275 11225 11148 1426
NM_020673chr2097690 7562 6743 4690 1601 1544 929 480 268 42981 1649 923 391 42333 1481 1049 195 27388 5397
NM_020718chr16106562 6481 6461 5119 4324 4071 2193 1168 288 254 14457 --16038
NM_020734chr1242806 2778 2755 1056 22766 2739 43199 2460 2417 452 22690 2291
NM_020739chr1573891 3420 2889 2850 2829 1116 260 22964 158 11121 --
NM_020752chr10102846 2595 2304 2222 1127 1083 786 763 633 561 22924 2652 2807 590 --
NM_020766chrX104520 4392 4353 3937 3579 3511 3334 584 450 129 24423 321 34624 3338 276 --
NM_020772chr17128030 6355 5976 5863 5632 5560 3476 3361 2993 2666 1163 869 35810 3325 3091 36815 3399 1824 11911
NM_020774chr18136070 5978 5615 5201 4835 4725 3920 3820 1364 1310 1134 1045 450 54292 2121 1766 1181 468 35013 2325 2103 24026 1091
NM_020810chr1473366 2468 1290 1003 586 184 62 1195 2972 560 --
NM_020819chr661201 889 461 399 337 301 1413 21168 65 --
NM_020841chr12104044 3981 3941 3639 3534 3410 3244 3008 1174 1111 41496 1436 895 732 13657 13997
NM_020854chr181455 31033 430 113 1335 21561 391
NM_020918chr1031280 1164 415 23122 1204 33258 1354 1271 1669
NM_020921chr1433245 3130 2510 21312 452 22707 614 23001 390
NM_020935chr264632 4372 3994 3442 3327 1436 11814 1817 11464
NM_020948chr193683 3591 3099 3044 2851 2286 1107 790 528 1912 12247 --
NM_021033chr1383475 3420 2187 1397 1185 1130 584 576 13482 22655 315 --
NM_021038chr3133340 3296 3006 2913 2877 2400 2368 2245 973 934 711 697 484 1549 33254 378 86 22286 2173
NM_021072chr5102511 2347 1872 1827 1743 1052 919 888 676 511 1860 1227 --
NM_021111chr93875 527 518 --21253 1216 1892
NM_021148chr772490 2088 1865 1707 1587 138 51 --42388 2271 1964 346 --
NM_021629chr364944 4749 3850 3129 2016 304 1691 34156 3878 1655 --
NM_021647chr4104085 3446 3323 3309 1189 1169 1145 964 641 475 1829 24255 3134 --
NM_021911chr575270 4636 2012 1469 1386 1283 1201 25519 4773 --14059
NM_021912chr15104150 3335 3187 3085 3072 1122 990 972 412 130 --1357 14094
NM_021961chr1197222 7211 6270 5569 4925 1789 903 781 195 11112 26941 786 12717
NM_021964chr3186512 6487 6158 5854 5803 5031 4936 4863 4689 4614 1824 1717 1682 1478 886 563 461 320 46643 6388 5639 2371 56139 5669 4618 4407 4384 --
NM_022048chr1596358 5816 5710 4818 4021 1337 813 802 50 --15674 --
NM_022133chr861826 1769 1611 353 246 192 11237 31884 1705 286 --
NM_022351chr8103873 3731 3437 3115 2912 1135 697 597 328 311 53232 2895 1185 1086 239 11422 --
NM_022474chr1442844 2792 2575 1093 2847 726 --32824 1946 1116
NM_022483chr561610 637 398 175 167 103 1603 31459 1427 1372 21308 116
NM_022763chr383097 2957 2524 2065 864 847 687 677 --23145 838 13070
NM_022893chr292963 2881 2628 2158 2058 1998 940 884 381 --23080 843 1774
NM_022918chr1171777 1435 262 249 243 99 56 32166 1521 1344 2484 280 --
NM_024345chr9145524 5483 5060 4826 4811 4407 4386 4275 2140 2087 1146 1071 657 528 35512 2336 625 --34897 4831 2145
NM_024408chr163606 3599 2660 691 499 399 13672 23078 518 23702 2665
NM_024423chr1874301 3420 3387 2999 804 333 68 44276 3607 1004 947 1553 33939 3497 278
NM_024511chr493201 2770 2620 2535 1362 1351 1098 1021 735 12709 1131 --
NM_024583chr251105 857 301 227 86 1831 --3865 822 350
NM_024615chr52191 91 178 --199
NM_024641chr692929 2913 2697 2049 968 912 474 340 110 12975 52998 2871 2462 849 151 --
NM_024665chr3124677 4512 4312 3631 3475 3252 3148 1646 966 946 498 383 1298 1739 --
NM_024770chr296032 5842 4972 4791 4449 4317 878 478 68 35976 5046 2517 1292 --
NM_024817chr1575871 5799 5497 5388 5150 5058 561 --15427 25876 5050
NM_024930chr572713 2323 1083 995 944 901 824 --1858 22811 2635
NM_024947chr3199574 9506 9092 8997 8765 8557 8323 6779 6102 6086 3814 3584 3415 3091 1254 1170 974 911 97 49250 7940 3480 1438 89597 9123 5956 3703 3532 2228 436 279 --
NM_024949chr474988 4970 4823 4635 1885 1549 1525 14494 13456 14569
NM_024989chr2158094 7744 6648 6633 6591 6435 6352 4988 3048 2986 2935 2867 2659 2566 1828 38021 5104 3140 56829 6653 6187 2076 982 16030
NM_025040chr19102361 2260 1806 1723 1605 1575 999 964 421 381 ----11684
NM_025054chr8104237 3848 3661 3529 3104 3056 461 127 118 37 23793 3784 24037 1668 --
NM_025073chr1134777 4746 4735 4688 4616 4234 4131 3471 3011 819 671 655 287 24453 353 11167 12975
NM_025179chr144883 4870 1851 1221 --34953 4747 1225 14899
NM_025191chr183506 3413 3003 2959 2278 842 463 448 43532 3519 2837 863 13284 --
NM_030621chr1494234 4080 3824 3645 3548 3127 1559 523 194 13015 43715 3147 1422 745 --
NM_030627chr5124078 4016 3868 3830 3618 3013 2955 2815 2739 1530 914 356 23649 615 33930 3746 3668 11375
NM_030647chr776303 6224 5630 4190 1116 1068 679 15008 36141 2114 1591 1954
NM_030648chr495466 5414 5162 4902 3882 732 719 675 223 33961 1147 1113 2723 679 --
NM_030650chr2104250 3788 3327 3230 2828 2699 976 683 189 156 --23331 1296 --
NM_030674chr1244969 937 533 438 15480 32117 1977 352 14974
NM_030791chr1461825 1278 1259 578 442 309 11222 2327 261 1378
NM_030806chr1119419 9383 9302 7541 3416 2965 2635 2411 1283 564 205 18773 22176 129 18823
NM_030816chr153453 2682 1092 788 505 11252 --22807 220
NM_031362chr272808 2795 2742 2396 1830 704 222 22763 2453 42817 2746 1016 708 --
NM_031365chr282944 2931 2878 2532 1966 840 358 132 22899 2589 42953 2882 1152 844 --
NM_031366chr282944 2931 2878 2532 1966 840 358 132 22899 2589 42953 2882 1152 844 --
NM_031411chr572381 2147 1999 1955 1541 1522 670 12246 --11926
NM_031427chr1485997 5959 5919 5630 4968 4704 1197 818 35252 1044 925 21006 586 --
NM_031438chr571853 1791 1429 750 514 200 27 11725 2676 568 11651
NM_031483chr20103424 3317 2879 2730 2459 2241 2174 1032 1020 510 12629 12951 12555
NM_031845chr283052 2380 1192 1142 1105 550 488 271 22447 405 3836 770 78 --
NM_031847chr283052 2380 1192 1142 1105 550 488 271 22447 405 3836 770 78 --
NM_031849chr572381 2147 1999 1955 1541 1522 670 12246 --11926
NM_031857chr572381 2147 1999 1955 1541 1522 670 12246 --11926
NM_031860chr572381 2147 1999 1955 1541 1522 670 12246 --11926
NM_032012chr984981 4927 4704 4558 3385 1079 756 412 43859 1969 1835 676 44714 1225 523 323 21951 596
NM_032042chr552821 2589 2387 1016 827 1882 12877 11954
NM_032047chr382335 2284 2273 856 542 390 304 228 ----1547
NM_032116chr1375877 5700 5386 4490 4402 4182 1094 11629 --24601 1665
NM_032121chrX62788 2752 2094 2039 1890 509 22113 284 --1275
NM_032208chr253441 3422 2711 2693 291 33251 3141 2668 --23579 2841
NM_032373chr10105925 5843 4216 3718 1286 1162 864 827 598 433 24958 2150 11560 25495 1910
NM_032435chr182059 1790 1759 1619 1546 658 629 180 42137 2100 700 342 12197 12357
NM_032446chr5113480 3431 3013 2998 2880 2865 1505 1216 511 467 397 13186 11194 1259
NM_032457chr483727 3116 2850 1103 830 809 779 666 --12506 33784 2925 1059
NM_032521chr2053218 2854 2372 2342 136 1816 12047 33154 2833 1223
NM_032804chr1042461 2005 902 803 22144 2133 32010 1810 1004 22063 1749
NM_032810chr1051537 1265 1144 1058 944 --31187 1114 256 11063
NM_032828chr1984666 3981 3723 3489 3385 1787 1149 941 54600 4370 3583 1167 271 34446 3965 3937 1624
NM_032859chr13113830 3296 980 924 540 474 362 265 222 78 28 --23283 1418 --
NM_032873chr11104401 4301 4277 4072 3159 2844 1602 1221 1058 935 24511 4001 14347 --
NM_032968chrX104073 3588 3381 3256 3213 3107 2789 1375 1094 611 23978 1173 24174 3765 23660 3581
NM_032969chrX104073 3588 3381 3256 3213 3107 2789 1375 1094 611 23978 1173 24174 3765 23660 3581
NM_032973chrY104065 3584 3376 3251 3208 3102 2784 1375 1094 611 11173 24166 3757 23652 3577
NM_032975chr1843530 2635 1434 846 13407 43582 3501 523 380 13483
NM_032980chr1843530 2635 1434 846 13407 43582 3501 523 380 13483
NM_033020chr1124541 4520 3824 3296 3178 3006 2927 1836 1183 755 719 533 --24071 1731 14756
NM_033107chr761894 1837 1557 580 526 474 11679 --21659 1577
NM_033119chr164117 101 83 68 ----191
NM_033132chr1372352 2010 1820 1654 1568 373 279 22320 538 32165 1842 1659 12186
NM_033138chr752367 2256 2137 689 148 2779 458 31431 758 592 12356
NM_033139chr752367 2256 2137 689 148 2779 458 31431 758 592 12356
NM_033140chr752367 2256 2137 689 148 2779 458 31431 758 592 12356
NM_033143chr4114636 4414 4208 4050 3556 3436 3254 3097 1051 923 803 1853 24215 3259 13517
NM_033157chr752367 2256 2137 689 148 2779 458 31431 758 592 12356
NM_033181chr6103938 3790 3642 1389 1061 956 570 404 85 72 1800 33687 2566 435 13370
NM_033224chr7158077 7120 7105 6466 6109 6014 3108 3051 2975 2078 1922 1776 1760 1258 997 37460 5402 1909 16071 --
NM_033225chr862445 1967 866 756 734 667 23148 2823 12218 12789
NM_033285chr873600 3218 3212 3160 738 517 285 --24151 1659 11078
NM_033360chr1232974 1084 118 --33592 868 715 24646 774
NM_033402chr85385 377 356 348 163 2510 121 --268 49
NM_033505chr266729 2553 2412 1407 1142 769 25012 1568 21874 594 26748 4983
NM_033656chr21115988 5620 5310 4158 3772 3741 3699 1478 970 549 152 1812 --1650
NM_052832chr892773 2758 2570 1984 1971 1893 1201 310 286 --23052 2381 12587
NM_052885chr1273734 3519 1964 1369 1146 1134 1054 44785 3616 827 653 44841 4696 3287 280 13583
NM_052886chr862158 2052 1422 748 667 295 ----21757 179
NM_053016chr9107238 6096 5977 2515 2163 1712 1524 1504 859 571 12789 42841 2490 1821 1632 --
NM_053042chr442585 504 472 204 --52982 2851 2773 2160 2153 13105
NM_053056chr1172640 2618 2494 2457 2116 607 601 --1611 12508
NM_057168chr741278 1202 1120 486 --31544 1362 1163 11269
NM_080759chr1372632 2269 2229 2059 1726 419 277 --32636 843 30 22383 2234
NM_080760chr1372632 2269 2229 2059 1726 419 277 --32636 843 30 22383 2234
NM_080764chr22113300 3257 3196 2513 2165 752 600 495 180 156 120 13283 ----
NM_080867chr1494866 3913 3085 1969 1860 1526 532 353 177 24801 3985 1440 13309
NM_080872chr843308 3030 2876 1299 1451 --33585 2794 969
NM_080874chr461913 1891 762 224 195 166 11401 41895 1881 1624 332 21221 391
NM_130391chr983625 2822 2336 2188 1373 1254 832 667 ----21026 517
NM_130392chr983625 2822 2336 2188 1373 1254 832 667 ----21026 517
NM_130393chr983625 2822 2336 2188 1373 1254 832 667 ----21026 517
NM_130810chr15127 --173 2136 32
NM_130838chr1551693 1610 1355 1168 235 11340 --1243
NM_130839chr1551693 1610 1355 1168 235 11340 --1243
NM_133334chr4115400 5382 5358 5136 4686 4264 3861 2213 1946 1108 600 22245 1015 34355 1563 474 26212 552
NM_133370chr483671 3560 3410 3027 2477 1456 670 647 13131 1826 1133
NM_133372chr572605 2247 1792 659 548 294 144 22479 516 12123 12918
NM_133433chr53783 736 672 --3833 702 225 1645
NM_133477chr483272 3044 2982 2631 2308 2205 1174 374 --22853 2062 12708
NM_133493chr684620 4604 3578 3173 3056 2985 2920 1483 34173 3656 3022 24630 2999 13064
NM_133646chr275376 5331 5186 4991 1367 1319 242 33738 1351 749 14819 11139
NM_134470chr36714 582 524 470 180 168 4737 667 576 260 ----
NM_138270chrX63244 2310 1042 728 648 532 --53441 3232 2797 2655 2319 --
NM_138286chr19104245 4178 3914 2816 1671 1409 1106 907 379 249 32755 726 330 63352 3247 2820 1526 1064 845 --
NM_138288chr1452214 1729 1708 903 231 1841 2739 391 11993
NM_138459chr653663 3475 2742 1232 598 --22817 933 32532 2440 878
NM_138554chr982513 2228 2191 1962 1792 1757 1727 346 12785 32034 356 351 12798
NM_138713chr16177046 6732 6661 6422 6015 5899 5553 5440 3287 2917 2413 2404 2162 1350 759 337 270 --37625 5941 5813 --
NM_138714chr16177046 6732 6661 6422 6015 5899 5553 5440 3287 2917 2413 2404 2162 1350 759 337 270 --37625 5941 5813 --
NM_138731chr1493476 2853 2725 1527 1061 871 836 389 310 23030 913 33965 2808 1287 --
NM_138771chr771584 1479 1404 1192 998 478 44 21343 489 41327 1003 594 464 --
NM_139169chr1051978 1938 500 394 238 1174 --12053
NM_139319chr1271848 1490 1469 1382 1241 1152 146 11163 --11495
NM_144567chr142411 2322 2049 43 12135 32853 2607 2097 1226
NM_144571chr4136526 5419 5152 5091 4395 2581 2316 1879 1496 1329 1012 904 121 12409 35442 878 253 11863
NM_144578chr14115489 5248 4935 4423 1485 1435 1342 1284 541 503 335 54809 4725 4343 2085 757 24878 3988 14718
NM_144599chr15115458 5269 4346 4242 4161 1604 1573 1242 1202 1067 860 2998 846 --14880
NM_144721chr482670 1067 976 207 183 139 131 124 ----22779 245
NM_144973chr1285257 5188 5169 3454 779 481 441 249 23268 714 24212 161 --
NM_145259chr2107055 6968 6423 5326 5141 4823 2686 2432 1753 200 --37022 2776 301 22832 821
NM_145284chrX52170 794 772 481 129 21859 1742 --32335 1832 923
NM_145307chr1084668 3239 1717 1672 510 438 84 66 23506 1041 13811 24031 3045
NM_147156chr1051552 1453 954 359 96 ----21382 603
NM_148955chr15116607 6566 6413 6310 2537 2073 2032 1935 1619 1592 247 --21623 1518 11602
NM_152388chr263815 3640 1581 1150 565 111 3616 525 491 11072 32636 340 140
NM_152409chr572943 2636 2557 2375 610 338 196 --53202 2755 2561 2442 883 --
NM_152529chr263665 3398 2947 1618 953 784 11073 1775 13513
NM_152608chr142283 1819 1023 846 31995 1900 401 11008 12505
NM_152624chr597134 6836 6543 4618 2500 1975 1828 1658 1361 42689 2141 1586 184 26711 1365 17018
NM_152641chr1252672 2630 1780 1125 582 22020 737 32735 1114 893 1341
NM_152673chr354421 4003 3523 1428 660 14444 24282 3163 33968 698 645
NM_152707chr1061048 748 399 373 340 196 ----2966 753
NM_152723chr114981 152 146 62 31053 926 440 194 21030 160
NM_152740chr73741 304 183 --1717 1726
NM_152754chr783883 3739 2406 1395 1388 1197 1147 285 11008 --23851 2838
NM_152774chr731043 828 622 22117 475 2770 324 22582 464
NM_152826chr15116607 6566 6413 6310 2537 2073 2032 1935 1619 1592 247 --21623 1518 11602
NM_152836chr861826 1769 1611 353 246 192 11237 31884 1705 286 --
NM_152837chr861826 1769 1611 353 246 192 11237 31884 1705 286 --
NM_152838chr2092934 2678 2216 2161 1348 1091 933 905 510 11310 2985 438 11354
NM_152999chr7184850 4792 4018 3825 3427 1911 1716 1699 1266 1170 1006 961 899 680 608 564 546 210 44616 3210 1741 1548 23405 439 21271 215
NM_153013chr582367 2333 2104 945 876 599 555 94 12069 --1846
NM_153188chr5104973 4462 4164 3803 3515 1602 1340 1239 809 340 13757 45620 4693 1145 330 35024 3682 2256
NM_153235chr622406 724 22297 1736 22261 476 11865
NM_153332chr862668 2279 2234 2143 889 584 1575 23039 2865 --
NM_153607chr562999 2925 1115 693 321 95 33186 2078 59 31281 1194 794 --
NM_153686chr471803 1600 1592 1572 1553 465 143 --3983 720 233 1340
NM_153689chr232365 1540 799 12066 11714 22261 62
NM_153715chr721121 261 --11231 21174 1126
NM_170710chr453133 2938 2528 2349 651 42412 637 537 253 33075 2447 1229 --
NM_172071chr1117256 5902 5644 5184 5098 2868 2580 2078 1671 575 351 47433 6563 5265 2784 21769 326 15421
NM_173198chr992295 1958 1929 1827 1074 923 366 249 194 22547 849 ----
NM_173200chr992295 1958 1929 1827 1074 923 366 249 194 22547 849 ----
NM_173214chr16177046 6732 6661 6422 6015 5899 5553 5440 3287 2917 2413 2404 2162 1350 759 337 270 --37625 5941 5813 --
NM_173468chr4125890 5881 5693 5475 5231 4355 4313 1877 1680 778 275 151 --45479 1968 1224 69 --
NM_173496chr1092996 2969 2953 2814 2710 2595 1157 1003 824 --22943 691 22045 1096
NM_173576chr1021981 1492 1169 1776 21975 1823
NM_173582chr11126310 5982 5807 5560 4248 3812 2077 2047 1183 464 401 263 12262 65598 4264 2034 393 313 251 36235 2434 1093
NM_173644chr2071936 1905 1885 1852 1752 652 435 11949 11346 11819
NM_173797chr54907 866 318 68 1916 --2987 158
NM_173808chr173979 3098 3072 2708 1692 1429 147 --33061 3042 1188 11217
NM_173829chr5146095 5879 5847 5807 5765 5068 4842 4176 4133 4049 4014 2285 2045 2001 35666 2055 312 45838 2481 884 84 15625
NM_175061chr762065 1822 1697 605 314 305 21610 378 22033 2010 1678
NM_175856chr54554 230 91 63 1644 173 1105
NM_175861chr1294887 4658 4638 1657 1214 916 885 805 631 23873 1335 21847 1095 24814 1941
NM_175921chr584295 4261 3413 1267 570 316 245 168 22904 474 34233 3133 3008 --
NM_177438chr1494234 4080 3824 3645 3548 3127 1559 523 194 13015 43715 3147 1422 745 --
NM_177538chr255691 3010 2216 1873 171 28807 8176 38659 8633 5680 --
NM_177968chr281759 1651 1416 884 516 506 406 349 1580 --1626
NM_177985chr272263 2206 1806 806 467 348 319 2903 549 31864 1842 622 --
NM_178011chr1052593 2053 996 444 335 12120 22169 550 1322
NM_178151chrX117431 6425 5636 5567 5086 2977 1240 1100 306 125 52 2208 144 16912 --
NM_178152chrX117431 6425 5636 5567 5086 2977 1240 1100 306 125 52 2208 144 16912 --
NM_178153chrX117431 6425 5636 5567 5086 2977 1240 1100 306 125 52 2208 144 16912 --
NM_178815chr1062104 2076 2042 877 757 609 12442 22535 1069 12749
NM_181265chr453133 2938 2528 2349 651 42412 637 537 253 33075 2447 1229 --
NM_181354chr831645 1260 1183 51597 1549 1364 268 142 11207 11491
NM_181358chr1133947 3861 3850 3453 3045 2699 1476 1419 1390 1321 878 613 401 12612 43630 1624 904 594 2927 686
NM_181443chr20102839 2369 2332 2264 1989 1844 1087 738 266 155 --12843 --
NM_181481chr18136886 6676 6104 5899 5893 5680 5409 4787 4763 1564 880 775 414 1664 35013 1343 408 26754 5213
NM_181482chr18136886 6676 6104 5899 5893 5680 5409 4787 4763 1564 880 775 414 1664 35013 1343 408 26754 5213
NM_181483chr18136886 6676 6104 5899 5893 5680 5409 4787 4763 1564 880 775 414 1664 35013 1343 408 26754 5213
NM_181659chr2053318 3154 2272 2184 543 33435 2164 2112 2997 992 22850 2463
NM_181659chr2053318 3154 2272 2184 543 33435 2164 2112 2997 992 22850 2463
NM_181714chr631616 1385 1359 21869 32 21646 644 166
NM_181723chr8122160 2112 1986 1835 1729 1519 1491 1421 891 676 492 319 --1202 22285 924
NM_181787chr883889 3724 3678 3574 3389 3158 980 524 13839 21406 1342 33324 963 304
NM_181861chr1252733 1965 1826 494 368 ----22691 2334
NM_181868chr1252733 1965 1826 494 368 ----22691 2334
NM_181869chr1252818 2050 1911 579 453 ----22776 2419
NM_181897chr321757 1036 12297 12314 42445 2263 2218 605
NM_182485chr493739 3621 3268 3128 2666 2323 890 616 455 33444 3438 853 ----
NM_182493chr16105331 4567 4383 3932 1968 1565 1501 375 365 101 25179 665 24524 440 22078 1096
NM_182515chr19116399 6236 6146 5633 4383 2483 2315 2228 666 552 484 46052 2181 1537 747 22338 1180 16328
NM_182646chr493739 3621 3268 3128 2666 2323 890 616 455 33444 3438 853 ----
NM_182756chr24642 146 133 120 --2617 103 1559
NM_182758chr1563425 2777 2475 1564 357 92 23270 2517 33938 3441 903 13215
NM_182762chr7125839 5085 4648 4453 3809 3801 2330 1309 1174 1158 359 174 54012 3969 2378 2302 924 --34067 4025 3982
NM_182830chr1451902 1677 1646 1600 613 21495 1397 11607 12008
NM_182898chr776467 6190 4556 4081 2541 1595 169 25248 897 55729 4998 4993 2250 141 1525
NM_182899chr776467 6190 4556 4081 2541 1595 169 25248 897 55729 4998 4993 2250 141 1525
NM_182920chr371414 1391 512 379 350 253 30 ----21450 291
NM_182948chr183063 2861 2034 1218 1106 454 411 350 12938 12455 12039
NM_194291chr892982 2003 1060 963 639 472 273 209 147 --1128 12459
NM_194314chr1145495 5361 5030 5010 4985 4009 3961 2198 1348 726 686 628 467 38 21232 1002 44531 2065 1799 288 11922
NM_194318chr1392543 2154 2089 1877 1801 1031 477 448 291 1347 22599 2069 --
NM_194434chr18115697 5427 5080 2304 2277 2187 1802 1534 1086 639 333 33962 806 679 --12150
NM_197941chr562929 2873 2850 573 401 159 33010 546 509 1342 --
NM_198066chr1452841 716 448 326 265 41166 929 680 123 1876 2490 206
NM_198128chr1882312 2241 1954 629 526 424 347 282 11590 41434 820 351 304 --
NM_198268chr1133947 3861 3850 3453 3045 2699 1476 1419 1390 1321 878 613 401 12612 43630 1624 904 594 2927 686
NM_198269chr1133947 3861 3850 3453 3045 2699 1476 1419 1390 1321 878 613 401 12612 43630 1624 904 594 2927 686
NM_198281chr493172 2916 2641 2520 2387 1274 662 329 319 1478 1311 23464 431
NM_198485chr362578 2361 1626 762 674 253 12270 11630 22201 1774
NM_198503chr182373 2300 2235 2096 1781 1587 1578 741 12055 1406 11805
NM_198581chr2147542 7197 7035 6105 5602 5456 4652 4578 2218 2055 1887 1107 555 144 26770 103 45969 5010 2203 607 26251 251
NM_198715chr1146360 6272 6018 5634 5620 5553 5311 4379 4351 4018 2235 2211 1225 257 33870 3846 2485 24249 3907 25668 5039
NM_199324chr473742 3233 3192 2455 2442 1262 303 12536 31333 1036 468 12554
NM_199355chr1641749 1646 580 550 21299 1260 21685 264 1662
NM_199421chr1494866 3913 3085 1969 1860 1526 532 353 177 24801 3985 1440 13309
NM_203282chr1991771 1738 1535 1369 1318 1273 1260 369 199 31312 654 496 1527 11211
NM_203406chr5172827 2738 2729 2271 2233 1912 1103 877 806 723 673 663 566 553 500 404 34 1699 3810 369 109 22907 839
NM_203458chr1113431 3238 3051 2831 2823 2564 1417 1249 966 935 722 12714 13242 --
NM_203459chr1102466 2194 2180 1666 962 938 725 623 344 246 11796 12158 12291
NM_203463chr274325 3393 3160 1809 1717 1325 255 33604 1409 808 11677 1929
NM_205860chr153118 2190 2042 1957 1281 32384 2036 262 22965 2097 11951
NM_206854chr6104969 4814 1858 1407 710 421 395 370 311 127 31776 1054 813 35060 3680 959 139
NM_206855chr6125934 5779 4094 2372 1675 1386 1360 1335 1276 1092 674 423 32019 1778 621 46025 4645 4010 1924 11004
NM_206876chr273170 2916 2448 2386 818 752 501 43580 2720 2513 1147 1202 22489 184
NM_206907chr572682 2433 1094 1011 332 241 85 196 1343 21183 358
NM_206909chr8138240 8058 7729 7627 6493 6352 5901 5167 3316 3214 1660 1126 263 --36911 5524 134 27716 1665
NM_207292chr3133340 3296 3006 2913 2877 2400 2368 2245 973 934 711 697 484 1549 33254 378 86 22286 2173
NM_207293chr3133340 3296 3006 2913 2877 2400 2368 2245 973 934 711 697 484 1549 33254 378 86 22286 2173
NM_207294chr3133340 3296 3006 2913 2877 2400 2368 2245 973 934 711 697 484 1549 33254 378 86 22286 2173
NM_207295chr3133340 3296 3006 2913 2877 2400 2368 2245 973 934 711 697 484 1549 33254 378 86 22286 2173
NM_207296chr3133340 3296 3006 2913 2877 2400 2368 2245 973 934 711 697 484 1549 33254 378 86 22286 2173
NM_207297chr3133365 3321 3031 2938 2902 2425 2393 2270 998 959 736 722 509 1574 33279 403 111 22311 2198
NM_207303chr1073982 3526 2845 1540 1186 376 273 13598 1235 14158
NM_207366chr772288 2273 1659 1629 1579 727 393 12172 31833 912 116 --
NM_207406chr466254 6210 5284 5192 2534 903 26446 4497 1202 26412 208
NM_207647chr982525 2286 1628 1595 856 599 571 407 22596 959 ----
NM_212558chr9124141 3818 3713 3532 3360 3004 1717 1293 771 602 577 439 --13721 13501
NM_213589chr2155574 5330 5295 5241 5228 5052 4839 4668 4043 3945 2139 1818 1594 986 104 45203 3530 1173 1052 1431 35512 4806 3643
NM_213651chr161587 1244 645 583 224 163 31676 1663 324 --11298