TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-374c-3p
miRNA Sequence: CACUUAGCAGGUUGUAUUAUAU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX53238 3190 2639 1135 849 33426 2489 1129 ----
NM_000084chrX76498 6471 6095 5534 5000 2455 2385 ------
NM_000092chr254007 1419 1148 73 53 ------
NM_000093chr912063 1581 1614 --
NM_000109chrX42507 1983 1692 230 12230 1648 --
NM_000110chr11905 ------
NM_000112chr554940 3831 3445 3384 2114 33512 1893 1353 --14776
NM_000129chr62230 56 11394 ----
NM_000176chr533125 2732 1069 --12434 --
NM_000202chrX53613 3480 2781 2703 427 13046 11448 --
NM_000214chr2021318 118 --11596 129
NM_000216chrX33342 1107 504 21521 577 ----
NM_000217chr1255187 1708 1047 940 906 2294 111 ----
NM_000240chrX51992 1882 1415 704 97 --12022 --
NM_000252chrX31168 1096 206 21151 503 ----
NM_000259chr1586271 5119 4907 4762 2368 2292 1224 338 22148 232 ----
NM_000264chr973309 3205 2800 2735 1275 999 580 ------
NM_000280chr111915 ------
NM_000297chr45755 566 346 285 210 ----1679
NM_000321chr1341811 1623 1475 1119 ------
NM_000330chrX31849 1715 500 1264 1447 --
NM_000332chr666853 6835 6038 4962 4739 1230 17079 ----
NM_000337chr5106449 6319 5672 4353 2227 1794 1413 1205 548 294 15613 12535 --
NM_000340chr321017 167 2206 99 ----
NM_000351chrX42958 2742 1638 683 1725 14061 --
NM_000368chr964535 3429 3017 1898 1362 97 ------
NM_000393chr222086 141 ------
NM_000408chr232651 2581 830 1212 ----
NM_000411chr2122580 198 1717 1105 --
NM_000430chr1733629 1289 451 --12316 --
NM_000449chr11489 --1133 1274
NM_000461chr383559 3384 1832 1662 1619 1033 1005 919 --14457 --
NM_000489chrX12942 22452 664 1408 1221
NM_000495chrX21010 437 ------
NM_000522chr72442 320 ------
NM_000533chrX21350 807 ------
NM_000538chr1321481 587 ------
NM_000555chrX86331 5457 4929 4835 2497 2214 1473 632 12300 ----
NM_000582chr41369 ------
NM_000596chr7--142 ----
NM_000618chr1255767 5030 1413 1157 396 15417 ----
NM_000618chr1255767 5030 1413 1157 396 15417 ----
NM_000719chr1255072 4725 1665 695 684 15151 15039 --
NM_000726chr241363 1126 213 55 ----1134
NM_000743chr1511171 ------
NM_000780chr811017 11143 ----
NM_000788chr421421 945 11261 ----
NM_000791chr562489 996 663 207 183 25 1858 1552 --
NM_000793chr1484973 3439 1829 1471 1153 705 495 382 14042 35099 3359 3230 1186
NM_000801chr20--1318 ----
NM_000809chr456518 3522 3298 2726 163 49021 2858 1800 1495 ----
NM_000813chr564874 4046 1547 714 548 250 44154 3872 2162 2045 --23696 172
NM_000826chr431891 711 641 --12455 --
NM_000833chr1661436 1358 1274 468 202 94 11220 ----
NM_000859chr52490 448 --1483 --
NM_000875chr1577065 7008 6752 5592 5401 4930 4707 16782 22071 1878 --
NM_000891chr1733448 1000 695 ------
NM_000899chr1221039 747 13326 ----
NM_000901chr4133 1859 ----
NM_000912chr863040 2335 1247 884 866 60 --1874 1295
NM_000926chr11199302 9221 9081 8721 8337 8054 7872 7583 7225 6462 6043 6002 5719 3482 2458 2184 1539 1132 597 38994 1860 391 ----
NM_000927chr71504 ------
NM_000935chr331050 777 78 31139 906 477 ----
NM_000944chr452394 1908 1607 1562 727 2880 854 ----
NM_000950chrX53060 2616 1346 1268 191 13611 11111 --
NM_000958chr51408 ------
NM_000961chr2093655 3477 3344 3098 1428 1207 1127 734 165 23942 2909 11021 --
NM_000965chr31456 --2860 316 --
NM_001001396chr173808 3478 3401 2812 1114 1030 149 --1665 --
NM_001001557chr852063 1995 1844 1663 113 --21772 600 --
NM_001001664chr273925 3682 691 660 478 425 345 13441 ----
NM_001001668chr1933833 1534 607 --14072 --
NM_001001711chr11163 ------
NM_001001890chr2143733 2619 1487 637 ------
NM_001001971chr103527 519 314 11141 --177
NM_001001995chrX31307 1170 288 11705 ----
NM_001002269chr9173 1541 ----
NM_001002860chr1464264 3825 1774 1524 1015 165 ------
NM_001002926chr731109 992 638 --1349 188
NM_001003407chr1064811 4796 3182 1778 1044 437 23786 423 24970 3541 --
NM_001003408chr1064811 4796 3182 1778 1044 437 23786 423 24970 3541 --
NM_001003652chr1898439 7823 6283 6209 5603 2851 1836 1191 267 26179 2401 17873 --
NM_001003712chr1243788 3372 1184 812 23004 1555 22622 213 --
NM_001003792chr31785 11045 ----
NM_001003793chr31785 11045 ----
NM_001004065chr963697 3100 2674 1480 1156 673 ------
NM_001004313chr1732130 2067 749 11431 ----
NM_001004317chr663666 3220 2999 1384 1111 252 ------
NM_001004419chr1254309 4116 3177 2862 567 31641 993 301 ----
NM_001005375chrY41781 1418 383 337 ------
NM_001005386chr241634 339 225 186 32406 499 257 ----
NM_001005463chr1022100 737 ----12468
NM_001005476chr2----1482 --
NM_001005502chr1274182 3765 3626 1466 1201 755 584 ------
NM_001005739chr2--1681 ----
NM_001005746chr241363 1126 213 55 ----1134
NM_001005747chr241363 1126 213 55 ----1134
NM_001005849chr17--1515 ----
NM_001005861chr32843 686 1970 ----
NM_001006618chr9137 ------
NM_001007023chr1484973 3439 1829 1471 1153 705 495 382 14042 35099 3359 3230 1186
NM_001007075chr411022 --1689 --
NM_001007097chr9124619 4332 3679 3547 3430 3349 1217 1175 806 671 559 228 ------
NM_001007098chr1190 ------
NM_001007102chr6185 --1450 1521
NM_001007214chr12353 322 1122 1710 --
NM_001007246chr211208 1559 --1639
NM_001007527chr51280 ------
NM_001008239chr1853549 3118 2514 1526 553 --12809 --
NM_001008405chr721222 85 1695 ----
NM_001008539chr865284 3770 3722 3502 3495 191 23632 55 ----
NM_001008540chr22493 50 ------
NM_001008660chr11--1537 ----
NM_001008738chr552844 2368 2329 2263 748 --12708 --
NM_001008925chr442206 1351 596 501 23311 2907 ----
NM_001009555chr421348 212 ------
NM_001009881chr11633 ------
NM_001009882chr11633 ------
NM_001009894chr1231346 1170 262 1644 ----
NM_001009958chr71473 ------
NM_001010888chrX64052 3882 1319 1111 242 205 13715 12821 --
NM_001010891chr596475 4544 4268 1452 1415 1292 1104 818 432 11983 22036 1337 --
NM_001010895chr951679 1652 1553 663 539 11346 ----
NM_001010927chr62409 153 ------
NM_001010971chr1------1893
NM_001010986chrX1179 ------
NM_001011546chr202781 253 ------
NM_001011666chr7106508 6436 6279 6007 5570 5185 5023 4895 4870 1275 22561 1454 ----
NM_001011708chr222322 991 ------
NM_001012267chr92740 670 ----1181
NM_001012398chr161427 2257 175 ----
NM_001012410chr31349 ------
NM_001012420chr1532949 2287 143 ------
NM_001012423chr1532949 2287 143 ------
NM_001012426chr632368 1122 667 --12437 --
NM_001012427chr632368 1122 667 --12437 --
NM_001012755chrX61680 1651 720 384 363 273 --181 13222
NM_001013406chr721665 1089 ----21508 1463
NM_001013620chr12128338 7460 7298 7262 7055 6017 3139 2955 2372 2365 537 166 21161 964 17003 --
NM_001013699chr121108 --1376 --
NM_001013717chr53511 494 329 --11121 --
NM_001013746chr722186 1780 ----21868 1848
NM_001014336chr121244 195 166 --
NM_001014380chr13105725 4295 4188 4080 3980 2269 2049 1563 1180 438 15544 12100 --
NM_001014434chr11194 ------
NM_001014797chr1086628 6588 2807 2639 2111 2084 1153 909 26159 1757 ----
NM_001015053chr1721460 1087 ----11565
NM_001015877chrX32322 780 337 11124 1181 12183
NM_001017368chr1732589 2128 1043 ------
NM_001017369chr41109 1215 ----
NM_001017395chr322339 949 1669 23438 3249 --
NM_001017923chr144665 655 389 204 1375 ----
NM_001018009chr341210 1038 973 223 --1967 --
NM_001018054chr111339 --11106 --
NM_001018065chr995346 4364 4074 2421 2384 992 647 434 273 15355 11513 --
NM_001018066chr995346 4364 4074 2421 2384 992 647 434 273 15355 11513 --
NM_001018067chr195007 4952 4434 4270 3834 3634 3570 3520 1685 35123 4260 4088 ----
NM_001018068chr195007 4952 4434 4270 3834 3634 3570 3520 1685 35123 4260 4088 ----
NM_001018069chr195007 4952 4434 4270 3834 3634 3570 3520 1685 35123 4260 4088 ----
NM_001018074chr533125 2732 1069 --12434 --
NM_001018075chr533125 2732 1069 --12434 --
NM_001018076chr533125 2732 1069 --12434 --
NM_001018077chr533125 2732 1069 --12434 --
NM_001020658chr11619 ------
NM_001020658chr11619 ------
NM_001020825chr51207 ------
NM_001023567chr151143 ------
NM_001024094chr533125 2732 1069 --12434 --
NM_001024226chr12423 277 ------
NM_001024227chr12423 277 ------
NM_001024228chr12423 277 ------
NM_001024649chr541931 989 800 605 --12278 --
NM_001024660chr341167 1112 1056 567 ------
NM_001024807chr191240 ------
NM_001024934chr61663 1243 ----
NM_001024935chr61663 1243 ----
NM_001024936chr61663 1243 ----
NM_001025068chr341674 1347 1210 340 ------
NM_001025069chr341674 1347 1210 340 ------
NM_001025076chr10116179 5754 5432 5278 4752 4468 4080 1582 1548 803 498 12053 ----
NM_001025077chr10127537 7112 6790 6636 6110 5826 5438 5115 2940 2906 2161 1856 1576 ----
NM_001025079chr344072 3137 1675 484 44089 1455 527 332 1161 12744
NM_001025252chr832893 2548 633 13088 11132 --
NM_001025253chr832893 2548 633 13088 11132 --
NM_001025266chr374157 3490 1977 1128 685 622 462 33838 1705 1441 11207 --
NM_001025580chrX83907 3577 3544 2992 1092 892 494 188 32621 1000 602 ----
NM_001025595chr421052 169 ------
NM_001025603chr11489 --1133 1274
NM_001029858chr643234 2930 2511 93 ------
NM_001029875chr532713 2483 942 ------
NM_001030055chr1464579 4480 4451 3195 1837 1312 24665 1499 11491 1474
NM_001031689chr9--1107 ----
NM_001031695chr2285212 4867 4804 2078 1312 1279 1127 492 --14206 --
NM_001031712chr61350 ------
NM_001031716chr22166 132 ------
NM_001031803chr171272 ------
NM_001031812chr552228 2146 1809 1443 339 ------
NM_001032296chr1321972 378 ------
NM_001032393chrX1753 --1191 --
NM_001033047chr432210 1915 484 1674 ----
NM_001033049chr2162231 2216 915 594 391 330 2793 316 ----
NM_001033112chr53852 817 154 1168 ----
NM_001033503chr51412 ------
NM_001033557chr211440 1102 --1153
NM_001033566chr175866 365 359 322 65 --1290 --
NM_001033568chr175866 365 359 322 65 --1290 --
NM_001033578chr862317 1963 1545 776 642 307 ------
NM_001033925chr1041551 1386 642 182 12097 ----
NM_001034025chr121110 1159 1820 --
NM_001034841chr1634772 3643 1466 13550 1618 1439
NM_001034850chr521417 1165 1573 ----
NM_001034915chr861529 1223 1196 402 349 342 ----1481
NM_001035260chr1041152 539 315 141 1663 ----
NM_001035511chr121328 195 11390 ----
NM_001035512chr121435 302 11497 ----
NM_001035513chr121435 302 11497 ----
NM_001035521chr2----1312 1757
NM_001037163chr7170 ------
NM_001037164chr752011 1712 595 518 423 21985 1946 ----
NM_001037174chr22647 369 11563 ----
NM_001037290chr114806 791 783 30 11030 ----
NM_001037872chr21510 ------
NM_001039111chr31170 1450 ----
NM_001039199chr2094987 4400 3510 2004 1438 1144 899 881 675 1482 ----
NM_001039348chr2133 1861 --1248
NM_001039349chr2133 1861 --1248
NM_001039538chr232571 521 379 12321 12931 12996
NM_001039547chr3137604 7556 7295 7077 6050 5995 5660 5221 2877 2233 1454 880 421 17738 ----
NM_001039618chr1135603 5503 4317 ----23723 720
NM_001039693chr2103901 3744 3707 3160 2977 2752 1418 901 808 645 ------
NM_001039762chr1041592 769 590 55 --12372 --
NM_001039802chr111239 ------
NM_001039840chrX44276 1987 1844 741 ------
NM_001039937chr1363640 3515 1639 1106 654 337 21604 412 --13206
NM_001040057chr731099 1002 258 --11224 --
NM_001040058chr41369 ------
NM_001040060chr41369 ------
NM_001040101chr461425 1410 1133 554 415 232 ------
NM_001040151chr1184426 3668 1711 1371 1264 815 698 553 ----12824
NM_001040152chr764669 4324 4138 3741 1877 370 24660 4609 25156 3791 --
NM_001040157chr432605 1902 558 22831 810 12130 32841 2611 312
NM_001040158chr51213 ------
NM_001040159chr421226 366 ------
NM_001040202chr452271 1766 446 397 36 21753 690 11627 --
NM_001040284chr1645616 4403 4056 2024 ------
NM_001040402chr472556 2463 2353 1150 1114 1038 943 1848 ----
NM_001040429chr1313149 13137 --12631
NM_001040440chr52143 47 ------
NM_001040441chr175189 4635 1860 1812 1679 958 444 ----24252 1444
NM_001040633chr73766 708 91 ------
NM_001040712chr923204 1266 ------
NM_001041chr32292 51 ------
NM_001042355chr1663398 1520 1165 936 485 265 12086 21472 270 13359
NM_001042412chr1663398 1520 1165 936 485 265 12086 21472 270 13359
NM_001042453chrX31728 1166 279 31292 494 263 ----
NM_001042481chr1422299 1019 21982 172 11788 --
NM_001042494chr1552385 1539 1208 283 140 ------
NM_001042495chr1552385 1539 1208 283 140 ------
NM_001042496chr1552385 1539 1208 283 140 ------
NM_001042497chr1552385 1539 1208 283 140 ------
NM_001042533chr332914 2500 1286 --22101 877 --
NM_001042548chr22703 650 1802 ----
NM_001042599chr245683 5035 2772 1202 21180 798 ----
NM_001042601chr342918 2790 2663 1140 32886 2634 66 ----
NM_001042603chr1274907 4607 3923 3479 3421 3363 3305 13891 ----
NM_001042604chr354339 4308 946 136 21 24404 194 13906 --
NM_001042683chr631652 1308 1287 1461 ----
NM_001042749chrX51703 1673 1552 424 43 ------
NM_001042750chrX51703 1673 1552 424 43 ------
NM_001042751chrX51703 1673 1552 424 43 ------
NM_001043318chr14103785 3554 3422 3305 1123 1051 644 459 370 261 12730 ----
NM_001043351chr122272 205 11574 ----
NM_001044385chr263989 3276 2857 2703 797 700 ------
NM_001044722chr552228 2146 1809 1443 339 ------
NM_001044723chr552228 2146 1809 1443 339 ------
NM_001046chr562312 2255 1875 1156 945 640 12047 --12907
NM_001049chr1462379 2250 1804 790 428 141 11720 ----
NM_001071775chr1311753 11870 ----
NM_001076chr41129 ------
NM_001076chr41129 ------
NM_001079874chr151615 1518 1394 156 144 ----1802
NM_001083620chr431889 710 640 --12453 --
NM_001099678chr384916 4684 4572 4450 4059 1928 983 103 32094 1316 798 ----
NM_001100108chr1178106 7071 6506 6323 6302 6275 6230 5592 5458 3334 2468 2362 2039 1663 323 207 138 15203 --27091 1859
NM_001106chr389342 8385 8290 8089 7444 6869 916 261 --39641 8975 8186 16527
NM_001121chr10166 ------
NM_001126chr11354 ------
NM_001146chr841791 1523 526 269 1830 1938 --
NM_001167chrX96267 6059 5118 4199 2516 1814 1227 1077 303 21977 75 21432 647 --
NM_001173chr1464579 4480 4451 3195 1837 1312 24665 1499 11491 1474
NM_001177chr1221978 238 ------
NM_001198chr6134 1695 ----
NM_001201chr473549 3311 3225 1070 546 524 472 12930 11581 --
NM_001204chr285885 5487 5333 4780 3046 1686 1015 202 1997 --25453 3058
NM_001206chr923059 2772 1738 ----
NM_001241chr21355 21836 1668 22008 79 --
NM_001241chr21355 21836 1668 22008 79 --
NM_001256chr1771923 1893 1178 979 839 437 75 12314 ----
NM_001259chr766071 5994 5833 5215 2242 1862 25284 4348 1349 --
NM_001270chr51316 ------
NM_001329chr1031613 644 415 --21190 241 --
NM_001332chr531551 1477 343 ------
NM_001356chrX31984 1966 602 ------
NM_001364chr11114415 4397 4251 4239 3937 3584 3476 3206 901 890 879 --14581 --
NM_001378chr2--150 ----
NM_001390chr1832708 1219 606 ----13526
NM_001412chrX91490 1440 1237 1100 1045 975 669 192 181 22643 495 --13084
NM_001418chr111686 ------
NM_001418chr111686 ------
NM_001419chr1954174 3969 3752 1255 204 1252 23046 421 --
NM_001420chr1942505 2239 873 421 ------
NM_001423chr1271865 1718 1679 1412 726 428 368 ------
NM_001432chr453660 3246 3054 1473 1208 1728 --12810
NM_001451chr163922 337 210 ------
NM_001498chr621020 904 --11121 --
NM_001521chr2----1312 1757
NM_001546chr631420 1142 303 1939 ----
NM_001567chr111742 ------
NM_001604chr111915 ------
NM_001616chr22121 55 43005 2988 2798 890 ----
NM_001621chr752386 2338 2154 1192 545 --12732 --
NM_001621chr752386 2338 2154 1192 545 --12732 --
NM_001650chr1843842 1630 967 409 12925 1305 --
NM_001656chr552075 1843 762 561 267 ------
NM_001658chr12423 277 ------
NM_001663chr141959 ------
NM_001678chr171240 11828 ----
NM_001684chr173525 3195 3118 1546 1533 831 747 --1382 --
NM_001699chr1971546 1474 1359 678 380 307 43 11799 ----
NM_001701chr921117 630 ------
NM_001709chr1132851 1091 87 12060 12425 --
NM_001723chr6----2897 141 --
NM_001742chr711520 ------
NM_001746chr541931 989 800 605 --12278 --
NM_001754chr2143733 2619 1487 637 ------
NM_001755chr1632140 1956 1837 ------
NM_001759chr1274349 4064 3905 3727 3632 1701 569 24254 1538 15233 --
NM_001777chr344072 3137 1675 484 44089 1455 527 332 1161 12744
NM_001791chr111239 ------
NM_001796chr16--1216 ----
NM_001797chr161264 ------
NM_001798chr121214 --1425 --
NM_001799chr5--179 ----
NM_001827chr91217 ------
NM_001831chr841263 1093 363 40 ------
NM_001838chr171877 ------
NM_001854chr141195 1046 543 210 11306 ----
NM_001859chr9103744 3198 3114 2714 2589 1331 1277 692 446 218 ------
NM_001874chr1274182 3765 3626 1466 1201 755 584 ------
NM_001893chr171365 ------
NM_001903chr52774 164 ------
NM_001904chr32689 364 --2706 423 --
NM_001918chr1128285 7986 7965 7675 7032 3089 2537 1973 1803 1387 524 476 13731 ----
NM_001935chr2--1163 ----
NM_001938chr121588 140 41775 1758 1668 1347 --11453
NM_001949chr612661 32465 2458 2388 22024 255 --
NM_001977chr42532 221 ------
NM_001981chr122226 776 12263 12127 --
NM_001993chr11916 --1847 --
NM_002009chr1551083 956 923 798 50 --21879 1720 --
NM_002017chr1131350 1344 1084 --1279 --
NM_002025chrX89237 8103 7643 5746 3008 2384 1593 869 16692 18609 --
NM_002026chr22919 390 1354 ----
NM_002039chr42781 159 191 ----
NM_002040chr21--12520 ----
NM_002054chr2----170 --
NM_002063chrX--11173 11303 --
NM_002069chr7--1464 ----
NM_002092chr464980 3636 3158 1920 1304 107 --34498 3520 1816 --
NM_002126chr1743734 2871 1153 639 23775 763 24127 3905 --
NM_002128chr1321846 687 1443 1637 --
NM_002129chr4163 --1410 --
NM_002130chr51240 --1629 --
NM_002137chr76894 815 554 471 454 100 ------
NM_002139chrX2631 232 --1127 --
NM_002141chr72678 162 ------
NM_002154chr52188 47 ------
NM_002156chr21365 ------
NM_002158chr253467 3046 1390 825 762 22460 1219 ----
NM_002187chr521053 869 21212 256 ----
NM_002190chr62528 259 41257 487 442 220 ----
NM_002203chr523800 697 1576 ----
NM_002211chr1041096 445 291 227 ------
NM_002214chr744260 1957 1674 720 11287 1727 --
NM_002223chr1273267 2916 2802 2649 1548 741 726 --1452 --
NM_002229chr19--1476 ----
NM_002245chr11487 163 ----
NM_002264chr354515 4201 3152 1976 1010 23729 3500 ----
NM_002267chr1332318 2186 840 22299 862 ----
NM_002270chr594419 4400 4247 4110 3863 3639 1895 1448 187 --11647 --
NM_002271chr1321790 921 --2849 771 --
NM_002310chr5116013 5283 5189 5148 4795 4179 4025 2321 2185 1648 1427 --1132 --
NM_002313chr1064811 4796 3182 1778 1044 437 23786 423 24970 3541 --
NM_002336chr1274246 3865 3854 3745 3508 774 402 41898 1162 725 308 ----
NM_002356chr61576 1712 12507 --
NM_002358chr42650 423 --1674 --
NM_002374chr232571 521 379 12321 12931 12996
NM_002376chr141422 2563 27 ----
NM_002395chr641335 1169 1015 436 ------
NM_002399chr1511060 --11433 --
NM_002408chr14--1342 ----
NM_002445chr811258 1559 ----
NM_002501chr1933813 2590 1098 --12544 --
NM_002520chr5--1212 ----
NM_002526chr641683 1253 1165 513 11460 1237 --
NM_002538chr5--134 1484 --
NM_002544chr17--199 ----
NM_002568chr8--1368 ----
NM_002578chrX1353 ------
NM_002581chr975387 4783 4032 2129 2052 895 488 --21504 1021 --
NM_002595chr1231364 578 530 ------
NM_002623chr201257 ------
NM_002627chr10162 ------
NM_002645chr1142769 2278 2252 804 2971 518 1502 --
NM_002655chr824058 1310 --1191 --
NM_002699chr111395 ------
NM_002706chr21723 ------
NM_002709chr233568 3401 39 ------
NM_002715chr51999 ------
NM_002731chr163119 3051 819 187 120 70 ------
NM_002734chr1731925 704 361 12066 ----
NM_002740chr332527 2306 2039 1977 --12701
NM_002745chr2241674 1464 874 455 11248 11176 --
NM_002748chr152844 74 1858 ----
NM_002752chr5--1443 ----
NM_002755chr152696 203 ------
NM_002758chr172502 404 ------
NM_002764chrX--1870 ----
NM_002827chr2021616 1403 ------
NM_002835chr7127 ------
NM_002839chr923204 1266 ------
NM_002840chr161597 1476 1442 1355 656 340 --11482 --
NM_002844chr611261 ------
NM_002890chr5----11006 --
NM_002892chr141203 11249 --1106
NM_002893chrX2291 270 ------
NM_002902chr151100 ------
NM_002906chr1112357 ------
NM_002942chr3--1185 1954 --
NM_002956chr121408 1326 ----
NM_002958chr32843 686 1970 ----
NM_002959chr123814 1223 --11579 --
NM_002973chr121514 ------
NM_002982chr171143 1123 ----
NM_002994chr421824 629 21605 745 1569 --
NM_002998chr82879 564 ------
NM_002999chr2041424 607 288 279 --1777 --
NM_003001chr121435 302 11497 ----
NM_003016chr1721916 1641 1630 ----
NM_003042chr321915 1846 1491 151 --
NM_003046chr865284 3770 3722 3502 3495 191 23632 55 ----
NM_003071chr32626 43 11653 --2655 278
NM_003079chr172838 178 ------
NM_003100chr5122 ------
NM_003106chr311064 ------
NM_003107chr642434 2339 787 742 ------
NM_003110chr1711030 ------
NM_003112chr753111 3065 2625 2111 832 1126 12920 --
NM_003128chr222028 610 ------
NM_003135chr51346 ------
NM_003139chr112869 385 ------
NM_003155chr822064 1969 ----12621
NM_003161chr1742638 2381 2198 815 ------
NM_003181chr62452 103 180 ----
NM_003199chr1855379 3846 3466 1457 274 21801 127 24937 4392 11680
NM_003221chr633645 3005 756 --13974 --
NM_003223chr161793 ------
NM_003234chr332438 2197 249 --12179 --
NM_003257chr1511178 ------
NM_003269chr61522 ------
NM_003270chrX31069 930 247 ------
NM_003275chr911161 ------
NM_003300chr14------1402
NM_003304chr321400 1222 1227 ----
NM_003338chr102524 47 ----1702
NM_003339chr551603 1247 543 388 258 ------
NM_003340chr41172 ------
NM_003341chr31659 ------
NM_003344chr741654 1445 1356 523 1616 ----
NM_003348chr1231461 1192 1159 1285 ----
NM_003350chr82649 643 2943 93 ----
NM_003373chr1041917 1547 725 62 ----11409
NM_003375chr10--1141 1395 --
NM_003385chr2--1649 ----
NM_003387chr232292 1160 737 12662 --1445
NM_003392chr313517 --13059 --
NM_003410chrX33064 1900 1139 11152 --1575
NM_003423chr1932651 1675 746 ----1827
NM_003432chr51108 ------
NM_003467chr22493 50 ------
NM_003472chr621319 104 ------
NM_003473chr10--1808 ----
NM_003478chr1163335 3261 3179 2793 2770 829 22898 2265 12426 1533
NM_003483chr1212533 ------
NM_003487chr171106 ------
NM_003507chr211886 ------
NM_003557chr131567 1468 1004 ------
NM_003566chr1243114 2454 1352 943 22796 1267 ----
NM_003574chr1873903 3558 1967 1859 923 754 539 ------
NM_003576chr1321972 378 ------
NM_003590chr283905 3739 3627 3331 3181 947 692 664 13877 ----
NM_003615chr321368 334 1633 ----
NM_003618chr221117 159 ------
NM_003628chr2----1482 --
NM_003631chr1031007 686 87 ------
NM_003670chr311195 ----11440
NM_003679chr142880 2846 2631 971 12573 11220 --
NM_003701chr131716 ------
NM_003704chr4------1651
NM_003758chr1541517 1429 1405 211 11184 --11246
NM_003758chr1541517 1429 1405 211 11184 --11246
NM_003760chr1--143 ----
NM_003783chr11753 ------
NM_003787chr181159 ------
NM_003794chr3173 ------
NM_003795chr61597 ------
NM_003800chr621504 26 --1529 --
NM_003812chr2185 ------
NM_003816chr83353 345 157 ------
NM_003822chr131210 972 714 1998 ----
NM_003825chr1531219 495 79 ------
NM_003829chr92308 133 ------
NM_003858chr141649 ------
NM_003861chr1432820 2678 206 1607 12767 --
NM_003909chr852426 2042 975 322 154 12798 ----
NM_003913chr663861 3131 2789 2750 1658 400 13609 ----
NM_003916chrX2178 121 11100 ----
NM_003930chr7--1563 1213 --
NM_003931chr61663 1243 ----
NM_003934chr9--1432 ----
NM_003941chr731603 782 420 11841 ----
NM_003953chr132818 2046 629 2883 745 ----
NM_003983chr1663852 3192 3014 1348 825 608 --33155 1103 321 --
NM_003994chr1221039 747 13326 ----
NM_004004chr1331183 1142 243 ------
NM_004006chrX42507 1983 1692 230 12230 1648 --
NM_004007chrX42507 1983 1692 230 12230 1648 --
NM_004009chrX42507 1983 1692 230 12230 1648 --
NM_004010chrX42507 1983 1692 230 12230 1648 --
NM_004011chrX42507 1983 1692 230 12230 1648 --
NM_004012chrX42507 1983 1692 230 12230 1648 --
NM_004013chrX42507 1983 1692 230 12230 1648 --
NM_004014chrX42507 1983 1692 230 12230 1648 --
NM_004015chrX42507 1983 1692 230 12230 1648 --
NM_004016chrX42421 1897 1606 144 12144 1562 --
NM_004017chrX42507 1983 1692 230 12230 1648 --
NM_004018chrX42421 1897 1606 144 12144 1562 --
NM_004020chrX42507 1983 1692 230 12230 1648 --
NM_004021chrX42421 1897 1606 144 12144 1562 --
NM_004022chrX42421 1897 1606 144 12144 1562 --
NM_004023chrX42421 1897 1606 144 12144 1562 --
NM_004028chr1843842 1630 967 409 12925 1305 --
NM_004050chr1411837 12444 126 22363 150
NM_004052chr101621 ------
NM_004056chr831120 885 254 ------
NM_004071chr2169 1258 ----
NM_004075chr12166 --1567 --
NM_004081chrY41781 1418 383 337 ------
NM_004082chr22266 104 --1288 --
NM_004085chrX--1550 ----
NM_004087chr33750 632 543 --11706 --
NM_004094chr1422441 2424 1122 ----
NM_004100chr621871 618 1819 12295 --
NM_004105chr2133 1861 --1248
NM_004114chrX1974 --11040 --
NM_004133chr842236 647 568 209 --1419 --
NM_004136chr1553193 2775 1248 1100 971 33134 3103 473 --23209 1112
NM_004162chr331249 1235 145 ------
NM_004171chr11129637 9081 8091 7373 6368 6102 5946 3394 2322 2272 1910 1614 23158 572 13661 --
NM_004181chr41294 ------
NM_004209chr1621073 958 ------
NM_004232chr18--21288 365 11280 --
NM_004267chr31389 ------
NM_004272chr551804 1656 786 493 334 11891 1761 11488
NM_004274chr1433176 2856 830 --12392 12084
NM_004281chr10282 57 ------
NM_004293chr963477 3286 2926 2770 2584 548 11307 13831 --
NM_004294chr131603 ------
NM_004329chr101249 ------
NM_004342chr721443 542 ------
NM_004354chr42639 619 ------
NM_004370chr611668 --11677 --
NM_004379chr23509 352 28 ------
NM_004381chr61129 ------
NM_004384chr552228 2146 1809 1443 339 ------
NM_004392chr1312180 1142 11696 --
NM_004393chr31481 --1488 --
NM_004397chr1112711 23564 2837 24266 3793 1773
NM_004411chr71607 --1254 --
NM_004412chr10115892 5673 5047 4628 4488 4038 3803 947 773 753 730 ------
NM_004432chr92292 58 ------
NM_004458chrX52652 2377 2233 2010 799 ------
NM_004480chr141320 ------
NM_004482chr21652 1678 ----
NM_004501chr153738 3694 1327 1137 433 --12508 --
NM_004504chr21247 21232 931 ----
NM_004506chr61233 ------
NM_004520chr5196 ------
NM_004524chr171244 ------
NM_004535chr2031547 665 506 ------
NM_004540chr212355 211 ------
NM_004583chr172216 209 ------
NM_004586chrX54585 4316 4289 1664 389 14690 11181 --
NM_004588chr1184018 3507 2634 2570 2475 1296 787 779 13720 ----
NM_004593chr31262 --1203 --
NM_004612chr933825 3088 1531 21456 949 14289 --
NM_004631chr111339 --11106 --
NM_004642chr12--1198 ----
NM_004645chr171527 --1710 --
NM_004654chrY1970 ------
NM_004655chr171484 --11033 --
NM_004657chr21430 ------
NM_004660chrY21448 604 1739 11894 --
NM_004704chr3124 ------
NM_004709chrX1127 11122 2697 74 --
NM_004719chr1242466 2092 951 339 ------
NM_004725chr103547 179 21 31149 1059 990 ----
NM_004726chrX115793 5588 5400 5246 5225 4507 4246 3582 2036 1462 707 31213 447 247 13701 --
NM_004730chr531955 860 219 ------
NM_004731chr12--1342 --11898
NM_004736chr132213 1981 831 ------
NM_004745chr876645 5872 4996 4785 2158 1772 865 --1718 11766
NM_004748chr1563980 1507 1413 338 286 214 24238 3397 12751 1783
NM_004762chr172401 155 ------
NM_004770chr8--1162 ----
NM_004774chr1752711 2384 2045 921 106 1527 11260 --
NM_004788chr1132501 539 168 32332 893 756 ----
NM_004792chr2144 ------
NM_004796chr1412032 12226 ----
NM_004798chr2063585 3340 2711 1024 756 695 --12427 --
NM_004800chr13--1213 ----
NM_004801chr211091 ------
NM_004808chr1043087 894 541 401 22788 328 22431 2245 --
NM_004831chr191690 ------
NM_004834chr243188 3012 2657 637 --12377 --
NM_004836chr23936 761 184 ------
NM_004844chr341210 1038 973 223 --1967 --
NM_004845chrX93613 3457 2587 1590 1421 1353 1326 260 135 11299 11366 --
NM_004857chr1494598 4435 3930 977 815 698 611 407 151 23536 2942 24658 3153 --
NM_004863chr14104839 4313 1823 1697 1561 1393 1184 1157 817 540 13942 25162 977 --
NM_004869chr1821474 1261 --11426 --
NM_004893chr51213 ------
NM_004896chr1041067 454 230 56 1578 ----
NM_004904chr7106508 6436 6279 6007 5570 5185 5023 4895 4870 1275 22561 1454 ----
NM_004912chr721665 1089 ----21508 1463
NM_004926chr142321 115 ------
NM_004949chr182849 609 --12074 --
NM_004965chr212733 155 ------
NM_004966chr102906 258 2274 265 ----
NM_004985chr1253523 3135 1325 716 181 --13634 --
NM_004996chr1641699 1592 1565 1402 11338 ----
NM_005014chr91135 167 ----
NM_005023chr531495 1279 1116 2524 446 ----
NM_005045chr72751 384 ------
NM_005056chr1275151 4851 4167 3723 3665 3607 3549 14135 ----
NM_005063chr1083347 3133 3050 2753 1321 1230 775 183 13551 --12806
NM_005066chr1------1572
NM_005068chr631106 1099 111 --1995 --
NM_005079chr832893 2548 633 13088 11132 --
NM_005095chr131380 438 91 11524 ----
NM_005102chr22703 650 1802 ----
NM_005105chr151846 1682 1488 790 597 ------
NM_005113chr141132 ------
NM_005116chr201121 14501 13513 162
NM_005119chr121029 369 --11236 --
NM_005126chr312068 21843 1465 --11746
NM_005135chr1552385 1539 1208 283 140 ------
NM_005156chr974906 3309 2125 1802 1194 698 113 11472 ----
NM_005166chr191240 ------
NM_005168chr21213 ----1600
NM_005188chr11108204 8024 6741 6212 6055 5114 5056 3236 2290 353 ----12992
NM_005197chr1466218 5748 5487 4714 957 469 --14564 --
NM_005230chr122253 210 ------
NM_005233chr3--2593 559 ----
NM_005235chr245683 5035 2772 1202 21180 798 ----
NM_005238chr1183245 2623 2584 1293 929 918 680 33 12339 21316 137 --
NM_005259chr2--31312 1042 79 ----
NM_005271chr101153 --1194 --
NM_005295chr7--1100 ----
NM_005308chr101433 ------
NM_005316chr1131023 814 443 --1230 --
NM_005329chr1652134 1962 1856 911 356 1478 1321 --
NM_005338chr773624 3379 3009 2996 2885 2702 658 1266 2841 707 --
NM_005339chr442762 1434 1213 252 42969 2846 2742 780 ----
NM_005340chr52171 45 ----170
NM_005342chrX62367 2197 1043 991 657 378 --12278 --
NM_005357chr19188 ------
NM_005359chr1895929 5732 5309 2452 2210 1918 1762 1328 801 11219 34567 4005 2537 --
NM_005378chr21345 ------
NM_005382chr8127 ------
NM_005385chr342762 2019 1803 295 ------
NM_005386chr201794 ------
NM_005399chr154277 3968 3586 1716 1351 1132 13188 --
NM_005400chr21975 --13105 --
NM_005406chr182465 121 ------
NM_005407chr1421040 104 ------
NM_005415chr22624 223 --1733 --
NM_005455chr131529 630 433 ------
NM_005461chr2051659 1618 477 372 195 ------
NM_005474chr1721460 1087 ----11565
NM_005475chr1253040 2811 2194 941 764 ------
NM_005491chrX42042 1894 1482 151 --31711 1496 1488 --
NM_005497chr17126028 5928 5885 5696 5643 5172 5013 4404 2194 1338 959 161 ------
NM_005502chr923171 1062 ------
NM_005509chr521688 1290 ------
NM_005513chr331120 188 79 11484 ----
NM_005520chr52616 240 --1745 --
NM_005524chr31109 ------
NM_005539chr10--1211 ----
NM_005542chr731907 1483 527 191 ----
NM_005570chr182313 141 21144 67 ----
NM_005578chr365164 5145 3824 3135 1494 1347 ------
NM_005584chr13155 ------
NM_005587chr151731 ------
NM_005596chr934150 4001 524 --14412 --
NM_005604chr612340 ------
NM_005610chr1--1325 ----
NM_005623chr171168 ------
NM_005626chr12415 143 --1408 --
NM_005639chr1221262 175 ------
NM_005650chr2231208 1056 175 ------
NM_005665chr184675 4281 4034 3894 3769 1801 1374 948 34414 4265 3457 ----
NM_005668chr534055 3622 487 44487 4363 3614 615 13402 --
NM_005669chr542034 2006 1983 1574 11731 ----
NM_005722chr241634 339 225 186 32406 499 257 ----
NM_005724chr15--1221 ----
NM_005737chr222537 2128 ----1552
NM_005738chr752011 1712 595 518 423 21985 1946 ----
NM_005742chr21716 ------
NM_005744chr15--1154 ----
NM_005746chr742463 2368 1970 1008 12640 12714 --
NM_005748chr1263169 3161 2983 2527 2375 2093 --1216 --
NM_005749chr172729 703 ------
NM_005752chr1631212 902 427 ------
NM_005754chr51114 ------
NM_005756chrX11549 --21360 319 --
NM_005759chr274294 4099 4008 3826 3787 404 210 11143 21516 167 --
NM_005776chr14----132 --
NM_005779chr523432 3077 --11044 --
NM_005786chr181239 ------
NM_005801chr172576 27 ------
NM_005802chr92689 210 ------
NM_005826chr11444 199 ----
NM_005828chr1774673 3307 3136 1536 1286 1007 840 14993 21673 219 13562
NM_005832chr33952 348 77 11287 ----
NM_005840chrX56744 6626 6581 6138 1260 12333 27028 4929 1968
NM_005843chr211648 1291 ----
NM_005857chr1--1105 ----
NM_005862chr321059 994 ------
NM_005868chr732479 2106 999 12042 --1759
NM_005885chr551568 1178 1061 1053 103 --1667 --
NM_005898chr1133145 2889 2132 12724 ----
NM_005901chr1898439 7823 6283 6209 5603 2851 1836 1191 267 26179 2401 17873 --
NM_005907chr621261 112 1236 ----
NM_005909chr564070 3430 1473 847 583 181 12867 21112 98 1300
NM_005923chr62564 490 1443 ----
NM_005930chr143858 673 74 157 ----
NM_005941chr843678 2740 1307 90 24019 3992 ----
NM_005966chr221484 478 1926 1245 --
NM_005977chr132308 275 --2928 67 --
NM_005999chr131265 1217 370 1530 ----
NM_006003chr191197 ------
NM_006007chr943411 3364 1380 835 12950 --11271
NM_006010chr3188 ------
NM_006037chr244345 4248 3650 1173 ------
NM_006038chr2021569 1508 ------
NM_006047chr2043077 2542 2425 992 --12968 --
NM_006048chr131171 202 147 ------
NM_006095chr424189 3332 13981 22899 223 --
NM_006106chr1122107 1263 12470 --12998
NM_006108chr1121964 355 --2958 186 11546
NM_006113chr151615 1518 1394 156 144 ----1802
NM_006141chr1642023 660 203 60 21746 413 ----
NM_006152chr12139 ------
NM_006167chr861773 1534 1509 796 437 194 22019 641 ----
NM_006183chr122228 161 ------
NM_006194chr1431084 1035 964 ------
NM_006197chr831955 1392 399 ------
NM_006203chr555150 3930 3827 3528 1600 23649 38 11386 --
NM_006206chr432157 1836 987 1752 ----
NM_006218chr31250 ------
NM_006241chr352350 2087 1850 1788 1686 194 ----
NM_006251chr532542 2248 1147 43332 2800 2320 618 22571 983 --
NM_006252chr196513 6063 5042 4754 2613 2448 2272 1534 1030 ------
NM_006256chr151082 732 354 232 96 12372 ----
NM_006265chr821180 536 ------
NM_006282chr2054671 4557 1209 1202 1014 ------
NM_006301chr123597 435 222 ------
NM_006306chrX115811 4774 4744 4525 4253 4238 4170 3715 2293 1007 225 --11426 --
NM_006313chr121265 ------
NM_006322chr133376 279 205 ------
NM_006325chr122597 102 ----1636
NM_006330chr82368 178 ------
NM_006343chr2------1143
NM_006352chr1--1377 ----
NM_006353chr61105 ------
NM_006371chr354408 4027 3680 1736 1076 14730 23545 1504 --
NM_006380chr1743603 1690 1397 1154 34340 3780 3100 13907 --
NM_006390chr12----11425 --
NM_006393chr1044297 4221 3873 3240 ----13907
NM_006407chr32538 21 ------
NM_006409chr7--1237 ----
NM_006420chr2063305 2508 1371 1227 639 573 --13092 --
NM_006459chr1051823 1374 1357 329 266 --152 --
NM_006460chr1731737 1128 611 1554 ----
NM_006475chr132667 41 --1425 --
NM_006504chr1042753 2711 1040 360 ------
NM_006534chr2022290 138 --1713 --
NM_006540chr831259 1043 1021 ----1966
NM_006544chr14145682 5669 5434 5410 5284 5154 5012 4906 4530 4378 4219 2274 1437 1410 11292 25047 3883 --
NM_006547chr722025 444 ------
NM_006548chr31425 ------
NM_006557chr931578 1340 1272 128 --11717
NM_006558chr81482 ------
NM_006559chr13980 236 109 --1392 --
NM_006561chr10116179 5754 5432 5278 4752 4468 4080 1582 1548 803 498 12053 ----
NM_006575chr1411387 ------
NM_006577chr221099 304 ------
NM_006591chr111516 ----11524
NM_006599chr1656372 6277 2981 2009 1543 37934 6673 2184 --13177
NM_006601chr125900 310 207 199 79 ------
NM_006603chrX51703 1673 1552 424 43 ------
NM_006620chr6114603 4203 4050 3528 1650 1314 609 471 259 181 75 13924 23888 1609 --
NM_006621chr151685 806 750 561 324 11392 1816 --
NM_006644chr132428 151 ------
NM_006703chr6----1165 --
NM_006706chr51700 ------
NM_006717chr922247 257 12658 1993 --
NM_006720chr1064811 4796 3182 1778 1044 437 23786 423 24970 3541 --
NM_006729chrX55668 3469 1360 1155 825 135 ----
NM_006731chr995192 5055 4521 3760 3533 1300 1292 476 383 14252 1198 --
NM_006735chr71123 ------
NM_006745chr41109 1215 ----
NM_006750chr16187878 7860 7430 7310 6547 6062 6053 5964 5916 5262 5169 2461 2154 2052 1697 1270 823 698 37747 6430 2072 --16295
NM_006754chr741048 802 792 172 ------
NM_006756chr831496 1371 1099 ------
NM_006774chr751602 350 333 314 165 ----11139
NM_006783chr131256 ------
NM_006811chr20296 73 1994 ----
NM_006813chr64888 839 309 299 --1746 --
NM_006826chr2--1295 11276 --
NM_006827chr1422462 2418 23263 2609 --11077
NM_006852chr1772718 2495 2310 2270 2237 828 266 --12615 --
NM_006870chr202781 253 ------
NM_006874chr41773 ------
NM_006885chr1653810 3665 3030 2839 720 --24182 2752 --
NM_006915chrX32436 2107 1661 21835 190 ----
NM_006920chr231324 1266 484 ------
NM_006924chr1764049 3833 3604 1233 978 190 23374 3154 23984 3131 --
NM_006930chr521932 632 --11565 --
NM_006931chr1241877 1703 702 522 ------
NM_006937chr17--1515 ----
NM_006939chr141807 ------
NM_006948chr2112277 1335 1570 --
NM_006965chr181922 ----11066
NM_006981chr921082 636 ------
NM_007005chr931422 1229 450 ------
NM_007008chr2--1197 ----
NM_007026chr17------1536
NM_007038chr2125198 1501 45688 2321 1379 1253 ----
NM_007064chr341167 1112 1056 567 ------
NM_007106chr1332060 711 585 --22578 2187 --
NM_007107chr322261 686 ----1792
NM_007114chr353204 2804 2189 648 480 ------
NM_007125chrY11078 ------
NM_007129chr1311012 ------
NM_007137chrX95457 5449 5312 4455 2030 1440 1269 1062 987 --13478 11191
NM_007159chr31255 ------
NM_007166chr11--1537 ----
NM_007172chr2242067 1214 547 275 12212 1166 --
NM_007175chr833114 1345 1209 23339 1044 1586 23636 3538
NM_007187chr131244 ------
NM_007191chr122164 26 1174 ----
NM_007203chr963697 3100 2674 1480 1156 673 ------
NM_007207chr11693 ------
NM_007208chr3------1202
NM_007214chr61186 2426 406 ----
NM_007246chr41108 ------
NM_007249chr1398814 6282 3496 3317 3219 2720 2508 1659 23 26942 448 16542 --
NM_007282chr32962 316 ------
NM_007285chr16------1361
NM_007315chr231485 460 316 ------
NM_007345chr1811543 ------
NM_007347chr1562839 2162 1273 1172 1022 507 22803 927 ----
NM_007350chr1254357 3588 3226 1763 690 --24208 1562 --
NM_007375chr111015 --22020 1060 12124
NM_012093chr111243 ------
NM_012095chr1073226 3178 2504 1393 915 859 178 ----13487
NM_012096chr342863 645 539 256 --13474 --
NM_012097chr22647 369 11563 ----
NM_012104chr1143153 2442 638 256 ----22772 1495
NM_012104chr1143153 2442 638 256 ----22772 1495
NM_012106chr161253 ----1126
NM_012110chr41218 ------
NM_012120chr622424 370 ------
NM_012137chr132241 866 137 12464 12474 --
NM_012141chr1363640 3515 1639 1106 654 337 21604 412 --13206
NM_012155chr191221 ------
NM_012158chr1311185 ------
NM_012164chr955377 1938 1859 1224 534 56730 4630 2331 1053 307 ----
NM_012175chr112908 257 1857 ----
NM_012193chr1132040 862 120 12021 21982 978 --
NM_012208chr51750 ------
NM_012214chr295556 5139 4185 1653 1487 1439 991 541 57 24669 2109 ----
NM_012219chr353224 2325 2149 1223 784 --1911 --
NM_012234chr31423 ----13379
NM_012250chr1121188 267 --11303 --
NM_012257chr7124 ------
NM_012262chr154071 1093 727 516 182 11761 ----
NM_012281chr711499 --32284 1827 593 --
NM_012287chr333172 1572 273 14530 --13206
NM_012290chr23276 129 57 11714 ----
NM_012297chr422531 341 --12208 --
NM_012309chr1164992 3907 3727 3018 1115 143 ------
NM_012310chrX----1215 1537
NM_012319chr181175 1899 ----
NM_012330chr101531 ------
NM_012334chr584254 4051 3103 1873 1288 1133 979 577 --11640 --
NM_012343chr52775 343 ------
NM_012345chr1341259 364 305 146 11499 ----
NM_012347chr651847 862 265 254 68 ------
NM_012382chr523616 1462 1220 23963 3111 --
NM_012395chr732849 726 36 ------
NM_012414chr12824 702 1274 ----
NM_012416chr92355 105 ------
NM_012420chr1052345 2268 1970 403 29 1651 ----
NM_012428chr151685 --1708 --
NM_012454chr62409 153 ------
NM_012482chr1--2535 474 ----
NM_013233chr251354 1112 1027 974 317 ------
NM_013257chr862317 1963 1545 776 642 307 ------
NM_013261chr412382 12442 --11078
NM_013269chr1254236 4043 3104 2789 494 31568 920 228 ----
NM_013279chr1131594 696 588 ------
NM_013286chr353060 2558 1508 1131 159 1555 22877 2835 --
NM_013293chr7----1592 --
NM_013302chr1684700 3173 3133 3063 2993 785 107 43 --11546 --
NM_013341chr222322 991 ------
NM_013372chr1552924 2827 2663 2196 501 --11136 --
NM_013374chr342259 2126 588 376 2354 214 12700 12868
NM_013396chr2131468 583 357 ------
NM_013437chr81426 21294 1158 ----
NM_013438chr921663 1560 ----1594
NM_013446chr7----11238 --
NM_013448chr141512 ------
NM_013450chr2--1120 ----
NM_013989chr1484973 3439 1829 1471 1153 705 495 382 14042 35099 3359 3230 1186
NM_014000chr1041917 1547 725 62 ----11409
NM_014011chr242532 2081 760 32 2985 673 --1593
NM_014021chr173225 2235 1232 518 275 111 55 12998 23092 693 11291
NM_014034chr621315 1193 1185 11123 --
NM_014109chr8147 ------
NM_014112chr835295 4495 4042 14204 1244 11134
NM_014117chr1632459 2376 2009 1155 12347 --
NM_014141chr765091 4159 3776 3348 3326 1553 --1203 --
NM_014155chr1177179 6431 5613 4928 4681 2175 218 36248 5187 675 26987 1308 --
NM_014233chr17--11753 ----
NM_014253chrX22108 1752 ------
NM_014267chr11--1731 ----
NM_014283chr131321 1208 599 --1974 --
NM_014289chrX2485 74 --1971 --
NM_014294chr831323 1308 393 ------
NM_014299chr1931474 693 71 ------
NM_014305chr13174 ------
NM_014309chr2285202 4857 4794 2068 1302 1269 1117 482 --14196 --
NM_014319chr1221862 221 11916 --31447 1249 179
NM_014321chr162785 659 --1153 --
NM_014342chr1111059 11497 ----
NM_014361chr111426 ----1355
NM_014363chr134444 418 102 92 ------
NM_014372chr122095 2068 ------
NM_014392chr461425 1410 1133 554 415 232 ------
NM_014405chr1712313 ------
NM_014415chr331375 1122 564 ------
NM_014423chr575631 5344 5334 3471 2217 1725 323 34477 4455 3933 14426 --
NM_014435chr4--1663 ----
NM_014445chr362377 1990 1851 1723 421 239 ------
NM_014447chr421051 169 ------
NM_014452chr62778 284 ------
NM_014454chr6--11020 ----
NM_014456chr1031612 392 230 ----1558
NM_014458chr11933 ------
NM_014491chr71674 ------
NM_014494chr1622287 59 ------
NM_014496chrX--1111 ----
NM_014503chr121410 ------
NM_014522chrX1121 ------
NM_014574chr141170 ------
NM_014584chr1431581 382 296 1146 1173 --
NM_014612chr9--1348 --11405
NM_014615chr1633544 3130 2622 22650 2366 ----
NM_014616chr362988 2600 2146 1262 549 298 ------
NM_014618chr92450 342 ------
NM_014620chr121210 ------
NM_014637chr821217 159 ------
NM_014646chr1843151 2512 2448 2270 --11266 --
NM_014660chr711008 1355 ----
NM_014666chr52917 839 ------
NM_014673chr81116 ------
NM_014676chr11619 ------
NM_014682chr821689 82 ------
NM_014699chr161370 ------
NM_014702chr642254 1035 914 66 23456 3208 13140 --
NM_014705chr71392 ------
NM_014707chr721960 535 1881 --1500
NM_014709chr22421 29 ------
NM_014721chr687257 4941 2797 2489 2347 1876 1161 491 27074 734 ----
NM_014729chr862118 2004 1954 1609 768 113 ------
NM_014733chr532235 2141 290 2698 227 ----
NM_014743chr452655 2598 2573 2293 810 ----12116
NM_014755chr241456 1311 981 312 ------
NM_014764chr121406 ------
NM_014765chr142699 2118 1834 1685 ------
NM_014784chr131127 1087 857 --11007 --
NM_014787chr132268 1004 952 1491 1123 --
NM_014795chr22217 77 1525 ----
NM_014802chr121227 ------
NM_014819chr562146 2082 1855 1827 494 335 11672 ----
NM_014824chr1121624 1336 ------
NM_014828chr1462548 2344 2280 2155 2069 571 ------
NM_014839chr112125 1764 --12503
NM_014840chr1262605 2524 2384 1158 783 642 22253 1274 32432 2389 437 12883
NM_014848chr1542436 2168 701 313 12400 12035 --
NM_014862chr1554159 3700 3374 806 283 24063 2638 ----
NM_014877chr1797347 6983 5820 4742 2911 2347 2266 1972 1713 27169 2693 12778 --
NM_014881chr10----132 --
NM_014900chr21977 1941 ----
NM_014910chr191331 ------
NM_014918chr1511343 ------
NM_014924chr1462412 2200 2129 390 369 82 12720 22612 891 --
NM_014932chr321757 266 ------
NM_014939chr1831257 378 292 ------
NM_014945chr521954 187 ------
NM_014946chr263003 2356 2133 479 244 93 1538 ----
NM_014950chr1411267 161 ----
NM_014951chr1032503 2353 1036 --1820 22283 700
NM_014962chr20--12655 ----
NM_014982chr1465306 4852 3950 3406 217 141 15066 15365 --
NM_014990chr1421065 349 1455 ----
NM_015000chr1232331 2283 2076 32933 2550 1128 ----
NM_015008chr322339 949 1669 23438 3249 --
NM_015009chr32745 594 ------
NM_015020chr1611308 --2515 269 11184
NM_015025chr232487 814 435 12498 ----
NM_015032chr1322450 2140 ------
NM_015035chr2086515 5495 5447 4985 4424 4303 818 593 15657 ----
NM_015042chr1544153 3625 3026 812 ------
NM_015049chr242709 2381 1310 897 12345 ----
NM_015051chr943260 2546 2142 204 ------
NM_015055chr1152543 450 322 274 230 32943 2587 1086 ----
NM_015056chr2172176 2147 1807 762 750 423 296 12301 ----
NM_015068chr763521 3176 2990 2593 1600 729 23512 3461 24008 2643 --
NM_015071chr5106094 5656 4858 4693 4501 1746 667 413 379 26 ------
NM_015087chr1312472 ------
NM_015092chr1652931 1695 1279 848 30 ------
NM_015101chr131931 929 239 ------
NM_015115chr472556 2463 2353 1150 1114 1038 943 1848 ----
NM_015130chr4------1356
NM_015137chr82241 60 ----1280
NM_015147chr272930 2907 2709 2529 2276 2128 2080 --1169 --
NM_015155chr1023301 2753 1389 ----
NM_015156chr1444018 3320 1343 485 12631 33752 3696 3178 --
NM_015163chr141534 --11722 --
NM_015172chr1158 ------
NM_015176chr121264 439 --21395 356 --
NM_015192chr2021200 855 12738 ----
NM_015199chr332959 549 126 --1913 --
NM_015206chr1532847 2689 2489 13589 13394 --
NM_015213chr11--1716 ----
NM_015225chr972907 2668 2471 1222 1055 771 731 --21032 521 1341
NM_015247chr1663398 1520 1165 936 485 265 12086 21472 270 13359
NM_015251chr1652326 2038 1494 916 713 --11646 --
NM_015269chr11633 ------
NM_015271chr454077 3624 3090 1498 425 1593 ----
NM_015272chr1632031 1898 220 ------
NM_015275chr1222015 191 ------
NM_015278chr633134 2267 425 ----11209
NM_015310chr8188091 7725 7398 7345 7297 7267 7089 6891 6796 6348 6113 5598 5363 2478 2116 1868 1650 717 15214 15620 --
NM_015313chr1163568 1603 1181 1068 1004 513 14314 ----
NM_015314chr742094 555 256 29 ----1153
NM_015317chr232743 753 212 --2774 530 --
NM_015319chr12----2182 177 --
NM_015323chr611737 ------
NM_015335chr1222043 2034 --1851 --
NM_015336chr1232073 841 444 1988 133 --
NM_015338chr20--1374 11324 --
NM_015344chr821507 595 ------
NM_015347chr1232928 707 626 1514 ----
NM_015349chr61813 12699 12586 --
NM_015355chr1711443 ------
NM_015358chr212883 377 11006 ----
NM_015361chr21809 1609 ----
NM_015365chrX83907 3577 3544 2992 1092 892 494 188 32621 1000 602 ----
NM_015375chr184781 4297 3107 1915 872 738 403 255 ------
NM_015387chr252061 1709 772 751 160 12051 --11841
NM_015396chr3----1551 --
NM_015397chr92600 278 ------
NM_015429chr32891 158 ------
NM_015435chr8177 11258 ----
NM_015436chr431170 415 320 23130 2726 ----
NM_015455chr533253 2529 1393 ------
NM_015458chr8105344 5124 4903 4641 4085 3850 3816 1972 1804 1072 12074 ----
NM_015462chr17--1256 ----
NM_015464chr7--1146 ----
NM_015469chr9----1109 --
NM_015475chr21900 --31112 965 917 1701
NM_015548chr6148 ------
NM_015550chr741343 1119 801 138 --1786 --
NM_015564chr553352 3207 900 179 116 --1636 --
NM_015568chr2044320 3292 524 466 12669 21519 980 --
NM_015571chr6--1161 ----
NM_015577chr531559 1541 344 1670 1314 --
NM_015578chr191742 ----1242
NM_015635chr962120 1634 763 639 499 200 2713 278 12215 --
NM_015640chr195007 4952 4434 4270 3834 3634 3570 3520 1685 35123 4260 4088 ----
NM_015676chr14--1271 1371 --
NM_015691chrX22619 255 11868 ----
NM_015833chr2162231 2216 915 594 391 330 2793 316 ----
NM_015852chr753405 3390 2909 2675 2267 --13544 12349
NM_015878chr8142 1726 1677 --
NM_015879chr18138247 7703 7590 6684 6430 6421 5885 3136 2998 2919 2273 1125 552 --28565 2053 --
NM_015885chr111112 2777 697 ----
NM_015888chr132762 2719 707 13384 13054 --
NM_015904chr2--1112 ----
NM_015906chr131022 397 85 --24153 3077 --
NM_015975chrX31640 1321 300 ----1202
NM_015990chr411022 --1689 --
NM_016009chr183850 3536 3401 1506 1433 1059 680 100 14715 14555 178
NM_016021chr652378 2201 1882 1869 344 --12008 --
NM_016040chr13417 192 145 11057 ----
NM_016048chr5----1106 --
NM_016072chr1212260 1725 1666 --
NM_016075chr1363078 2404 2089 1113 579 71 12887 ----
NM_016076chr122361 867 1610 1268 --
NM_016083chr61222 22753 980 13065 --
NM_016084chr17----150 --
NM_016087chr72687 595 --11399 --
NM_016103chr51412 ------
NM_016129chr41309 ------
NM_016131chr221916 701 --32317 1641 689 1889
NM_016132chr1523312 2179 --23197 2757 --
NM_016152chr31456 --2860 316 --
NM_016201chr331713 615 320 --1464 --
NM_016203chr73766 708 91 ------
NM_016206chr3148271 8147 6842 5460 3429 3415 3339 3224 2795 2085 1711 1436 1028 583 15951 48906 2665 280 25 --
NM_016220chr722186 1780 ----21868 1848
NM_016227chr131321 1208 599 --1974 --
NM_016230chr62540 476 ------
NM_016235chr161530 ----11499
NM_016252chr2--1731 ----
NM_016257chr172899 2283 2222 978 628 539 293 ------
NM_016258chr13655 628 324 2222 135 ----
NM_016260chr247515 2452 1915 636 26718 5484 47159 6636 5225 538 --
NM_016275chr332037 1106 959 ------
NM_016277chr611338 --11615 --
NM_016289chr232102 868 369 --1111 --
NM_016300chr3181 191 --1200
NM_016308chr121757 403 11865 --11489
NM_016316chr21510 ------
NM_016322chr943076 2857 2779 1174 12252 ----
NM_016374chr13330 308 146 ------
NM_016374chr13330 308 146 ------
NM_016396chr1532310 467 382 ------
NM_016424chr1721900 389 ------
NM_016470chr201502 ------
NM_016480chr53852 817 154 1168 ----
NM_016516chr2--1681 ----
NM_016530chr153844 761 105 22700 778 ----
NM_016542chrX31728 1166 279 31292 494 263 ----
NM_016575chr12104883 4678 4020 2190 1677 1206 820 591 157 77 ------
NM_016577chr354025 3435 2801 1361 634 ------
NM_016591chr541090 954 856 342 1440 1182 --
NM_016607chrX21722 146 11038 ----
NM_016613chr42743 21 1610 1293 12619
NM_016623chr81513 ------
NM_016628chr103769 299 102 185 ----
NM_016651chr14----11147 --
NM_016824chr10166 ------
NM_016831chr141912 1795 108 65 12386 11602 --
NM_016950chr421226 366 ------
NM_016953chr285379 4722 4421 2259 1569 981 954 326 35675 4937 1059 25847 5339 --
NM_017413chrX52245 1953 1908 604 493 ------
NM_017415chr563840 3633 3480 3273 1823 352 ------
NM_017420chr1443792 1114 589 433 ----2467 162
NM_017447chr2154249 3903 3390 1633 618 14104 ----
NM_017455chr151685 --1708 --
NM_017456chr172401 155 ------
NM_017519chr641369 1342 405 380 ------
NM_017522chr111339 --11106 --
NM_017548chr32514 408 1881 ----
NM_017580chr1041807 673 592 464 --12244 --
NM_017599chr121108 1274 ----
NM_017612chr12163 ------
NM_017626chr1011709 --1569 --
NM_017628chr484822 4707 4426 3828 1587 1037 676 246 ------
NM_017632chr41338 ------
NM_017633chr623576 140 ------
NM_017635chr1131100 222 162 11494 ----
NM_017637chr9159289 8385 7975 7753 7688 7396 6473 6385 6174 5889 3340 3306 2403 1855 186 13098 28080 1161 --
NM_017644chr384705 4643 4490 4254 3793 2016 1961 1158 11504 15090 --
NM_017649chr101392 ------
NM_017650chr795768 5409 4697 3924 2384 2145 1265 613 126 1242 15118 --
NM_017651chr631518 1067 524 ----1369
NM_017658chr1464586 3887 3788 1656 1629 1333 ------
NM_017664chr132891 187 ------
NM_017668chr161714 ------
NM_017677chrX3159 130 95 ----128
NM_017693chr1321020 223 ------
NM_017694chr231623 682 268 1326 ----
NM_017697chr83402 349 342 ----1481
NM_017709chr173783 2744 2633 1145 679 360 47 --1929 --
NM_017737chr11200 ------
NM_017738chr911149 1175 ----
NM_017741chr492641 2439 2296 2248 2112 2027 1709 475 217 11737 ----
NM_017742chr1811726 ------
NM_017744chr182359 2252 2186 1810 1785 1719 1628 798 1476 12128 --
NM_017745chrX1184 ------
NM_017752chrX31986 758 545 1587 --11881
NM_017754chr674622 4570 4492 3392 774 636 286 --54447 1546 1105 877 780 14679
NM_017758chr173357 305 190 ------
NM_017769chr1442800 1011 667 379 --13189 12676
NM_017798chr2041137 820 812 791 ------
NM_017799chr1431928 1309 106 ------
NM_017810chr163561 528 27 ------
NM_017811chr941230 1061 1049 610 11016 1874 --
NM_017813chr855046 4605 3972 3572 97 25566 4660 2992 285 --
NM_017857chr111198 ------
NM_017864chr8----170 --
NM_017866chr84950 855 790 337 ------
NM_017919chr9115033 4695 4667 4619 3937 3863 1524 1479 1058 206 185 34272 4217 868 25815 379 --
NM_017922chr141244 ------
NM_017938chrX41820 494 379 129 1722 ----
NM_017952chr294398 3954 3519 3288 3149 3014 2952 1507 810 1228 ----
NM_017987chr1021829 1384 31888 1555 1456 ----
NM_017988chr122631 275 1382 ----
NM_018027chr1023023 2115 12587 12613 --
NM_018036chr1443712 3422 1763 271 12806 14339 --
NM_018061chr111562 --1195 --
NM_018084chr243291 2880 2803 269 12129 32070 411 324 --
NM_018085chr1106424 6022 5502 2324 2182 1973 1773 1352 1215 846 13250 12854 --
NM_018086chr23690 543 129 ------
NM_018098chr31264 ------
NM_018121chr1072945 2906 2345 1226 670 491 204 ------
NM_018128chr1741365 1317 1200 1052 --1393 1162
NM_018133chr311763 --1132 --
NM_018155chr322905 122 1823 ----
NM_018157chr1223015 2000 22025 825 12340 --
NM_018169chr121441 ------
NM_018184chr321388 859 ------
NM_018195chr111161 ------
NM_018222chr112561 377 --31379 1209 768 1599
NM_018243chr434015 3293 3010 11472 12754 --
NM_018247chr662944 2846 2718 2282 1997 1065 22189 955 12738 --
NM_018254chr13813 413 404 1273 --1923
NM_018263chr242341 1952 410 198 --22539 1669 --
NM_018287chr101500 ------
NM_018302chr462200 744 620 558 236 43 ------
NM_018307chr175866 365 359 322 65 --1290 --
NM_018312chr1121515 493 1638 ----
NM_018313chr322089 187 --1736 --
NM_018323chr421754 111 ----1553
NM_018325chr931540 1108 355 --11129 1124
NM_018330chr10--1466 ----
NM_018334chr7--1193 ----
NM_018362chr1133519 3299 1317 13542 --13862
NM_018364chr174056 4040 3832 2971 2859 176 76 11096 181 --
NM_018374chr754490 4483 1679 1424 1323 13385 ----
NM_018400chr1184426 3668 1711 1371 1264 815 698 553 ----12824
NM_018402chr121412 ------
NM_018403chr364052 3749 3584 2929 610 284 13199 2797 259 --
NM_018433chr23569 563 378 ------
NM_018439chr183578 540 103 ------
NM_018440chr8108421 7700 7360 7186 6679 6369 6321 6183 5988 196 13115 16086 --
NM_018452chr6_random63058 2995 2703 2592 1474 204 1819 --13368
NM_018460chr21149 ------
NM_018471chr2129 ------
NM_018555chr1931850 474 123 1148 ----
NM_018557chr221261 137 11629 ----
NM_018566chr185136 4501 4023 3917 983 876 514 155 11506 1542 --
NM_018569chr441423 1301 1108 178 ------
NM_018590chr1061688 1670 1441 1383 445 327 ------
NM_018602chr1541517 471 409 171 1204 21063 136 --
NM_018638chr1245405 3709 385 32 13795 11765 15512
NM_018652chr151238 ------
NM_018657chr3127 3698 623 209 ----
NM_018667chr1652612 2559 1846 1733 1050 12567 ----
NM_018682chr72181 70 ------
NM_018683chr2021641 1472 ------
NM_018685chr72939 312 198 ----
NM_018686chr12--172 ----
NM_018693chr2176 ------
NM_018700chr53632 611 530 --189 --
NM_018704chr152031 1328 691 611 71 2168 157 ----
NM_018834chr5----2186 153 --
NM_018844chr731464 327 75 ------
NM_018945chr6103466 3360 3224 2954 2487 1253 1067 442 352 101 13677 --13367
NM_018963chr2151433 1296 1184 500 336 ------
NM_018970chr762918 2326 1072 369 238 51 ----1287
NM_018979chr1262164 1812 1055 634 288 51 ----12158
NM_018999chr1084853 4793 4609 4154 3615 1875 283 139 23939 727 23648 3431 --
NM_019000chr521417 1165 1573 ----
NM_019001chr354339 4308 946 136 21 24404 194 13906 --
NM_019004chr742031 1697 1554 791 --153 --
NM_019027chr432454 675 423 12337 ----
NM_019044chr254496 1748 1171 1137 717 --22877 1632 --
NM_019050chr442304 1852 751 611 11988 ----
NM_019063chr23882 634 268 21963 1415 ----
NM_019083chr131517 1460 384 ------
NM_019095chr20--1144 ----
NM_019114chr931786 1579 687 ------
NM_019592chr92622 589 ------
NM_019597chrX1753 --1191 --
NM_019610chr142126 1475 640 238 --1132 --
NM_019617chr21128 ------
NM_019862chr1641699 1592 1565 1402 11338 ----
NM_019898chr1641699 1592 1565 1402 11338 ----
NM_019899chr1641699 1592 1565 1402 11338 ----
NM_019900chr1641699 1592 1565 1402 11338 ----
NM_019903chr10166 ------
NM_020066chr11813 ------
NM_020135chr61290 ------
NM_020139chr431905 704 358 21305 164 ----
NM_020166chr3------129
NM_020182chr2053068 2765 2745 2459 178 ------
NM_020204chr11194 ------
NM_020226chr4146 ------
NM_020228chr1162414 1980 1935 1875 1641 323 ------
NM_020244chr12184 ------
NM_020337chr433117 1246 311 1636 ----
NM_020346chr112446 337 ------
NM_020354chr101771 ------
NM_020390chr354373 1390 941 382 66 21406 1237 24817 1395 --
NM_020403chr1311420 ------
NM_020416chr472332 2068 1695 1011 729 609 579 ------
NM_020420chrY41781 1418 383 337 ------
NM_020432chr742115 1644 505 104 12025 --11957
NM_020443chr186659 6234 5091 4285 2093 1968 1902 1638 35859 1992 1541 ----
NM_020457chr161263 ------
NM_020463chr23959 502 139 --11096 --
NM_020532chr2--1197 ----
NM_020640chr322181 485 ------
NM_020666chr52818 162 --1116 --
NM_020673chr2097533 7232 7150 6094 5746 2987 953 460 286 25161 1476 ----
NM_020689chr2041665 1096 471 351 ------
NM_020699chr155327 5194 4280 1171 824 24430 1693 --14999
NM_020715chr1451767 1437 883 319 159 ----12214
NM_020717chrX74911 4863 3365 1933 1157 1122 170 13637 11616 11000
NM_020718chr1636028 4654 840 25740 2557 35355 4298 1463 --
NM_020732chr641369 1342 405 380 ------
NM_020738chr241751 1425 1192 451 1295 --1490
NM_020739chr1563980 1507 1413 338 286 214 24238 3397 12751 1783
NM_020742chrX1451 12690 12403 --
NM_020748chr1722082 232 11727 ----
NM_020752chr1042710 1796 1054 933 1402 12499 --
NM_020760chr231791 1285 463 ------
NM_020766chrX84202 4118 4108 2894 1768 1717 1398 284 13626 --14074
NM_020772chr1758110 8098 2013 609 296 37918 7169 2782 18300 --
NM_020774chr1845722 5450 5006 497 11320 --11648
NM_020781chr782915 2185 2164 1276 1264 1158 593 459 22255 360 12171 --
NM_020786chr1661981 1531 769 739 487 208 --11608 --
NM_020792chr321047 188 ------
NM_020825chr1623592 703 12526 ----
NM_020841chr1243788 3372 1184 812 23004 1555 22622 213 --
NM_020853chr1242103 2067 676 602 1271 11118 --
NM_020854chr1821107 975 21475 418 ----
NM_020860chr41179 ------
NM_020870chr411966 ------
NM_020871chrX42169 1780 240 23 ------
NM_020905chr22308 124 ------
NM_020918chr1043530 2492 2335 1426 1306 ----
NM_020920chr141406 ------
NM_020921chr1442506 2255 1359 522 --33433 3170 3102 --
NM_020935chr261794 1628 1601 1311 1270 1241 23735 1081 ----
NM_020948chr161072 867 848 825 797 438 ------
NM_020956chr19143991 3970 3936 3888 3636 3133 3127 3052 3040 3011 1327 871 238 187 --33470 3338 260 --
NM_020962chr1552466 2314 2305 138 125 ------
NM_020964chr1874642 3833 3796 2962 838 258 224 ----14822
NM_020975chr1041860 239 226 50 41953 1946 1936 1929 ----
NM_021005chr1531072 814 82 ------
NM_021025chr51503 ------
NM_021038chr343413 2540 651 235 22270 638 12095 22084 1237
NM_021061chr8124314 3294 3128 3051 3020 2964 2898 2879 2818 2746 557 536 --13502 --
NM_021064chr61242 21553 1279 ----
NM_021072chr541664 646 599 307 ------
NM_021116chr7109057 7227 6813 6472 6424 5954 2831 2305 1759 680 --26116 2995 --
NM_021120chrX82736 1959 1212 1186 1054 765 172 140 ------
NM_021140chrX21016 421 --11147 --
NM_021144chr91521 ------
NM_021145chr72954 465 ------
NM_021148chr732486 2074 1937 ----1638
NM_021163chr733761 3471 840 1776 --13479
NM_021167chr772567 2430 2228 2064 805 670 500 ----11954
NM_021176chr231768 1565 747 ------
NM_021183chrX41872 713 268 154 11690 11926 --
NM_021190chr1----1426 --
NM_021191chr1242170 2016 678 386 11943 12181 --
NM_021198chr231456 1332 1018 --11032 --
NM_021240chr92695 248 ------
NM_021249chr1421188 74 --11471 --
NM_021255chr1473952 3910 3218 1331 1177 1086 959 12776 ----
NM_021627chr32988 977 ------
NM_021643chr21116 11811 --193
NM_021818chr1421100 23 11185 11499 --
NM_021911chr564874 4046 1547 714 548 250 44154 3872 2162 2045 --23696 172
NM_021913chr1971546 1474 1359 678 380 307 43 11799 ----
NM_021914chr1422172 553 ------
NM_021961chr1167170 6501 6175 2937 2671 1554 11487 27333 1283 --
NM_021964chr365688 2238 1952 1860 372 119 1413 ----
NM_021979chr142400 290 ------
NM_021998chrX11213 1233 ----
NM_022037chr21993 ------
NM_022041chr1631043 869 248 1823 12434 --
NM_022058chr241581 1478 838 682 11849 --1711
NM_022068chr182173 77 ------
NM_022080chr2032784 2178 914 11954 12366 --
NM_022085chr62346 183 2630 199 1188 --
NM_022091chr622279 1708 191 ----
NM_022121chr63399 392 38 1159 1836 --
NM_022123chr142546 439 ------
NM_022143chr74562 357 301 108 --1637 --
NM_022173chr21993 ------
NM_022340chr363500 3012 2845 954 709 681 ------
NM_022459chr1355894 5780 2349 1743 387 --25163 190 11965
NM_022465chr1252364 2094 831 439 247 12628 1890 --
NM_022473chr15104042 3628 1500 1452 1347 1323 571 429 219 179 1414 ----
NM_022474chr1432312 749 385 --11999 --
NM_022476chr161427 2257 175 ----
NM_022484chr711340 1141 ----
NM_022494chr10296 30 ------
NM_022497chr373038 3032 2572 1143 960 306 180 1532 ----
NM_022650chr5----11006 --
NM_022716chr152468 2403 2024 1013 774 ------
NM_022719chr2273567 3005 1185 1134 1042 928 450 1256 21553 1458 --
NM_022731chr11217 ------
NM_022781chr932909 758 638 13265 13110 --
NM_022802chr1031613 644 415 --21190 241 --
NM_022824chr531500 1437 1224 ------
NM_022826chr21453 ------
NM_022832chr43833 658 503 --12020 --
NM_022841chr1522201 410 --1827 --
NM_022843chr131191 ------
NM_022845chr1632094 1910 1791 ------
NM_022893chr231967 415 155 --13103 --
NM_022894chr221152 23 ------
NM_022898chr1474471 3918 1507 1485 1349 955 458 24375 1738 ----
NM_022900chr71291 1976 ----
NM_022909chr52537 470 ------
NM_022912chr241935 1869 393 299 ------
NM_022977chrX52652 2377 2233 2010 799 ------
NM_023000chr141203 11249 --1106
NM_023001chr141203 11249 --1106
NM_023012chr121489 ------
NM_023019chr22266 104 --1288 --
NM_023079chr1711710 ------
NM_023929chr812655 ------
NM_024007chr522043 796 --11116 --
NM_024061chr71473 ------
NM_024090chr431307 358 201 --11218 11582
NM_024345chr986037 5838 2202 2132 1721 1112 607 578 15257 --14983
NM_024429chr73766 708 91 ------
NM_024524chr332591 2212 940 13065 ----
NM_024539chrX1504 ------
NM_024569chr132895 2123 706 2960 822 ----
NM_024613chr841536 1246 648 427 ------
NM_024617chr9--1611 ----
NM_024620chr1961303 1238 1158 1110 494 141 --1155 --
NM_024624chr221414 241 11596 ----
NM_024636chr722919 257 12499 2386 381 1869
NM_024665chr323544 3457 33624 3178 1732 --13576
NM_024689chrX31263 381 280 1532 ----
NM_024721chr822069 521 11075 ----
NM_024725chr111219 1530 ----
NM_024744chr231945 1658 422 ----11070
NM_024751chr411865 21907 1801 ----
NM_024761chr941822 1545 427 181 25061 1715 24458 3924 --
NM_024770chr2115396 4606 4178 4078 2578 2095 1064 1033 872 689 282 36690 6516 1540 ----
NM_024811chr11----11688 --
NM_024813chr11127 1278 ----
NM_024824chr1421067 521 --1567 --
NM_024900chr441705 463 433 169 11774 1630 --
NM_024900chr441705 463 433 169 11774 1630 --
NM_024920chr411418 ------
NM_024947chr399086 7898 7560 7099 7030 6136 3667 2819 2119 49327 8452 3082 2400 --27853 2013
NM_024949chr484983 4851 4778 4374 4262 3911 3462 808 11705 ----
NM_024953chr1262837 2451 1008 950 758 637 12771 ----
NM_024969chr21715 ------
NM_024989chr297750 6382 6133 2384 1614 1255 1105 1076 900 36444 6217 2504 ----
NM_025054chr843476 2567 1210 227 12952 23711 898 --
NM_025074chr432544 692 430 32996 938 605 ----
NM_025106chr1--11541 ----
NM_025134chr1652264 2230 2144 739 711 --1597 --
NM_025146chr322703 1776 2634 568 12685 --
NM_025147chr22386 342 ------
NM_025154chr751310 1138 1124 520 320 ------
NM_025160chr144211 3970 3730 1559 ------
NM_025191chr162822 2299 2207 1319 496 487 1106 ----
NM_025237chr1751490 1248 373 193 132 --11465 --
NM_025263chr621847 416 ------
NM_030627chr534012 3489 2626 23853 1232 33983 2704 721 --
NM_030634chr1121 --2828 355 --
NM_030647chr775342 4151 2290 2072 2035 1664 1176 26122 1647 12386 11341
NM_030650chr274054 3978 3420 2887 1352 402 354 --13396 1566
NM_030665chr1721311 551 ------
NM_030759chr101667 ------
NM_030791chr143655 348 187 21603 125 ----
NM_030810chr62346 183 2630 199 1188 --
NM_030816chr143663 3184 3022 2749 ------
NM_030817chr1273360 2808 1454 1057 701 677 617 12481 ----
NM_030820chr6--1103 ----
NM_030885chr342272 1765 1651 599 1623 ----
NM_030917chr4----1166 --
NM_030949chr641186 566 451 391 --21071 1017 --
NM_030979chr13--1393 ----
NM_031217chr111216 --1115 --
NM_031243chr76894 815 554 471 454 100 ------
NM_031296chr42156 68 32717 2259 1939 ----
NM_031371chr13330 308 146 ------
NM_031371chr13330 308 146 ------
NM_031427chr1485928 5736 5123 4314 1992 1704 1463 981 ------
NM_031431chr1341773 1164 273 53 ----11711
NM_031438chr52602 478 11844 ----
NM_031439chr8--1221 ----
NM_031442chrX23100 944 ------
NM_031469chr641539 757 651 337 13307 22869 2549 --
NM_031483chr2052965 2387 1352 1036 114 ------
NM_031844chr153738 3694 1327 1137 433 --12508 --
NM_031845chr232571 521 379 12321 12931 12996
NM_031847chr232571 521 379 12321 12931 12996
NM_031911chr432336 589 288 --11852 11070
NM_031938chr114806 791 783 30 11030 ----
NM_031954chr1221767 951 --12825 --
NM_032021chr112965 389 11022 ----
NM_032047chr351734 1683 849 188 38 2708 86 ----
NM_032048chr181626 ------
NM_032102chr1122196 650 --23078 2575 1927
NM_032116chr13105725 4295 4188 4080 3980 2269 2049 1563 1180 438 15544 12100 --
NM_032121chrX11126 22705 267 ----
NM_032128chr4--1803 --158
NM_032145chr621349 436 11236 ----
NM_032160chr1834228 3447 304 14178 ----
NM_032175chr511608 31788 1585 167 11670 --
NM_032199chr1063751 3126 2914 2874 2693 319 13047 ----
NM_032211chr1061167 1038 750 438 360 249 ------
NM_032217chr41415 1570 ----
NM_032221chr201515 11921 ----
NM_032228chr1142868 2177 1353 268 ----13511
NM_032229chr1321020 49 1319 ----
NM_032239chr411276 1921 ----
NM_032246chr1511246 31348 1323 197 ----
NM_032256chr121752 ------
NM_032281chr1942505 2239 873 421 ------
NM_032291chr141452 1381 461 196 21930 752 ----
NM_032303chr91197 ------
NM_032312chr22844 618 ------
NM_032315chr11233 1270 ----
NM_032352chr1411157 ------
NM_032373chr1075348 5117 4471 2314 1927 1111 894 24851 4389 11226 --
NM_032379chr113369 308 238 170 ----
NM_032438chr6185 --1450 1521
NM_032457chr443589 3261 2872 1156 --11191 --
NM_032458chrX52652 1110 667 137 115 --1511 12513
NM_032505chr352151 1869 1122 611 94 12368 12156 --
NM_032510chr18102308 2301 2220 1977 1937 1891 1790 716 668 226 1371 ----
NM_032521chr2052752 2005 1230 749 196 32995 2560 611 ----
NM_032539chrX3792 778 669 1559 ----
NM_032558chr921470 1057 1984 11090 --
NM_032622chr42406 48 --11211 --
NM_032682chr332594 1389 638 --21409 1312 --
NM_032747chr10143 ------
NM_032778chr332914 2500 1286 --22101 877 --
NM_032810chr1041077 1007 586 137 ------
NM_032812chr10146 ------
NM_032826chr7115457 5351 3674 3412 1935 1245 974 926 791 298 105 ------
NM_032859chr1343227 2459 2451 636 1372 ----
NM_032866chr1593056 2733 2411 967 854 781 647 356 270 ------
NM_032869chr851990 492 441 424 86 1530 --11393
NM_032873chr1184473 3658 2987 1709 896 462 304 91 24031 3586 ----
NM_032943chr113369 308 238 170 ----
NM_032975chr1832708 1219 606 ----13526
NM_032980chr1832708 1219 606 ----13526
NM_033012chr131716 ------
NM_033020chr131022 397 85 --24153 3077 --
NM_033029chr31375 ------
NM_033030chr211480 ------
NM_033132chr131407 ------
NM_033138chr721443 542 ------
NM_033139chr721443 542 ------
NM_033140chr721443 542 ------
NM_033157chr721443 542 ------
NM_033181chr61222 22753 980 13065 --
NM_033222chr911403 --1168 --
NM_033224chr7167625 7016 6950 6328 6022 5255 5134 2878 2849 2318 2286 2252 1852 829 489 143 27652 1582 ----
NM_033228chr52645 413 ------
NM_033285chr874063 3925 3811 3283 1648 1469 1017 ------
NM_033300chr111339 --11106 --
NM_033326chr112345 149 ------
NM_033360chr1253644 3256 1446 837 302 --13755 --
NM_033380chrX21010 437 ------
NM_033381chrX21010 437 ------
NM_033394chr231165 490 483 1564 ----
NM_033427chr72849 709 1537 ----
NM_033430chr451595 1579 1441 1238 534 --1478 --
NM_033437chr451595 1579 1441 1238 534 --1478 --
NM_033480chr651847 862 265 254 68 ------
NM_033481chr651847 862 265 254 68 ------
NM_033495chrX--178 ----
NM_033626chrX31775 480 467 ------
NM_033642chrX1974 --11040 --
NM_033656chr2185633 5280 4047 4016 3937 3905 988 933 12391 --25198 1787
NM_052827chr121214 --1425 --
NM_052832chr832429 2037 1056 --12879 --
NM_052851chr131135 ------
NM_052860chr53959 831 250 1389 --1731
NM_052879chr1221455 1132 12926 13367 --
NM_052885chr1284886 4686 3990 3211 1735 1717 1705 733 13637 14327 --
NM_052898chr811291 11908 ----
NM_052900chr811663 ------
NM_052910chr1321938 244 11335 ----
NM_052925chr191841 ------
NM_052927chr51109 22199 1948 1820 --
NM_052937chr841987 1720 1008 354 12321 ----
NM_052954chr2132091 1803 143 1354 1308 --
NM_052958chr8--2758 591 1743 --
NM_053016chr9107468 6819 6671 6464 5162 2269 1478 1240 1226 1199 12059 11887 16945
NM_053024chr3167 ----122
NM_054026chr81695 2688 93 1908 --
NM_057168chr72687 595 --11399 --
NM_057178chr1732589 2128 1043 ------
NM_057749chr82913 385 ------
NM_058170chr131577 255 153 ------
NM_078483chr594085 3730 3443 3435 3043 2947 1174 1145 851 1411 11006 --
NM_078487chr933178 1184 747 11285 23282 682 --
NM_080422chr18----1213 --
NM_080423chr18----1213 --
NM_080546chr921632 827 21608 855 ----
NM_080629chr141195 1046 543 210 11306 ----
NM_080630chr141195 1046 543 210 11306 ----
NM_080645chr611668 --11677 --
NM_080672chr201445 ------
NM_080759chr1312180 1142 11696 --
NM_080760chr1312180 1142 11696 --
NM_080867chr1435034 3692 1022 11003 ----
NM_080872chr843761 2994 2578 338 11127 23393 818 --
NM_080874chr42709 150 ------
NM_080927chr332701 2489 2245 1777 ----
NM_100264chr103769 299 102 185 ----
NM_100486chr103769 299 102 185 ----
NM_130387chr331109 168 130 --1869 --
NM_130391chr923204 1266 ------
NM_130392chr923204 1266 ------
NM_130393chr923204 1266 ------
NM_130395chr61290 ------
NM_130435chr1042753 2711 1040 360 ------
NM_130438chr2142863 2566 2106 1066 --11200 --
NM_130440chr161597 1476 1442 1355 656 340 --11482 --
NM_130798chr1531219 495 79 ------
NM_130847chr1174852 4065 3938 3903 1971 671 254 34538 4340 4239 ----
NM_133369chr51901 ------
NM_133372chr552844 2368 2329 2263 748 --12708 --
NM_133445chr943330 186 113 105 ----12684
NM_133465chr9------1350
NM_133477chr41133 2658 361 --1518
NM_133478chr252122 2059 956 908 495 11909 ----
NM_133493chr644148 1661 559 541 33377 3216 877 --11625
NM_133494chr1185 ------
NM_133496chr143167 2758 1599 171 54270 3026 1662 800 122 11586 --
NM_133507chr12--1333 ----
NM_133646chr2104950 4944 4789 4619 4015 3967 3668 1684 782 776 ------
NM_133647chr1552385 1539 1208 283 140 ------
NM_134428chr9158 ------
NM_134442chr23509 352 28 ------
NM_138270chrX12942 22452 664 1408 1221
NM_138286chr1931495 950 626 14087 --1669
NM_138333chr952011 1999 821 815 328 32377 1672 615 ----
NM_138348chr595971 5799 4399 2338 1561 1281 1243 1158 516 24998 376 26380 4527 --
NM_138357chr10----11631 --
NM_138395chr221177 93 ------
NM_138401chr191262 ------
NM_138423chr1542280 1702 933 223 ------
NM_138426chr71226 ------
NM_138455chr81348 ------
NM_138457chr632368 1122 667 --12437 --
NM_138468chr2155955 5470 5177 4912 3948 3900 2366 2019 1672 1586 1538 1404 698 355 302 11159 ----
NM_138473chr1294768 4380 4339 4213 3506 1242 1195 1173 546 15035 --14392
NM_138576chr1474471 3918 1507 1485 1349 955 458 24375 1738 ----
NM_138609chr51213 ------
NM_138610chr51213 ------
NM_138638chr1422172 553 ------
NM_138694chr662882 2521 1222 681 669 227 ------
NM_138713chr1656372 6277 2981 2009 1543 37934 6673 2184 --13177
NM_138714chr1656372 6277 2981 2009 1543 37934 6673 2184 --13177
NM_138727chr182359 2252 2186 1810 1785 1719 1628 798 1476 12128 --
NM_138728chr182359 2252 2186 1810 1785 1719 1628 798 1476 12128 --
NM_138731chr1431197 962 138 1826 23985 3794 --
NM_138735chr211091 ------
NM_138771chr711282 1357 ----
NM_138779chr13----1253 --
NM_138782chr521624 451 ------
NM_138785chr6184 ------
NM_138798chr2138 ------
NM_138927chr212686 368 ------
NM_138970chr1412032 12226 ----
NM_138971chr1143153 2442 638 256 ----22772 1495
NM_138971chr1143153 2442 638 256 ----22772 1495
NM_138972chr1143153 2442 638 256 ----22772 1495
NM_138972chr1143153 2442 638 256 ----22772 1495
NM_138973chr1143153 2442 638 256 ----22772 1495
NM_138973chr1143153 2442 638 256 ----22772 1495
NM_139062chr171447 ------
NM_139068chr5--1574 ----
NM_139069chr5--1574 ----
NM_139070chr5--1443 ----
NM_139168chr5------22007 1476
NM_139215chr171106 ------
NM_139321chr2053505 2904 840 791 579 ------
NM_144571chr456726 6198 5860 2420 1368 25102 5010 ----
NM_144578chr14105149 4748 4668 4551 4171 1742 1301 1156 1123 1050 ------
NM_144609chr1711317 ------
NM_144632chr251978 1896 1783 1765 203 ------
NM_144642chr341256 527 473 448 ------
NM_144643chr4197 1434 ----
NM_144664chr1132498 971 161 ------
NM_144667chr1231157 784 768 ------
NM_144718chr372145 2118 1978 1850 925 71 22 2919 262 ----
NM_144728chr11693 ------
NM_144729chr11693 ------
NM_144778chr1312524 1992 ----
NM_144949chr242532 2081 760 32 2985 673 --1593
NM_145014chr111335 ------
NM_145049chr51879 ----1747
NM_145055chr1853549 3118 2514 1526 553 --12809 --
NM_145165chr1432413 2264 177 --12334 --
NM_145175chr231399 1241 312 ------
NM_145176chr662734 1219 1132 841 524 206 12783 12593 --
NM_145206chr1053355 2624 1244 638 521 32893 2398 48 ----
NM_145238chr12581 187 1677 ----
NM_145251chr141414 11370 ----
NM_145259chr2105710 5629 5022 4585 1805 727 458 311 162 123 36585 6175 2574 --14617
NM_145284chrX42285 2043 786 654 --12225 --
NM_145306chr101147 1533 ----
NM_145307chr1033937 3155 2833 14498 12953 --
NM_145320chr741343 1119 801 138 --1786 --
NM_145321chr741343 1119 801 138 --1786 --
NM_145322chr741343 1119 801 138 --1786 --
NM_145341chr1031612 392 230 ----1558
NM_145686chr243188 3012 2657 637 --12377 --
NM_145687chr243188 3012 2657 637 --12377 --
NM_145725chr14------1402
NM_145726chr14------1402
NM_145735chr1362295 2213 1984 1083 431 375 ------
NM_145753chr311536 1515 ----
NM_145805chr151510 ------
NM_145808chr773122 2663 2281 697 576 504 436 ----12408
NM_145858chr213410 353 132 ------
NM_145893chr1631563 716 677 21634 183 11656 --
NM_145912chr22123983 3716 3528 3477 3437 3236 2991 1580 1317 634 401 80 --14516 --
NM_147150chr963697 3100 2674 1480 1156 673 ------
NM_147175chrX22025 350 ------
NM_147189chr821549 365 ------
NM_148174chr8142 1726 1677 --
NM_148898chr71674 ------
NM_148899chr71674 ------
NM_152233chr1421188 74 --11471 --
NM_152261chr122925 197 ------
NM_152263chr1156021 5748 5657 5012 4673 4499 4429 4237 4189 2266 1766 1440 1141 637 180 11879 ----
NM_152275chr22759 673 ------
NM_152330chr1422299 1019 21982 172 11788 --
NM_152352chr1842910 2866 2409 1998 11963 --12776
NM_152375chr132568 2131 726 ----11952
NM_152380chr121644 309 ------
NM_152388chr263989 3276 2857 2703 797 700 ------
NM_152407chr552688 1177 1120 964 71 --11246 --
NM_152414chr841283 1177 548 420 ------
NM_152417chr84884 397 376 273 11223 ----
NM_152446chr14------1915
NM_152519chr211662 ----12006
NM_152522chr23789 728 378 4741 223 216 183 ----
NM_152549chr52143 47 ------
NM_152556chr731807 1741 918 ------
NM_152581chrX41466 971 414 309 ------
NM_152594chr1532313 2192 1886 1861 12061 --
NM_152608chr152333 1873 1804 1684 1650 ------
NM_152622chr552632 1263 1137 1069 966 ------
NM_152624chr5156645 6403 5926 2739 2448 2252 1898 1545 1202 1047 975 873 437 291 230 --16636 14771
NM_152660chr11771 1891 1806 --
NM_152665chr11498 ------
NM_152672chr31195 ------
NM_152695chrX11787 ------
NM_152699chr343564 3514 905 864 13295 --12403
NM_152707chr102732 433 1905 ----
NM_152721chr182720 660 --1178 --
NM_152723chr112351 341 ------
NM_152726chr13188 ------
NM_152734chr694863 4709 4299 2053 1727 1701 1152 793 230 ------
NM_152739chr71753 ------
NM_152745chr72988 762 ------
NM_152754chr732657 306 109 --11370 --
NM_152756chr5--22739 1028 23043 1151 --
NM_152758chr882833 2754 2707 2652 2128 1878 1039 279 1896 ----
NM_152774chr712455 ------
NM_152789chr731099 1002 258 --11224 --
NM_152835chr132628 689 597 22229 309 12664 --
NM_152838chr2043077 2542 2425 992 --12968 --
NM_152857chr61343 ------
NM_152858chr61343 ------
NM_152991chr113653 294 97 1171 ----
NM_152996chr121694 1474 --12009 11825
NM_153020chr611120 21619 235 ----
NM_153038chr22551 120 ------
NM_153182chr332914 2500 1286 --22101 877 --
NM_153188chr594419 4400 4247 4110 3863 3639 1895 1448 187 --11647 --
NM_153208chr162781 387 1752 ----
NM_153211chr181136 ------
NM_153226chr101157 ------
NM_153240chr32313 156 ------
NM_153255chr62819 692 ------
NM_153374chr153415 381 189 1127 ----
NM_153607chr523133 2559 3954 243 137 ----
NM_153633chr121210 ------
NM_153645chr2242067 1214 547 275 12212 1166 --
NM_153649chr122272 205 11574 ----
NM_153686chr431937 574 254 --12335 --
NM_153687chr1241086 1011 636 495 ------
NM_153810chr1074580 2031 1831 1708 981 724 290 ------
NM_153828chr2--1197 ----
NM_170606chr71563 ----11537
NM_170674chr1511060 --11433 --
NM_170675chr152736 271 --11109 --
NM_170676chr152736 271 --11109 --
NM_170677chr1511060 --11433 --
NM_170686chr782915 2185 2164 1276 1264 1158 593 459 22255 360 12171 --
NM_170709chr862317 1963 1545 776 642 307 ------
NM_170731chr1132851 1091 87 12060 12425 --
NM_170732chr1132851 1091 87 12060 12425 --
NM_170733chr1132851 1091 87 12060 12425 --
NM_170734chr1132851 1091 87 12060 12425 --
NM_170735chr1132851 1091 87 12060 12425 --
NM_170754chr12----2182 177 --
NM_172020chr731893 1718 64 --11478 11440
NM_172097chr153572 223 204 1317 ----
NM_172103chr621871 618 1819 12295 --
NM_172105chr621871 618 1819 12295 --
NM_172240chr1221322 1281 21361 1239 1356 --
NM_172315chr1511060 --11433 --
NM_172316chr1511060 --11433 --
NM_172373chr13----2941 402 11032
NM_173039chr111200 ------
NM_173054chr72751 384 ------
NM_173078chrX1397 ------
NM_173198chr921082 636 ------
NM_173200chr921082 636 ------
NM_173214chr1656372 6277 2981 2009 1543 37934 6673 2184 --13177
NM_173468chr466037 5834 5178 381 174 103 --14319 --
NM_173469chr1511278 ------
NM_173470chrX12581 ----22503 2157
NM_173478chr1721004 160 --2873 215 --
NM_173503chr171144 ------
NM_173510chr2232961 2612 502 --1402 --
NM_173511chr243692 3668 3198 898 ------
NM_173519chr821874 383 ------
NM_173531chr1943696 2740 1205 811 ----1892
NM_173552chr341832 1673 1588 284 ----11542
NM_173562chr643265 2808 2564 2059 12976 23047 2740 --
NM_173582chr11115899 5275 2481 1667 1634 1448 1416 1283 900 787 413 11087 ----
NM_173591chr121751 1743 ----
NM_173607chr1472107 1614 1515 349 282 256 34 ------
NM_173647chr22734 715 --1982 --
NM_173683chr8136 1496 1485 --
NM_173685chr81199 ------
NM_173694chrX21597 245 ------
NM_173797chr531323 860 530 ------
NM_173808chr124221 3051 1735 21092 320 --
NM_173825chr362865 2296 1987 1912 741 447 21105 381 12971 --
NM_174858chr111243 ------
NM_174890chr10----1255 --
NM_174902chr1121404 1301 ------
NM_174911chr883445 2585 1421 753 714 626 610 487 ------
NM_174938chr91136 ------
NM_175069chr9--1938 ----
NM_175566chr111426 ----1355
NM_175610chr1511178 ------
NM_175748chr141275 ------
NM_175861chr1265949 5330 4352 4143 4046 1533 14732 21346 555 --
NM_175863chr641369 1342 405 380 ------
NM_175866chr141268 920 581 507 21361 178 --1465
NM_175873chr51284 ------
NM_175876chr132569 1909 70 --12044 --
NM_175910chr1942331 2248 2190 1918 11867 ----
NM_176081chr10115892 5673 5047 4628 4488 4038 3803 947 773 753 730 ------
NM_176083chr10115892 5673 5047 4628 4488 4038 3803 947 773 753 730 ------
NM_176812chr201657 ------
NM_176814chr71335 ------
NM_177538chr2208006 7931 7282 7214 6871 6690 6228 5529 3426 2998 2497 2151 2117 2030 1696 1383 980 838 565 429 26222 1844 ----
NM_177947chrX21722 146 11038 ----
NM_177948chrX21722 146 11038 ----
NM_177966chr32767 659 11873 ----
NM_177969chr21723 ------
NM_177974chr1542280 1702 933 223 ------
NM_177985chr22647 369 11563 ----
NM_178006chr131135 ------
NM_178007chr131135 ------
NM_178011chr1042633 2349 830 176 --1199 --
NM_178151chrX86331 5457 4929 4835 2497 2214 1473 632 12300 ----
NM_178152chrX86331 5457 4929 4835 2497 2214 1473 632 12300 ----
NM_178153chrX86331 5457 4929 4835 2497 2214 1473 632 12300 ----
NM_178154chr141320 ------
NM_178155chr141320 ------
NM_178156chr141320 ------
NM_178157chr141320 ------
NM_178177chr3163 ------
NM_178191chr111524 ------
NM_178424chr51205 1214 ----
NM_178470chrX21715 685 ------
NM_178496chr331528 126 112 ------
NM_178505chr1043265 2293 242 140 --13525 --
NM_178507chr111789 ------
NM_178509chr1743023 1405 1213 682 --24087 3156 --
NM_178566chr91194 ------
NM_178815chr1031929 603 75 22741 627 ----
NM_180989chr1341670 1602 1572 1556 12349 22072 1922 --
NM_181077chr151143 ------
NM_181332chrX1451 12690 12403 --
NM_181354chr821342 523 11385 ----
NM_181361chr33952 348 77 11287 ----
NM_181443chr20--12655 ----
NM_181457chr211186 ------
NM_181492chr2231146 994 113 ------
NM_181504chr534163 2886 830 --11183 --
NM_181523chr534163 2886 830 --11183 --
NM_181524chr534163 2886 830 --11183 --
NM_181571chr1011063 --1156 --
NM_181581chr7--2827 626 ----
NM_181659chr2022290 138 --1713 --
NM_181659chr2022290 138 --1713 --
NM_181689chr201794 ------
NM_181726chr41202 ------
NM_181787chr822988 2715 21081 852 23936 612 --
NM_181838chr551603 1247 543 388 258 ------
NM_181872chr9179 ----1218
NM_181876chr472332 2068 1695 1011 729 609 579 ------
NM_181886chr41172 ------
NM_181887chr41172 ------
NM_181888chr41172 ------
NM_181889chr41172 ------
NM_181890chr41172 ------
NM_181891chr41172 ------
NM_181892chr41219 ------
NM_181893chr41172 ------
NM_182485chr433763 2780 1155 43715 3571 1283 836 ----
NM_182487chr974405 3994 2975 845 808 684 550 --24307 2909 --
NM_182488chr132834 773 1704 ----
NM_182503chr6105359 5093 4926 4847 4625 4544 4441 1661 1274 146 23939 2202 24729 3425 --
NM_182515chr1955387 4379 4180 1022 973 26248 1839 12625 11463
NM_182646chr433763 2780 1155 43715 3571 1283 836 ----
NM_182648chr141512 ------
NM_182663chr152108 1931 750 601 471 --11642 1841
NM_182664chr152238 2061 880 731 601 --11772 1971
NM_182665chr152108 1931 750 601 471 --11642 1841
NM_182666chr31659 ------
NM_182691chr7------2365 205
NM_182692chr7------2365 205
NM_182697chr741654 1445 1356 523 1616 ----
NM_182715chr741048 802 792 172 ------
NM_182717chr1011468 --1561 --
NM_182718chr1011063 --1156 --
NM_182719chr1011063 --1156 --
NM_182720chr1011468 --1561 --
NM_182721chr1011468 --1561 --
NM_182722chr1011468 --1561 --
NM_182723chr1011468 --1561 --
NM_182724chr1011063 --1156 --
NM_182725chr1011063 --1156 --
NM_182765chr1031775 728 125 --11978 --
NM_182767chr1221338 224 2824 255 ----
NM_182769chr1011063 --1156 --
NM_182770chr1011063 --1156 --
NM_182771chr1011063 --1156 --
NM_182772chr1011063 --1156 --
NM_182850chr1011063 --1156 --
NM_182853chr1011468 --1561 --
NM_182894chr1451238 1144 1138 1130 184 11750 ----
NM_182896chr331360 1124 474 11189 ----
NM_182898chr7106508 6436 6279 6007 5570 5185 5023 4895 4870 1275 22561 1454 ----
NM_182899chr7106508 6436 6279 6007 5570 5185 5023 4895 4870 1275 22561 1454 ----
NM_182907chr6134 1695 ----
NM_182931chr72181 70 ------
NM_182943chr331050 777 78 31139 906 477 ----
NM_182944chr142111 94 1454 ----
NM_182948chr163119 3051 819 187 120 70 ------
NM_182972chr122675 2312 ------
NM_182975chr1--164 ----
NM_182976chr12767 273 ------
NM_182977chr52775 343 ------
NM_183011chr1011468 --1561 --
NM_183012chr1011468 --1561 --
NM_183013chr1011468 --1561 --
NM_183043chr132308 275 --2928 67 --
NM_183044chr132308 275 --2928 67 --
NM_183060chr1011063 --1156 --
NM_183227chr611338 --11615 --
NM_183244chr201445 ------
NM_183246chr201445 ------
NM_183380chr6148 ------
NM_183381chr32962 316 ------
NM_183383chr32962 316 ------
NM_183384chr32962 316 ------
NM_183416chr121282 135 --11824 --
NM_183419chr8177 11258 ----
NM_194071chr765194 4794 4692 4556 3844 831 14759 15050 25371 4682
NM_194247chr233528 3184 1313 24346 1507 1807 14165
NM_194250chr21174 --158 --
NM_194278chr14103785 3554 3422 3305 1123 1051 644 459 370 261 12730 ----
NM_194285chr1153216 2886 691 628 598 --12160 --
NM_194286chr1256167 4536 1344 642 180 --13880 14075
NM_194291chr81279 2567 558 ----
NM_194292chr121142 639 1135 ----
NM_194301chr142893 177 1283 ----
NM_194314chr124086 1691 35559 4523 3526 ----
NM_194328chr932909 758 638 13265 13110 --
NM_194329chr932909 758 638 13265 13110 --
NM_194330chr932909 758 638 13265 13110 --
NM_194332chr932909 758 638 13265 13110 --
NM_194434chr1873903 3558 1967 1859 923 754 539 ------
NM_194454chr721665 1089 ----21508 1463
NM_194455chr721665 1089 ----21508 1463
NM_194456chr721665 1089 ----21508 1463
NM_194463chrX1504 ------
NM_197970chr211480 ------
NM_198077chr12509 64 ------
NM_198123chr811663 ------
NM_198124chr811663 ------
NM_198215chr103527 519 314 11141 --177
NM_198236chr131127 1087 857 --11007 --
NM_198240chr121408 1326 ----
NM_198261chr121489 ------
NM_198262chr121489 ------
NM_198270chrX53401 2427 1322 637 116 22532 201 --13059
NM_198273chr5--1309 12275 --
NM_198279chrX21292 493 ------
NM_198316chr12----2182 177 --
NM_198320chr1274182 3765 3626 1466 1201 755 584 ------
NM_198395chr51114 ------
NM_198399chr341674 1347 1210 340 ------
NM_198465chrX11907 22868 199 ----
NM_198467chr72630 541 ------
NM_198507chr52514 107 ------
NM_198513chr831955 1934 452 ------
NM_198565chr31229 ------
NM_198581chr245868 2646 1562 919 45590 5261 1212 1058 11518 --
NM_198584chr822665 864 ------
NM_198715chr185774 4755 4533 2396 1669 1101 1062 573 ----25792 5423
NM_198793chr344068 3133 1671 480 44085 1451 523 328 1157 12740
NM_198794chr1411387 ------
NM_198859chr375036 3559 3521 1357 717 394 40 1531 ----
NM_198889chr41415 1570 ----
NM_198902chr15--1221 ----
NM_198935chr2022288 883 --12999 --
NM_199039chr411022 --1689 --
NM_199076chr101392 ------
NM_199169chr2053068 2765 2745 2459 178 ------
NM_199170chr2053068 2765 2745 2459 178 ------
NM_199171chr2053068 2765 2745 2459 178 ------
NM_199185chr5--1212 ----
NM_199188chr1221455 1132 12926 13367 --
NM_199189chr5----2186 153 --
NM_199190chr1221455 1132 12926 13367 --
NM_199421chr1435034 3692 1022 11003 ----
NM_199436chr263003 2356 2133 479 244 93 1538 ----
NM_199437chr1162414 1980 1935 1875 1641 323 ------
NM_199438chr1162414 1980 1935 1875 1641 323 ------
NM_199439chr1162414 1980 1935 1875 1641 323 ------
NM_199440chr21365 ------
NM_199462chr184781 4297 3107 1915 872 738 403 255 ------
NM_199478chrX21350 807 ------
NM_199482chr252061 1709 772 751 160 12051 --11841
NM_201263chr111824 ----11648
NM_201280chr631389 1309 198 --1651 --
NM_201434chr172216 209 ------
NM_201437chr831496 1371 1099 ------
NM_201999chr41773 ------
NM_203282chr1931844 1246 730 ------
NM_203327chr201121 14501 13513 162
NM_203339chr841263 1093 363 40 ------
NM_203350chr131424 525 328 ------
NM_203354chr143858 673 74 157 ----
NM_203355chr143858 673 74 157 ----
NM_203356chr143858 673 74 157 ----
NM_203364chr112777 98 ------
NM_203458chr143138 1535 1377 941 ----1651
NM_203459chr162308 2138 1653 522 331 186 ----1603
NM_203463chr274588 4469 4238 3437 1076 828 539 13405 ----
NM_203487chr1311420 ------
NM_203504chr422531 341 --12208 --
NM_203505chr422531 341 --12208 --
NM_205768chr1--1377 ----
NM_205860chr131210 972 714 1998 ----
NM_206853chr642958 751 538 343 23037 412 23565 228 --
NM_206854chr674219 2012 1799 1604 1262 1049 513 24298 1673 24826 1489 --
NM_206855chr675184 3942 2227 2014 1478 387 269 15263 25791 2454 --
NM_206876chr233568 3401 39 ------
NM_206907chr532542 2248 1147 43332 2800 2320 618 22571 983 --
NM_206909chr8188091 7725 7398 7345 7297 7267 7089 6891 6796 6348 6113 5598 5363 2478 2116 1868 1650 717 15214 15620 --
NM_206927chr113369 308 238 170 ----
NM_206928chr113369 308 238 170 ----
NM_206929chr113369 308 238 170 ----
NM_206930chr113369 308 238 170 ----
NM_207012chr1073226 3178 2504 1393 915 859 178 ----13487
NM_207043chr172219 764 435 339 243 167 135 ------
NM_207044chr172219 764 435 339 243 167 135 ------
NM_207047chr172219 764 435 339 243 167 135 ------
NM_207123chr42781 159 191 ----
NM_207292chr343413 2540 651 235 22270 638 12095 22084 1237
NM_207293chr343413 2540 651 235 22270 638 12095 22084 1237
NM_207294chr343413 2540 651 235 22270 638 12095 22084 1237
NM_207295chr343413 2540 651 235 22270 638 12095 22084 1237
NM_207296chr343413 2540 651 235 22270 638 12095 22084 1237
NM_207297chr343438 2565 676 260 22295 663 12120 22109 1262
NM_207304chr1312411 1879 ----
NM_207337chr123363 124 28 1399 1150 --
NM_207361chr1356159 6047 5250 4901 4234 46021 5740 5432 2460 ----
NM_207387chr1751738 1589 1395 513 372 11170 ----
NM_207406chr4106374 5953 5318 4178 2518 2488 2125 1954 989 395 --11097 --
NM_207520chr2--1197 ----
NM_207521chr2--1197 ----
NM_207645chr111454 ------
NM_207647chr911881 --12425 --
NM_207660chr1421067 521 --1567 --
NM_207661chr1421067 521 --1567 --
NM_207662chr1421067 521 --1567 --
NM_212460chr752011 1712 595 518 423 21985 1946 ----
NM_212471chr1731925 704 361 12066 ----
NM_212472chr1731925 704 361 12066 ----
NM_212474chr22919 390 1354 ----
NM_212475chr22919 390 1354 ----
NM_212476chr22919 390 1354 ----
NM_212478chr22919 390 1354 ----
NM_212482chr22919 390 1354 ----
NM_212559chrX2354 123 --1738 --
NM_213589chr245466 4159 1302 227 11200 25007 4653 --