TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-374c-5p
miRNA Sequence: AUAAUACAACCUGCUAAGUGCU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX83429 2984 2832 2686 2676 2571 2372 1312 12412 ----
NM_000112chr585532 5343 4826 3901 3888 3637 1969 1681 --25431 1039 24595 262
NM_000248chr32557 213 11167 --2970 473
NM_000259chr1546366 5919 5812 5549 --65356 4803 2170 2133 881 196 15939
NM_000408chr273441 3330 3169 978 910 187 154 --2466 398 23404 1243
NM_000448chr1163186 3127 2915 2489 1091 296 12146 11025 1415
NM_000555chrX87211 6910 6868 6859 6317 2960 1500 973 26433 2861 --12638
NM_000809chr4109281 9226 7293 6883 6842 5926 3621 1573 728 693 ----12971
NM_000814chr1574149 4012 3563 3338 3186 2659 488 --1411 22807 2771
NM_001001419chr575069 4914 4705 1099 228 173 145 --35155 4324 3226 1953
NM_001001420chr575069 4914 4705 1099 228 173 145 --35155 4324 3226 1953
NM_001003652chr18108362 8072 3445 2773 2739 2482 1706 1238 621 341 12093 12565 38657 8102 5881
NM_001003674chr18116784 5745 5403 2605 2586 1834 1357 571 558 502 322 ------
NM_001003675chr18116784 5745 5403 2605 2586 1834 1357 571 558 502 322 ------
NM_001003679chr152154 1545 673 472 65 --11931 22095 1782
NM_001003712chr1263007 2649 1614 1232 927 324 1138 22886 2822 1211
NM_001004065chr984002 3864 3788 3701 3440 3316 1289 1169 13296 1995 23679 1338
NM_001004317chr694159 4026 3737 3575 3384 3066 2858 1397 761 24174 3606 12750 --
NM_001004342chr166010 5987 4359 1809 665 621 --36047 5966 4630 25692 4471
NM_001005473chr586630 6598 6395 5478 4948 2577 1236 228 --34294 444 51 1811
NM_001007466chr664700 4060 4048 1933 651 473 11276 35049 4682 3702 13981
NM_001008408chr7166384 6350 6121 5980 5736 5010 5003 4438 4380 4223 2195 2051 1834 1826 636 204 26420 2122 16033 --
NM_001009909chr1173885 3717 3331 3286 3245 2686 510 1937 43901 3627 2739 911 11262
NM_001009960chr772855 2691 2476 2377 2235 785 190 21085 197 --1253
NM_001010891chr5126462 6158 5757 5253 4483 2220 2094 1555 1384 1353 674 168 198 --1775
NM_001011666chr7106327 6303 5922 5633 4705 4329 4170 4138 1955 1881 16243 --16435
NM_001012420chr1572525 2340 2121 993 684 355 124 --21912 589 12201
NM_001012423chr1572525 2340 2121 993 684 355 124 --21912 589 12201
NM_001013620chr12158322 7503 7137 6529 5511 5134 3026 2696 2221 2187 2169 1464 1146 967 694 11430 68347 6733 6071 2151 746 455 13274
NM_001014380chr1385862 5809 5796 5335 4697 4181 1385 925 --15413 11965
NM_001018067chr155063 1827 527 364 206 --45163 5116 281 219 --
NM_001018068chr155063 1827 527 364 206 --45163 5116 281 219 --
NM_001018069chr155063 1827 527 364 206 --45163 5116 281 219 --
NM_001024647chr12106124 4746 4740 1316 1257 1119 673 656 631 169 ----1339
NM_001024649chr562914 2257 2192 868 676 439 ----32276 613 348
NM_001025076chr10105913 5063 2421 1383 1172 1127 1031 1025 971 372 --43975 3771 2407 779 --
NM_001025077chr10117271 6421 4702 2741 2530 2485 2389 2383 2329 1730 242 --45333 5129 5063 2137 --
NM_001025079chr374065 3270 2776 1270 897 854 64 --13825 13857
NM_001030055chr1444592 1502 1126 1103 14280 64495 3739 3645 3316 1594 1397 --
NM_001034954chr1063228 3125 2201 869 227 141 23033 2904 22190 176 12431
NM_001034955chr1063228 3125 2201 869 227 141 23033 2904 22190 176 12431
NM_001034956chr1063228 3125 2201 869 227 141 23033 2904 22190 176 12431
NM_001034957chr1063228 3125 2201 869 227 141 23033 2904 22190 176 12431
NM_001037174chr242262 788 610 569 11567 31840 620 466 11395
NM_001039590chrX53794 3661 1489 1300 969 --33638 3004 738 13773
NM_001039591chrX53794 3661 1489 1300 969 --33638 3004 738 13773
NM_001039618chr1185496 5269 4953 4322 4014 3668 1113 467 --14274 11008
NM_001039840chrX75287 5279 1784 1757 193 140 92 14215 44863 820 632 28 14845
NM_001040284chr1695965 5582 5531 4599 4378 2063 1799 1215 924 25615 4013 11265 --
NM_001040450chr153638 584 226 ----22597 2457
NM_001040453chr153638 584 226 ----22597 2457
NM_001042683chr621711 649 --11817 2690 38
NM_001044385chr263751 337 279 159 89 64 --11580 23433 3275
NM_001071775chr1351958 1731 716 263 192 11269 21652 457 1651
NM_001099678chr396281 6122 5932 5053 2286 2003 1621 719 144 26207 1212 25754 1558 14661
NM_001167chrX96594 5776 5651 5542 2691 1776 492 276 185 25224 2346 46588 5216 879 194 --
NM_001173chr1444592 1502 1126 1103 14280 64495 3739 3645 3316 1594 1397 --
NM_001201chr433555 668 182 11331 22431 1515 12513
NM_001204chr2107535 7426 6812 6191 6046 5784 2296 1981 1029 497 --47587 5554 1317 326 17697
NM_001432chr483794 3621 2661 2462 1134 1076 114 96 --13722 22953 525
NM_001527chr654798 3397 1571 1540 115 14409 --24850 709
NM_001621chr752348 1225 1167 1123 653 11191 32885 2726 1919 11958
NM_001621chr752348 1225 1167 1123 653 11191 32885 2726 1919 11958
NM_001695chr8113764 3175 3144 2847 1464 1238 862 853 654 387 37 --21565 541 --
NM_001746chr562914 2257 2192 868 676 439 ----32276 613 348
NM_001777chr374065 3270 2776 1270 897 854 64 --13825 13857
NM_001858chr674985 4946 4331 3204 1845 1811 1090 --44938 4872 4867 4800 --
NM_002015chr1352370 1118 906 369 359 --43015 2713 2665 2627 --
NM_002069chr731328 598 291 1223 11662 21877 525
NM_002158chr253825 3486 3247 2496 418 --2901 831 13045
NM_002222chr33316 309 25 1956 1174 1442
NM_002223chr1253655 3430 2599 1182 167 ----21136 1027
NM_002270chr5135638 5112 5000 4972 4763 4448 3868 2132 1729 1677 1623 1482 986 --23802 1148 34525 4182 185
NM_002310chr5136597 6575 5994 5593 5485 5344 5097 4091 1508 1383 1355 1205 102 --15259 14794
NM_002336chr1284909 4553 4426 4183 3793 3451 3244 1723 24644 3317 13338 13440
NM_002460chr652944 2918 1509 464 411 1546 13217 23414 647
NM_002655chr8115267 5060 5041 4847 4614 3354 2087 2044 1373 950 182 ----13423
NM_002731chr183141 3058 2876 1989 1954 1220 803 349 ----12907
NM_002834chr1294069 4017 3733 3538 3383 2881 1554 312 179 23747 2783 14051 --
NM_003112chr763060 2891 2839 2815 462 403 13151 12558 1298
NM_003199chr1895673 5448 5248 5086 4422 3774 2166 1978 1166 14692 24167 63 11749
NM_003262chr344580 918 726 121 --25245 1031 13413
NM_003274chr2162838 2711 2433 2203 1129 919 ----32969 2505 1182
NM_003410chrX42303 2098 710 174 1966 1897 12476
NM_003463chr633295 939 166 2277 115 --33330 1135 629
NM_003574chr1875578 4745 4547 2246 1505 1345 638 25730 4680 25237 1538 --
NM_003583chr1263127 3011 758 667 249 221 23313 2808 23850 1547 --
NM_003622chr1272643 2445 2416 1988 1970 1835 1813 ----12129
NM_003663chr363354 3313 2397 613 81 57 42534 2167 791 46 11062 13329
NM_003759chr453767 3290 3019 1289 1254 21551 459 33469 1228 991 23421 3402
NM_004124chr1483291 3149 3116 2660 2413 2334 1305 401 22528 460 1490 2786 37
NM_004171chr11119328 7909 6939 6838 2561 2499 2114 1813 1026 884 400 17420 58124 7900 6804 1588 227 --
NM_004293chr983875 3774 3436 3241 1310 770 560 479 1711 1605 11078
NM_004338chr18116784 5745 5403 2605 2586 1834 1357 571 558 502 322 ------
NM_004458chrX42612 2556 2294 778 1544 1231 2974 425
NM_004504chr241964 1141 913 645 --11007 23068 138
NM_004726chrX94565 4457 4266 3966 3722 3636 2001 1098 263 --25232 4727 15552
NM_004744chr483470 2894 2747 880 619 306 111 29 21322 958 12964 --
NM_004745chr896857 6663 5921 2586 2065 2054 1129 1097 816 15590 32711 2669 1162 --
NM_004748chr1553077 2741 1395 1123 317 13347 --23895 3641
NM_004775chr184890 877 749 389 --22010 1877 12403
NM_004815chr174032 3374 3237 596 224 138 53 24296 3651 53959 3754 1669 1227 40 11561
NM_004834chr242936 838 485 131 --13382 23078 3052
NM_004904chr7106327 6303 5922 5633 4705 4329 4170 4138 1955 1881 16243 --16435
NM_004992chrX118285 7395 7167 7057 6964 6511 6503 5997 2212 2200 2056 --27186 2761 --
NM_004992chrX118285 7395 7167 7057 6964 6511 6503 5997 2212 2200 2056 --27186 2761 --
NM_004999chr673688 2775 1195 1016 677 611 602 23204 1082 11506 --
NM_005121chr1773489 3420 2944 855 768 608 226 --23043 649 12983
NM_005188chr11116688 6499 3303 3277 3198 2811 2370 1422 978 733 507 18023 1529 28229 433
NM_005197chr1495916 5461 5347 4986 4526 4099 1352 1070 1061 --16189 --
NM_005238chr1163555 3301 3279 2290 947 643 --12617 1566
NM_005339chr433626 1438 1055 --23042 1105 23351 1193
NM_005359chr18104338 4220 2113 1625 854 776 766 510 370 129 16206 24514 535 11240
NM_005497chr17105889 5842 4866 4669 3807 1889 1883 1221 349 308 15046 45826 5032 2284 1045 --
NM_005504chr1286549 5044 4591 4406 4130 1653 1053 378 35008 1386 527 45516 5347 938 132 --
NM_005596chr966079 5946 5439 5260 4295 4287 --36154 5432 1890 24160 1367
NM_005668chr5104595 4350 4310 3908 3529 2842 1477 1145 859 830 --24085 3538 --
NM_005746chr792078 2038 1913 1789 1757 885 366 73 22 32797 1936 255 2705 544 22462 622
NM_005877chr2241700 813 624 579 --32403 562 230 1836
NM_005901chr18108362 8072 3445 2773 2739 2482 1706 1238 621 341 12093 12565 38657 8102 5881
NM_005903chr575069 4914 4705 1099 228 173 145 --35155 4324 3226 1953
NM_005966chr242285 1876 417 313 --11762 42148 848 733 243
NM_006007chr984462 3848 3819 3428 3168 1204 386 374 13998 41463 1422 1167 1073 --
NM_006080chr762998 2774 2660 2226 2075 632 --12634 22391 368
NM_006206chr452649 2400 2194 1154 383 2930 563 12889 1396
NM_006252chr187038 6852 6359 5954 1370 927 566 412 17408 54615 3013 1829 1547 920 15602
NM_006330chr851371 510 462 448 193 1104 11167 11356
NM_006434chr1063228 3125 2201 869 227 141 23033 2904 22190 176 12431
NM_006482chr1263127 3011 758 667 249 221 23313 2808 23850 1547 --
NM_006544chr1495700 4847 4759 3929 3797 2450 2260 1482 762 11987 --24795 4102
NM_006561chr10105913 5063 2421 1383 1172 1127 1031 1025 971 372 --43975 3771 2407 779 --
NM_006628chr1544666 4069 3136 393 11203 14421 2764 380
NM_006722chr32557 213 11167 --2970 473
NM_006738chr1594553 3304 3242 3006 1634 1628 1620 927 625 ----12999
NM_006750chr16158064 7939 7838 7543 7300 7288 6660 6150 5758 5094 2850 2784 2119 1326 387 --15694 12447
NM_006873chr2123203 3109 2402 1372 1346 1191 855 750 629 186 168 131 11230 1611 --
NM_006948chr2152344 2246 878 613 486 --2402 376 1789
NM_007006chr1663448 3390 3361 3268 2658 509 1695 33190 788 422 --
NM_007007chr12124707 4267 4103 3548 3433 3106 3080 2959 1641 1268 1097 490 33166 1479 1181 11500 34826 3894 3629
NM_007200chr1594553 3304 3242 3006 1634 1628 1620 927 625 ----12999
NM_007203chr984002 3864 3788 3701 3440 3316 1289 1169 13296 1995 23679 1338
NM_007212chr182027 1963 1940 1831 400 319 269 244 11933 2813 784 --
NM_007249chr13159280 9226 9060 8882 8389 8115 7954 7209 6355 3674 3630 2450 2383 1949 1505 27308 87 39080 8277 8168 --
NM_007345chr1842321 915 727 460 196 42118 1981 1594 335 11792
NM_012081chr5103660 3427 2958 2503 859 367 302 249 219 116 23615 3118 21358 1345 --
NM_012090chr111202 --1119 21172 278
NM_012097chr242262 788 610 569 11567 31840 620 466 11395
NM_012120chr672962 2860 2616 2358 2349 1984 775 --1313 --
NM_012164chr975988 5455 4855 1699 896 297 256 26247 483 11674 15243
NM_012193chr1154256 4125 4097 581 481 --14385 25439 3731
NM_012214chr266391 6043 4760 1141 261 167 --56199 5784 5084 2543 1792 --
NM_012252chr784854 4787 4703 4673 4349 967 115 71 44196 1734 348 176 14128 --
NM_012262chr194202 4079 3436 1518 1409 1070 981 921 824 1592 --2435 114
NM_012334chr5104478 2970 1800 1648 1403 995 888 786 606 501 11769 34489 3686 854 1184
NM_012382chr543075 3037 599 302 23910 671 --22955 1272
NM_012388chr1573010 2977 2888 2639 2515 917 126 --12290 --
NM_013255chr778865 8353 8011 7338 7005 6701 2395 57791 7089 5883 5580 2863 22585 584 38771 7712 570
NM_013943chr1113251 2962 2857 2588 2519 1327 1180 788 438 182 93 ----13306
NM_014021chr132689 196 34 1294 33365 971 611 12550
NM_014048chr1685255 5202 5111 4736 1550 908 900 175 ----11263
NM_014112chr865446 4940 4586 3353 2183 997 --11508 14845
NM_014155chr1196331 6083 5962 5780 5698 5684 2742 2279 1172 --17289 27355 2503
NM_014253chrX52198 1889 1836 832 593 --32432 767 70 12012
NM_014331chr4117738 7631 7293 6911 6864 5597 5570 5236 3077 1329 1303 1797 37749 5690 5447 16419
NM_014345chr64855 406 335 242 --1808 21061 832
NM_014372chr171872 1835 1339 1280 772 300 240 1287 1554 1321
NM_014423chr5105498 5441 5394 3746 3685 3578 2226 2001 1797 132 25453 586 --35663 4042 707
NM_014721chr6116938 6904 6760 6532 5028 2496 1335 1190 940 465 99 12936 36971 6853 1304 --
NM_014746chr2114272 4193 4147 4090 3863 3284 2687 1501 1282 855 630 --24337 3567 --
NM_014795chr291369 1252 1132 1036 905 462 256 177 47 1216 --176
NM_014864chr184368 3849 3709 3429 1673 703 603 343 --11608 13445
NM_014873chr184599 4380 3954 3578 1373 832 644 610 12969 14674 13467
NM_014877chr17187784 7760 6570 6555 6418 6356 6337 6286 6075 5458 4969 4785 2873 2716 1692 755 589 341 24741 1805 1250 --
NM_014912chr1053322 2681 2327 710 663 ----23463 2455
NM_015000chr1242533 1159 894 473 42816 2018 409 291 21057 757 22702 2634
NM_015020chr1673823 3796 3681 2995 2793 2708 2451 1513 --33847 2624 2536
NM_015026chr1253847 3424 1428 1303 1141 22960 561 31441 1120 703 21769 319
NM_015032chr1352874 2028 1068 422 416 22739 677 1763 --
NM_015076chr674146 3329 3288 2908 1455 903 224 --44041 1161 1093 938 --
NM_015137chr852382 1720 1690 1036 654 --32252 1966 748 22600 88
NM_015192chr2062653 2478 2278 1074 998 566 ----22806 2554
NM_015271chr473917 3606 2623 1026 648 472 178 --21152 1040 11207
NM_015308chr114841 824 718 46 --130 2654 262
NM_015385chr1063228 3125 2201 869 227 141 23033 2904 22190 176 12431
NM_015458chr8104837 4661 1393 1147 1110 940 928 784 473 284 15302 11054 --
NM_015571chr662392 2070 987 757 546 247 1614 22221 2112 1158
NM_015640chr155063 1827 527 364 206 --45163 5116 281 219 --
NM_015886chr8105662 5427 4822 4612 4204 4085 3504 1599 1406 1303 --25746 4851 --
NM_015888chr143070 1057 879 272 --32590 2444 323 33052 2813 1116
NM_015906chr184772 4673 4037 1814 1450 1047 959 152 23236 1827 14787 --
NM_016009chr164357 3870 1781 1261 811 42 --14313 21505 99
NM_016083chr672447 1388 1378 1322 1300 1100 955 13079 23690 433 23861 902
NM_016107chr551110 370 334 164 157 127 11335 --
NM_016205chr42925 317 ----21437 256
NM_016206chr3148736 8066 7791 7559 6815 6702 6520 6402 6120 2512 2350 1765 653 456 12203 27992 1550 29015 8779
NM_016260chr256988 5117 2870 915 448 26033 970 46174 4879 4773 4755 15126
NM_016272chr2272713 2671 2523 2068 952 835 181 ----22800 2253
NM_016531chr484076 3379 3045 2571 1159 1073 692 334 --22914 364 14132
NM_016953chr285759 5730 5662 4788 4588 3853 631 474 --45704 4838 4497 1123 11056
NM_017415chr583975 3715 3085 2799 1754 1459 1093 788 --14534 33632 3316 416
NM_017447chr2164221 3941 3487 3133 3027 468 34101 1537 1518 34369 1237 1005 24248 1144
NM_017594chr943255 3082 1055 593 42238 735 369 103 31263 1076 763 13024
NM_017637chr999329 8406 3281 3049 3039 2613 1926 1569 973 37656 6478 980 --22483 570
NM_017650chr7156058 5164 4224 2362 2111 1881 1806 1722 1604 817 697 297 283 250 138 --15383 --
NM_017658chr1474595 4503 3778 3744 3647 3007 1507 --34369 3247 1108 1415
NM_017719chr332350 2293 1922 --12012 22442 1788
NM_017813chr8155579 5518 5338 4918 4801 3794 3731 2294 2272 2114 1345 686 658 509 202 --24706 1217 12234
NM_017919chr975720 4671 4444 2203 2182 1759 1674 13718 --25631 4080
NM_018036chr1454122 3924 621 607 590 --11567 24324 1665
NM_018155chr383420 3257 2311 2215 2177 2157 445 366 13343 21241 344 --
NM_018227chr443172 2890 945 684 1935 --2276 264
NM_018340chr1664946 4340 3707 1443 313 282 13552 --1418
NM_018351chr1244744 4640 3057 2905 ----1305
NM_018374chr774969 4863 4546 4362 4227 4129 1789 14606 1668 1176
NM_018566chr131868 400 293 --33755 1442 841 25134 4810
NM_018638chr12135718 5535 4958 4615 4545 4446 4319 4096 1666 1506 1238 879 711 --14165 45264 3898 737 221
NM_018976chr1232600 2400 1123 12241 --22775 952
NM_020245chr664606 3966 3954 1839 557 379 11182 34955 4588 3608 13887
NM_020297chr1293584 3562 3526 1392 1371 1157 487 352 28 ----1244
NM_020390chr364767 4327 3145 1259 1093 308 24362 366 --14919
NM_020727chr2154055 3984 3861 1351 1220 1454 11461 11399
NM_020739chr1553077 2741 1395 1123 317 13347 --23895 3641
NM_020748chr1762111 2076 1351 1343 300 100 1557 --11987
NM_020766chrX74576 4519 4208 3984 3155 590 274 14613 1128 23603 282
NM_020772chr17117065 6813 3226 3126 3032 2992 2240 2132 2124 1120 568 25497 3298 13475 --
NM_020782chr1274828 3958 3209 2933 893 513 363 24217 1902 1754 14725
NM_020783chr181470 --32162 1563 170 12214
NM_020841chr1263007 2649 1614 1232 927 324 1138 22886 2822 1211
NM_020844chr8117472 7443 7430 7225 7123 6708 4790 2206 2177 322 89 15382 37721 5963 1855 --
NM_020871chrX32149 1827 528 --22497 865 2893 645
NM_020917chr1993608 3375 2803 2775 2672 999 956 561 69 --1337 --
NM_020948chr183590 3064 2962 2622 2558 2295 2288 654 ----1343
NM_021033chr1353508 3141 2861 2478 474 199 13177 12282
NM_021127chr1831488 1397 1113 --21105 593 11277
NM_021255chr1443337 2695 415 179 12905 33983 3978 3237 13935
NM_021629chr384962 4823 4634 4497 940 443 322 272 14627 --21465 214
NM_021912chr1574149 4012 3563 3338 3186 2659 488 --1411 22807 2771
NM_021954chr1373613 3278 3253 3131 2892 2713 2256 --23156 1006 --
NM_021961chr11147471 7280 7132 7116 6824 6264 6191 5568 5375 5242 2834 715 398 180 --1784 --
NM_022456chr12106124 4746 4740 1316 1257 1119 673 656 631 169 ----1339
NM_022459chr13136384 5475 5080 4790 4455 2462 2420 1902 1787 1079 1016 979 194 15286 11577 26108 4744
NM_022763chr352947 2058 607 550 459 --13067 13101
NM_022977chrX42612 2556 2294 778 1544 1231 2974 425
NM_024511chr492622 2427 2261 1354 1023 804 737 489 199 --13200 --
NM_024524chr32400 25 22932 449 23115 865 22976 2329
NM_024761chr934966 1421 761 25052 3753 11414 25246 1489
NM_024770chr264971 4117 1897 1596 290 109 --1477 14490
NM_024947chr3179371 9292 9104 8764 8601 8575 8223 7707 7472 3790 3414 3155 2909 2313 1672 973 539 47266 6323 6111 5976 49126 3530 2277 277 --
NM_024989chr2188083 8062 7978 6497 6459 6437 6424 6351 5922 5708 5361 5143 5010 2565 2349 2086 777 38 28145 6057 27743 6651 --
NM_024991chr1063228 3125 2201 869 227 141 23033 2904 22190 176 12431
NM_025134chr1682462 2380 2339 1823 1677 1632 1624 973 ----11668
NM_030647chr7126261 6199 6174 5721 5176 4845 2112 2043 1219 951 626 300 --26227 478 --
NM_030650chr273415 2583 1633 1525 1334 815 375 22769 171 --11170
NM_030751chr1051821 1540 1250 623 376 11321 21597 640 11440
NM_030751chr1051821 1540 1250 623 376 11321 21597 640 11440
NM_030755chr14103075 2242 2079 1225 1154 1039 660 512 458 317 ------
NM_031435chr1263498 3321 3034 2185 1068 240 12146 --32831 975 428
NM_032012chr985047 4557 4165 4105 1991 1244 884 184 --31204 521 411 --
NM_032116chr1385862 5809 5796 5335 4697 4181 1385 925 --15413 11965
NM_032228chr1173427 2929 2740 2578 2333 980 884 --32942 1374 192 12922
NM_032435chr142018 2004 1819 91 --22354 2218 22126 1623
NM_032457chr443022 2543 1056 460 ----33828 3170 564
NM_032509chr852518 795 219 126 103 ----2867 841
NM_032547chr441408 1212 1023 513 --41302 1017 205 174 --
NM_032682chr333467 3235 985 11431 2595 549 33434 2262 146
NM_032873chr1184376 4349 3373 2843 1785 1750 195 55 13381 34425 4318 3598 --
NM_032968chrX84059 3488 3181 3093 3030 3004 2610 197 --24244 4072 24219 3120
NM_032969chrX84059 3488 3181 3093 3030 3004 2610 197 --24244 4072 24219 3120
NM_032973chrY84051 3484 3176 3088 3025 2999 2609 197 --24236 4064 24211 3115
NM_033020chr184772 4673 4037 1814 1450 1047 959 152 23236 1827 14787 --
NM_033044chr111202 --1119 21172 278
NM_033181chr672447 1388 1378 1322 1300 1100 955 13079 23690 433 23861 902
NM_033211chr552024 2005 1471 1350 404 --11796 11651
NM_033224chr7137474 7406 6766 6486 6146 5746 5459 2799 2177 2133 1842 1801 1775 --16069 --
NM_033285chr884179 4149 4047 4008 3972 1657 552 130 --21075 362 14414
NM_033430chr4133872 3584 3099 2937 1679 1521 1180 1073 503 351 120 93 45 13712 1574 --
NM_033437chr4133872 3584 3099 2937 1679 1521 1180 1073 503 351 120 93 45 13712 1574 --
NM_052879chr1254069 4063 3466 2509 943 31137 1103 1017 21213 491 23819 1443
NM_053016chr986931 6051 5736 5558 2629 2468 570 367 18020 12585 15573
NM_053043chr7166384 6350 6121 5980 5736 5010 5003 4438 4380 4223 2195 2051 1834 1826 636 204 26420 2122 16033 --
NM_080832chrX51796 1546 524 504 244 1606 11277 --
NM_133334chr4106307 5680 5589 5402 4506 4490 4046 886 599 472 1118 34685 4353 1281 --
NM_133477chr473241 3187 2907 2867 1266 705 140 1515 11259 12320
NM_138423chr1552263 1626 909 857 581 12285 32203 2041 186 12139
NM_138444chr1374958 4371 3498 3356 3102 943 929 24196 3852 ----
NM_138494chr772855 2691 2476 2377 2235 785 190 21085 197 --1253
NM_139168chr531719 1431 547 --1393 21466 530
NM_144571chr486456 5598 2522 1361 996 312 195 125 25397 713 45722 5418 2580 768 1257
NM_144578chr1484906 4769 4318 1805 1341 1322 1198 1035 14058 34876 4715 1484 --
NM_144599chr15115520 4975 4137 2123 1852 1660 1254 1241 1058 1020 99 --35365 1266 446 --
NM_144767chr1594553 3304 3242 3006 1634 1628 1620 927 625 ----12999
NM_144973chr1285256 3739 2079 1614 1483 1297 815 697 14517 55187 5100 480 211 159 --
NM_145259chr296330 5800 5504 5466 5148 4958 2548 1724 1494 11153 17054 --
NM_145686chr242936 838 485 131 --13382 23078 3052
NM_145687chr242936 838 485 131 --13382 23078 3052
NM_147150chr984002 3864 3788 3701 3440 3316 1289 1169 13296 1995 23679 1338
NM_152388chr263751 337 279 159 89 64 --11580 23433 3275
NM_152608chr162590 2551 2285 1818 379 213 --1681 11978
NM_152624chr5105866 5135 5050 5003 2887 1879 1668 1109 832 282 27107 897 47425 7133 5996 1069 1306
NM_152754chr793738 3495 3320 2755 2496 2466 1535 1394 692 --13848 --
NM_152793chr784634 4175 3846 2021 1975 1737 1600 1047 ----2741 347
NM_152903chr1372609 2576 2313 2204 1984 1977 995 --31098 860 462 --
NM_153188chr5135638 5112 5000 4972 4763 4448 3868 2132 1729 1677 1623 1482 986 --23802 1148 34525 4182 185
NM_153207chr1294034 3338 3293 3285 3176 1045 894 589 548 --12535 23748 1051
NM_153332chr862667 2419 2146 1062 828 360 1976 12863 12291
NM_153354chr54947 617 239 149 --1827 1133
NM_153367chr1093195 3182 3166 3080 2566 2511 507 175 161 13110 1350 14000
NM_153810chr103931 873 64 11843 35081 3626 400 14619
NM_170665chr1253786 1118 1007 757 507 --33997 3977 400 14406
NM_172071chr175613 5231 2890 2749 1347 390 381 36557 5294 2500 27255 2478 25693 4796
NM_173531chr1933161 2488 1442 --23218 617 22738 2504
NM_173582chr11106309 6268 4876 4169 2343 1775 1090 625 262 249 1497 36232 2037 80 --
NM_173602chr1273783 3158 1379 1357 757 391 294 1952 --23801 2321
NM_173829chr5105437 5070 4178 4161 4105 1250 886 366 290 278 25710 188 15622 --
NM_175623chr12106124 4746 4740 1316 1257 1119 673 656 631 169 ----1339
NM_175624chr12106219 4841 4835 1411 1352 1214 768 751 726 264 ----1434
NM_175625chr12106219 4841 4835 1411 1352 1214 768 751 726 264 ----1434
NM_175854chr1352648 2610 1908 1879 1827 --32743 2713 840 1815
NM_177974chr1552263 1626 909 857 581 12285 32203 2041 186 12139
NM_177985chr242262 788 610 569 11567 31840 620 466 11395
NM_178151chrX87211 6910 6868 6859 6317 2960 1500 973 26433 2861 --12638
NM_178152chrX87211 6910 6868 6859 6317 2960 1500 973 26433 2861 --12638
NM_178153chrX87211 6910 6868 6859 6317 2960 1500 973 26433 2861 --12638
NM_181358chr194214 3929 3612 2711 2674 1421 1389 678 637 --33044 647 400 --
NM_181481chr18116784 5745 5403 2605 2586 1834 1357 571 558 502 322 ------
NM_181482chr18116784 5745 5403 2605 2586 1834 1357 571 558 502 322 ------
NM_181483chr18116784 5745 5403 2605 2586 1834 1357 571 558 502 322 ------
NM_181521chr1697208 6976 6353 6007 4618 2298 1797 1341 303 ----27266 868
NM_182485chr493276 2931 2699 2676 2668 1388 802 615 243 13511 22595 592 12304
NM_182646chr493276 2931 2699 2676 2668 1388 802 615 243 13511 22595 592 12304
NM_182758chr1593498 3439 3309 3188 3080 2895 2591 2550 2489 11003 --23942 148
NM_182762chr795865 5741 5680 4336 1287 1232 358 296 268 25954 717 25838 4890 15449
NM_182898chr7106327 6303 5922 5633 4705 4329 4170 4138 1955 1881 16243 --16435
NM_182899chr7106327 6303 5922 5633 4705 4329 4170 4138 1955 1881 16243 --16435
NM_182948chr183141 3058 2876 1989 1954 1220 803 349 ----12907
NM_194282chr482150 1943 1144 1115 726 656 468 91 ----11915
NM_194291chr822444 1919 --22456 126 21887 300
NM_194314chr194529 4493 4444 4090 4018 4008 3924 969 530 --35637 5277 744 15121
NM_194434chr1875578 4745 4547 2246 1505 1345 638 25730 4680 25237 1538 --
NM_198158chr32557 213 11167 --2970 473
NM_198159chr32557 213 11167 --2970 473
NM_198177chr32557 213 11167 --2970 473
NM_198178chr32557 213 11167 --2970 473
NM_198268chr194214 3929 3612 2711 2674 1421 1389 678 637 --33044 647 400 --
NM_198269chr194214 3929 3612 2711 2674 1421 1389 678 637 --33044 647 400 --
NM_198581chr2127090 6796 5308 5012 1556 1215 1144 1130 1109 927 826 545 16193 1736 11285
NM_198793chr374061 3266 2772 1266 893 850 60 --13821 13853
NM_198859chr385014 5007 4576 4558 4015 3327 455 271 21857 538 1993 11833
NM_198935chr2082279 2271 2124 2033 1043 765 702 225 22997 2455 --22298 674
NM_199188chr1254069 4063 3466 2509 943 31137 1103 1017 21213 491 23819 1443
NM_199190chr1254069 4063 3466 2509 943 31137 1103 1017 21213 491 23819 1443
NM_199461chr1052928 2612 1178 814 256 2956 595 --23344 1069
NM_203458chr173590 3237 1266 1108 879 755 721 13011 13050 1844
NM_203463chr264878 4778 1324 849 726 270 13626 14328 1626
NM_206854chr665074 5062 3682 3308 1182 1157 ----11654
NM_207406chr476378 5948 4982 4503 2220 1470 619 --25465 1535 25288 394
NM_207491chr421381 1171 11458 1374 21490 1199