TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-376a-5p
miRNA Sequence: GUAGAUUCUCCUUCUAUGAGUA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr511292 21175 1116 ----
NM_000033chrX1641 ------
NM_000038chr561997 1713 1625 722 653 619 ------
NM_000052chrX53245 2950 2776 1028 202 11355 ----
NM_000081chr161655 725 642 586 203 130 11268 --1357
NM_000084chrX86270 5674 5051 4969 4800 4776 985 792 46625 5696 5109 1909 25966 645 1404
NM_000089chr72536 217 ------
NM_000092chr2104398 3895 3588 1719 1424 1366 1218 1206 491 208 33810 1446 1434 ----
NM_000108chr751890 361 339 183 95 11821 1625 1304
NM_000109chrX52331 1799 735 377 177 ------
NM_000125chr643550 3243 896 296 13125 12794 1425
NM_000138chr1511809 22106 1064 ----
NM_000143chr1--143 ----
NM_000153chr1461297 1125 1074 206 154 143 ----11137
NM_000163chr592390 2127 1862 1529 1453 817 794 761 556 2646 472 ----
NM_000165chr651720 1449 1270 1183 1139 ------
NM_000167chrX71838 1584 1340 1206 656 378 334 --11593 --
NM_000176chr563947 3745 3603 1574 1320 229 32525 1492 906 ----
NM_000188chr101692 ------
NM_000202chrX123945 3823 3151 3121 3027 2988 2838 2609 1152 640 567 195 2527 453 1379 --
NM_000212chr1722465 460 1219 ----
NM_000214chr2041598 1212 78 35 1116 --1556
NM_000216chrX93420 3307 3280 2602 2566 1466 1043 478 322 52766 1180 557 532 396 12828 1551
NM_000217chr1275380 4460 3531 3459 1990 886 290 15099 --1877
NM_000227chr181387 ----1127
NM_000232chr462306 2287 2218 2044 1127 190 1968 ----
NM_000242chr1072485 2245 2052 2009 1794 463 279 --21968 1078 --
NM_000245chr751940 1420 541 274 154 ------
NM_000251chr21246 ------
NM_000252chrX41349 585 275 264 ------
NM_000259chr15125943 5793 5759 5348 4797 4563 2470 1851 1642 1551 1332 1023 11737 --12331
NM_000264chr952620 2429 2211 1022 376 --12698 --
NM_000266chrX1657 --2832 369 --
NM_000267chr1773514 2646 2483 2385 2347 1389 1294 1177 ----
NM_000280chr11------1397
NM_000282chr13--135 ----
NM_000291chrX4988 942 844 214 1672 ----
NM_000314chr1062458 2063 1260 1214 613 338 --1711 --
NM_000319chr1211171 ------
NM_000321chr1341816 1649 1433 394 1416 --1584
NM_000322chr641510 619 94 63 1451 1382 1144
NM_000332chr6127037 7024 6090 5900 5051 5020 4784 4343 2803 2312 2162 1768 26229 5491 --14802
NM_000337chr586116 6049 5646 4968 4398 657 447 376 46040 2425 974 307 36594 4147 2103 14944
NM_000345chr431014 698 247 ------
NM_000362chr2263563 3167 2779 685 234 112 23267 2434 ----
NM_000367chr672205 2038 904 862 687 610 88 --11991 --
NM_000368chr994873 4545 4332 3501 3396 3079 1807 660 169 21184 342 --1355
NM_000380chr93528 56 33 ------
NM_000389chr6--1115 ----
NM_000390chrX93006 2806 2475 2245 953 932 478 405 346 33250 2778 760 158 --
NM_000393chr261713 1599 755 617 576 312 1727 21880 664 --
NM_000408chr252643 2155 987 865 201 ----11249
NM_000411chr2173027 2786 2280 729 361 212 78 33348 575 57 ----
NM_000430chr1783744 3304 2363 1428 1353 551 507 193 ----2996 832
NM_000439chr582341 2023 1902 1777 1708 586 551 371 1607 ----
NM_000448chr1152996 2283 991 849 834 11306 32685 2513 720 --
NM_000452chr1362037 1961 1742 788 348 117 --11410 11301
NM_000461chr374509 4127 3951 3616 3051 1754 1733 ----13557
NM_000462chr15--31657 1190 58 ----
NM_000465chr2134 ------
NM_000484chr21----1259 --
NM_000489chrX73362 3315 2677 1298 789 352 203 13370 22842 2792 --
NM_000493chr63879 800 203 ------
NM_000495chrX1723 11144 1232 --
NM_000503chr881890 1853 1554 1422 728 642 463 414 1681 ----
NM_000509chr41164 ------
NM_000510chr1121199 1084 1932 ----
NM_000531chrX2368 329 ----183
NM_000536chr115636 466 230 222 38 --147 --
NM_000555chrX116658 6504 6437 6279 5070 4931 4776 1942 1052 894 452 36271 2495 1471 14841 --
NM_000578chr211508 ------
NM_000585chr43557 499 233 ------
NM_000599chr284578 4522 4099 2832 993 648 558 153 23049 1837 --13147
NM_000600chr71143 ------
NM_000601chr72403 320 ----176
NM_000615chr1162992 1203 1056 976 357 184 --1335 --
NM_000618chr12145622 5210 4674 4632 4444 4378 2389 2294 1162 936 842 524 482 357 36026 5062 4726 25851 4344 14045
NM_000618chr12145622 5210 4674 4632 4444 4378 2389 2294 1162 936 842 524 482 357 36026 5062 4726 25851 4344 14045
NM_000681chr10--11295 ----
NM_000684chr1011207 ------
NM_000693chr1531772 1503 1127 ----1354
NM_000719chr1266367 5288 5060 4587 2159 1161 11485 36589 4109 1308 15281
NM_000721chr142638 2506 2474 2405 --22377 340 --
NM_000726chr281311 1132 526 437 405 382 359 281 11451 1173 1919
NM_000745chr154284 252 134 95 ------
NM_000783chr102569 158 1456 ----
NM_000788chr451512 1351 1163 1105 147 ------
NM_000806chr541722 1663 455 105 --147 --
NM_000807chr42714 255 ------
NM_000809chr4229156 8930 8135 7663 7549 7493 7207 6903 6659 6299 6138 6129 3497 3132 2537 2183 1465 1194 1119 881 465 340 49299 9193 7251 1872 --11492
NM_000813chr565230 4828 1954 1708 1400 459 45208 5058 4188 1111 --25555 2066
NM_000814chr1594222 3766 3592 3464 3261 3066 3055 2795 279 14106 ----
NM_000817chr211261 ------
NM_000826chr452516 2392 1804 402 93 22573 750 ----
NM_000838chr612054 ----12089
NM_000844chr311021 ------
NM_000849chr162228 2161 1918 877 588 527 22823 1083 --1535
NM_000868chrX52636 2627 2369 1789 981 11604 12428 --
NM_000875chr1556361 2458 1310 534 113 15724 26929 887 12514
NM_000879chr51304 1108 ----
NM_000885chr262055 1922 1720 1339 259 89 32088 2007 59 ----
NM_000891chr1733512 3006 469 --21198 886 --
NM_000899chr1274414 4150 3915 3587 1568 1239 474 24260 3644 --14367
NM_000901chr442504 1666 983 758 22469 1858 --12053
NM_000909chr4----1250 --
NM_000912chr833207 1394 57 13019 11028 2568 107
NM_000922chr111738 ------
NM_000925chr32395 32 ------
NM_000926chr11169350 8921 8167 7638 7107 6472 5886 5861 3685 3669 2877 2066 1747 1236 1134 1051 1134 37890 6423 227 39443 9051 2752
NM_000935chr34915 285 278 30 ------
NM_000945chr252056 1809 704 614 275 31595 1462 383 ----
NM_000949chr52758 702 ------
NM_000958chr51436 21032 955 ----
NM_000963chr1112414 2272 2113 2078 1758 951 881 851 783 652 267 21947 52 ----
NM_000998chr2153 ------
NM_001001323chr1222768 898 --11141 --
NM_001001330chr1021296 1053 ----1139
NM_001001344chrX42566 2352 1939 654 22549 1022 ----
NM_001001394chr21660 1692 ----
NM_001001395chr1262390 2148 1870 1126 889 519 --31786 1036 606 --
NM_001001396chr184268 4078 4037 3300 3106 3066 1283 287 24365 3584 1528 --
NM_001001419chr5104639 3757 3647 3641 3421 1868 969 729 598 311 --1159 --
NM_001001420chr5104639 3757 3647 3641 3421 1868 969 729 598 311 --1159 --
NM_001001433chr2063157 2056 997 791 559 39 1770 2949 532 2215 107
NM_001001481chr842979 2903 2447 1179 --12409 --
NM_001001484chr1051717 1536 925 305 266 3783 372 332 ----
NM_001001556chr1541561 1513 1340 578 11539 11551 --
NM_001001567chr211173 ------
NM_001001568chr211173 ------
NM_001001571chr211173 ------
NM_001001572chr211173 ------
NM_001001573chr211173 ------
NM_001001574chr211173 ------
NM_001001575chr211173 ------
NM_001001576chr211173 ------
NM_001001577chr211173 ------
NM_001001579chr211173 ------
NM_001001580chr211173 ------
NM_001001581chr211173 ------
NM_001001582chr211173 ------
NM_001001584chr211173 ------
NM_001001585chr211173 ------
NM_001001664chr2113927 3535 3144 3016 1341 1107 741 549 389 358 158 33339 809 476 --13272
NM_001001668chr19114003 3853 3744 3489 3456 3270 3252 2599 1449 1305 190 33657 1206 362 ----
NM_001001852chr221813 ------
NM_001001890chr2173420 3187 3034 1134 1071 425 148 11338 11314 --
NM_001001933chr12469 455 ------
NM_001001971chr101461 1300 ----
NM_001001974chr1052169 1735 1543 544 491 --1154 --
NM_001002233chr842190 1935 1841 1666 12050 ----
NM_001002243chr21188 --1703 --
NM_001002257chr233443 2443 690 ------
NM_001002811chr161552 1526 1452 979 372 177 ----11258
NM_001002812chr161552 1526 1452 979 372 177 ----11258
NM_001002812chr161552 1526 1452 979 372 177 ----11258
NM_001002838chrX61875 1385 1221 608 490 480 ----11456
NM_001002860chr1453612 2849 1171 965 290 1573 --12889
NM_001002909chr171778 ------
NM_001003407chr1044827 4022 1780 92 --21987 1659 21883 1620
NM_001003408chr1044827 4022 1780 92 --21987 1659 21883 1620
NM_001003652chr18128519 7945 6551 6021 5375 3486 2877 1288 1034 915 439 405 27939 2279 1153 --
NM_001003674chr1876763 6083 6031 5177 5107 2007 1003 14335 --16135
NM_001003675chr1876763 6083 6031 5177 5107 2007 1003 14335 --16135
NM_001003679chr152085 1828 599 592 55 31998 807 103 ----
NM_001003688chr431006 759 434 1143 --1948
NM_001003694chr31663 ----1471
NM_001003712chr1274034 4021 3977 3628 3464 879 403 23122 2472 --1648
NM_001003790chr81269 ----1155
NM_001003791chr81269 ----1155
NM_001003792chr361258 908 463 328 205 29 ------
NM_001003793chr361258 908 463 328 205 29 ------
NM_001003800chr942566 2521 1061 568 --1120 --
NM_001003891chr221902 ------
NM_001004125chr9--41022 892 876 799 ----
NM_001004196chr331056 383 48 1409 ----
NM_001004317chr673691 1753 1345 576 254 128 46 23682 420 11777 --
NM_001004330chr1251658 1308 652 201 129 11285 ----
NM_001004346chr451097 1024 428 381 175 21063 919 ----
NM_001004356chr411516 ------
NM_001004358chr411516 ------
NM_001004360chr241481 1429 368 171 31724 1364 416 ----
NM_001004419chr1254479 3446 1369 1131 306 --21269 152 --
NM_001005217chr461182 1159 936 314 188 54 1852 ----
NM_001005242chr122591 164 11318 21538 1224 --
NM_001005375chrY4564 547 175 84 ------
NM_001005386chr232057 1984 1739 42460 2255 2202 184 ----
NM_001005404chr1764497 4149 3830 3517 3476 3333 --24300 4065 --
NM_001005463chr1042645 2388 1643 952 ----12157
NM_001005473chr5166580 6508 6426 6278 5953 5456 5151 5064 4572 4365 2470 1297 1267 547 216 98 25263 2147 25096 4388 26039 2505
NM_001005474chr351163 1155 1001 500 238 --1225 --
NM_001005502chr1214838 25221 3264 35211 5143 3324 14150
NM_001005527chr351147 901 886 844 283 1988 ----
NM_001005609chrX93168 2923 2828 2772 2643 1372 935 897 305 --13197 --
NM_001005732chr211171 ------
NM_001005733chr211171 ------
NM_001005746chr281311 1132 526 437 405 382 359 281 11451 1173 1919
NM_001005747chr281311 1132 526 437 405 382 359 281 11451 1173 1919
NM_001005845chr841600 1498 1279 753 21300 1190 1590 --
NM_001006600chr572442 2213 1579 1571 880 712 579 21950 910 ----
NM_001006623chr242522 1647 911 204 ------
NM_001006944chr111169 ------
NM_001006945chr11182 ------
NM_001007024chr1763909 3834 3340 3183 1529 642 34432 4413 3221 ----
NM_001007025chr1763909 3834 3340 3183 1529 642 34432 4413 3221 ----
NM_001007026chr121455 ------
NM_001007027chr11199 ------
NM_001007075chr42738 50 1724 ----
NM_001007097chr964467 4440 4250 1518 1481 1219 1454 13918 14092
NM_001007102chr631628 262 239 1423 11574 --
NM_001007237chr142135 641 456 399 ------
NM_001007245chr71234 1136 ----
NM_001007246chr2141703 1508 1428 145 21909 473 1226 --
NM_001007257chr141303 1011 970 92 11110 --11506
NM_001007278chr1395124 4546 4483 3219 1855 918 388 171 128 54523 4502 3971 1711 288 35268 4652 2042 --
NM_001007466chr634109 3628 1078 43399 3345 2083 1744 13437 --
NM_001007565chr3--199 ----
NM_001007794chr14754 496 172 94 2744 673 ----
NM_001008225chr71194 ------
NM_001008239chr1873578 2969 1468 1169 352 243 206 ----11108
NM_001008391chr112645 267 --1229 1664
NM_001008405chr761746 1632 1370 1290 728 438 11226 21639 491 --
NM_001008491chr251786 1613 1287 613 315 21938 1510 --1145
NM_001008492chr251786 1613 1287 613 315 21938 1510 --1145
NM_001008495chr832164 1461 400 --11747 --
NM_001008539chr865335 4974 3882 3575 1976 126 35273 1964 1244 13859 11259
NM_001008541chr10--11489 ----
NM_001008541chr10--11489 ----
NM_001008564chr1332264 1650 134 12103 156 1186
NM_001008708chr21486 ------
NM_001008723chr105510 482 379 69 45 ----1448
NM_001008744chr1451331 612 571 327 58 2380 26 ----
NM_001008779chr22309 80 ------
NM_001008895chr1321219 1132 11420 ----
NM_001008897chr61529 ------
NM_001008925chr483548 3304 3021 2959 2668 676 639 164 33455 2447 2321 ----
NM_001009554chr494624 3638 3632 3614 3474 3109 3100 1499 171 --24348 3551 --
NM_001009554chr494624 3638 3632 3614 3474 3109 3100 1499 171 --24348 3551 --
NM_001009555chr441772 1221 1162 132 1661 ----
NM_001009881chr11439 ------
NM_001009882chr11439 ------
NM_001009894chr1251725 1633 1233 423 129 4641 328 286 272 1485 --
NM_001009899chr3115632 5132 4924 4248 3992 2037 1353 1111 957 861 613 36094 5701 4093 12023 --
NM_001009931chr1123 140 ----
NM_001009959chr262561 2525 2423 2234 1044 595 22608 1685 1285 --
NM_001009960chr742246 725 586 223 12661 1486 12630
NM_001009993chr284425 2905 1436 1430 1417 461 330 266 14487 ----
NM_001009994chr6187 ------
NM_001010000chr1852990 2875 2428 2306 258 32462 1164 906 21317 1293 --
NM_001010846chr164357 4351 3169 1407 1078 112 34551 4301 1785 13181 --
NM_001010861chr142639 2525 2441 1906 32807 932 898 12697 --
NM_001010862chrX83293 2781 2534 2355 2091 2046 1173 43 52385 2130 1221 435 210 12593 --
NM_001010867chr195723 5371 5165 4180 2409 2006 1923 1226 1061 ----15087
NM_001010870chr64481 437 418 406 ------
NM_001010888chrX84030 3938 2925 2835 1627 896 768 437 33530 3032 1095 13098 --
NM_001010891chr5136581 6235 5946 5207 5105 5061 1944 1768 1612 1409 376 367 353 51993 1923 1882 1606 569 26886 4305 26065 4608
NM_001010908chr102634 569 1294 ----
NM_001010923chr651542 1439 398 219 199 ------
NM_001010932chr72403 320 ----176
NM_001010934chr731072 300 214 1821 ----
NM_001010971chr13724 110 52 ----1341
NM_001010984chr162476 2312 2207 1860 1683 798 ------
NM_001011513chr473715 3423 2852 2600 481 371 32 1325 13807 23617 300
NM_001011537chr342339 1652 492 331 22032 1583 1848 --
NM_001011553chr72676 640 ------
NM_001011657chrX31181 1116 896 31061 447 149 2282 264 --
NM_001011663chr1051076 1056 995 783 242 ------
NM_001011666chr7115769 5039 4664 4640 4634 4054 4048 1801 1495 1356 336 35328 5253 2347 45676 4120 4040 1984 --
NM_001011708chr282825 2558 2107 739 635 575 507 111 --1356 --
NM_001011713chr1431643 1336 995 --11403 --
NM_001011885chr152248 207 ------
NM_001012267chr911466 ------
NM_001012393chr11145113 4968 4945 4439 4104 3823 3654 1518 1489 1150 993 920 901 59 23343 1984 ----
NM_001012398chr164954 943 770 445 ------
NM_001012420chr1552841 2831 2460 2179 133 32537 2109 433 ----
NM_001012423chr1552841 2831 2460 2179 133 32537 2109 433 ----
NM_001012478chr192616 412 ------
NM_001012751chr1051878 1780 566 470 192 1387 ----
NM_001012754chr1391968 1811 1577 1390 639 511 335 146 109 --187 --
NM_001012968chrX32375 2182 33 32802 2584 2524 ----
NM_001013399chr63762 405 394 11072 ----
NM_001013406chr71610 --21721 444 --
NM_001013620chr12137867 7597 3399 3181 2736 2648 2614 2592 2163 1362 1080 344 89 21488 830 12382 48069 5732 5397 3339
NM_001013635chr122447 397 ------
NM_001013659chr19115159 4577 4538 4221 3854 3450 1935 1505 386 62 35 24035 762 21687 352 --
NM_001013703chr151476 185 ----
NM_001013843chr152758 35 1128 ----
NM_001014380chr13145893 5000 4882 4771 4198 3904 2271 2193 1351 788 537 519 256 87 35770 1221 130 45145 3850 500 478 --
NM_001014443chr11265 ------
NM_001014764chr171132 ------
NM_001014797chr1098249 8138 7544 6923 6880 6506 2368 2289 2011 45347 2439 1265 462 14965 --
NM_001014812chr15--1452 ----
NM_001015877chrX42844 2734 2660 1929 --12819 --
NM_001015880chr1021725 595 ------
NM_001015882chr92300 205 1147 ----
NM_001017371chr221097 427 21335 287 1219 1267
NM_001017395chr363611 1350 1304 518 470 285 23332 308 1116 --
NM_001017415chr13776 574 77 2743 708 ----
NM_001017416chr13776 574 77 2743 708 ----
NM_001017423chr10126 ------
NM_001017424chr131879 1686 154 31739 1733 1356 ----
NM_001017425chr131879 1686 154 31739 1733 1356 ----
NM_001017440chr788218 8059 6105 5288 5104 2560 1307 1254 15069 25559 3272 18234
NM_001017923chr1451437 1118 497 473 166 1402 ----
NM_001017926chr82295 66 21247 244 ----
NM_001017930chrX41313 1201 298 71 21490 930 ----
NM_001017979chr41725 ------
NM_001017995chr553288 3036 1474 806 76 ----13237
NM_001017999chr142066 1473 801 285 12332 ----
NM_001017999chr142066 1473 801 285 12332 ----
NM_001018000chr142066 1473 801 285 12332 ----
NM_001018000chr142066 1473 801 285 12332 ----
NM_001018001chr142066 1473 801 285 12332 ----
NM_001018054chr131434 541 139 ------
NM_001018056chr92492 237 ------
NM_001018064chr941815 1730 616 322 11719 ----
NM_001018065chr986020 5365 5051 4663 3935 3870 3763 383 ----15384
NM_001018066chr986020 5365 5051 4663 3935 3870 3763 383 ----15384
NM_001018067chr174982 4448 1760 1673 1398 1097 139 35240 3617 768 14668 --
NM_001018068chr174982 4448 1760 1673 1398 1097 139 35240 3617 768 14668 --
NM_001018069chr174982 4448 1760 1673 1398 1097 139 35240 3617 768 14668 --
NM_001018074chr563947 3745 3603 1574 1320 229 32525 1492 906 ----
NM_001018075chr563947 3745 3603 1574 1320 229 32525 1492 906 ----
NM_001018076chr563947 3745 3603 1574 1320 229 32525 1492 906 ----
NM_001018077chr563947 3745 3603 1574 1320 229 32525 1492 906 ----
NM_001018080chr1121199 1084 1932 ----
NM_001018089chr1583737 3190 2922 2503 1146 807 207 56 23463 28 ----
NM_001018100chr152742 715 1735 ----
NM_001023567chr1532455 2223 133 --11922 --
NM_001024094chr563947 3745 3603 1574 1320 229 32525 1492 906 ----
NM_001024218chr14------1147
NM_001024226chr111035 ------
NM_001024227chr111035 ------
NM_001024228chr111035 ------
NM_001024647chr12127197 7138 6234 5961 5036 4899 4735 2067 1806 1099 230 160 26228 1112 27035 6686 --
NM_001024660chr31578 --11583 --
NM_001024808chr1232761 1999 807 ----12439
NM_001024947chr52892 855 ------
NM_001024948chr1153082 3010 2807 2738 2572 2543 2522 2348 2189 697 575 487 443 368 288 ------
NM_001024956chr1165673 5461 5358 4615 4124 1373 25281 1339 34026 3687 778 1668
NM_001025068chr341685 1213 1128 77 2427 421 134 1321
NM_001025069chr341685 1213 1128 77 2427 421 134 1321
NM_001025076chr10106014 5382 4471 2078 1822 1397 891 823 281 184 11624 14291 14856
NM_001025077chr10117372 6740 5829 5018 4746 2755 2249 2181 1639 1542 267 22982 777 15649 26214 355
NM_001025079chr3114128 3866 3212 3176 3032 1663 997 927 540 209 186 14051 ----
NM_001025105chr531466 997 67 ------
NM_001025108chr244113 4025 3957 934 33536 3508 3200 14148 --
NM_001025201chr21695 162 ----
NM_001025356chr1272748 2634 2568 1904 1097 252 107 1459 22497 36 --
NM_001025366chr6--11276 --11912
NM_001025366chr6--11276 --11912
NM_001025367chr6--11276 --11912
NM_001025367chr6--11276 --11912
NM_001025368chr6--11276 --11912
NM_001025368chr6--11276 --11912
NM_001025369chr6--11292 --11928
NM_001025369chr6--11292 --11928
NM_001025370chr6--11276 --11912
NM_001025370chr6--11276 --11912
NM_001025580chrX41253 1159 925 278 11075 33950 3897 865 --
NM_001025780chr961260 623 547 331 230 212 21439 423 ----
NM_001029835chr7--1396 ----
NM_001029860chr81234 ------
NM_001029875chr582319 2071 1195 598 467 430 394 231 32882 2448 829 --21933 569
NM_001029989chr154143 109 97 40 ------
NM_001030007chr1611321 13903 ----
NM_001030055chr14114086 3975 3637 3612 3324 3280 1762 962 780 431 48 64409 3955 1378 976 805 169 43656 2958 1851 993 12908
NM_001031623chr641751 1223 1196 1150 2646 145 21312 270 --
NM_001031695chr2254869 4528 3347 1211 559 --21096 904 --
NM_001031700chr482531 2443 2074 2018 1785 863 687 646 11611 ----
NM_001031710chr73682 271 258 ------
NM_001031712chr63434 279 38 --1356 --
NM_001031725chr12123 86 1114 ----
NM_001031732chr4113117 3092 2964 2628 2350 1392 1290 1251 866 340 83 --11024 --
NM_001031804chr1634158 1499 1362 54130 1480 1356 844 285 13870 --
NM_001031812chr541572 643 406 364 1188 ----
NM_001032279chr111107 ------
NM_001032293chr172586 207 1519 ----
NM_001032730chr11677 ------
NM_001032999chr2045269 2130 1919 1679 --15230 11832
NM_001033045chr263634 2990 2861 1701 1578 1114 43908 3539 1650 310 33683 885 552 --
NM_001033057chr311618 --21606 380 --
NM_001033059chr642057 1602 1283 440 11956 1792 --
NM_001033506chr111371 ------
NM_001033559chr151365 ------
NM_001033566chr172773 683 1910 ----
NM_001033568chr172773 683 1910 ----
NM_001033578chr852410 2376 2164 197 40 22366 234 ----
NM_001033602chr132398 283 ------
NM_001033659chr1731599 1409 1070 11376 11613 --
NM_001033756chr6--11210 --11846
NM_001033756chr6--11210 --11846
NM_001033925chr1011945 ------
NM_001034845chr441452 977 253 188 ------
NM_001034954chr1042910 2285 2012 1021 23118 291 --11078
NM_001034955chr1042910 2285 2012 1021 23118 291 --11078
NM_001034956chr1042910 2285 2012 1021 23118 291 --11078
NM_001034957chr1042910 2285 2012 1021 23118 291 --11078
NM_001035260chr1031667 1541 46 ------
NM_001037132chr742154 2059 1539 1421 11845 ----
NM_001037133chr742154 2059 1539 1421 11845 ----
NM_001037164chr731872 1649 284 1563 ----
NM_001037317chr142639 2525 2441 1906 32807 932 898 12697 --
NM_001037332chr552405 2353 2046 1614 1590 --12421 --
NM_001037333chr552405 2353 2046 1614 1590 --12421 --
NM_001037334chr1842379 2125 2040 1679 22102 1665 11941 11928
NM_001037535chrX41238 1047 162 21 --1389 1418
NM_001037536chrX41238 1047 162 21 --1389 1418
NM_001037540chrX41238 1047 162 21 --1389 1418
NM_001037954chr1143065 1254 1015 625 13507 13285 --
NM_001039091chrX2517 489 ------
NM_001039111chr3188 ------
NM_001039348chr22891 698 1869 ----
NM_001039349chr22891 698 1869 ----
NM_001039585chr1114084 3519 3412 3057 2875 2768 2571 1645 1477 278 121 13532 11700 --
NM_001039590chrX123910 3846 3826 3779 3479 3258 2555 1455 1015 899 806 311 12763 ----
NM_001039591chrX123910 3846 3826 3779 3479 3258 2555 1455 1015 899 806 311 12763 ----
NM_001039618chr1195635 4995 4806 3985 3847 1100 1026 826 127 55411 5132 4584 1957 416 22081 1225 --
NM_001039709chr2045269 2130 1919 1679 --15230 11832
NM_001039762chr1062088 2031 1578 1510 633 21 21716 238 --1837
NM_001039840chrX166091 5963 5676 5665 5370 5325 5042 4630 4370 4141 4118 2031 1897 1564 1326 746 26074 3968 25713 4340 --
NM_001039844chr1072782 2449 2366 2209 977 669 21 12062 ----
NM_001039916chr121979 11152 ----
NM_001039917chr121979 11152 ----
NM_001039918chr121979 11152 ----
NM_001039919chr121979 11152 ----
NM_001039920chr121979 11152 ----
NM_001039937chr1393618 3550 3184 3008 2598 1477 684 595 129 23248 226 --11537
NM_001040057chr741157 947 380 98 --1327 --
NM_001040100chr31259 --1267 --
NM_001040142chr222297 1508 2701 285 1413 --
NM_001040143chr222297 1508 2701 285 1413 --
NM_001040152chr7114185 4128 4048 3920 3834 3761 3464 1189 1173 872 408 34891 4083 1411 ----
NM_001040153chr133707 342 236 ------
NM_001040158chr52562 448 --1530 --
NM_001040159chr431527 1429 230 21452 375 --1589
NM_001040181chr34264 221 176 123 1894 ----
NM_001040182chr34264 221 176 123 1894 ----
NM_001040183chr34264 221 176 123 1894 ----
NM_001040199chr34264 221 176 123 1894 ----
NM_001040200chr34264 221 176 123 1894 ----
NM_001040284chr1685942 5382 5220 4273 2294 2276 2101 1909 1628 35710 3667 1255 --
NM_001040402chr452559 1954 934 855 227 22753 2043 ----
NM_001040409chr231050 214 86 ----1980
NM_001040429chr1363027 2648 2400 1289 1265 317 23538 2564 23521 3292 --
NM_001040441chr1104174 3616 2161 2087 1420 1248 740 461 95 40 43901 3852 2014 1503 33421 315 82 --
NM_001040450chr1541781 744 736 613 31025 440 390 32655 2515 1763 --
NM_001040453chr1541781 744 736 613 31025 440 390 32655 2515 1763 --
NM_001040610chr15------142
NM_001040665chr7164621 4314 4118 3968 3944 3701 3169 1956 1905 1553 1422 1187 842 347 219 192 13382 13128 --
NM_001040876chr4156 ----11414
NM_001042355chr16105065 3809 3784 3761 3266 2082 1930 1293 852 537 34291 4195 235 1453 11731
NM_001042388chr183876 863 695 ------
NM_001042404chr121539 1341 --11831 1269
NM_001042410chr21180 ------
NM_001042412chr16105065 3809 3784 3761 3266 2082 1930 1293 852 537 34291 4195 235 1453 11731
NM_001042413chr963491 3324 2921 2568 1268 1218 13237 1252 --
NM_001042453chrX51719 1629 1378 1246 106 31289 709 491 ----
NM_001042473chr1041654 1598 441 378 --21817 1749 --
NM_001042492chr1773514 2646 2483 2385 2347 1389 1294 1177 ----
NM_001042493chr641882 1802 1671 585 --11447 --
NM_001042494chr1553758 3662 3288 2380 372 --1444 --
NM_001042495chr1553758 3662 3288 2380 372 --1444 --
NM_001042496chr1553758 3662 3288 2380 372 --1444 --
NM_001042497chr1553758 3662 3288 2380 372 --1444 --
NM_001042533chr342486 1142 1096 610 ----1719
NM_001042555chr1263927 1834 1627 1448 1407 1312 2906 753 24505 1603 --
NM_001042573chr1722034 652 ------
NM_001042599chr2156941 6901 6481 5991 5804 5777 5581 5232 4775 3073 2615 2561 2048 1685 1385 57862 6268 2510 1177 592 27839 6389 22302 754
NM_001042601chr352995 2714 2672 1145 541 --12684 11200
NM_001042603chr1285316 4214 4014 3562 1895 1707 557 415 1681 --15015
NM_001042604chr374592 4287 3586 1777 1580 760 235 13025 11136 --
NM_001042616chr4----181 --
NM_001042683chr641481 353 195 122 11680 ----
NM_001042749chrX32005 1963 22 2490 317 ----
NM_001042750chrX32005 1963 22 2490 317 ----
NM_001042751chrX32005 1963 22 2490 317 ----
NM_001044385chr293802 3079 1295 1228 1160 681 620 500 369 13255 ----
NM_001044722chr541572 643 406 364 1188 ----
NM_001044723chr541572 643 406 364 1188 ----
NM_001046chr561976 1207 952 903 846 840 32871 1124 859 ----
NM_001048183chr1103804 3732 3514 3290 2615 662 605 481 166 117 13054 13170 --
NM_001049chr1452439 2393 2127 2112 1749 1585 --21812 1717
NM_001068chr3--1303 ----
NM_001071775chr1361604 1506 1291 572 529 498 ------
NM_001076chr42440 139 1355 ----
NM_001076chr42440 139 1355 ----
NM_001077628chr11722 ------
NM_001083620chr452514 2390 1802 401 93 22571 749 ----
NM_001100108chr197533 7299 6554 5981 5158 2740 1720 419 407 38232 3093 2509 --11475
NM_001106chr3159755 9577 8589 7918 7111 7096 6652 6022 3445 3035 2590 1468 1314 1090 38 18705 36448 3153 363 28677 575
NM_001113490chrX62687 1364 1009 981 697 175 12249 1249 --
NM_001116chr1642920 2389 2227 280 13121 --22989 525
NM_001121chr103542 343 202 11338 1477 --
NM_001122679chr511292 21175 1116 ----
NM_001123chr104677 165 130 123 2598 185 ----
NM_001126chr121043 824 ------
NM_001128chr1611321 13903 ----
NM_001144chr1611318 1159 ----
NM_001146chr842280 1529 505 184 12228 1159 --
NM_001149chr103401 200 185 ------
NM_001160chr124808 599 547 323 11799 --12822
NM_001165chr11140 1609 ----
NM_001167chrX166718 6522 5700 5378 4657 4569 4429 2715 2407 2303 2288 1878 1842 897 862 165 56580 5526 2557 2317 2167 --16364
NM_001172chr141485 1233 ----
NM_001173chr14114086 3975 3637 3612 3324 3280 1762 962 780 431 48 64409 3955 1378 976 805 169 43656 2958 1851 993 12908
NM_001186chr2153208 2538 2239 543 131 1336 22959 857 --
NM_001198chr672203 1933 1591 1518 717 381 369 ------
NM_001201chr473927 3729 3316 3099 2557 1335 1120 11027 --1899
NM_001204chr2166835 6564 6172 6125 6106 5995 5919 5579 3109 2709 2539 2017 1108 990 643 164 26729 2761 15960 --
NM_001206chr962670 2342 1013 882 692 380 22756 2273 1699 --
NM_001219chr742211 2062 460 37 21931 1717 ----
NM_001237chr411067 2451 284 1893 1960
NM_001237chr411067 2451 284 1893 1960
NM_001241chr262382 2294 2247 2133 2045 176 2697 142 11532 --
NM_001241chr262382 2294 2247 2133 2045 176 2697 142 11532 --
NM_001253chr6193 1267 ----
NM_001254chr172135 128 --1766 --
NM_001256chr1772778 2711 1994 664 657 225 77 --21974 944 --
NM_001261chr91452 ------
NM_001269chr12967 179 ------
NM_001278chr1041146 932 805 438 21066 912 1211 --
NM_001289chrX31315 1283 160 ------
NM_001290chr42372 314 --1726 --
NM_001304chr1753837 3782 3633 747 148 43794 2424 253 208 --12836
NM_001310chr1292635 2178 1074 1024 822 339 198 168 126 33098 2865 991 ----
NM_001315chr641979 1748 1651 1506 ------
NM_001326chr111170 ------
NM_001331chr1132747 2393 349 --12814 --
NM_001332chr5191 ------
NM_001343chr531724 1637 507 11190 1202 1560
NM_001351chr351544 1481 449 347 87 ----11469
NM_001356chrX31705 1594 397 ------
NM_001364chr1154267 1820 706 570 427 11068 ----
NM_001365chr172769 641 ------
NM_001389chr21--1562 --1385
NM_001390chr1843148 3019 2905 595 --2855 785 --
NM_001396chr2132540 1907 1863 12682 ----
NM_001399chrX93168 2923 2828 2772 2643 1372 935 897 305 --13197 --
NM_001408chr11295 11530 --1285
NM_001412chrX33287 1418 634 22544 1470 --1352
NM_001419chr1954203 3200 1467 1213 983 3722 399 249 11343 13793
NM_001420chr1943197 2429 2268 633 --12100 --
NM_001427chr7--21856 55 11410 --
NM_001429chr222782 83 ------
NM_001430chr22729 277 11690 ----
NM_001431chr61428 --1101 --
NM_001438chr132545 1154 126 33373 3234 2238 --11101
NM_001451chr1611060 ------
NM_001453chr621483 512 ------
NM_001460chr153327 2892 2658 2524 2274 21253 557 21273 1116 --
NM_001483chr73375 337 148 ------
NM_001497chr95854 822 762 350 68 1440 ----
NM_001514chr12411 214 ------
NM_001542chr142135 641 456 399 ------
NM_001550chr71234 1136 ----
NM_001553chr41177 ------
NM_001584chr1151186 1160 911 482 207 ------
NM_001604chr11------1397
NM_001609chr1043959 3163 2915 785 22981 800 23490 1313 --
NM_001614chr171580 ------
NM_001614chr171580 ------
NM_001616chr242959 2714 1409 283 22950 934 --12925
NM_001619chr113399 47 34 ------
NM_001621chr732822 983 769 32384 1932 821 ----
NM_001621chr732822 983 769 32384 1932 821 ----
NM_001634chr642057 1602 1283 440 11956 1792 --
NM_001650chr1893877 3814 3426 3328 2836 2790 1396 907 157 53747 2940 864 200 135 ----
NM_001654chrX1316 ------
NM_001656chr571992 1924 1907 1351 723 132 96 1803 1730 --
NM_001658chr111035 ------
NM_001663chr1442678 2563 370 107 11025 12621 --
NM_001664chr32264 99 ------
NM_001668chr121631 199 12307 12012 --
NM_001681chr123776 670 216 ------
NM_001682chr1222482 612 --1855 --
NM_001684chr173985 3795 3754 3017 2823 2783 1000 24082 3301 1245 --
NM_001690chr362600 2472 2204 1608 370 70 ------
NM_001695chr873565 2694 1596 967 878 807 759 ----14285
NM_001709chr1132892 2163 153 12369 ----
NM_001714chr121548 --1536 1481
NM_001718chr621124 1076 ------
NM_001721chrX193 ------
NM_001730chr1331583 1101 1028 11274 1196 --
NM_001730chr1331583 1101 1028 11274 1196 --
NM_001731chr123365 335 320 --1589 193
NM_001742chr771498 1285 622 428 198 186 128 21142 145 ----
NM_001753chr741712 1346 201 97 ------
NM_001754chr2173420 3187 3034 1134 1071 425 148 11338 11314 --
NM_001755chr1652296 2173 1758 1439 541 1360 ----
NM_001761chr161686 ------
NM_001769chr121335 ------
NM_001777chr3114128 3866 3212 3176 3032 1663 997 927 540 209 186 14051 ----
NM_001786chr10------1172
NM_001788chr72676 640 ------
NM_001789chr331304 1175 436 1572 ----
NM_001794chr201252 ------
NM_001798chr1221122 724 ------
NM_001806chr1952647 2466 2321 1108 424 --22020 1820 --
NM_001821chr1104813 4319 3868 3765 3065 1967 665 459 234 53 13377 11836 14230
NM_001822chr21695 162 ----
NM_001827chr9--138 ----
NM_001842chr91574 ------
NM_001845chr132430 134 ------
NM_001854chr161464 1404 1289 1036 995 270 21271 1212 ----
NM_001858chr6154715 4378 4279 4009 3824 3554 1988 1979 1939 1867 1340 581 514 423 383 44633 4623 1893 1558 13317 --
NM_001874chr1214838 25221 3264 35211 5143 3324 14150
NM_001884chr51493 1207 ----
NM_001892chr531466 997 67 ------
NM_001894chr2221192 1077 11150 ----
NM_001902chr1--1368 --1362
NM_001903chr55855 785 346 144 74 ------
NM_001914chr181373 ------
NM_001931chr112157 119 1374 2851 473 --
NM_001938chr151682 479 393 345 226 1198 ----
NM_001940chr121455 ------
NM_001941chr1893897 3652 3592 2886 2815 2713 1138 1078 134 12743 1742 --
NM_001942chr1841961 1574 1467 238 1403 11716 --
NM_001949chr642999 2675 2233 158 32188 962 868 ----
NM_001955chr63973 929 743 ------
NM_001963chr44774 703 675 544 ------
NM_001969chr1453928 3369 2791 478 130 11333 ----
NM_001977chr451647 1295 1240 309 72 31259 1102 637 136 --
NM_001978chr81842 ------
NM_001981chr132200 798 686 ------
NM_001987chr1274149 4068 3600 2906 2708 710 258 13200 ----
NM_001999chr521090 165 ------
NM_002006chr4145701 5633 5580 4867 4530 4404 3978 3821 3670 3650 2264 1912 676 404 25591 5139 --1435
NM_002009chr1572643 2414 2308 1086 820 518 300 22093 587 12482 --
NM_002010chr131596 ------
NM_002014chr122267 87 ------
NM_002024chrX31858 1411 139 12221 ----
NM_002025chrX128969 7654 7619 7607 7601 5720 3329 2673 1973 1068 994 501 28654 2426 35648 3067 455 28151 5744
NM_002033chr1183490 3188 3055 3044 2546 1487 1228 335 33913 2861 1004 1771 13428
NM_002040chr21132920 2713 2435 2401 1944 632 514 444 208 161 155 86 80 22947 2613 12448 22517 699
NM_002044chr1541561 1513 1340 578 11539 11551 --
NM_002054chr2--183 ----
NM_002063chrX11088 ------
NM_002076chr1283281 3150 2578 2259 1235 1170 1131 326 ----1975
NM_002077chr962052 1932 1715 1631 1597 1341 ------
NM_002092chr4114760 4628 4552 4141 3480 3422 3371 1895 1387 555 247 ----1846
NM_002094chr161312 ------
NM_002104chr51198 ------
NM_002107chr11200 ------
NM_002126chr1764177 2724 2526 916 803 430 22710 1372 ----
NM_002128chr1342306 2176 1964 737 42554 2091 1868 255 ----
NM_002136chr12----1442 --
NM_002140chr91489 ------
NM_002148chr21256 --1554 --
NM_002155chr12274 200 ------
NM_002158chr241091 910 872 375 13097 ----
NM_002166chr22734 66 ------
NM_002182chr392771 2433 2357 2154 1795 638 629 262 130 11830 12001 1350
NM_002187chr541127 806 261 195 ----1380
NM_002188chr51683 ------
NM_002193chr2--21847 1347 ----
NM_002203chr583400 3047 1443 1370 1209 1112 893 511 13656 ----
NM_002210chr273230 3203 3149 2782 970 612 532 12945 13493 12531
NM_002214chr795103 4848 3873 3683 3460 1908 1620 1401 425 55757 5375 4248 4066 3719 12012 23621 1964
NM_002223chr12104012 3894 2886 2524 1593 1500 1359 1154 391 157 ------
NM_002232chr11360 11300 --1494
NM_002239chr231165 895 887 1912 1990 187
NM_002264chr354790 4405 1323 788 410 54018 3791 3671 3212 863 13328 14781
NM_002266chr171202 ------
NM_002268chr371872 1431 1396 1377 1279 526 128 ------
NM_002270chr5115561 5344 5308 4949 4871 4158 3881 1879 1121 299 290 105495 5396 4417 4245 4108 4102 1276 908 608 469 12061 --
NM_002271chr1342271 2173 1724 415 42377 1652 733 319 ----
NM_002285chr244113 4025 3957 934 33536 3508 3200 14148 --
NM_002293chr132625 2445 1889 22785 734 ----
NM_002310chr566485 5158 4340 1607 1059 782 1170 26431 4733 --
NM_002313chr1044827 4022 1780 92 --21987 1659 21883 1620
NM_002334chr1142102 1867 1573 579 12092 1210 --
NM_002336chr12134782 4265 4221 4085 3748 3282 2000 1851 1762 1513 1197 818 712 44170 3176 1460 1012 --23932 1329
NM_002345chr123494 231 98 1108 ----
NM_002351chrX--2623 41 --11529
NM_002356chr632776 2326 357 12011 12532 --
NM_002372chr51689 ------
NM_002376chr141526 ------
NM_002380chr82799 182 --1221 --
NM_002382chr1421002 245 ----2860 436
NM_002384chr182945 335 ----1856
NM_002392chr12171 --155 --
NM_002395chr651215 1115 993 380 72 1124 1413 --
NM_002397chr531922 1419 641 11810 11513 --
NM_002399chr1511375 ------
NM_002401chr1732137 2019 1532 ------
NM_002431chr141325 ------
NM_002440chr1----150 --
NM_002449chr51340 ------
NM_002451chr973929 3911 3748 3652 3486 2514 852 1584 --2977 887
NM_002463chr21------1682
NM_002478chr113621 551 461 ------
NM_002480chr1231521 525 142 ------
NM_002500chr231281 461 265 21062 1050 1337 1959
NM_002506chr11104 ------
NM_002514chr841083 890 387 294 1274 ----
NM_002515chr1431696 1591 188 1495 ----
NM_002523chr751217 1136 1082 1048 128 ------
NM_002543chr1221071 1061 ----156
NM_002544chr171269 ------
NM_002545chr11145113 4968 4945 4439 4104 3823 3654 1518 1489 1150 993 920 901 59 23343 1984 ----
NM_002556chr1122058 1836 11406 1423 --
NM_002568chr81276 1298 ----
NM_002577chr353341 3158 2678 2511 1039 23978 2861 11305 23361 1051
NM_002578chrX1171 ------
NM_002581chr9105606 5487 5460 4934 4693 4217 1852 1747 1551 1311 25283 716 --15385
NM_002583chr121626 1588 ----
NM_002590chr131413 ------
NM_002594chr2022161 1688 31568 934 124 1513 --
NM_002601chr2130 ------
NM_002606chr211173 ------
NM_002607chr7--1916 ----
NM_002613chr1675375 4666 4243 3738 3707 1927 1905 15306 15314 --
NM_002641chrX41450 1337 209 105 11719 11922 1462
NM_002645chr1132237 2166 203 32506 2315 2089 12750 --
NM_002655chr8104952 4935 4139 4065 1784 1258 1135 916 881 385 ----24775 3647
NM_002656chr65998 838 401 392 173 1205 --2791 300
NM_002670chr361595 1426 1396 1235 1025 191 21324 615 ----
NM_002698chr191965 ------
NM_002699chr111321 ----11407
NM_002702chr12--1812 1778 --
NM_002709chr283584 3468 3070 2782 2380 2219 579 141 22436 2205 ----
NM_002715chr51948 2497 333 ----
NM_002718chr362431 2267 2051 713 662 277 11771 ----
NM_002721chr91153 ------
NM_002726chr61150 ------
NM_002731chr153097 2531 2364 2087 536 --12170 --
NM_002734chr1762017 1700 1621 865 837 616 32312 2063 1548 12155 --
NM_002737chr1724309 1247 --21285 652 26294 537
NM_002740chr352789 2738 2617 2300 216 22280 1117 ----
NM_002747chr1811915 11619 ----
NM_002748chr1571173 1100 906 883 837 470 324 ------
NM_002763chr1--1451 ----
NM_002765chrX2517 489 ------
NM_002798chr17--154 ----
NM_002822chr1221780 1538 21132 723 11302 --
NM_002823chr22665 184 ----182
NM_002830chr21258 ------
NM_002837chr12124457 4291 4067 4019 2814 1815 1737 1593 1325 465 124 116 21056 153 --14133
NM_002843chr1151277 1070 836 583 565 --32921 1167 429 --
NM_002851chr76523 289 220 188 146 75 ------
NM_002852chr3--2636 561 ----
NM_002860chr10126 ------
NM_002873chr51507 ------
NM_002874chr942313 2260 2111 379 1444 2396 141 --
NM_002886chr385043 4263 3597 3237 1246 1194 801 769 34997 4391 674 11110 24741 1735
NM_002892chr1421493 295 --11216 --
NM_002906chr1142185 2131 1774 1656 3629 623 142 ----
NM_002930chr18137 ------
NM_002940chr4156 ----11414
NM_002942chr321035 92 11392 ----
NM_002956chr1251315 1009 922 218 124 --11155 --
NM_002967chr191126 ------
NM_002973chr12184 1572 ----
NM_002977chr263373 1336 579 553 379 78 13463 ----
NM_002994chr431623 615 515 ------
NM_002998chr831810 504 385 1187 ----
NM_003002chr113746 691 298 ----1151
NM_003010chr1752460 1793 779 743 61 12038 31938 625 494 --
NM_003017chr62251 132 1332 ----
NM_003034chr1277400 7307 5549 5150 2294 2142 277 57710 7543 2902 1805 865 35064 734 678 27994 1910
NM_003040chr7--1108 ----
NM_003046chr865335 4974 3882 3575 1976 126 35273 1964 1244 13859 11259
NM_003048chr282754 2687 2376 2071 981 957 933 923 42529 2280 2263 1882 1659 --
NM_003051chr141738 1694 176 76 32018 413 406 ----
NM_003071chr331686 1432 85 32069 1892 1883 ----
NM_003079chr171208 --2306 246 1767
NM_003081chr2041018 780 410 300 ------
NM_003087chr101233 ------
NM_003094chr13936 734 156 ------
NM_003095chr121269 ------
NM_003106chr32915 806 ------
NM_003108chr2116600 6422 6407 5987 5845 5801 5625 5075 4884 4836 2119 37191 1440 619 --26146 4862
NM_003111chr221097 427 21335 287 1219 1267
NM_003112chr7103156 2966 2729 2506 2099 1148 395 272 164 60 22109 571 22628 2519 --
NM_003114chr85873 531 351 252 169 ------
NM_003130chr731251 974 198 21189 278 ----
NM_003133chr121060 342 ------
NM_003139chr111951 ------
NM_003144chr672291 2233 835 614 606 219 136 --21916 1742 --
NM_003161chr1742389 1340 1291 508 13150 23179 777 126
NM_003162chr2--1352 2934 209 --
NM_003171chr10151 ------
NM_003183chr21568 --3686 677 200 --
NM_003184chr841088 989 800 405 ----1177
NM_003194chr61443 ------
NM_003199chr1865290 3571 2070 1622 669 611 35016 3992 398 ----
NM_003204chr1721757 1173 ------
NM_003221chr684120 3930 3663 1266 1160 1058 852 544 34189 4003 64 24059 1197 --
NM_003246chr1532090 1815 1551 ------
NM_003253chr2141405 742 666 488 21197 351 ----
NM_003257chr1521381 1305 153 ----
NM_003262chr385228 4833 4792 4432 3354 740 287 105 24037 1089 13192 --
NM_003269chr6------11341
NM_003270chrX31033 881 397 ------
NM_003274chr2132368 2288 2011 42441 1963 1028 762 ----
NM_003286chr2031018 280 243 ----2748 460
NM_003298chr376117 6079 5389 4956 4942 4427 4292 15553 ----
NM_003299chr122165 50 ------
NM_003300chr14----1415 --
NM_003304chr31493 21035 576 1557 --
NM_003315chr171231 ------
NM_003337chr52298 48 11087 ----
NM_003338chr1081815 1735 1246 1240 746 378 276 44 1589 --11262
NM_003340chr421154 251 --1520 --
NM_003342chr1732795 2305 2284 22596 844 13040 11300
NM_003347chr222797 244 2565 195 ----
NM_003358chr91129 ------
NM_003359chr441289 1112 498 127 --1492 --
NM_003368chr13776 574 77 2743 708 ----
NM_003369chr111914 ------
NM_003374chr51772 --162 1702
NM_003376chr6--11276 --11912
NM_003376chr6--11276 --11912
NM_003383chr92492 237 ------
NM_003385chr25884 858 779 733 193 ------
NM_003387chr262412 2156 2097 2000 788 672 12226 ----
NM_003392chr373995 3444 3108 1586 563 415 233 34086 4050 720 12945 --
NM_003400chr21817 ------
NM_003403chr141102 1685 ----
NM_003404chr2021697 300 1367 1761 11407
NM_003406chr851978 1406 239 128 39 ------
NM_003410chrX73045 2178 971 950 823 793 282 --11909 --
NM_003411chrY81735 1689 1554 1471 1456 1408 733 255 --11811 11768
NM_003413chrX41974 1293 1281 765 1640 ----
NM_003420chr3--1174 ----
NM_003423chr1972155 2002 1807 473 253 171 88 1733 1602 --
NM_003435chr19145 ------
NM_003457chr172586 207 1519 ----
NM_003463chr693265 2812 2795 2239 840 653 335 314 297 2713 92 ----
NM_003468chr2103547 2774 1678 1574 1476 1457 818 759 297 248 --24078 3855 --
NM_003472chr621237 158 31534 1265 1121 ----
NM_003473chr103415 157 105 ------
NM_003474chr1061915 1599 632 582 446 203 ------
NM_003477chr111562 ------
NM_003478chr1193346 3188 3164 2715 1217 970 770 381 271 42878 2473 2291 2271 1910 --
NM_003482chr1222347 1939 --12274 --
NM_003483chr123789 742 43 3991 959 891 ----
NM_003489chr21103455 3406 3200 3142 2235 1324 1048 1026 1012 28 23359 403 12426 --
NM_003503chr131294 1209 106 ------
NM_003505chr731771 1728 667 --11697 --
NM_003506chr831183 506 261 ------
NM_003508chr71288 ------
NM_003557chr131447 297 86 ------
NM_003564chr13677 457 255 ------
NM_003566chr1283413 3141 3076 3017 2166 1193 1148 788 32263 2239 370 1549 --
NM_003574chr18115570 4965 4910 4727 1872 1513 1322 1308 1121 505 321 25751 1949 25263 4942 --
NM_003579chr11137 ------
NM_003589chr1321219 1132 11420 ----
NM_003590chr253666 3470 1438 922 298 23757 1022 1828 --
NM_003591chr10--1347 ----
NM_003601chr4152 ------
NM_003607chr163699 3431 3070 1160 929 361 1636 11471 13401
NM_003615chr354033 3757 3288 1423 285 53782 3558 2673 1560 1308 1433 1710
NM_003617chr144927 4158 1291 73 34722 943 635 11338 --
NM_003618chr241051 971 481 119 --1285 --
NM_003626chr1131331 1247 91 ----1197
NM_003629chr143236 2436 759 600 2540 370 12536 12334
NM_003630chr61151 ------
NM_003632chr171863 ------
NM_003659chr231048 947 455 ------
NM_003663chr362958 2796 2554 958 762 682 11233 ----
NM_003671chr972619 2334 1100 1016 422 363 244 --1585 --
NM_003672chr141997 457 369 251 --11323 --
NM_003677chr123852 846 458 22018 820 1380 21544 921
NM_003679chr183003 2792 2688 2592 2532 2099 1114 1106 12244 --12629
NM_003692chr92818 397 ----1963
NM_003701chr1341082 1008 881 816 ------
NM_003702chr83837 719 698 --173 --
NM_003716chr3184 2853 263 ----
NM_003718chr7--162 ----
NM_003722chr332708 1105 449 42748 873 405 325 ----
NM_003728chr42485 48 --1229 1615
NM_003741chr31299 ------
NM_003743chr252186 846 760 252 94 2271 27 ----
NM_003750chr101997 2277 86 --1214
NM_003759chr421382 911 --12745 --
NM_003760chr1--2573 40 ----
NM_003762chr11932 166 11485 1251
NM_003763chr2063157 2056 997 791 559 39 1770 2949 532 2215 107
NM_003766chr17--1489 ----
NM_003772chr1131173 1147 887 21262 1163 1253 --
NM_003778chr31121 ------
NM_003783chr11201 1396 ----
NM_003787chr1841338 1316 464 354 ------
NM_003794chr35983 755 410 361 345 2238 71 ----
NM_003795chr61565 1595 ----
NM_003797chr111204 ------
NM_003799chr18114071 4023 2807 1266 810 762 637 629 553 359 222 ------
NM_003800chr662168 2044 879 357 341 122 --11619 1254
NM_003816chr841214 1112 506 367 1419 1204 --
NM_003819chr1--1118 ----
NM_003822chr163160 2612 2483 2007 1029 364 --1536 1144
NM_003825chr1541138 969 514 470 --11322 --
NM_003848chr33345 313 141 2999 180 1864 --
NM_003850chr13--1691 ----
NM_003861chr1442825 1975 656 400 ------
NM_003885chr1732547 1075 510 32643 2609 1000 152 --
NM_003887chr261844 1797 785 709 528 228 ------
NM_003895chr2152097 2044 1509 694 312 ------
NM_003913chr664020 3846 3457 3253 3043 172 11729 13172 --
NM_003919chr7----131 --
NM_003927chr183685 675 284 --11066 --
NM_003930chr752516 1011 791 429 314 22350 731 ----
NM_003934chr92957 144 ------
NM_003936chr211007 ------
NM_003938chr19--1117 11085 --
NM_003941chr792210 2095 1756 975 906 394 318 164 143 52149 1928 1642 1555 780 ----
NM_003942chr111169 ------
NM_003968chr31165 1646 1497 --
NM_003972chr101891 1192 --1515
NM_003980chr651421 1214 929 298 43 134 ----
NM_003993chr11304 ------
NM_003994chr1274414 4150 3915 3587 1568 1239 474 24260 3644 --14367
NM_004006chrX52331 1799 735 377 177 ------
NM_004007chrX52331 1799 735 377 177 ------
NM_004009chrX52331 1799 735 377 177 ------
NM_004010chrX52331 1799 735 377 177 ------
NM_004011chrX52331 1799 735 377 177 ------
NM_004012chrX52331 1799 735 377 177 ------
NM_004013chrX52331 1799 735 377 177 ------
NM_004014chrX52331 1799 735 377 177 ------
NM_004015chrX52331 1799 735 377 177 ------
NM_004016chrX52245 1713 649 291 91 ------
NM_004017chrX52331 1799 735 377 177 ------
NM_004018chrX52245 1713 649 291 91 ------
NM_004020chrX52331 1799 735 377 177 ------
NM_004021chrX52245 1713 649 291 91 ------
NM_004022chrX52245 1713 649 291 91 ------
NM_004023chrX52245 1713 649 291 91 ------
NM_004028chr1893877 3814 3426 3328 2836 2790 1396 907 157 53747 2940 864 200 135 ----
NM_004035chr1784129 3543 1571 1206 1058 664 68 26 54763 2011 2005 1696 1109 11458 1305
NM_004036chr2----2709 44 --
NM_004056chr83988 799 711 ------
NM_004067chr741538 1220 279 111 --1976 --
NM_004075chr123401 212 162 1422 ----
NM_004079chr142957 713 650 556 ----22649 2110
NM_004081chrY4564 547 175 84 ------
NM_004087chr342044 1719 661 76 1527 ----
NM_004094chr1452033 1868 1082 908 537 2585 27 1707 --
NM_004097chr21314 ------
NM_004100chr641782 508 237 52 42583 2107 771 429 --1400
NM_004105chr22891 698 1869 ----
NM_004109chr1162310 2204 1828 414 148 33 32129 508 374 ----
NM_004113chr331822 1457 796 21502 630 ----
NM_004124chr1463444 2694 1431 550 475 286 22272 1351 23078 718 --
NM_004133chr8102563 2335 2252 2154 2026 1842 1086 760 503 275 2623 314 22416 737 --
NM_004161chr221146 36 31465 1452 45 ----
NM_004163chr182385 130 ------
NM_004170chr941721 1651 1585 1367 21693 213 ----
NM_004171chr11139233 7157 7050 6975 6798 3675 1961 1313 946 822 665 550 122 28132 7205 28285 2420 16750
NM_004172chr511687 1375 ----
NM_004180chr22129 108 1432 ----
NM_004202chrY3676 655 257 ----1297
NM_004215chr81548 ------
NM_004225chr81488 --11040 --
NM_004229chrX72246 2017 2011 1750 1729 888 629 31683 261 56 ----
NM_004232chr1873621 2949 2427 2360 1273 741 649 43197 3156 2942 2700 23873 473 --
NM_004238chr2--1291 ----
NM_004239chr14126 ----1132
NM_004241chr103636 606 204 ------
NM_004242chr62306 172 ------
NM_004251chrX--1242 ----
NM_004253chr93835 781 765 2646 228 ----
NM_004261chr14999 762 753 74 ------
NM_004272chr561854 1782 1684 1607 391 134 31975 1917 461 11437 --
NM_004281chr10152 ------
NM_004290chr521052 204 11379 ----
NM_004293chr983527 3515 2979 2961 2826 2682 876 586 2533 510 1861 --
NM_004311chr1043152 3119 2344 2292 ------
NM_004329chr1031294 1270 586 ------
NM_004330chr151457 --1193 --
NM_004331chr851826 851 743 631 219 11849 12188 --
NM_004337chr852240 2143 1820 152 82 31463 730 648 1336 1833
NM_004338chr1876763 6083 6031 5177 5107 2007 1003 14335 --16135
NM_004342chr752066 1816 1729 1694 173 11993 22184 1838 --
NM_004365chr51349 1277 ----
NM_004369chr23719 567 537 ----1607
NM_004379chr241104 1093 567 139 21417 1083 ----
NM_004384chr541572 643 406 364 1188 ----
NM_004392chr1352540 2528 2512 566 111 ------
NM_004397chr1184313 4259 3746 1413 1224 813 328 41 23764 3713 ----
NM_004404chr251786 1613 1287 613 315 21938 1510 --1145
NM_004412chr1085129 5062 5033 4490 3805 737 170 114 25454 96 14373 --
NM_004415chr6149 1716 ----
NM_004423chr352579 2477 2177 821 794 ------
NM_004432chr92803 773 11617 ----
NM_004439chr41141 ------
NM_004440chr681913 1842 1555 1312 1253 705 532 497 --1188 1322
NM_004447chr124894 740 204 107 2366 195 ----
NM_004449chr2131469 1390 1277 ------
NM_004456chr72204 75 ------
NM_004457chr21251 11723 11118 11165
NM_004458chrX32210 1889 64 2992 704 1932 --
NM_004464chr484262 3859 3273 3026 2712 1350 1341 1258 33595 1327 869 12867 --
NM_004480chr142754 735 2318 96 ----
NM_004482chr2--1345 ----
NM_004496chr1421175 944 ------
NM_004497chr191661 ------
NM_004499chr5--2530 80 --1446
NM_004501chr184026 3917 3498 3045 2562 1613 1131 1029 --2814 342 13619
NM_004504chr242041 898 761 493 --13059 --
NM_004505chr1751788 1717 1626 1265 522 ------
NM_004516chr194439 411 390 374 ----1158
NM_004521chr101297 ------
NM_004523chr1021154 431 1393 ----
NM_004535chr2031411 1380 610 1265 ----
NM_004537chr1211444 --172 --
NM_004540chr212879 216 --1287 --
NM_004575chr431554 498 112 ------
NM_004580chr1541562 365 283 49 11400 ----
NM_004586chrX95462 4203 4161 3877 1979 1222 986 906 564 25366 1057 1534 15325
NM_004595chrX--1139 ----
NM_004598chr512811 ------
NM_004602chr2031371 1294 80 ------
NM_004612chr954446 3712 1393 486 238 --11876 1524
NM_004621chr1131238 1011 945 11265 ----
NM_004631chr131434 541 139 ------
NM_004634chr31663 ----1471
NM_004643chr141832 ------
NM_004650chrX61325 1298 695 547 183 83 21810 1393 ----
NM_004657chr221152 1096 11041 --1414
NM_004660chrY21536 395 21965 736 ----
NM_004663chr152510 117 1442 ----
NM_004666chr641263 1074 477 314 139 ----
NM_004667chr151456 ------
NM_004670chr1021725 595 ------
NM_004673chr14508 338 125 94 3538 350 22 11510 --
NM_004685chr1352477 2434 1073 750 85 1332 22907 1882 --
NM_004703chr1772483 1703 1028 811 645 388 358 11655 ----
NM_004716chr112884 829 ----194
NM_004719chr1232629 2473 575 ------
NM_004723chr131025 961 258 ------
NM_004725chr1041384 1029 457 151 ------
NM_004726chrX65573 5068 4626 3791 1800 229 11210 34365 1596 338 13508
NM_004730chr511872 3878 858 247 ----
NM_004734chr13103000 2777 2514 2504 1086 1007 476 450 403 199 12868 ----
NM_004736chr152077 1618 1496 904 446 ------
NM_004742chr3--11608 ----
NM_004744chr4123894 3724 3465 3045 948 927 615 503 446 394 346 185 11416 ----
NM_004745chr855881 4790 4524 1309 755 46555 5870 4349 4336 ----
NM_004748chr15144093 4075 4055 3991 3883 3762 3683 3486 3447 3322 1662 1232 1091 941 13042 --1120
NM_004755chr1421017 462 1272 1110 --
NM_004760chr762475 2230 2159 1866 1741 281 1462 ----
NM_004768chr14946 848 751 730 1214 2796 459 --
NM_004772chr51208 --1139 --
NM_004775chr1851681 1531 796 472 289 1297 ----
NM_004785chr161352 ------
NM_004788chr1172527 2188 1706 731 605 577 480 12073 --1597
NM_004791chr131177 1758 --1502
NM_004796chr1452173 1883 1518 400 61 22223 1965 32351 858 751 1846
NM_004797chr383757 3734 3154 1499 1389 1338 780 512 13698 ----
NM_004800chr13--1248 ----
NM_004808chr1062980 2868 2829 2676 1320 1314 ------
NM_004815chr1134903 4781 4583 4348 4118 4011 3784 3340 1399 1065 1039 988 592 13036 14707 --
NM_004820chr82448 29 1410 --1331
NM_004827chr44778 586 255 245 1264 --11960
NM_004831chr19--1688 ----
NM_004834chr233300 2230 38 11038 ----
NM_004856chr151410 ------
NM_004857chr1484784 4039 3739 3731 3321 3230 1504 1292 22991 1382 --13961
NM_004859chr1792242 2227 2140 1150 873 415 364 354 289 21109 891 1199 --
NM_004866chr5124398 3911 3813 3567 3447 3416 3222 3127 1777 1615 705 354 14049 --11673
NM_004867chrX----2490 241 --
NM_004871chr1763909 3834 3340 3183 1529 642 34432 4413 3221 ----
NM_004884chr1511507 ------
NM_004888chr92308 155 ----1225
NM_004893chr52562 448 --1530 --
NM_004896chr1031582 1456 601 ------
NM_004898chr422882 1100 12653 ----
NM_004904chr7115769 5039 4664 4640 4634 4054 4048 1801 1495 1356 336 35328 5253 2347 45676 4120 4040 1984 --
NM_004912chr71610 --21721 444 --
NM_004921chr13697 157 90 12044 --11765
NM_004926chr14--21415 384 11797 --
NM_004929chr821290 212 1102 --11530
NM_004932chr521535 1404 ----1489
NM_004934chr5130 ------
NM_004947chr332546 2272 772 ------
NM_004956chr7144377 4327 3853 3061 2938 2928 2872 1635 1593 843 823 487 458 73 44614 4608 3997 203 33411 1685 1150 --
NM_004965chr211717 ------
NM_004966chr104896 726 290 122 1770 --1705
NM_004972chr941044 1006 726 478 1930 ----
NM_004973chr611652 1386 ----
NM_004985chr1264044 3229 1693 1643 907 454 24477 1441 34054 3848 3542 --
NM_004992chrX98430 7143 5652 5475 5155 3343 2417 2085 991 --11713 --
NM_004992chrX98430 7143 5652 5475 5155 3343 2417 2085 991 --11713 --
NM_004999chr694524 4279 3790 3462 3023 1697 871 522 146 ----11138
NM_005006chr21921 --1804 11076
NM_005010chr742154 2059 1539 1421 11845 ----
NM_005014chr9--164 --1133
NM_005016chr122326 254 ------
NM_005032chrX21070 207 1831 ----
NM_005037chr32167 82 167 ----
NM_005044chrX44543 3732 3239 2806 23821 3047 3711 698 44 --
NM_005045chr7--2317 302 ----
NM_005054chr221369 358 --2400 76 --
NM_005056chr1295560 4458 4258 3806 2139 1951 801 659 228 1925 --15259
NM_005057chr131204 256 136 191 --11257
NM_005063chr1073620 2705 1526 1337 1283 917 440 13855 11242 23893 2543
NM_005065chr1495381 4983 4598 4387 4247 3374 1924 1557 1319 13601 14177 1152
NM_005080chr224908 884 862 197 --1713 --
NM_005093chr2045269 2130 1919 1679 --15230 11832
NM_005109chr332435 1857 770 ----1466
NM_005116chr2064459 3455 3439 1215 1153 292 ------
NM_005121chr1761482 1399 1119 1100 1088 359 13446 ----
NM_005124chr63727 707 127 --1860 --
NM_005128chr212519 441 ----1496
NM_005133chr111107 ------
NM_005134chr183876 863 695 ------
NM_005135chr1553758 3662 3288 2380 372 --1444 --
NM_005141chr43381 270 68 ------
NM_005151chr1842379 2125 2040 1679 22102 1665 11941 11928
NM_005154chr151650 ------
NM_005156chr955177 3873 1657 1642 1392 31097 419 381 14478 --
NM_005160chr2276835 6568 5375 5182 2581 2025 84 16822 --1325
NM_005171chr1231345 375 324 3916 288 256 ----
NM_005180chr101595 11180 --11296
NM_005188chr11118099 7253 6876 6267 3118 2458 1883 1718 1677 998 475 42642 2192 1761 1694 --25613 2669
NM_005190chr63762 405 394 11072 ----
NM_005197chr1425874 192 14640 12113 --
NM_005222chr71925 ------
NM_005224chr192538 242 ----1208
NM_005227chr11488 ------
NM_005233chr332204 860 412 31994 745 249 22098 459 --
NM_005235chr2156941 6901 6481 5991 5804 5777 5581 5232 4775 3073 2615 2561 2048 1685 1385 57862 6268 2510 1177 592 27839 6389 22302 754
NM_005238chr1173587 3338 3314 2777 2462 572 72 1488 --11410
NM_005239chr212631 614 1533 ----
NM_005243chr22170 ------
NM_005252chr142733 648 1748 ----
NM_005257chr182900 378 ------
NM_005259chr231465 1232 338 --1447 --
NM_005261chr82820 66 ------
NM_005277chr441859 1447 1221 176 1562 ----
NM_005295chr7--151 ----
NM_005296chrX31074 1041 232 1183 ----
NM_005313chr1531169 1118 419 2493 129 --11287
NM_005328chr81624 ------
NM_005339chr4104302 4091 4032 3376 3187 2871 1198 1113 891 528 23931 196 1441 12843
NM_005358chr1351482 1208 476 303 67 11194 ----
NM_005359chr1864261 2104 1303 820 647 293 2693 73 --11216
NM_005378chr21721 ------
NM_005380chr1--1191 ----
NM_005384chr9179 ------
NM_005385chr392378 1913 1866 972 442 298 264 232 104 22760 1034 12010 1163
NM_005398chr1021383 1242 --1158 --
NM_005399chr174122 3704 3231 2730 1091 1043 514 23663 3122 1190 13566
NM_005402chr75605 585 464 158 51 --1529 --
NM_005406chr1821500 1320 11048 --1551
NM_005407chr141194 ------
NM_005410chr52125 31 ------
NM_005428chr191174 ------
NM_005433chr183614 576 32 22308 404 22744 195 12799
NM_005436chr1063048 1377 726 483 225 22 --1384 --
NM_005445chr10--175 ----
NM_005450chr171233 ------
NM_005455chr171717 1631 1606 1171 702 201 119 31448 1351 389 ----
NM_005493chr64854 748 237 81 1764 ----
NM_005497chr1721092 630 45986 5954 4551 1926 ----
NM_005499chr191516 ------
NM_005502chr952361 2223 1216 1057 991 --43107 2125 577 237 --
NM_005509chr531444 319 27 11643 ----
NM_005521chr103841 786 249 ------
NM_005522chr721331 343 1482 ----
NM_005525chr11264 ------
NM_005534chr212559 189 1502 ----
NM_005537chr132918 903 --11024 --
NM_005542chr781731 1668 1513 1280 1258 720 152 96 153 ----
NM_005570chr182217 198 21188 89 1814 164
NM_005573chr52467 111 1128 ----
NM_005578chr3105103 5050 5027 3753 1755 1497 1282 1269 373 200 1596 24188 623 1558
NM_005593chr121410 ------
NM_005595chr11784 --1342 --
NM_005596chr984490 4172 4006 2497 1834 1183 893 885 11503 33909 1119 987 1967
NM_005600chr11214 ------
NM_005604chr622433 2106 21667 510 ----
NM_005610chr11223 ------
NM_005623chr171449 2490 128 ----
NM_005627chr61105 ------
NM_005646chr1185 ------
NM_005664chr151293 ------
NM_005665chr194878 4445 3726 3115 1433 1412 1266 1059 347 11361 ----
NM_005667chr2----1149 --
NM_005668chr5114502 4057 3686 3606 3578 3241 1585 541 515 501 489 13450 --11556
NM_005685chr7154 ------
NM_005694chr31105 ------
NM_005697chr151177 ------
NM_005715chr652867 1780 1104 1042 651 32563 2218 939 --1442
NM_005717chr14959 376 272 256 1813 ----
NM_005722chr232057 1984 1739 42460 2255 2202 184 ----
NM_005725chr12948 256 21987 30 12241 2651 102
NM_005732chr521490 355 --1404 --
NM_005737chr252542 2122 1055 155 141 11959 ----
NM_005738chr731872 1649 284 1563 ----
NM_005739chr1572322 2145 1933 912 839 829 25 31658 507 265 12013 --
NM_005742chr21799 --1657 --
NM_005746chr772717 2623 2564 2116 2088 822 248 12328 1911 --
NM_005748chr1253472 2616 1203 535 147 ----2927 341
NM_005749chr17176 ------
NM_005751chr72459 164 ------
NM_005754chr54963 851 265 58 ------
NM_005759chr294332 3741 3243 1312 905 322 316 183 169 12964 1371 --
NM_005765chrX1269 1633 1341 --
NM_005780chr132707 341 1985 ----
NM_005786chr1811067 1389 ----
NM_005792chr163559 430 222 --1417 --
NM_005795chr282824 2758 2298 1959 1917 1071 896 616 22929 2440 ----
NM_005798chr1395124 4546 4483 3219 1855 918 388 171 128 54523 4502 3971 1711 288 35268 4652 2042 --
NM_005801chr17155 ------
NM_005836chr8--1339 ----
NM_005839chr1--1978 ----
NM_005840chrX127636 7543 6634 5995 5341 4822 2764 2757 2094 1179 1165 648 17147 17524 --
NM_005853chr16135 1408 ----
NM_005857chr151333 914 424 240 190 --1308 --
NM_005868chr73431 129 26 --22338 930 --
NM_005880chr1621396 427 2338 165 --11103
NM_005885chr561476 1435 1381 304 295 175 21470 1324 ----
NM_005886chr161267 ------
NM_005900chr431006 759 434 1143 --1948
NM_005901chr18128519 7945 6551 6021 5375 3486 2877 1288 1034 915 439 405 27939 2279 1153 --
NM_005903chr5104639 3757 3647 3641 3421 1868 969 729 598 311 --1159 --
NM_005909chr593833 3576 3454 2816 1365 1247 598 548 29 1803 13110 --
NM_005918chr7134 ------
NM_005922chr6--1469 ----
NM_005930chr142652 162 ------
NM_005935chr495171 5096 1481 1058 967 878 607 373 260 ------
NM_005941chr853758 3683 2977 1339 1044 11274 23809 3077 --
NM_005944chr331056 383 48 1409 ----
NM_005955chr1105566 5398 5152 5023 4715 3859 1679 1606 808 102 25499 346 --1440
NM_005962chr10--11489 ----
NM_005962chr10--11489 ----
NM_005964chr1731497 1380 1360 11189 ----
NM_005966chr262324 1884 1493 339 324 206 --1449 --
NM_005967chr121740 1495 181 --
NM_005968chr19142 ------
NM_005977chr135895 874 761 680 163 3888 703 175 ----
NM_005994chr171658 ------
NM_005999chr131405 315 233 61215 1206 1187 1162 527 368 11504 --
NM_006007chr964435 4164 3550 830 424 235 44248 3393 2775 773 ----
NM_006010chr3178 ------
NM_006016chr692320 2287 2020 808 459 451 368 354 107 ------
NM_006037chr274507 4068 3413 3036 1585 1544 1299 24686 383 ----
NM_006038chr2021767 1599 12135 ----
NM_006047chr2073332 3218 3107 2809 2525 2150 406 --1294 --
NM_006063chr2162 ------
NM_006070chr3--199 ----
NM_006079chr61833 ------
NM_006080chr772287 2204 2185 2106 1857 853 592 2652 623 ----
NM_006089chrX2439 215 161 --1459
NM_006090chr14754 496 172 94 2744 673 ----
NM_006094chr842433 2252 1498 238 11792 ----
NM_006095chr454043 3905 3366 1624 865 13897 14339 13814
NM_006108chr1112258 183 22367 2020 --
NM_006139chr242792 2546 2264 949 22861 2088 ----
NM_006141chr1632653 2144 835 12563 ----
NM_006153chr32636 111 ------
NM_006154chr1552894 2203 1087 313 102 12741 ----
NM_006155chr251786 1613 1287 613 315 21938 1510 --1145
NM_006166chr1262520 2326 2025 287 171 44 ------
NM_006180chr941815 1730 616 322 11719 ----
NM_006186chr231129 1106 1076 ------
NM_006192chr20--1893 ----
NM_006194chr14--11171 ----
NM_006195chr94880 511 272 141 ------
NM_006196chr21244 ----2323 141
NM_006197chr822033 1986 21953 896 --1273
NM_006203chr574343 4123 2210 1292 742 708 269 35578 3428 731 1444 --
NM_006206chr472780 2574 2367 891 839 650 325 22968 734 11165 --
NM_006218chr3----1119 --
NM_006226chr25937 500 459 320 162 41041 958 952 387 1874 --
NM_006241chr321764 339 11979 --11737
NM_006246chr1431328 1218 378 2927 493 ----
NM_006251chr543112 2594 363 310 22917 852 1892 --
NM_006252chr1156872 6447 5883 5836 5508 5309 5054 2958 2198 1357 1055 784 427 374 188 36525 6032 2054 12269 12884
NM_006255chr1451110 1045 731 429 63 1891 1723 --
NM_006256chr152760 2338 2016 793 287 11859 ----
NM_006264chr41478 ------
NM_006265chr8--31249 1045 391 ----
NM_006267chr241877 1478 745 528 2401 317 ----
NM_006275chr2042157 817 329 97 1782 --11815
NM_006282chr2054317 4168 3638 3059 1784 44541 4067 3761 1075 ----
NM_006283chr8134508 4391 4025 3971 3237 3009 1341 1145 996 972 660 464 199 ----23772 3192
NM_006299chr61233 ------
NM_006300chr1962434 2375 2091 1607 908 657 12192 ----
NM_006306chrX104814 4801 4386 3737 1402 1225 1095 708 497 427 ----15237
NM_006310chr173837 96 89 11141 ----
NM_006313chr1231139 519 411 ------
NM_006315chr421485 368 2516 341 11144 --
NM_006329chr142757 264 ------
NM_006330chr841441 403 382 165 11681 21088 216 --
NM_006352chr162064 1841 772 431 162 152 ------
NM_006353chr631344 1277 91 --11332 --
NM_006363chr201145 ----1257
NM_006364chr1441095 343 280 198 ------
NM_006380chr1773288 2882 1506 1307 1172 941 93 43845 1554 1301 630 11403 1717
NM_006390chr1221415 1360 --1495 --
NM_006393chr1074322 4092 1744 1703 1431 1199 661 13842 1543 --
NM_006401chr91189 ----1484
NM_006413chr102969 121 --1209 --
NM_006419chr42552 538 1759 ----
NM_006420chr2063151 719 686 271 225 110 53327 1135 876 839 741 ----
NM_006434chr1042910 2285 2012 1021 23118 291 --11078
NM_006439chr41231 ------
NM_006449chr241754 399 288 169 --1681 --
NM_006451chr51773 ------
NM_006457chr473715 3423 2852 2600 481 371 32 1325 13807 23617 300
NM_006459chr1021726 1629 ----21974 1239
NM_006460chr172517 146 4724 585 366 330 ----
NM_006466chr2021018 167 163 1751 --
NM_006475chr13--1143 ----
NM_006489chr1431696 1591 188 1495 ----
NM_006494chr19----1296 --
NM_006496chr151770 1318 607 425 123 12001 ----
NM_006497chr171226 ------
NM_006504chr1042353 2296 1072 67 21142 32 ----
NM_006520chrX71355 1268 1208 640 627 238 42 21657 217 ----
NM_006526chr2061867 1831 1628 581 409 313 --1149 11798
NM_006534chr2022083 938 11223 --11364
NM_006538chr264108 3905 3290 2534 497 190 21677 1654 ----
NM_006540chr871484 1234 974 629 506 461 418 11257 ----
NM_006544chr1495530 5099 4290 3787 2187 2071 1454 1167 224 34884 1978 854 16023 --
NM_006546chr17136533 6480 6232 6214 6158 5437 4578 2446 1336 1328 1213 912 705 12461 ----
NM_006547chr711604 31541 678 671 ----
NM_006561chr10106014 5382 4471 2078 1822 1397 891 823 281 184 11624 14291 14856
NM_006572chr1783532 2705 2506 2435 2369 2231 735 630 32758 2607 2312 ----
NM_006577chr221138 291 1878 1892 --
NM_006583chr41427 1341 ----
NM_006584chr17291 41 ------
NM_006593chr21553 ------
NM_006595chr1151960 1697 685 386 321 ----11651
NM_006599chr16128162 6567 6309 5993 5512 5311 2815 2769 2751 2038 952 504 47821 7806 6544 5019 1237 --
NM_006603chrX32005 1963 22 2490 317 ----
NM_006609chr232460 592 573 22818 2121 32696 2272 672 --
NM_006614chr373109 2976 2961 2568 2308 1289 640 32391 925 511 11340 --
NM_006620chr664782 4713 4520 3533 3265 731 31689 1381 205 14594 24685 1357
NM_006624chr105836 692 467 241 88 --1520 --
NM_006626chr982489 1994 1787 1690 1031 860 567 320 --12526 --
NM_006628chr15114633 4483 4122 3770 3461 1662 1585 1519 1060 914 548 14302 24685 26 --
NM_006629chr1832485 1056 939 22066 723 11837 --
NM_006633chr53696 299 54 ------
NM_006636chr231050 214 86 ----1980
NM_006646chr1342408 2336 2298 1012 12349 --22980 565
NM_006654chr1263927 1834 1627 1448 1407 1312 2906 753 24505 1603 --
NM_006667chrX21057 461 ----1274
NM_006682chr762685 2443 2153 754 659 626 22123 1064 ----
NM_006699chr152707 2263 779 618 566 ------
NM_006704chr132348 77 1163 ----
NM_006705chr91453 ------
NM_006717chr983335 2522 1371 930 766 754 745 679 --12509 --
NM_006718chr65998 838 401 392 173 1205 --2791 300
NM_006720chr1044827 4022 1780 92 --21987 1659 21883 1620
NM_006721chr104677 165 130 123 2598 185 ----
NM_006724chr6--1469 ----
NM_006729chrX125632 5135 4914 4723 4655 4532 4396 3813 1805 1228 625 562 31364 335 189 13878 --
NM_006731chr9165802 5668 5227 4715 4371 4105 4099 3951 3683 1425 1028 951 909 472 173 26 23722 1048 23657 902 12221
NM_006746chrX41238 1047 162 21 --1389 1418
NM_006750chr16177685 7602 7516 7486 6476 6351 5397 5253 4983 2910 2647 2316 1985 1876 1437 575 175 27876 4931 25141 497 --
NM_006751chr23990 886 736 ------
NM_006754chr72903 480 11282 ----
NM_006766chr83805 328 122 12279 ----
NM_006772chr621355 581 1426 ----
NM_006775chr632831 718 401 11142 12550 --
NM_006777chrX62363 2038 1043 1000 509 283 12570 --1875
NM_006806chr211370 --1327 --
NM_006810chr3166 ------
NM_006811chr20----2964 768 --
NM_006815chr1241140 989 459 397 21354 1187 ----
NM_006823chr82911 902 ------
NM_006828chr63511 470 433 ------
NM_006832chr144959 202 173 97 ------
NM_006851chr1282689 2503 2439 2053 1970 685 438 259 12313 ----
NM_006872chr2------1131
NM_006873chr2102953 1413 1255 1245 1177 1168 1159 800 790 164 2894 209 13233 22855 744
NM_006874chr421121 922 ------
NM_006885chr1633568 1615 1197 13553 13340 136
NM_006888chr14103305 3169 3062 3026 2824 2752 1404 1150 166 52 1927 ----
NM_006908chr721415 234 ------
NM_006910chr161295 ------
NM_006912chr132259 2080 224 ------
NM_006914chr921000 297 1373 ----
NM_006915chrX72540 1607 1016 998 561 412 60 22167 341 12394 --
NM_006916chr271233 1092 1075 969 491 366 203 11180 1881 11352
NM_006918chr1165673 5461 5358 4615 4124 1373 25281 1339 34026 3687 778 1668
NM_006922chr232134 889 750 1779 12464 12577
NM_006924chr17134252 4127 3962 3752 3545 3145 2787 1281 1245 1040 959 860 219 14262 --23565 2998
NM_006939chr142832 61 1805 2376 252 --
NM_006940chr121539 ------
NM_006947chr461553 1539 1334 1159 428 363 1554 ----
NM_006948chr2172133 2019 1869 1814 1755 589 542 12192 1628 11978
NM_006963chr104946 874 119 70 11054 --1149
NM_006981chr932551 2357 2146 22997 1064 ----
NM_006996chr111207 2467 220 11285 11704
NM_006999chr51569 ------
NM_007007chr1263912 3781 3700 3512 774 152 34596 2976 580 --13935
NM_007011chr15126669 6342 6310 6005 5986 5356 5097 2759 2369 2023 1282 99 46270 4750 1346 1119 26906 4476 --
NM_007013chr82804 102 1823 ----
NM_007017chr52822 593 1750 ----
NM_007018chr92392 379 ------
NM_007023chr21815 ------
NM_007027chr3--189 ----
NM_007036chr53937 860 274 1731 ----
NM_007038chr2195658 5266 4314 4227 3907 2349 2104 1833 887 54783 1499 1250 1241 850 1142 23952 821
NM_007039chr1432350 1609 797 32161 876 789 1580 --
NM_007049chr63984 926 754 ------
NM_007050chr20118084 7479 6561 6288 5932 5823 2857 1648 1604 1254 326 --15123 13024
NM_007052chrX4580 439 57 26 ------
NM_007054chr552665 1007 892 349 162 43811 3482 3205 580 1740 --
NM_007064chr31578 --11583 --
NM_007106chr1332314 2174 1983 11090 21951 401 --
NM_007107chr352394 2148 1856 475 106 12368 1885 --
NM_007112chr1133 ------
NM_007114chr373323 2474 973 851 741 623 506 1577 12807 --
NM_007118chr51301 2312 56 ----
NM_007125chrY21368 342 21435 399 ----
NM_007137chrX84195 3929 3892 3582 1433 923 513 198 2605 381 14557 --
NM_007145chr1921420 461 11436 ----
NM_007157chrX53002 2819 2165 2069 1011 32107 1835 849 ----
NM_007159chr331705 1674 323 11170 ----
NM_007173chr1122409 1974 1953 11734 11724
NM_007175chr853671 3580 3548 2958 2921 12609 13506 --
NM_007187chr133926 161 102 2824 254 ----
NM_007191chr121113 ------
NM_007195chr1893671 3630 3066 3002 2505 2446 1502 1190 512 11075 23604 548 --
NM_007212chr161561 1520 642 489 426 302 ------
NM_007222chr82295 66 21247 244 ----
NM_007235chr12151 ------
NM_007246chr46939 919 901 391 252 219 --177 --
NM_007249chr13169197 8468 7977 7818 7805 7388 7229 2528 2500 2133 1971 1705 638 471 392 39 1445 28939 7004 12708
NM_007269chr11640 2178 82 ----
NM_007279chr192616 412 ------
NM_007292chr1784129 3543 1571 1206 1058 664 68 26 54763 2011 2005 1696 1109 11458 1305
NM_007308chr42698 247 ------
NM_007345chr1862211 2089 1858 723 537 72 --12018 --
NM_007353chr753053 2876 2749 2685 1089 ------
NM_007358chr131366 420 72 11671 ----
NM_007373chr10101827 1396 717 664 658 575 548 431 208 159 2291 237 ----
NM_007375chr152764 2445 2375 182 98 12778 12413 --
NM_012069chrX72642 2559 2500 2125 444 338 305 ------
NM_012082chr82866 202 1810 --1849
NM_012089chr121585 1095 2472 437 --11461
NM_012090chr11805 ------
NM_012093chr111176 ------
NM_012096chr363444 2942 2708 2644 279 36 --1765 --
NM_012104chr1133780 3279 855 1254 ----
NM_012104chr1133780 3279 855 1254 ----
NM_012115chr61123 1432 ----
NM_012120chr672816 2272 2223 1848 1070 365 329 1817 1158 22422 803
NM_012129chr7112111 1889 1857 1736 1545 850 464 423 220 187 122 ------
NM_012141chr1393618 3550 3184 3008 2598 1477 684 595 129 23248 226 --11537
NM_012161chr441149 867 852 150 ------
NM_012164chr9127191 6079 5616 5062 4756 2738 2584 2068 2057 1971 1166 334 57551 7327 6854 2550 1343 22140 1904 --
NM_012175chr113840 305 210 1644 --1605
NM_012176chr5142 ------
NM_012180chr44704 616 460 194 ------
NM_012193chr11105396 5241 5024 4725 1474 1344 771 587 446 91 15126 11178 --
NM_012197chr911235 ------
NM_012199chr153424 3289 1866 1634 1596 13967 ----
NM_012214chr2116155 5310 4881 4736 2215 1983 1963 452 150 107 37 --25562 2432 --
NM_012223chr221323 1081 ------
NM_012224chr42401 48 --11137 --
NM_012234chr3123779 3608 3407 3308 3164 3125 3039 1018 984 287 166 89 2742 619 1262 --
NM_012238chr1061762 1662 1189 649 466 402 11496 11501 --
NM_012242chr101803 1562 ----
NM_012243chr15916 722 648 85 48 5880 851 614 608 247 --1112
NM_012249chr262845 2723 2179 1385 820 205 --23244 366 --
NM_012250chr111417 1184 1481 1307
NM_012252chr7125231 5032 5006 4426 4182 3920 3567 1990 1856 1510 571 553 25186 1438 --13980
NM_012262chr165082 5027 3941 3570 3330 489 44808 3559 3274 604 --13516
NM_012287chr384033 3245 3025 2767 1575 869 253 32 23587 3170 23160 1737 --
NM_012297chr441824 405 206 198 --12553 --
NM_012300chr552507 1857 1836 999 360 42289 751 615 267 1311 --
NM_012301chr761809 1659 821 771 637 78 21478 469 22064 1818 --
NM_012302chr151269 1120 946 421 160 ------
NM_012304chr552577 2451 1817 1592 918 --42562 2379 2040 130 --
NM_012309chr1184474 3928 3693 3642 3612 1658 1435 715 23511 1667 ----
NM_012316chr165127 4247 4096 3994 2228 2044 --13956 15400
NM_012322chr7162 ------
NM_012329chr171163 ------
NM_012334chr5104743 4586 4458 3734 3273 1501 1291 1232 1105 957 24391 3477 --1448
NM_012338chr731079 447 54 ------
NM_012342chr101134 2394 373 ----
NM_012347chr62714 708 43000 2354 2195 1954 12614 --
NM_012388chr1542474 502 315 226 ------
NM_012414chr12317 84 125 ----
NM_012417chr172227 66 1388 --1614
NM_012420chr1061659 1616 740 701 306 169 1488 2926 751 --
NM_012443chr103713 562 139 ------
NM_012467chr16------1121
NM_012475chr11265 ------
NM_012479chr711936 22360 279 ----
NM_012481chr173749 693 234 ----1246
NM_012482chr13689 440 246 ------
NM_013229chr124808 599 547 323 11799 --12822
NM_013231chr1431348 737 137 21721 1627 12688 12960
NM_013233chr22544 373 11384 --31206 1025 330
NM_013250chr1141384 1127 186 173 --21229 64 --
NM_013257chr852410 2376 2164 197 40 22366 234 ----
NM_013263chr161124 ------
NM_013269chr1254406 3373 1296 1058 233 --21196 79 --
NM_013280chr111237 ------
NM_013281chr2041104 1054 339 140 21025 474 ----
NM_013282chr1921019 165 --1183 --
NM_013296chr13465 143 51 --179 1313
NM_013301chr19--1384 ----
NM_013309chr1562428 2076 1620 1067 625 393 ------
NM_013313chr2273244 3224 2875 2537 1005 830 173 1805 ----
NM_013322chr711369 ----1313
NM_013336chr33683 354 113 1162 ----
NM_013341chr282825 2558 2107 739 635 575 507 111 --1356 --
NM_013354chr831151 505 352 1220 ----
NM_013357chr8--2846 32 ----
NM_013371chr11253 ------
NM_013372chr1592938 2869 2682 2567 2276 2137 1367 847 357 33100 1155 524 13338 13352
NM_013381chr1272413 2303 1758 1682 867 764 127 11813 21652 813 --
NM_013396chr212601 496 1230 ----
NM_013438chr941782 615 333 33 --11138 --
NM_013444chrX4873 755 431 113 2469 130 ----
NM_013446chr73990 467 126 ----1243
NM_013448chr142585 564 ------
NM_013450chr23458 253 222 11079 ----
NM_013943chr172865 2773 2750 2555 2545 512 449 12466 --13034
NM_013960chr81755 ------
NM_013975chr171548 ------
NM_013986chr22170 ------
NM_014003chr161398 ------
NM_014005chr592299 2205 984 858 799 722 240 165 127 12863 1752 --
NM_014011chr272634 2535 1860 1000 992 800 655 31628 1031 775 1945 --
NM_014021chr152937 2481 2406 480 163 32516 2366 852 12737 23085 2912
NM_014023chr1042847 2537 2479 738 ----12633
NM_014028chr662831 1322 1305 788 781 144 32986 2878 685 12670 --
NM_014033chr1252262 2088 2081 2015 1476 11747 11752 142
NM_014034chr621351 102 2436 232 --11391
NM_014039chr1121252 1235 11389 ----
NM_014043chr31157 --11214 --
NM_014048chr1674993 4537 1526 1366 1281 188 81 33792 646 640 14373 --
NM_014055chr121376 1484 ----
NM_014079chr32997 73 1988 ----
NM_014089chr1332264 1650 134 12103 156 1186
NM_014106chr1562808 2465 2086 1952 595 301 1969 ----
NM_014112chr853828 3731 521 440 350 15234 11970 --
NM_014117chr1662218 2126 1839 1728 1078 906 ----12696
NM_014155chr1197249 5523 3019 3007 2497 2423 2023 1715 400 46354 5817 2842 341 ----
NM_014157chr1633865 1129 1039 23914 2590 --13677
NM_014160chr321062 396 11363 11053 --
NM_014171chr24633 210 122 55 ------
NM_014181chr262944 2514 2357 1056 711 665 12244 ----
NM_014183chr20--138 ----
NM_014217chr131879 1686 154 31739 1733 1356 ----
NM_014220chr34253 171 114 52 ------
NM_014243chr4--1780 ----
NM_014253chrX41767 1634 908 809 --12233 11606
NM_014264chr41117 180 ----
NM_014270chr19----137 --
NM_014271chrX5584 249 240 157 108 --147 --
NM_014278chr4--1469 ----
NM_014309chr2254859 4518 3337 1201 549 --21086 894 --
NM_014319chr1241993 1947 1267 385 2673 451 ----
NM_014331chr4197728 7127 7087 7058 6729 5940 5851 5699 2420 2400 2205 1021 994 518 475 238 169 80 29 47835 7307 6081 2442 86764 6263 5122 5089 2083 1285 851 673 12257
NM_014333chr1152058 2049 1714 764 407 --1555 --
NM_014344chr111693 --1832 --
NM_014345chr62266 155 --11018 --
NM_014352chr1151512 1401 1365 536 460 ----1479
NM_014363chr132819 496 --1307 1180
NM_014372chr121747 1665 ------
NM_014376chr552405 2353 2046 1614 1590 --12421 --
NM_014380chrX--2239 220 ----
NM_014386chr5299 63 ------
NM_014393chr861947 1802 1706 496 435 187 1666 1710 11483
NM_014395chr411982 ------
NM_014397chr961376 1170 1120 928 467 314 ------
NM_014398chr311633 --135 --
NM_014415chr321711 206 ----1313
NM_014421chr462125 2097 1998 1505 556 499 11697 ----
NM_014423chr575512 5260 4668 3495 1130 373 218 54430 3631 1614 1362 401 1573 11944
NM_014445chr332222 1690 40 1324 ----
NM_014452chr651209 968 905 348 38 ------
NM_014455chr1--1154 ----
NM_014456chr1041761 722 480 153 1756 11161 --
NM_014458chr12908 213 ------
NM_014494chr1631875 1481 621 11760 11679 --
NM_014521chr231431 1282 673 2246 240 1281 --
NM_014547chr153520 246 218 ------
NM_014547chr153520 246 218 ------
NM_014548chr1531359 627 499 1129 21464 340 1272
NM_014554chr1242134 915 868 344 ------
NM_014562chr21113 ------
NM_014573chr1711553 --11584 --
NM_014575chr31158 --137 --
NM_014577chr222779 359 ------
NM_014583chr32464 458 ------
NM_014584chr145588 489 422 176 57 21117 578 11446 --
NM_014616chr383323 3055 2733 844 826 613 502 397 1807 22721 1334 1197
NM_014620chr123765 688 676 --1732 181
NM_014630chr1521288 207 13101 --13740
NM_014635chr21322 11272 2364 40 --
NM_014637chr841447 1148 909 343 ------
NM_014660chr721127 244 ------
NM_014663chr11980 ------
NM_014666chr53340 117 35 ------
NM_014670chr231514 519 421 1288 --1223
NM_014677chr831162 1154 947 1257 ----
NM_014678chr22--195 ----
NM_014679chr1141405 1180 66 37 1947 ----
NM_014682chr872153 2055 684 575 393 311 58 11992 ----
NM_014686chr19--1958 ----
NM_014689chr24156 139 85 46 1402 ----
NM_014701chr1523221 853 53416 3383 3331 3310 3303 ----
NM_014702chr663320 1211 898 747 189 110 23156 145 1830 --
NM_014705chr72755 207 21929 173 22039 2028 --
NM_014707chr762203 2184 2080 1420 873 250 ----22098 404
NM_014711chr1641677 1340 527 391 41906 1528 1407 362 ----
NM_014720chr1041593 1566 1243 725 11421 ----
NM_014721chr666747 5760 2966 2399 2247 1792 14827 11201 1518
NM_014730chr12104841 4429 4055 3896 3413 1618 1558 934 791 489 ------
NM_014730chr12104841 4429 4055 3896 3413 1618 1558 934 791 489 ------
NM_014733chr581959 1938 1894 1587 1541 754 571 260 2224 187 ----
NM_014736chr154168 134 122 65 ------
NM_014739chr674032 3875 3790 3345 2846 1307 121 32777 1233 1085 13599 --
NM_014752chr1161979 1710 1657 365 138 35 ----1497
NM_014755chr283912 3598 3173 3028 2828 2751 751 545 24222 2697 ----
NM_014764chr1211261 1159 ----
NM_014766chr783072 2824 1517 1261 918 866 847 160 --22473 1485 13643
NM_014774chr143271 2381 2248 202 23137 1255 ----
NM_014781chr811290 ------
NM_014795chr221377 351 1433 ----
NM_014802chr126907 758 357 274 157 138 1302 ----
NM_014803chr1042979 2663 2648 1945 11992 12758 1719
NM_014804chr1711169 ------
NM_014810chr1103690 3095 2837 2260 1428 1318 1008 777 629 334 11258 23250 2708 12466
NM_014812chr121539 1341 --11831 1269
NM_014824chr1151769 1586 1525 1406 766 --1567 11358
NM_014826chr163699 3431 3070 1160 929 361 1636 11471 13401
NM_014828chr1462251 1952 937 250 190 179 2714 638 --1592
NM_014829chr52866 154 31573 941 831 ----
NM_014832chr1332000 1758 655 1807 21849 713 --
NM_014839chr12984 838 22242 1001 31711 785 430 --
NM_014840chr1253189 2283 2219 2167 211 23256 1271 1678 --
NM_014841chr61930 1874 11270 --
NM_014844chr1434163 1124 1085 --11050 13017
NM_014846chr8165 ------
NM_014847chr1--1512 ----
NM_014864chr143411 3072 967 711 23498 824 --24354 3119
NM_014872chr962291 2245 2066 1565 908 49 1292 ----
NM_014873chr1114820 4763 3533 3315 3224 2960 1835 1582 384 339 160 13616 14486 --
NM_014877chr1787349 6410 5928 5508 5435 4927 2219 1244 33118 2127 1195 46645 6442 1111 846 --
NM_014879chr33921 851 122 2915 319 1391 --
NM_014887chr132301 289 2731 355 ----
NM_014891chr711568 ------
NM_014892chr63628 504 404 1115 ----
NM_014893chrY22104 503 2391 252 11527 --
NM_014897chr1753060 2781 2487 1281 283 ------
NM_014899chr552270 1275 1174 1149 427 43015 2575 604 349 13130 --
NM_014900chr22174 124 11164 21021 167 11059
NM_014903chr1222158 2027 22092 592 11974 --
NM_014904chr1064030 4003 3837 3624 3328 283 34013 3755 1299 1834 23233 1408
NM_014905chr23432 312 304 21551 157 21711 587 --
NM_014906chr17124015 4007 3999 3443 2919 2762 2682 1633 1536 780 403 384 43413 2743 419 173 --13197
NM_014912chr1052397 1187 673 599 94 12267 1953 --
NM_014920chr673573 3533 3468 1439 935 757 23 1417 13292 --
NM_014923chr1351788 1514 771 453 299 11685 1402 --
NM_014924chr1453111 2528 2189 1096 29 1510 ----
NM_014932chr321730 629 ----12020
NM_014934chr1393746 3588 3451 3119 2490 1476 941 832 328 --11198 --
NM_014936chr662022 1151 1024 434 386 360 12178 12660 --
NM_014946chr251051 940 797 587 114 12894 1831 --
NM_014947chr142394 937 708 592 --11235 12450
NM_014949chr121067 224 1207 1196 --
NM_014950chr143492 390 238 21277 538 --11407
NM_014962chr203934 478 337 2826 771 22772 1142 --
NM_014964chr1742446 2146 1702 892 1562 1720 --
NM_014982chr14114783 4559 4458 3305 2075 2003 1871 1323 1177 1161 772 --23815 2068 1977
NM_014989chr652080 1290 803 198 189 21582 56 ----
NM_014997chr742761 2171 471 439 22631 42 ----
NM_015000chr1253029 2391 2336 2210 1134 22920 2432 23052 585 1856
NM_015002chr121837 4904 829 636 218 1576 --
NM_015005chr1411757 ------
NM_015008chr363611 1350 1304 518 470 285 23332 308 1116 --
NM_015009chr32740 697 ------
NM_015017chr13906 855 247 ------
NM_015020chr16103894 3271 2763 2508 1201 1082 855 714 630 131 --1914 --
NM_015025chr282750 2520 1850 1099 957 823 698 103 22495 991 --1493
NM_015026chr1294402 3939 3871 3208 3047 1644 1363 422 63 138 11468 --
NM_015032chr13112836 2633 2364 2231 1997 869 823 692 402 374 203 --1356 12830
NM_015035chr20106549 5682 4957 4757 4458 2305 1993 1957 925 861 14647 ----
NM_015040chr2123221 2734 2495 2341 2218 2154 966 816 548 466 418 172 23270 445 13437 --
NM_015042chr1584186 3585 2975 1750 1287 1153 985 538 ----13419
NM_015059chr15103963 3285 3085 2933 2746 2719 1596 1194 1115 941 11012 11183 11249
NM_015068chr793037 2980 2900 2772 2686 2613 997 41 25 33743 2935 263 11053 --
NM_015071chr576340 6175 5103 4995 1389 1366 509 ------
NM_015074chr163593 688 551 325 316 204 13521 ----
NM_015076chr684157 3736 3514 3161 1212 1132 1050 785 34548 4189 259 ----
NM_015087chr1312034 22470 1756 1885 --
NM_015090chr156205 5903 5602 4980 2205 ----11633
NM_015092chr16124465 4421 4199 3490 3145 2951 1383 1214 1184 691 551 23 23801 3397 --1916
NM_015107chrX22423 2319 12254 ----
NM_015110chr9112334 1924 1851 1794 1707 1014 880 538 484 473 30 ------
NM_015115chr452559 1954 934 855 227 22753 2043 ----
NM_015132chr71628 11921 ----
NM_015141chr352479 1894 1777 1008 124 12766 --11795
NM_015144chr1673674 3478 1325 1293 1072 143 75 24002 716 ----
NM_015149chr121479 180 --11982 --
NM_015153chr62786 549 ----1216
NM_015155chr1033033 2908 1293 13299 ----
NM_015156chr1443969 3812 3646 3504 ----11531
NM_015161chr1621582 1174 --21280 332 --
NM_015170chr842339 2113 1878 635 22095 1629 11714 --
NM_015172chr131449 297 149 --1254 --
NM_015176chr141444 1365 324 189 ------
NM_015192chr201541 --12254 12782
NM_015199chr392554 2416 2266 2005 1995 1024 933 855 191 1384 ----
NM_015200chr462499 2423 2302 2254 824 460 ------
NM_015208chr1872883 2795 2764 1590 1468 1414 176 1790 21021 286 --
NM_015209chr142066 1473 801 285 12332 ----
NM_015215chr163089 3019 2738 2346 623 477 12789 12426 --
NM_015216chr561221 1168 1069 570 558 323 21159 103 ----
NM_015230chr481903 1589 1531 1432 1363 1210 304 99 --1494 --
NM_015233chr132398 283 ------
NM_015236chr421428 1352 ------
NM_015247chr16105065 3809 3784 3761 3266 2082 1930 1293 852 537 34291 4195 235 1453 11731
NM_015250chr91823 ------
NM_015251chr1642139 2097 1987 849 22242 206 ----
NM_015263chr152116 103 ------
NM_015265chr232675 2276 1022 11049 12356 --
NM_015267chr1231842 1421 529 --1362 --
NM_015268chr31221 1586 ----
NM_015269chr11439 ------
NM_015271chr4104239 3600 3503 3331 3107 1725 1507 1195 444 395 43441 3433 2685 1470 1217 --
NM_015272chr1661637 1575 760 282 254 97 11865 ----
NM_015275chr1231493 352 314 21988 674 --11857
NM_015277chr182694 598 11289 11175 --
NM_015285chr1862402 1870 1818 1597 752 711 --21645 407 --
NM_015286chr1552111 1939 451 278 253 12523 191 11996
NM_015296chr1321146 1031 --1456 --
NM_015299chr1483972 3904 3744 3529 2496 1553 1305 842 --22459 1335 12697
NM_015310chr8108318 6965 5409 3325 3148 2632 2594 2431 2143 1146 38175 2940 2000 37621 3370 517 26462 364
NM_015315chr521029 877 --12537 2939 607
NM_015316chr1421212 220 ------
NM_015317chr241098 948 91 49 22642 32 --11962
NM_015336chr1262232 1959 1065 403 371 128 2985 723 22489 519 1803
NM_015344chr832116 1884 1417 --1697 1261
NM_015347chr1232807 1805 926 12633 1210 --
NM_015349chr662730 2664 2355 1891 724 458 ------
NM_015355chr1731345 323 294 ------
NM_015358chr2111170 ------
NM_015359chr832396 2012 1038 12431 --11852
NM_015365chrX41253 1159 925 278 11075 33950 3897 865 --
NM_015367chr2261642 1571 1197 547 227 61 ------
NM_015375chr144129 1448 1130 71 11648 11111 11358
NM_015381chr2231777 1755 494 ------
NM_015385chr1042910 2285 2012 1021 23118 291 --11078
NM_015387chr222102 1414 11402 1254 --
NM_015394chr12----21622 84 2872 268
NM_015396chr321325 576 11253 ----
NM_015423chr1131471 1156 234 11416 ----
NM_015436chr493367 3123 2840 2778 2487 1328 1248 495 458 33274 2266 2140 ----
NM_015443chr17----1126 --
NM_015446chr141055 561 427 90 ------
NM_015455chr593863 3186 2583 1137 1042 992 744 695 338 32889 124 54 1442 1437
NM_015458chr8125213 4496 3644 3489 3333 1436 1184 834 717 665 589 555 25332 4772 11276 --
NM_015461chr181602 ------
NM_015496chr8179 ------
NM_015508chr3--1325 ----
NM_015520chr312316 --22304 1078 1612
NM_015525chr641079 735 460 75 1264 1352 1413
NM_015534chr12956 225 ------
NM_015535chr264149 3679 3484 3048 3030 1273 24163 3181 1799 1423
NM_015541chr331301 1250 148 --1394 --
NM_015549chr141451 ------
NM_015550chr773449 3316 3253 3123 520 335 141 13392 --12365
NM_015554chr1582465 2289 2155 2031 1944 796 715 285 21090 887 12054 --
NM_015555chr641751 1223 1196 1150 2646 145 21312 270 --
NM_015560chr352617 2514 2153 983 973 22080 994 ----
NM_015564chr583173 2818 2418 2217 1412 1258 510 334 41359 936 908 230 ----
NM_015565chr2142031 753 736 315 11998 1719 --
NM_015567chr132815 177 --1925 1880
NM_015568chr2062941 2866 2662 1521 477 435 11031 23214 629 14125
NM_015569chr164768 4088 3869 3648 1328 1218 11182 24016 962 13536
NM_015571chr652033 1819 829 794 741 1464 1859 21713 848
NM_015575chr252743 970 912 893 52 --11119 --
NM_015578chr1931969 537 33 ------
NM_015601chr103972 271 126 ----1847
NM_015602chr131817 1410 514 21808 1722 21285 258 --
NM_015640chr174982 4448 1760 1673 1398 1097 139 35240 3617 768 14668 --
NM_015657chr22419 298 ------
NM_015678chr131629 1689 11304 --
NM_015687chr61467 2369 97 ----
NM_015693chr41267 ------
NM_015844chr182945 335 ----1856
NM_015846chr182945 335 ----1856
NM_015847chr182945 335 ----1856
NM_015853chr11123 ------
NM_015866chr141303 1011 970 92 11110 --11506
NM_015869chr32167 82 167 ----
NM_015878chr821540 1395 42015 1553 723 81 ----
NM_015879chr18137843 7727 6898 6705 6590 6190 2788 2573 2189 1774 1237 1090 894 36145 2227 1751 17439 --
NM_015885chr11168 1229 2788 53 --
NM_015886chr8105447 4987 4634 4079 2254 2235 1276 1091 593 76 35237 3471 1076 31803 1167 950 --
NM_015888chr111104 42432 1170 1164 641 12216 --
NM_015889chr221902 ------
NM_015895chr62168 30 ------
NM_015901chr101846 ------
NM_015902chr82377 261 ------
NM_015905chr7--172 ----
NM_015906chr184219 3922 3769 3692 3113 3062 1548 827 23793 1903 ----
NM_015912chr81214 1344 --12080
NM_015915chr14----1290 --
NM_015920chr155557 272 250 83 24 ------
NM_015939chr202662 25 ------
NM_015949chr71963 ------
NM_015975chrX31343 633 357 --11378 --
NM_015984chr11458 ------
NM_015990chr42738 50 1724 ----
NM_015994chr144573 168 123 105 1510 1229 --
NM_016009chr1154125 4069 4014 3911 3852 3346 3276 1377 959 927 706 695 473 409 341 54417 1558 1546 754 624 1178 --
NM_016018chr882481 2346 2249 1906 1041 494 372 290 32333 422 86 12062 --
NM_016023chr892094 1988 1795 1654 1592 1574 1343 804 191 61968 1842 707 661 579 446 ----
NM_016026chr1411421 21159 1043 --1311
NM_016045chr2011574 11469 --11753
NM_016061chr241201 304 263 57 11564 1456 1129
NM_016073chr1531082 906 416 ------
NM_016075chr1373011 2985 2692 2409 879 700 164 32613 2314 290 32975 314 99 1216
NM_016076chr193157 3073 2839 2413 2384 2356 1226 400 231 12195 11212 1958
NM_016078chr173939 914 794 --1843 --
NM_016083chr683752 3603 3068 882 734 687 58 36 53654 2750 2735 2464 291 168 12997
NM_016100chr201142 1413 ----
NM_016101chr16189 11338 ----
NM_016107chr531076 386 90 ----1102
NM_016120chrX21208 260 2974 214 --11031
NM_016121chr141113 919 881 63 11025 ----
NM_016125chr172536 408 ------
NM_016131chr262209 2152 691 420 383 319 12371 ----
NM_016132chr1562763 2700 2368 2271 1024 46 11145 --12351
NM_016138chr1671727 1555 1349 1325 645 108 44 --11707 --
NM_016141chr31116 ------
NM_016201chr331947 820 533 --11940 --
NM_016206chr3248726 8654 8593 8552 8014 7412 7169 7068 6658 6649 6557 5994 5947 5449 2925 2186 2061 2044 1802 1759 1302 1267 1229 669 66381 2296 1904 1345 1315 1011 33193 2334 2053 26446 1402
NM_016217chr683146 2596 2528 682 464 305 251 182 1103 22282 293 1869
NM_016218chr54436 360 191 61 ------
NM_016224chr64829 353 319 263 ------
NM_016226chr12--1408 1325 --
NM_016235chr16130 ------
NM_016248chr1353303 2462 1425 852 185 44027 3850 2895 803 23411 3063 --
NM_016252chr2----1607 1728
NM_016255chr692985 2586 2515 2442 2159 2148 785 345 295 33122 289 269 ----
NM_016258chr11144 ------
NM_016260chr2167546 7538 6523 6053 5770 5446 5394 4945 4608 2933 2897 2650 2418 2346 2323 1469 46715 5728 2269 2035 42490 1380 1200 576 1253
NM_016271chr1862325 2179 2085 871 751 292 21713 412 ----
NM_016275chr331010 770 386 31052 757 686 12132 22648 2123
NM_016289chr252309 1765 1703 625 102 12343 11746 12043
NM_016300chr31422 ------
NM_016308chr121679 409 21995 680 --11695
NM_016312chr121139 --1156 --
NM_016315chr261615 1559 1523 1343 1223 244 ------
NM_016328chr7154 ------
NM_016338chr5------1202
NM_016340chr511002 ------
NM_016355chr12--1410 ----
NM_016357chr121109 1469 1391 --
NM_016395chr1521485 660 145 1153 11588
NM_016396chr1562477 2464 1915 662 512 215 32455 2180 1053 ----
NM_016400chr153284 168 37 --1125 1150
NM_016422chr1182927 2887 2811 2519 2383 2105 703 347 --12905 1485
NM_016441chr241876 1855 73 50 21885 745 ----
NM_016447chr71197 ------
NM_016467chr231410 942 42 21418 1209 ----
NM_016485chr651975 532 348 337 127 ----1504
NM_016486chr11334 ------
NM_016488chr1231735 607 521 31774 1222 723 1258 --
NM_016507chr1772869 2595 2428 2102 434 427 66 12725 12514 --
NM_016513chr673573 3533 3468 1439 935 757 23 1417 13292 --
NM_016519chr43546 524 510 1472 ----
NM_016530chr15103391 3300 3119 2988 2788 2662 2518 678 631 539 23620 1060 23785 3204 --
NM_016531chr484037 3061 2595 1536 1025 651 552 122 43914 3140 3131 1487 32862 1281 131 --
NM_016542chrX51719 1629 1378 1246 106 31289 709 491 ----
NM_016544chr2103898 3856 2666 2505 2412 1353 706 508 249 94 22966 2530 23823 1279 --
NM_016559chr331244 1109 80 1608 ----
NM_016577chr364197 4153 4101 3051 1584 1449 41609 923 279 268 31726 1639 1324 --
NM_016578chr11129 1477 ----
NM_016588chr61330 2894 820 ----
NM_016589chr31319 2207 104 ----
NM_016603chr551928 1425 1404 296 110 ------
NM_016612chr81480 ------
NM_016617chr1342001 1939 1886 336 31847 1653 593 21904 676 --
NM_016622chr242078 1346 276 198 12142 --1669
NM_016630chr152518 215 ------
NM_016631chr212970 776 1868 1189 --
NM_016651chr142389 362 11102 ----
NM_016653chr2--31029 970 963 --1770
NM_016824chr103542 343 202 11338 1477 --
NM_016831chr172341 2323 2213 2140 1523 898 172 12292 ----
NM_016946chr173132 2960 2817 2499 1436 1344 363 --33505 2572 331 --
NM_016950chr431527 1429 230 21452 375 --1589
NM_017412chr821236 562 ----1509
NM_017420chr14103664 3469 2985 2970 2945 2784 1490 904 752 682 21103 886 1847 --
NM_017423chr44828 589 527 46 11546 1654 --
NM_017437chr1422314 325 31909 1763 847 1106 --
NM_017440chr12--1172 ----
NM_017444chr861453 1287 1244 460 430 326 1629 ----
NM_017447chr2194356 4229 4090 4010 3225 3125 1596 843 749 23741 616 13178 11651
NM_017452chr2031371 1294 80 ------
NM_017453chr2031371 1294 80 ------
NM_017454chr2031371 1294 80 ------
NM_017489chr81366 187 --11038
NM_017516chr1121103 1063 ----196
NM_017522chr131434 541 139 ------
NM_017563chr386383 6120 5448 5376 5351 977 595 454 14447 36234 1644 512 --
NM_017577chr32263 225 1536 1557 --
NM_017581chr4296 56 1327 ----
NM_017594chr943271 2904 2302 1067 --22435 196 --
NM_017599chr1252109 1761 1740 736 314 ------
NM_017610chr1552129 1299 739 384 333 1411 ----
NM_017628chr4135165 5105 5046 5011 4903 4814 4612 4049 3761 1792 982 723 264 2299 44 ----
NM_017632chr42167 125 ------
NM_017633chr683904 3585 2794 2600 2556 1542 1446 1104 11513 11581 --
NM_017634chr862000 1744 1609 762 752 369 31792 1755 110 ----
NM_017635chr1121412 1397 1381 --11568
NM_017637chr9159402 9007 8799 8499 8257 8133 7592 7289 7054 6575 3741 1546 496 239 198 59186 6776 2841 1972 1914 ----
NM_017640chr6----1319 --
NM_017641chr123990 759 259 ------
NM_017643chr1783016 2213 2136 745 738 608 239 191 12915 --11023
NM_017644chr3135045 4988 4965 4473 4438 4160 4090 1782 1480 1398 1147 939 269 14525 11736 --
NM_017645chr932911 2598 1182 32068 761 741 ----
NM_017650chr7105520 5175 4331 3882 2234 2227 2018 1488 792 375 36020 5998 1642 ----
NM_017654chr751700 1475 485 68 28 11317 11247 --
NM_017657chr21188 --1703 --
NM_017658chr1434462 3153 1736 33879 3351 2847 --33492 2939 711
NM_017666chrX11673 ------
NM_017667chr71529 2563 217 ----
NM_017672chr1531374 273 116 11053 ----
NM_017705chr1593680 3101 3069 2616 2465 898 373 354 268 --23807 2763 --
NM_017709chr153639 1376 1131 892 336 24322 2737 13255 11172
NM_017712chr1945093 617 370 288 1413 --11729
NM_017737chr141791 1719 1516 1447 --1775 --
NM_017742chr1831633 1208 319 1233 ----
NM_017745chrX--1565 ----
NM_017753chr94900 399 391 216 --1842 --
NM_017761chr13453 288 23 --178 --
NM_017762chr1552346 1845 782 121 84 --1505 --
NM_017770chr692495 1818 811 600 559 528 425 341 163 ------
NM_017784chr321097 883 --1184 --
NM_017801chr322124 975 22567 2373 --1469
NM_017813chr8105155 4483 4279 3849 3531 2341 2238 1287 329 276 35369 3869 3671 1288 33786 1876 1552
NM_017831chr18123891 3862 3519 3491 3383 1565 1424 1389 1144 433 286 181 11342 24468 4034 14727
NM_017832chr921171 349 --11143 --
NM_017845chr42217 150 ------
NM_017905chr134681 671 643 180 ------
NM_017907chr111430 ------
NM_017915chr1231022 468 180 --1491 --
NM_017919chr975848 5760 4864 4397 3635 2150 647 23602 1985 ----
NM_017935chr46765 659 638 157 140 70 --132 --
NM_017938chrX22147 1711 182 ----
NM_017944chr1162928 2262 1250 1002 856 410 13075 ----
NM_017945chr31437 ------
NM_017964chr24966 767 372 52 ------
NM_018004chr3------1154
NM_018010chr3--21523 1299 21373 580 21338 595
NM_018015chrX1279 1948 1230 --
NM_018017chr1042796 1919 712 662 22542 1952 --1242
NM_018025chr191242 ------
NM_018031chr31223 ------
NM_018036chr1443874 3542 1724 665 1138 34292 1406 491 --
NM_018046chr551953 1574 1222 194 48 51742 1495 1231 748 408 1589 --
NM_018048chr1251987 1856 1347 760 579 ------
NM_018051chr71126 ------
NM_018061chr151296 695 442 346 51 --1594 --
NM_018071chr141101 ------
NM_018078chr4--2912 785 ----
NM_018084chr262826 2751 661 426 353 274 23017 625 1382 12126
NM_018085chr147519 3259 3227 794 --1912 26422 1910
NM_018089chr21180 ------
NM_018092chr1631469 1122 165 21671 425 ----
NM_018098chr33777 406 222 1262 3376 349 239 --
NM_018126chr441343 1112 115 106 1998 ----
NM_018132chr62203 51 138 1279 --
NM_018133chr352203 1856 1745 773 748 ------
NM_018137chr131402 1126 1112 --11082 --
NM_018151chr23728 652 504 1242 1591 --
NM_018155chr393112 2998 2720 2330 2250 1110 894 865 381 32581 965 491 ----
NM_018157chr1243195 3110 379 68 12022 1297 --
NM_018164chr12125 ------
NM_018169chr121391 ------
NM_018181chr1821691 291 11937 --1670
NM_018182chr1751590 818 491 306 132 ----1144
NM_018184chr321955 1479 --21580 825 --
NM_018206chr164727 703 694 556 1243 ----
NM_018211chr191937 1684 1668 1631 1528 1521 1366 810 401 1675 ----
NM_018214chr621167 314 21176 1103 ----
NM_018221chr22395 381 --1347 --
NM_018227chr452571 2424 1026 384 268 12813 --1473
NM_018243chr494042 3858 3704 3677 3592 2544 1179 835 779 --13240 --
NM_018254chr132405 1501 586 1617 32296 1753 1720 --
NM_018257chr2062356 1990 1973 527 480 251 ------
NM_018266chr32953 862 ----11101
NM_018272chr121198 ------
NM_018287chr1031194 1100 256 ------
NM_018293chr342744 2617 2533 2042 12488 --1797
NM_018294chr10174 ------
NM_018299chr842979 2903 2447 1179 --12409 --
NM_018307chr172773 683 1910 ----
NM_018313chr351840 1644 865 843 813 ----11676
NM_018314chr113738 700 565 ------
NM_018319chr1451331 612 571 327 58 2380 26 ----
NM_018323chr42493 73 1109 ----
NM_018325chr921666 1338 1353 ----
NM_018328chr21340 ------
NM_018335chr14--1523 ----
NM_018348chr163803 401 312 21240 79 1210 1931
NM_018351chr1294761 3942 3696 3116 1756 1624 1236 756 45 --13745 1655
NM_018352chr421011 246 ------
NM_018361chr873638 3555 2660 2476 1247 371 137 22762 1411 186 13509
NM_018362chr1183793 3754 3188 2921 2694 1462 1163 107 44031 2933 1315 994 11075 --
NM_018364chr163426 3382 3012 2562 1438 466 33989 2617 657 11596 --
NM_018370chr1231439 483 130 ------
NM_018372chr11182 ------
NM_018373chr14126489 6377 6100 5995 5958 5722 5441 5007 4656 3966 1825 295 14763 14502 1629
NM_018374chr7114680 4422 4164 3808 3303 3223 1921 1827 886 400 198 34454 4145 1114 --1213
NM_018375chr1441670 1523 1398 535 11407 1295 --
NM_018398chr3--1312 ----
NM_018409chr462858 2701 2099 704 426 311 2502 470 --11984
NM_018413chr12--141 ----
NM_018416chr1241885 1813 523 48 1319 ----
NM_018420chr152056 1864 1089 1009 462 1344 --1230
NM_018424chr971681 1440 1287 762 679 265 180 11261 --1714
NM_018429chr552430 2399 2124 2070 1115 --11971 --
NM_018433chr21532 1540 ----
NM_018440chr8128101 7702 7087 5990 5404 3048 3027 2806 1554 795 653 609 35505 2976 1031 37189 5482 2795 11625
NM_018444chr851559 1469 942 453 181 32167 2037 542 ----
NM_018448chr1231153 998 355 --11105 --
NM_018452chr6_random42720 2411 1283 719 13173 33619 3255 1471 --
NM_018456chr3247 29 ------
NM_018466chrX4740 733 690 256 ------
NM_018476chrX1185 --155 --
NM_018482chr842146 1756 1609 824 ------
NM_018490chr1171583 1397 1246 578 371 311 254 1587 ----
NM_018555chr1971709 1690 1656 880 595 479 118 22121 1968 ----
NM_018557chr25568 357 311 260 225 ------
NM_018566chr144540 1550 683 516 11971 14562 23552 962
NM_018569chr461605 1575 1460 1056 249 158 31421 606 220 ----
NM_018584chr1193 ------
NM_018638chr12165345 5336 4926 4061 3561 2204 2177 1841 1471 1441 909 731 515 226 146 48 55432 5403 4878 1155 269 13886 11500
NM_018640chr1262390 2148 1870 1126 889 519 --31786 1036 606 --
NM_018650chr172166 2056 1840 1526 717 113 98 3864 783 506 ----
NM_018652chr152222 209 1107 ----
NM_018657chr32692 583 ------
NM_018658chr171241 1154 ----
NM_018662chr1114241 4227 3957 3187 2943 1751 698 670 496 216 175 34009 536 472 --13005
NM_018682chr7--1496 ----
NM_018695chr572442 2213 1579 1571 880 712 579 21950 910 ----
NM_018698chrX153 11633 ----
NM_018703chr161295 ------
NM_018710chr841296 1095 511 135 ------
NM_018712chr1131523 384 359 ------
NM_018713chr13881 856 170 ------
NM_018715chr132180 652 284 ----189
NM_018834chr51318 ------
NM_018841chr1103288 3144 3130 3091 2707 1583 1375 1341 798 763 ------
NM_018844chr751988 1874 1612 1532 680 21468 73 21881 733 --
NM_018846chr73682 271 258 ------
NM_018847chr921957 1475 21981 43 1778 --
NM_018890chr721415 234 ------
NM_018898chr572227 1994 1937 1667 924 681 123 22021 1813 ----
NM_018899chr572227 1994 1937 1667 924 681 123 22021 1813 ----
NM_018900chr572227 1994 1937 1667 924 681 123 22021 1813 ----
NM_018901chr572227 1994 1937 1667 924 681 123 22021 1813 ----
NM_018902chr572227 1994 1937 1667 924 681 123 22021 1813 ----
NM_018903chr572227 1994 1937 1667 924 681 123 22021 1813 ----
NM_018904chr572227 1994 1937 1667 924 681 123 22021 1813 ----
NM_018905chr572227 1994 1937 1667 924 681 123 22021 1813 ----
NM_018906chr572227 1994 1937 1667 924 681 123 22021 1813 ----
NM_018907chr572227 1994 1937 1667 924 681 123 22021 1813 ----
NM_018908chr572227 1994 1937 1667 924 681 123 22021 1813 ----
NM_018909chr572227 1994 1937 1667 924 681 123 22021 1813 ----
NM_018910chr572227 1994 1937 1667 924 681 123 22021 1813 ----
NM_018911chr572227 1994 1937 1667 924 681 123 22021 1813 ----
NM_018947chr7104814 3614 3310 3207 1415 1401 1279 704 619 189 44908 4894 683 508 --11495
NM_018953chr121766 ------
NM_018970chr743072 2176 1270 1262 22053 1193 12076 --
NM_018983chr41279 ------
NM_018992chr1641590 1400 1129 462 11560 ----
NM_018993chr2041459 1205 1180 986 ------
NM_018999chr10104885 4673 4413 3860 3340 3273 3155 3084 1928 1275 23960 1807 13932 1509
NM_019001chr374592 4287 3586 1777 1580 760 235 13025 11136 --
NM_019004chr762315 1992 1924 1528 422 184 12283 ----
NM_019022chr1863134 2715 2543 2461 447 225 --42372 1266 65 52 --
NM_019032chr11707 ------
NM_019041chr622127 145 12234 ----
NM_019044chr244723 3971 3840 1246 14436 13605 --
NM_019050chr42727 639 21522 1478 --1710
NM_019067chrX84632 4161 3725 3322 3099 1804 1027 295 --13833 --
NM_019071chr71155 ------
NM_019072chr573654 3508 3234 1518 1353 581 164 32670 1102 1086 --12654
NM_019080chr1311499 ----11244
NM_019083chr141645 1417 429 344 21135 423 1589 --
NM_019084chr1062566 2364 2152 725 533 489 ----196
NM_019087chr521256 699 11173 1216 --
NM_019094chr1272415 2338 900 762 595 210 104 23290 910 ----
NM_019095chr203231 225 188 ------
NM_019098chr851691 1629 1592 740 422 11718 ----
NM_019114chr941795 759 326 236 31021 579 567 1626 --
NM_019117chrX73314 3193 3059 1282 1225 727 252 22904 2427 --11379
NM_019555chr351544 1335 693 304 171 --2406 191 --
NM_019593chr2062529 1057 1016 261 218 82 1673 ----
NM_019610chr111795 --3849 805 597 --
NM_019854chr121626 ------
NM_019857chrX21769 656 1565 --1156
NM_019891chr141296 1188 993 429 3884 125 89 2903 521 --
NM_019895chr34264 221 176 123 1894 ----
NM_019903chr103542 343 202 11338 1477 --
NM_020061chrX190 ------
NM_020062chr201702 ------
NM_020066chr13988 209 159 --1700 --
NM_020116chr44682 312 113 70 --11677 --
NM_020122chr275399 5280 2100 1849 1342 1303 847 14196 35429 722 584 --
NM_020130chr831335 910 491 ------
NM_020133chr665640 5467 5036 4130 791 142 46094 5925 4310 2178 ----
NM_020141chr1112263 2118 1788 928 815 636 518 444 411 343 214 ------
NM_020143chr23369 351 239 2398 194 ----
NM_020144chr761890 1568 1557 1446 1324 659 ------
NM_020148chr1863098 2409 2097 1005 988 108 1361 ----
NM_020150chr1062238 1959 1782 1434 399 129 1808 ----
NM_020157chr204839 646 282 108 1891 ----
NM_020159chr451565 1497 1179 1109 613 ----1549
NM_020177chr5142952 2890 2781 2716 2243 2144 1121 1082 944 866 824 795 345 148 42843 2591 2427 956 13040 12620
NM_020180chr1811006 ------
NM_020194chr2--1660 ----
NM_020205chr172493 2465 2137 1261 1171 834 534 13241 ----
NM_020228chr1121715 255 1481 --1753
NM_020245chr634015 3534 984 43305 3251 1989 1650 13343 --
NM_020341chr2051665 1541 1328 474 441 21804 1752 --11497
NM_020342chr252421 2316 1936 1646 1059 22242 2189 2579 548 11659
NM_020344chr91132 ------
NM_020347chr351723 676 570 321 228 22179 2034 ----
NM_020357chr331126 476 171 ----11502
NM_020386chr3136 ------
NM_020390chr3113943 3934 3897 3470 3351 3193 1568 1302 943 720 199 34068 1779 53 ----
NM_020409chr32322 22 ------
NM_020420chrY4564 547 175 84 ------
NM_020425chr641882 1802 1671 585 --11447 --
NM_020443chr196947 5759 5600 4771 2643 2074 1855 1830 551 35417 2470 787 36784 2397 2015 1997
NM_020449chrX2727 60 ------
NM_020463chr231067 610 353 31306 1204 70 ----
NM_020466chr674561 4274 3651 1861 1571 1556 1483 24554 1665 11301 13472
NM_020473chrX41450 1337 209 105 11719 11922 1462
NM_020474chr1841857 1757 1424 250 1817 11692 --
NM_020640chr351757 907 525 496 403 ------
NM_020647chr841798 1458 843 286 2883 669 ----
NM_020648chr1842818 2772 2545 706 12535 11795 --
NM_020651chr281812 1479 1453 587 189 167 120 36 2576 258 ----
NM_020666chr52837 757 1642 --1923
NM_020673chr20167402 7130 6529 5988 5063 4880 2088 1710 1530 1496 1308 977 892 740 205 105 26902 2648 16409 --
NM_020689chr2011537 ------
NM_020711chr262561 2525 2423 2234 1044 595 22608 1685 1285 --
NM_020717chrX84524 4420 3719 3579 3444 1762 1677 1390 33801 3412 1120 44603 3890 3877 388 --
NM_020718chr16156620 6419 6242 5896 5806 5795 5758 5554 4861 4749 2389 2179 1761 853 591 25847 5003 16515 16185
NM_020726chr51100 ------
NM_020727chr2153319 3202 1444 1143 703 53132 2665 875 801 592 ----
NM_020728chr732442 1981 179 1724 ----
NM_020739chr15144093 4075 4055 3991 3883 3762 3683 3486 3447 3322 1662 1232 1091 941 13042 --1120
NM_020748chr1751783 790 702 353 289 11541 2199 55 --
NM_020752chr1082889 2825 2419 2373 2191 2130 775 615 ------
NM_020755chr641549 1303 1125 431 --1499 --
NM_020764chr161444 11131 ----
NM_020766chrX34301 3853 3107 24597 1052 21039 295 --
NM_020768chr532079 491 417 ------
NM_020771chr651278 1049 598 557 124 21383 304 ----
NM_020772chr17168314 7771 7135 7031 6428 5567 5297 3385 3061 3012 2971 2602 2331 1989 831 217 37370 7166 1031 1774 --
NM_020774chr18135941 5563 5090 4657 4478 4219 2236 1460 828 788 328 239 68 14079 26164 2310 14426
NM_020775chr11135 ------
NM_020781chr742029 1266 166 120 22722 651 12006 --
NM_020782chr1284744 4665 1882 1842 1820 1693 815 356 2960 824 --13029
NM_020783chr182955 392 12013 ----
NM_020792chr352313 961 526 175 124 --12641 12611
NM_020794chr161355 1285 996 977 554 60 11334 11434 --
NM_020796chr522481 954 1491 ----
NM_020800chr311027 21378 938 ----
NM_020806chr14------1147
NM_020810chr1493371 3300 2949 2515 2225 1191 699 444 55 11167 ----
NM_020819chr641016 898 849 129 --1870 --
NM_020825chr1643629 3433 2629 2458 1822 ----
NM_020841chr1274034 4021 3977 3628 3464 879 403 23122 2472 --1648
NM_020844chr8167389 7175 6496 6264 6213 5551 5362 4931 2494 2029 1700 1623 1495 1415 1161 76 36227 3045 2846 22753 1379 11220
NM_020853chr1292323 2016 2002 1706 330 298 263 176 157 --11956 --
NM_020859chr433513 3427 2549 44049 4022 4004 58 --13996
NM_020860chr411178 1768 ----
NM_020868chr241481 1429 368 171 31724 1364 416 ----
NM_020870chr441494 1379 389 313 1702 --11776
NM_020871chrX72509 2469 2179 1852 1609 820 389 42313 2025 309 291 ----
NM_020872chr341822 1754 1101 326 11533 1212 1174
NM_020873chr31578 ------
NM_020898chr12----1233 --
NM_020899chr1762439 2273 1752 606 305 190 --1907 --
NM_020909chr284071 3116 3094 2956 1569 1384 939 267 13687 1469 --
NM_020918chr1063243 2599 2351 1367 370 157 --22614 1402 --
NM_020920chr14--1404 ----
NM_020922chrX61875 1385 1221 608 490 480 ----11456
NM_020935chr263597 3426 1214 835 660 83 33545 3264 2921 13292 --
NM_020940chr1012316 1594 ----
NM_020948chr163466 2674 2579 842 799 120 23052 300 --12395
NM_020951chr1932299 2288 1973 --12030 --
NM_020975chr1061987 1961 1898 1825 228 63 1411 11810 --
NM_020980chr1531695 649 630 11340 ----
NM_020987chr103401 200 185 ------
NM_020993chr1232761 1999 807 ----12439
NM_021005chr1521127 152 --1777 1138
NM_021007chr222297 1508 2701 285 1413 --
NM_021032chr331822 1457 796 21502 630 ----
NM_021033chr1363539 2743 679 440 251 103 ------
NM_021072chr532491 2095 2005 1505 2931 786 --
NM_021076chr221150 ------
NM_021097chr252347 2166 513 232 26 1446 ----
NM_021101chr352521 1637 906 532 86 32312 1802 103 22440 720 1673
NM_021116chr769082 8338 7940 7444 2233 1263 15546 --26925 2772
NM_021144chr92469 113 ------
NM_021145chr73398 268 97 2924 106 ----
NM_021148chr782480 2433 2289 2226 2185 1703 446 412 ------
NM_021161chr142571 487 ------
NM_021183chrX31790 1611 807 11870 --12412
NM_021190chr111066 --11159 --
NM_021191chr1272417 2330 2286 2071 1883 1683 296 32300 1624 639 ----
NM_021215chr2052391 1963 881 636 347 12180 41668 701 612 199 --
NM_021222chr161199 572 477 338 231 107 --21416 309 --
NM_021229chr122932 89 ------
NM_021238chr1242109 2035 542 48 11694 ----
NM_021239chr1431237 129 66 ------
NM_021242chrX2978 879 11017 ----
NM_021252chr1081713 1638 1589 1434 1353 617 539 196 ------
NM_021255chr1493943 3546 3060 2955 2795 1426 1197 542 361 23709 1084 33185 3134 633 --
NM_021622chr1052169 1735 1543 544 491 --1154 --
NM_021629chr344223 4135 3817 3785 64939 3991 1350 1033 966 632 14277 1491
NM_021645chr132747 725 21725 1719 11733 --
NM_021647chr494624 3638 3632 3614 3474 3109 3100 1499 171 --24348 3551 --
NM_021648chr632682 2001 371 1347 ----
NM_021813chr685821 5696 4424 4195 3769 3673 1056 353 15563 ----
NM_021814chr61629 31139 426 315 11301 11173
NM_021815chr253026 2807 2752 1156 950 22902 2397 1396 13071
NM_021911chr565230 4828 1954 1708 1400 459 45208 5058 4188 1111 --25555 2066
NM_021912chr1594222 3766 3592 3464 3261 3066 3055 2795 279 14106 ----
NM_021922chr61725 ------
NM_021923chr411516 ------
NM_021931chr2011030 ------
NM_021935chr34877 732 319 179 1925 ----
NM_021949chrX42861 2647 2234 949 12844 ----
NM_021954chr13103222 3183 2929 2340 2275 1361 1135 532 481 284 13059 11125 --
NM_021960chr152387 1924 1852 717 380 1912 1748 --
NM_021961chr1187243 6498 6310 6200 5331 4980 962 495 32669 1484 867 27191 1033 --
NM_021964chr396536 6082 5998 5406 4918 4644 4468 2340 354 76439 4826 4007 1581 1304 613 605 24348 934 34813 1926 410
NM_021973chr4------1606
NM_021998chrX21026 957 ----1194
NM_021999chr13------1573
NM_022037chr21715 1909 ----
NM_022048chr15106272 5669 5279 5014 4725 2287 1681 994 641 634 ------
NM_022049chr161811 1623 1497 1195 633 318 ------
NM_022058chr262009 1881 1576 620 462 109 1606 1303 11785
NM_022068chr18143 ------
NM_022073chr1441561 1494 1137 564 ------
NM_022079chr103972 271 126 ----1847
NM_022114chr144797 1408 592 192 14101 44769 4489 1398 469 --
NM_022123chr141513 ----1527
NM_022130chr531421 1125 561 ------
NM_022133chr851842 1803 1751 476 44 ------
NM_022143chr751604 639 512 218 111 1149 1383 --
NM_022154chr41864 ------
NM_022166chr16106341 6100 5934 5246 4709 4687 4442 3960 2249 34 14010 14338 --
NM_022173chr21715 1909 ----
NM_022351chr8103890 3546 3293 3158 1547 1074 962 576 173 93 --22409 324 22901 2505
NM_022373chr7181 ------
NM_022454chr82148 138 ------
NM_022456chr12127197 7138 6234 5961 5036 4899 4735 2067 1806 1099 230 160 26228 1112 27035 6686 --
NM_022459chr13155993 5817 5722 5483 5364 4568 4369 3868 1870 1356 510 354 205 73 25 36334 4993 1064 --11232
NM_022461chr3--11086 11345 1216
NM_022469chr172962 2627 2511 2466 2144 2091 1337 12911 ----
NM_022474chr1462195 1908 851 738 684 487 12612 ----
NM_022475chr43588 488 269 1121 ----
NM_022476chr164954 943 770 445 ------
NM_022482chr2041852 1836 1754 1568 12568 1765 --
NM_022491chr1283559 3479 3341 3070 3018 2562 2452 900 ----1424
NM_022495chr141457 ------
NM_022550chr5175 2494 113 ----
NM_022566chr153548 492 136 ------
NM_022728chr72504 144 ----1555
NM_022733chr11906 ------
NM_022739chr1731074 971 340 ------
NM_022753chr172335 2108 1934 1806 929 353 170 32524 2167 263 12462 --
NM_022763chr362400 2364 1204 1011 603 357 2821 586 ----
NM_022776chr31261 11078 ----
NM_022781chr9123278 2953 2853 2406 2368 2239 2161 1012 561 366 77 23 12178 ----
NM_022782chr121253 ------
NM_022831chr171794 1510 1429 1334 277 265 35 ------
NM_022841chr15--1772 ----
NM_022843chr1351270 1169 1154 106 50 1154 ----
NM_022845chr1652250 2127 1712 1393 495 1314 ----
NM_022897chr51166 ------
NM_022898chr1454129 3495 1629 1559 1213 1452 ----
NM_022900chr72989 970 31181 906 348 1264 --
NM_022902chr51135 1153 ----
NM_022913chr5188 ------
NM_022915chr24638 620 569 228 ------
NM_022918chr1121882 287 21609 536 ----
NM_022977chrX32210 1889 64 2992 704 1932 --
NM_023000chr1421493 295 --11216 --
NM_023001chr1421493 295 --11216 --
NM_023012chr122513 116 1487 ----
NM_023923chr1103804 3732 3514 3290 2615 662 605 481 166 117 13054 13170 --
NM_023929chr862813 2152 2041 979 690 635 22325 801 ----
NM_023940chr41998 ------
NM_024007chr573013 2541 1959 1209 859 376 182 2771 63 ----
NM_024052chr1722995 2752 23133 679 ----
NM_024089chr132185 67 ------
NM_024090chr411421 ----11925
NM_024102chr121337 1219 ------
NM_024321chr191119 ------
NM_024345chr9105892 5795 5571 5533 4654 4445 3988 2342 699 61 13964 11439 1719
NM_024423chr18114111 3866 3806 3100 3029 2927 1352 1292 348 182 100 12957 1956 --
NM_024491chr31666 1257 ----
NM_024511chr482342 1253 1129 942 841 661 341 21 11219 13074 --
NM_024524chr362304 2258 2214 1058 948 256 1742 ----
NM_024529chr121200 860 --152 --
NM_024539chrX21110 817 189 11133 --
NM_024545chr2134 ------
NM_024548chr341778 1268 369 121 ------
NM_024563chr551730 1637 1627 472 323 ----11482
NM_024573chr63945 816 238 --1844 --
NM_024580chr15------142
NM_024582chr41890 1182 1201 --
NM_024595chr11430 ------
NM_024605chr41692 ------
NM_024607chr894085 3925 3395 1712 1257 1250 942 325 252 1873 --13708
NM_024611chr1583737 3190 2922 2503 1146 807 207 56 23463 28 ----
NM_024613chr841253 1200 1176 106 31457 1440 1415 11794 --
NM_024617chr91934 1143 ----
NM_024624chr251681 1432 1314 1239 258 1183 ----
NM_024630chr62543 198 ------
NM_024631chr111529 ------
NM_024636chr761145 1121 987 817 617 47 11993 11809 --
NM_024646chr193992 3869 3419 3311 3035 2716 1486 1403 1297 13405 23210 3140 --
NM_024665chr354160 3790 1610 1275 711 1122 --1224
NM_024670chr1071262 1186 610 493 409 275 111 1551 ----
NM_024692chr21424 11425 11728 --
NM_024713chr1561599 1385 1310 337 169 60 ------
NM_024721chr831654 726 375 1925 1622 1850
NM_024740chr1163399 2951 2581 1569 887 150 44004 3815 860 163 21639 125 --
NM_024744chr262026 1991 1019 692 503 411 21929 666 2262 24 11884
NM_024749chr15835 759 664 543 105 11900 11965 1139
NM_024751chr441878 1603 1325 474 ------
NM_024755chr152758 35 1128 ----
NM_024761chr995172 5068 4309 4005 3908 3833 2120 1371 440 12085 12012 --
NM_024808chr13----1336 --
NM_024817chr1575861 5444 4481 3968 3693 1667 1275 ------
NM_024818chr331533 1420 1398 1305 --11473
NM_024824chr1441757 1715 1603 1332 --1528 11549
NM_024828chr951057 1004 425 73 23 1565 ----
NM_024834chr1051594 1386 748 679 655 ------
NM_024835chr17179 1404 ----
NM_024841chr1151887 1828 976 946 890 11578 21691 600 --
NM_024854chr1251536 1427 1048 586 299 ------
NM_024899chr183537 102 45 --1216 --
NM_024913chr731453 1121 587 --21386 25 1504
NM_024920chr421444 1144 ------
NM_024927chr171164 ------
NM_024945chr941178 833 350 56 11164 ----
NM_024947chr3199266 8465 8413 8077 7924 7110 6950 6342 6227 6028 5918 2459 2223 2097 1949 1045 607 446 124 21088 344 29344 8402 --
NM_024953chr1292815 2791 2644 2157 1890 1868 834 708 139 ------
NM_024979chr1311631 ------
NM_024989chr2238190 8180 7722 7406 7214 7134 5903 5006 3193 2999 2861 2720 2203 2051 1998 1588 1091 681 545 462 411 112 32 16205 35079 1818 1164 --
NM_024991chr1042910 2285 2012 1021 23118 291 --11078
NM_024993chr221468 509 21090 388 ----
NM_024997chr161164 1157 1916 --
NM_025004chr112572 101 --1476 1677
NM_025040chr1952267 2005 1875 1536 912 --11641 --
NM_025047chr31394 ------
NM_025054chr884156 4126 3752 3196 1217 1156 443 199 33519 2900 2565 21527 818 --
NM_025057chr1441308 1023 1003 459 1110 ----
NM_025073chr1113659 3122 2993 2929 1483 1449 1148 400 335 201 133 24636 1829 ----
NM_025074chr453079 3064 2112 1980 1207 11916 ----
NM_025125chr1021628 80 ------
NM_025134chr1662525 2479 2041 2003 682 387 42148 2026 1038 571 1448 --
NM_025138chr1351474 1303 1019 926 281 21433 69 11069 1556
NM_025147chr2--1302 ----
NM_025151chr842190 1935 1841 1666 12050 ----
NM_025152chr1442003 1974 509 202 21704 348 ----
NM_025160chr1103922 3664 3224 2727 2633 1584 1359 1044 948 453 11213 --1735
NM_025191chr153355 3325 2841 2635 1420 23063 2246 43200 2524 1105 155 --
NM_025208chr1162234 809 461 425 412 136 ------
NM_030583chr82799 182 --1221 --
NM_030621chr1473558 3457 3192 2998 1477 1248 871 13937 --23680 121
NM_030627chr583884 3332 2882 1246 1155 1015 951 776 23704 1436 23265 1313 --
NM_030637chr142548 213 1618 --2491 133
NM_030647chr7115742 4378 1964 1853 1827 1559 1134 428 334 269 44 12236 --16335
NM_030648chr455356 3914 3850 2228 2182 45568 3626 1983 273 34191 787 48 --
NM_030650chr283479 2980 1470 1405 951 841 797 439 ------
NM_030652chr6133 ------
NM_030661chr741453 682 346 33 1564 11616 --
NM_030664chr1051717 1536 925 305 266 3783 372 332 ----
NM_030674chr12175731 5616 5166 5101 5039 4898 4477 4235 3864 2178 2098 1109 1086 1011 741 429 201 14504 25443 4919 11666
NM_030752chr61529 ------
NM_030755chr1453122 2252 804 301 112 43112 2896 2089 815 33002 2953 137 12346
NM_030758chr223980 543 70 ------
NM_030759chr101284 ------
NM_030761chr111058 160 ----
NM_030762chr12----1555 --
NM_030763chrX4892 795 282 246 ------
NM_030777chr2062399 1596 615 484 322 190 12185 32455 2299 217 --
NM_030786chr171834 1720 1415 1216 747 690 502 11363 11706 2621 480
NM_030791chr1431728 1618 729 --11557 1105
NM_030806chr1139018 8721 8481 8157 8092 7667 7234 6041 5803 3720 1859 1586 456 --25969 897 23609 2519
NM_030809chr1272331 1971 1897 1875 1775 344 281 12105 22040 477 --
NM_030817chr1253076 2380 2294 448 63 11465 ----
NM_030820chr61986 ------
NM_030917chr42154 87 ------
NM_030918chr195260 5088 4759 4688 3455 976 476 435 351 --23882 1496 13569
NM_030920chr142068 1836 444 237 ------
NM_030938chr1721045 774 1464 ----
NM_030948chr6148 ------
NM_030949chr611437 ------
NM_030953chr531050 478 144 174 ----
NM_030958chr81443 --122 --
NM_030963chr63638 450 172 2646 429 ----
NM_030972chr19----3566 482 64 --
NM_030979chr131305 3327 115 94 ----
NM_031157chr12----1442 --
NM_031203chr19142 ------
NM_031262chr91432 ------
NM_031263chr91489 ------
NM_031266chr5--2530 80 --1446
NM_031267chr7--162 ----
NM_031268chr1675375 4666 4243 3738 3707 1927 1905 15306 15314 --
NM_031271chr841701 1144 402 371 2645 153 ----
NM_031275chr111136 ----131
NM_031291chr4------1151
NM_031296chr432531 809 729 32714 1861 1807 22540 2123 32643 2006 231
NM_031298chr171132 ------
NM_031411chr572227 1994 1937 1667 924 681 123 22021 1813 ----
NM_031419chr351163 1155 1001 500 238 --1225 --
NM_031422chr18--196 ----
NM_031427chr1495804 5256 5125 5086 4584 4532 4455 866 579 25266 1881 32139 1154 631 --
NM_031435chr1263139 3076 666 464 328 122 1937 12315 --
NM_031443chr7--1396 ----
NM_031453chr1082107 2074 1910 779 591 508 460 109 12513 ----
NM_031461chr852262 2035 514 152 58 --1591 1338
NM_031468chr788218 8059 6105 5288 5104 2560 1307 1254 15069 25559 3272 18234
NM_031469chr673854 2573 1436 1193 831 427 328 11003 --12740
NM_031492chr111520 ------
NM_031844chr184026 3917 3498 3045 2562 1613 1131 1029 --2814 342 13619
NM_031849chr572227 1994 1937 1667 924 681 123 22021 1813 ----
NM_031857chr572227 1994 1937 1667 924 681 123 22021 1813 ----
NM_031860chr572227 1994 1937 1667 924 681 123 22021 1813 ----
NM_031903chr7--1266 ----
NM_031905chr711152 192 1473 --
NM_031911chr452746 2713 2198 1062 878 --2133 42 --
NM_031922chr61485 ------
NM_031935chr11773 ------
NM_031965chr171136 ------
NM_031989chr122326 254 ------
NM_032012chr954433 3471 1849 878 496 --24799 4272 --
NM_032021chr1141063 871 277 85 11165 ----
NM_032025chr341654 381 236 108 2477 331 ----
NM_032042chr571875 1138 1007 964 886 816 659 12641 --12286
NM_032047chr362422 2378 1644 1638 870 204 --1487 --
NM_032048chr18--1624 ----
NM_032102chr1143009 2891 271 66 32725 2514 856 ----
NM_032105chr156231 5212 1685 1345 552 --36662 6460 5511 15292
NM_032116chr13145893 5000 4882 4771 4198 3904 2271 2193 1351 788 537 519 256 87 35770 1221 130 45145 3850 500 478 --
NM_032138chr131177 ------
NM_032145chr641735 430 329 103 1739 ----
NM_032146chr32354 305 --147 --
NM_032153chr352715 2430 2076 1058 1028 1989 ----
NM_032154chr1051076 1056 995 783 242 ------
NM_032160chr1883635 3115 3091 2727 1744 926 684 344 24175 3152 11606 23140 3062
NM_032175chr531483 1200 736 11630 ----
NM_032182chr1071640 1270 1235 393 338 261 76 --11553 --
NM_032189chr1334654 4614 1149 24928 4603 15049 --
NM_032217chr441217 1078 507 335 1567 --1922
NM_032221chr2052051 1871 1446 1406 206 ------
NM_032228chr1163078 3056 2645 2556 362 208 2665 46 ----
NM_032229chr132329 195 1874 ----
NM_032231chr15--1328 ----
NM_032239chr421264 392 ----11039
NM_032246chr151206 1187 ----
NM_032256chr124998 781 410 61 ------
NM_032280chr53436 417 398 ------
NM_032281chr1943197 2429 2268 633 --12100 --
NM_032288chr342339 1652 492 331 22032 1583 1848 --
NM_032291chr131515 1327 1281 41505 406 338 318 11849 --
NM_032303chr951712 1391 1342 1157 133 31141 586 69 ----
NM_032315chr1154 1267 ----
NM_032352chr1441455 1176 974 27 1458 1912 --
NM_032354chr1731206 440 149 1475 1947 --
NM_032373chr10165876 5811 5663 5220 5166 5083 4457 4369 4160 4083 2061 1961 1673 1530 1437 628 14848 35120 4228 1830 11784
NM_032408chr741265 866 276 136 ----1358
NM_032410chr831089 433 350 ------
NM_032413chr152265 43 ------
NM_032433chr1921562 1474 21155 391 ----
NM_032435chr122192 2107 11483 12237 --
NM_032437chr11114 ------
NM_032438chr631628 262 239 1423 11574 --
NM_032440chr1062957 2391 2326 2167 765 621 ----12647
NM_032441chrX31181 1116 896 31061 447 149 2282 264 --
NM_032446chr583715 3451 2914 2639 1058 745 600 416 --23131 2739 12701
NM_032457chr473768 3215 3198 3160 3103 2576 1421 43869 3439 3192 2899 ----
NM_032458chrX53174 3064 2990 2259 26 --13149 --
NM_032468chr8--1631 1305 --
NM_032471chr641062 407 81 31 ------
NM_032491chr1221036 429 --1399 --
NM_032492chr32819 174 --1790 --
NM_032499chr1541752 1155 665 486 11096 ----
NM_032505chr342210 2025 1915 689 42149 1111 729 395 ----
NM_032509chr882510 2323 2168 1902 1042 822 635 164 22578 1580 2937 269 --
NM_032518chr41184 ------
NM_032520chr16--1209 ----
NM_032521chr2063057 3001 2977 2463 1264 897 ----1194
NM_032547chr451389 1167 1103 270 184 ------
NM_032560chr1421005 934 ----1980
NM_032574chr2126 ------
NM_032578chr1021251 1158 ------
NM_032582chr1741800 1725 1649 533 ------
NM_032622chr441167 993 526 373 1319 ----
NM_032682chr343438 3037 2636 218 22805 2749 --1418
NM_032778chr342486 1142 1096 610 ----1719
NM_032796chrX1325 ------
NM_032810chr1031340 1153 33 --11367 1274
NM_032828chr1984023 3621 3482 3006 1519 1096 747 158 --11663 --
NM_032832chr63474 187 50 --11289 --
NM_032833chr122672 1042 32611 2551 376 1123 --
NM_032842chr71314 21626 1443 ----
NM_032846chr1461507 1135 1008 418 380 147 ------
NM_032859chr13113712 3562 3362 2904 2881 2704 813 747 741 617 300 11524 ----
NM_032867chr11------1578
NM_032870chr62386 369 1183 152 --
NM_032873chr1174155 3943 3660 2772 1434 417 111 23747 1160 --13060
NM_032876chr1452027 1946 1495 633 328 1667 11857 --
NM_032892chr152342 291 ------
NM_032900chr1043444 2714 2454 38 13406 32761 2474 604 --
NM_032905chr103959 854 204 ------
NM_032932chr17115701 5633 2565 2489 1999 1940 1776 1546 1450 1251 1196 14462 ----
NM_032937chr9--129 ----
NM_032949chr131413 ------
NM_032961chr451407 1245 1153 1106 919 11235 1955 --
NM_032968chrX144014 3918 3630 3531 3162 1619 1193 1178 1071 867 674 668 521 133 154 --1217
NM_032969chrX144014 3918 3630 3531 3162 1619 1193 1178 1071 867 674 668 521 133 154 --1217
NM_032973chrY154006 3910 3622 3527 3157 2674 1618 1193 1178 1071 867 674 668 521 133 154 --1217
NM_032975chr1843148 3019 2905 595 --2855 785 --
NM_032980chr1843148 3019 2905 595 --2855 785 --
NM_032993chr41279 ------
NM_033012chr1341082 1008 881 816 ------
NM_033020chr184219 3922 3769 3692 3113 3062 1548 827 23793 1903 ----
NM_033027chr341061 457 444 74 ------
NM_033031chrX160 1185 ----
NM_033044chr11805 ------
NM_033067chr11656 ----1276
NM_033105chr81187 ------
NM_033132chr1332066 1589 1452 22334 175 ----
NM_033135chr1162234 809 461 425 412 136 ------
NM_033138chr752066 1816 1729 1694 173 11993 22184 1838 --
NM_033139chr752066 1816 1729 1694 173 11993 22184 1838 --
NM_033140chr752066 1816 1729 1694 173 11993 22184 1838 --
NM_033143chr484593 4190 3604 3357 3043 1681 1672 1589 33926 1658 1200 13198 --
NM_033157chr752066 1816 1729 1694 173 11993 22184 1838 --
NM_033181chr683752 3603 3068 882 734 687 58 36 53654 2750 2735 2464 291 168 12997
NM_033196chr1931185 1101 563 1992 1506 --
NM_033208chr161119 ------
NM_033211chr571778 1279 601 445 397 366 29 ------
NM_033215chrX--1373 ----
NM_033224chr7168059 7746 7489 7361 7214 6934 6903 6496 6356 2814 2009 1784 1740 1170 1154 409 37014 5824 2316 37300 6042 486 --
NM_033227chr53522 454 437 ------
NM_033228chr53562 494 477 ------
NM_033255chr131482 ------
NM_033281chr55690 371 255 160 134 ------
NM_033285chr874479 4252 3841 3132 2924 1411 390 --11291 --
NM_033290chrX52776 2355 1214 347 228 33583 2372 1326 1845 --
NM_033296chr4--1627 ----
NM_033300chr131434 541 139 ------
NM_033326chr113945 587 222 11013 1707 11970
NM_033331chr972619 2334 1100 1016 422 363 244 --1585 --
NM_033343chr11105 ------
NM_033360chr1264165 3350 1814 1764 1028 575 24598 1562 34175 3969 3663 --
NM_033379chr10------1172
NM_033380chrX1723 11144 1232 --
NM_033381chrX1723 11144 1232 --
NM_033393chr441910 925 904 522 22821 2697 ----
NM_033394chr241327 427 121 29 11005 ----
NM_033396chr111306 ------
NM_033407chr1167 1628 1581 --
NM_033425chr1143065 1254 1015 625 13507 13285 --
NM_033426chr1462873 2736 2165 2121 1906 428 12140 11995 12720
NM_033429chr1583142 3106 3054 2028 1096 714 420 266 12893 12791 22158 2050
NM_033430chr473811 3082 2737 2721 1224 1021 388 33408 3248 957 13500 --
NM_033437chr473811 3082 2737 2721 1224 1021 388 33408 3248 957 13500 --
NM_033480chr62714 708 43000 2354 2195 1954 12614 --
NM_033481chr62714 708 43000 2354 2195 1954 12614 --
NM_033495chrX----1847 --
NM_033496chr101692 ------
NM_033497chr101692 ------
NM_033498chr101692 ------
NM_033500chr101692 ------
NM_033505chr2135319 5017 4301 4276 2216 2053 1867 1750 1483 1428 866 654 102 21402 144 14821 --
NM_033535chr441149 867 852 150 ------
NM_033540chr33956 862 749 ------
NM_033551chr521029 877 --12537 2939 607
NM_033624chr121837 4904 829 636 218 1576 --
NM_033644chr552507 1857 1836 999 360 42289 751 615 267 1311 --
NM_033645chr552507 1857 1836 999 360 42289 751 615 267 1311 --
NM_033656chr21125875 4815 4766 4602 4264 4134 3783 1940 1905 778 356 230 26034 5278 35998 5958 661 14347
NM_052811chr1395124 4546 4483 3219 1855 918 388 171 128 54523 4502 3971 1711 288 35268 4652 2042 --
NM_052827chr1221122 724 ------
NM_052832chr883018 2618 1881 1855 1138 1124 702 401 22927 2816 ----
NM_052834chr1862402 1870 1818 1597 752 711 --21645 407 --
NM_052851chr1372026 1991 1958 1820 1700 770 164 1727 --11762
NM_052862chr131549 396 364 1381 --1199
NM_052867chr1371380 1294 982 530 90 79 24 --1448 --
NM_052879chr1293765 3055 1447 1086 1043 965 635 562 440 13564 13671 12667
NM_052885chr12104495 4274 4209 3959 3804 1772 1524 665 357 88 33163 267 222 43757 3462 3253 1219 13202
NM_052886chr832143 2117 866 --11838 12068
NM_052888chr171126 ------
NM_052900chr841503 1117 594 452 ------
NM_052904chr621014 337 51276 917 438 239 124 ----
NM_052905chr231772 406 142 11453 ----
NM_052913chr621017 718 ------
NM_052934chr142243 2147 1817 224 12253 1570 --
NM_052937chr872361 1029 760 691 607 544 188 12555 12259 --
NM_052953chr31275 1289 ----
NM_052954chr2151759 1606 1422 724 683 1351 ----
NM_052978chr1441795 1345 745 670 21658 201 ----
NM_053002chr321113 301 163 1933 21020 337
NM_053016chr9137313 6991 6539 6085 5873 5625 4864 2159 1678 1625 896 522 431 32196 1576 1399 ----
NM_053023chr1141237 1173 889 91 33108 2997 76 22858 2139 11205
NM_053025chr331408 1148 189 31365 1321 696 ----
NM_053026chr331408 1148 189 31365 1321 696 ----
NM_053027chr331408 1148 189 31365 1321 696 ----
NM_053028chr331408 1148 189 31365 1321 696 ----
NM_053031chr331408 1148 189 31365 1321 696 ----
NM_053032chr331408 1148 189 31365 1321 696 ----
NM_053064chr1473099 2859 2826 2718 2596 2538 2210 12781 ----
NM_053067chr92333 33 ------
NM_054026chr8------1853
NM_054110chr32369 29 --1700 --
NM_057157chr102569 158 1456 ----
NM_057164chr23719 567 537 ----1607
NM_057165chr23719 567 537 ----1607
NM_057166chr23719 567 537 ----1607
NM_057167chr23719 567 537 ----1607
NM_057175chr472007 1682 997 858 828 300 289 32597 2440 1765 ----
NM_057180chr12--1408 1325 --
NM_057749chr881190 1040 873 859 556 516 333 269 21393 472 1405 --
NM_058170chr11200 21435 658 ----
NM_058191chr212846 74 ----1311
NM_058229chr8------1179
NM_058237chr141387 11001 31064 743 681 --
NM_058241chr262282 2194 2147 2033 1945 76 2597 42 11432 --
NM_058241chr262282 2194 2147 2033 1945 76 2597 42 11432 --
NM_078467chr6--1115 ----
NM_078476chr631792 1734 1562 ------
NM_080552chr203686 675 597 ----1576
NM_080617chr2031033 314 273 2731 701 ----
NM_080626chr121285 ------
NM_080629chr161464 1404 1289 1036 995 270 21271 1212 ----
NM_080630chr161464 1404 1289 1036 995 270 21271 1212 ----
NM_080671chr231947 1544 287 22255 1476 --1739
NM_080672chr20123 ------
NM_080683chr41478 ------
NM_080684chr41478 ------
NM_080685chr41478 ------
NM_080759chr1352540 2528 2512 566 111 ------
NM_080760chr1352540 2528 2512 566 111 ------
NM_080764chr2293253 3212 2423 2055 1179 666 489 273 169 11169 ----
NM_080832chrX21336 228 11348 1364 --
NM_080867chr14124980 4356 3585 3246 1986 1234 1095 1029 647 421 295 270 44811 4144 3864 3148 24655 4219 --
NM_080872chr874035 3572 3561 3088 2782 946 670 --1531 1539
NM_080927chr342434 1356 1059 1009 23022 2656 13284 --
NM_130434chr153908 858 418 31210 1056 174 ----
NM_130435chr1042353 2296 1072 67 21142 32 ----
NM_130436chr2132540 1907 1863 12682 ----
NM_130438chr2133117 2484 2440 13259 ----
NM_130439chr10--11489 ----
NM_130439chr10--11489 ----
NM_130798chr1541138 969 514 470 --11322 --
NM_130809chr552525 1038 1024 609 247 42591 1207 264 90 12936 --
NM_130811chr2041018 780 410 300 ------
NM_130830chr352838 1569 873 816 55 --33686 3452 1501 --
NM_130831chr352617 2514 2153 983 973 22080 994 ----
NM_130832chr352617 2514 2153 983 973 22080 994 ----
NM_130833chr352617 2514 2153 983 973 22080 994 ----
NM_130834chr352617 2514 2153 983 973 22080 994 ----
NM_130835chr352617 2514 2153 983 973 22080 994 ----
NM_130836chr352617 2514 2153 983 973 22080 994 ----
NM_130837chr352617 2514 2153 983 973 22080 994 ----
NM_130838chr15--31657 1190 58 ----
NM_130839chr15--31657 1190 58 ----
NM_130847chr1175340 4970 4640 4496 1119 1088 272 24567 1454 ----
NM_133170chr20118084 7479 6561 6288 5932 5823 2857 1648 1604 1254 326 --15123 13024
NM_133265chrX62687 1364 1009 981 697 175 12249 1249 --
NM_133326chr11330 148 ----
NM_133329chr241530 1434 1232 1155 1508 ----
NM_133334chr4106189 6179 5851 5254 4298 3892 2385 2050 1480 102 46391 1958 1349 1272 15073 --
NM_133338chr51507 ------
NM_133339chr51507 ------
NM_133340chr51507 ------
NM_133341chr51507 ------
NM_133342chr51507 ------
NM_133343chr51507 ------
NM_133344chr51507 ------
NM_133367chr683461 3152 2894 2666 2248 456 294 236 22176 735 --13185
NM_133370chr4113117 3092 2964 2628 2350 1392 1290 1251 866 340 83 --11024 --
NM_133433chr56697 652 635 569 35 26 ------
NM_133446chr10172 ------
NM_133450chr16--1388 ----
NM_133468chr72849 33 32459 862 287 --11689
NM_133473chr192410 326 1519 ----
NM_133476chr121979 11152 ----
NM_133482chr521490 355 --1404 --
NM_133493chr6104487 3819 3586 3453 1703 1471 1368 1137 550 252 43662 3069 1280 588 1538 --
NM_133496chr174040 3601 3365 2925 701 492 374 24074 1173 ----
NM_133507chr122942 84 1693 ----
NM_133638chr53900 523 120 1107 ----
NM_133646chr2115484 5057 4972 4594 4239 3593 3499 1715 1681 1551 787 34436 1506 738 ----
NM_133647chr1553758 3662 3288 2380 372 --1444 --
NM_134428chr91295 169 ----
NM_134442chr241104 1093 567 139 21417 1083 ----
NM_138270chrX73362 3315 2677 1298 789 352 203 13370 22842 2792 --
NM_138285chr22419 343 ------
NM_138286chr1974377 3809 2789 1627 1012 541 445 23606 1539 --1684
NM_138290chr7150 ------
NM_138317chr142571 487 ------
NM_138318chr142571 487 ------
NM_138335chr44872 128 99 65 ------
NM_138385chr411447 ------
NM_138389chr41154 1227 ----
NM_138394chr2----125 --
NM_138400chr753459 3263 2696 733 382 1149 12195 --
NM_138410chr31409 ------
NM_138453chr51192 ------
NM_138455chr81353 ------
NM_138458chr2--1368 ----
NM_138459chr6103635 3547 3443 3123 3062 2964 2736 2728 1175 119 33152 2577 789 ----
NM_138468chr286301 5601 4346 4297 1130 727 378 283 35520 4132 2115 15894 --
NM_138473chr1243692 3520 1948 1733 23405 3191 34668 3794 1283 --
NM_138494chr742246 725 586 223 12661 1486 12630
NM_138555chr151410 ------
NM_138576chr1454129 3495 1629 1559 1213 1452 ----
NM_138609chr52562 448 --1530 --
NM_138610chr52562 448 --1530 --
NM_138621chr264108 3905 3290 2534 497 190 21677 1654 ----
NM_138635chr752482 1018 866 555 339 ------
NM_138701chr7179 ------
NM_138711chr32167 82 167 ----
NM_138712chr32167 82 167 ----
NM_138713chr16128162 6567 6309 5993 5512 5311 2815 2769 2751 2038 952 504 47821 7806 6544 5019 1237 --
NM_138714chr16128162 6567 6309 5993 5512 5311 2815 2769 2751 2038 952 504 47821 7806 6544 5019 1237 --
NM_138715chr852155 1839 864 379 217 32064 792 786 12092 --
NM_138730chr62331 287 ------
NM_138736chr1614189 ------
NM_138771chr721033 233 11225 11318 --
NM_138779chr132280 232 ------
NM_138782chr5112256 1843 1699 1597 1522 1509 860 846 732 543 362 --11767 --
NM_138792chr15--1125 ----
NM_138799chr251712 698 498 340 133 ------
NM_138811chr751015 917 894 239 63 ----1142
NM_138927chr213827 262 184 1239 ----
NM_138959chr176341 6008 4927 4562 4414 2305 1641 15991 35841 2629 2147 --
NM_138966chr181391 ------
NM_138970chr1452173 1883 1518 400 61 22223 1965 32351 858 751 1846
NM_138971chr1133780 3279 855 1254 ----
NM_138971chr1133780 3279 855 1254 ----
NM_138972chr1133780 3279 855 1254 ----
NM_138972chr1133780 3279 855 1254 ----
NM_138973chr1133780 3279 855 1254 ----
NM_138973chr1133780 3279 855 1254 ----
NM_138983chr21------11275
NM_139012chr641979 1748 1651 1506 ------
NM_139014chr642059 1828 1731 1586 ------
NM_139048chr34849 309 264 150 31232 1055 1046 ----
NM_139072chr21722 2313 85 1671 --
NM_139136chr12----3966 90 49 --
NM_139168chr53386 226 89 21556 1498 11971 1113
NM_139169chr1062195 1999 1507 387 285 157 1793 --11852
NM_139182chr481903 1589 1531 1432 1363 1210 304 99 --1494 --
NM_139207chr1242118 1382 502 456 1676 1746 1658
NM_139244chr61923 ------
NM_139245chr351848 1709 1663 1399 65 ------
NM_139283chr1262521 2356 1858 1747 1709 926 2818 385 ----
NM_139321chr20104012 3876 3079 1660 1603 965 940 900 813 676 44146 1466 919 879 ----
NM_139323chr2021697 300 1367 1761 11407
NM_144571chr4186704 6148 6131 6065 5737 5292 5228 4581 4556 1892 1416 1258 1224 823 763 511 448 30 46479 5455 1567 220 --12298
NM_144574chr141174 1496 1486 --
NM_144578chr1495423 4276 4256 2112 1856 1491 1158 1116 285 24640 320 22076 344 14406
NM_144582chr222590 771 --11814 --
NM_144586chr21196 --1903 11127
NM_144590chr1092855 2770 2285 1145 1125 1017 665 508 439 ----12341
NM_144591chr102340 127 1436 --1374
NM_144595chr133707 342 236 ------
NM_144599chr1595512 5215 4737 4560 4285 4175 3926 3364 240 ------
NM_144632chr282369 2328 2119 1514 866 717 684 168 --1425 1495
NM_144635chr311266 ------
NM_144643chr41389 ----1361
NM_144657chrX--2649 186 ----
NM_144660chr101155 ------
NM_144664chr1162273 2124 1796 1771 1738 403 12117 1488 --
NM_144684chr191462 32174 444 235 32185 155 35 --
NM_144712chr2132 ------
NM_144721chr462783 2773 2606 1097 503 401 2788 590 ----
NM_144778chr131393 31037 989 865 133 22698 2367
NM_144949chr272634 2535 1860 1000 992 800 655 31628 1031 775 1945 --
NM_144963chr882668 2205 2076 1900 958 945 730 235 22293 2160 1751 22363 1813
NM_144969chrX3656 221 196 ------
NM_144973chr1274969 4706 4541 3999 3755 807 466 34804 4489 4051 1183 25163 4779
NM_144982chr121711 ------
NM_144988chr1128 ------
NM_145000chr52491 233 ----1204
NM_145014chr111368 ------
NM_145044chr371608 1480 1316 1215 1207 428 86 3623 482 343 11506 --
NM_145052chrX31037 680 281 1831 ----
NM_145055chr1873578 2969 1468 1169 352 243 206 ----11108
NM_145112chr1421002 245 ----2860 436
NM_145113chr1431274 517 221 ----11132
NM_145117chr1143092 2981 2253 2211 --12917 --
NM_145165chr1452397 2241 619 608 468 42645 1105 981 719 --22743 2561
NM_145207chr4135265 5162 5131 4841 4546 4312 4186 3862 1911 1743 1188 1146 721 44790 4458 3632 3517 34054 306 127 --
NM_145243chr12232 188 --1156 --
NM_145251chr144397 322 268 31 1646 1526 --
NM_145259chr2126752 6389 5987 5270 4798 4682 4659 4541 2388 1744 1325 439 46730 5600 2164 1985 26876 1788 15627
NM_145261chr3--1913 1896 --
NM_145274chr171231 2332 111 ----
NM_145291chr4--2440 147 1410 --
NM_145305chrX41397 1326 468 273 --1250 --
NM_145307chr10134347 4230 4159 3623 3259 3072 1728 1491 1157 595 390 262 35 51707 1380 1252 1148 350 23397 764 --
NM_145320chr773449 3316 3253 3123 520 335 141 13392 --12365
NM_145321chr773449 3316 3253 3123 520 335 141 13392 --12365
NM_145322chr773449 3316 3253 3123 520 335 141 13392 --12365
NM_145332chr61621 ------
NM_145333chr61621 ------
NM_145341chr1041761 722 480 153 1756 11161 --
NM_145658chr15--1204 ----
NM_145686chr233300 2230 38 11038 ----
NM_145687chr233300 2230 38 11038 ----
NM_145690chr851978 1406 239 128 39 ------
NM_145698chr1041654 1598 441 378 --21817 1749 --
NM_145725chr14----1415 --
NM_145726chr14----1415 --
NM_145728chr1552111 1939 451 278 253 12523 191 11996
NM_145756chr1851481 1141 1098 438 192 1542 --11339
NM_145808chr742764 1969 1040 329 22925 710 ----
NM_145858chr21160 1429 ----
NM_145909chr621291 171 ------
NM_147164chr91574 ------
NM_147166chr71555 2590 118 --1713
NM_147171chr72459 164 ------
NM_147175chrX41783 1611 872 530 22178 749 1499 --
NM_147185chr72459 164 ------
NM_147189chr83682 444 379 12083 --1230
NM_147223chr242369 943 435 277 2454 210 163 --
NM_147233chr252186 846 760 252 94 2271 27 ----
NM_148174chr821540 1395 42015 1553 723 81 ----
NM_148177chr8------1179
NM_148571chr1731795 1309 338 11358 --1415
NM_148921chr1742446 2146 1702 892 1562 1720 --
NM_148957chr1342600 2442 2135 1867 1119 12635 --
NM_152221chr2221192 1077 11150 ----
NM_152261chr1252567 2289 2001 1697 708 12464 1313 --
NM_152263chr165584 4573 3858 3690 1267 30 24687 1756 11949 --
NM_152271chr84907 846 475 39 1102 ----
NM_152272chr841294 1255 915 162 1369 ----
NM_152277chr551581 1349 864 370 86 11693 --11715
NM_152280chr173228 2235 1354 1004 758 587 215 32600 2563 2422 ----
NM_152344chr1721229 1068 1189 ----
NM_152347chr171119 --1484 --
NM_152373chr13451 100 84 192 --1513
NM_152387chr22246 231 ----1871
NM_152388chr293802 3079 1295 1228 1160 681 620 500 369 13255 ----
NM_152399chr441234 986 467 86 1831 1530 --
NM_152400chr42847 135 ------
NM_152409chr532571 582 574 22875 725 23502 2722 --
NM_152414chr851669 1560 307 185 38 21351 1226 ----
NM_152417chr82249 77 --21152 995 11220
NM_152420chr91134 2776 704 ----
NM_152424chrX44180 3097 1726 955 --14061 --
NM_152433chr1121417 73 21701 202 ----
NM_152437chr1242172 1922 1669 746 12476 12257 --
NM_152442chr1231105 569 379 ----1942
NM_152446chr142667 216 ------
NM_152451chr152742 715 1735 ----
NM_152455chr1582857 2667 2550 1893 1823 741 311 154 32568 1757 179 ----
NM_152470chr1844167 3905 3831 3113 14035 ----
NM_152487chr131352 573 468 11387 ----
NM_152510chr222720 611 1836 ----
NM_152520chr221030 398 173 ----
NM_152522chr21975 ----1314
NM_152527chr241862 673 537 489 ------
NM_152529chr263634 2990 2861 1701 1578 1114 43908 3539 1650 310 33683 885 552 --
NM_152536chr32855 287 --1913 --
NM_152551chr6102690 2513 2459 2357 2203 2107 2055 1102 682 543 2853 462 ----
NM_152556chr71163 --12142 --
NM_152557chr72374 220 1232 ----
NM_152581chrX41035 987 384 271 --1496 --
NM_152589chr12--1279 ----
NM_152594chr1532040 707 93 32175 741 404 1349 --
NM_152608chr192487 2379 2293 2245 2112 2034 1667 873 290 --1277 --
NM_152622chr583523 3516 3190 2770 2534 2468 912 873 43067 3039 2349 2224 12909 --
NM_152624chr5126053 5792 5658 5592 5461 4898 4845 4587 2596 1247 469 50 26342 5608 16899 15645
NM_152629chr963491 3324 2921 2568 1268 1218 13237 1252 --
NM_152638chr126964 916 349 311 109 65 ----11137
NM_152641chr12102704 2686 2429 2163 1935 1845 1180 1089 1053 594 2449 194 12034 --
NM_152665chr13940 189 136 ----1891
NM_152673chr353342 3179 2871 2718 1699 44202 3261 1007 596 13349 --
NM_152678chr362584 2342 2302 2273 2250 1872 31087 764 681 ----
NM_152685chr51398 ------
NM_152695chrX31921 855 468 ----1610
NM_152699chr383129 2707 771 530 366 135 82 62 --13704 13292
NM_152701chr751866 1437 704 688 149 11980 ----
NM_152705chr1321329 410 --1473 2555 299
NM_152713chr111243 ------
NM_152721chr181196 --1211 --
NM_152723chr112779 243 3857 713 349 11109 --
NM_152734chr642140 1625 618 596 14607 1513 13565
NM_152737chr681726 1372 1300 792 630 242 71 64 11431 --11682
NM_152754chr7143440 3232 3169 3110 2988 2880 2783 2768 2681 1377 1000 581 538 320 43727 1408 1029 128 33767 373 281 --
NM_152756chr5103821 3612 3603 3544 2770 2665 1539 1308 935 903 34219 4134 732 12634 --
NM_152758chr892952 2946 1979 1874 1070 884 757 326 27 52811 2650 788 575 488 12074 --
NM_152765chr852334 1687 1649 766 646 12346 --11511
NM_152774chr742157 1074 580 514 11976 ----
NM_152789chr741157 947 380 98 --1327 --
NM_152793chr7104885 4620 4493 1649 1423 1074 1000 700 477 195 21928 1013 23581 257 --
NM_152832chr111503 ------
NM_152835chr142916 2443 2141 341 31846 885 874 12890 --
NM_152836chr851842 1803 1751 476 44 ------
NM_152837chr851842 1803 1751 476 44 ------
NM_152838chr2073332 3218 3107 2809 2525 2150 406 --1294 --
NM_152857chr61909 ------
NM_152858chr61909 ------
NM_152890chr141089 1061 260 127 1411 ----
NM_152902chr11578 2814 564 --135
NM_152924chr15126669 6342 6310 6005 5986 5356 5097 2759 2369 2023 1282 99 46270 4750 1346 1119 26906 4476 --
NM_152989chr121539 ------
NM_152991chr111734 ------
NM_152996chr13743 681 412 2246 164 11380 --
NM_152998chr72204 75 ------
NM_152999chr7164621 4314 4118 3968 3944 3701 3169 1956 1905 1553 1422 1187 842 347 219 192 13382 13128 --
NM_153026chr121182 ------
NM_153028chr164678 643 542 66 ------
NM_153042chr62495 428 21259 607 ----
NM_153181chr181391 ------
NM_153182chr342486 1142 1096 610 ----1719
NM_153184chr351851 1569 1396 1231 795 11510 ----
NM_153188chr5115561 5344 5308 4949 4871 4158 3881 1879 1121 299 290 105495 5396 4417 4245 4108 4102 1276 908 608 469 12061 --
NM_153207chr12104100 3953 3646 3475 3376 2922 2855 923 756 503 43402 2972 2954 2691 12528 --
NM_153223chr541345 1267 1048 605 2256 38 --11329
NM_153235chr662432 2281 809 410 263 178 --11836 --
NM_153240chr341063 341 198 71 11208 ----
NM_153262chr173076 2780 2219 1042 627 354 292 2593 257 --12739
NM_153332chr8103172 3132 2275 2054 1313 1200 1077 510 251 62 2768 261 ----
NM_153341chr12232 58 ------
NM_153346chrX21313 686 11597 --11630
NM_153354chr51225 ------
NM_153357chr17139 ------
NM_153365chr452547 2068 1984 337 298 12328 12031 --
NM_153374chr151393 ------
NM_153377chr12299 71 ------
NM_153456chr1346109 5121 4240 1335 26322 5489 --12354
NM_153498chr102242 222 ----1533
NM_153607chr5103122 2912 2742 2708 2461 1999 1058 1041 784 271 1951 12506 --
NM_153613chr152187 88 ------
NM_153620chr711722 ------
NM_153631chr741453 682 346 33 1564 11616 --
NM_153632chr741453 682 346 33 1564 11616 --
NM_153633chr123765 688 676 --1732 181
NM_153686chr452088 872 628 240 193 1572 12449 --
NM_153689chr232271 2031 861 1227 ----
NM_153694chr121236 ------
NM_153702chr4----154 --
NM_153746chr62543 198 ------
NM_153748chr12----3966 90 49 --
NM_153757chr421225 814 --1119 --
NM_153758chr11253 ------
NM_170587chr83837 719 698 --173 --
NM_170606chr741852 1816 1174 71 11269 ----
NM_170665chr1284611 4505 4051 3611 1244 1130 487 85 1446 ----
NM_170674chr1511375 ------
NM_170675chr1511051 ------
NM_170676chr1511051 ------
NM_170677chr1511375 ------
NM_170686chr742029 1266 166 120 22722 651 12006 --
NM_170709chr852410 2376 2164 197 40 22366 234 ----
NM_170710chr483003 2622 2436 1215 844 817 794 142 32319 270 182 12536 --
NM_170719chr1351474 1303 1019 926 281 21433 69 11069 1556
NM_170731chr1132892 2163 153 12369 ----
NM_170732chr1132892 2163 153 12369 ----
NM_170733chr1132892 2163 153 12369 ----
NM_170734chr1132892 2163 153 12369 ----
NM_170735chr1132892 2163 153 12369 ----
NM_170740chr693483 3364 3169 2822 2243 1214 1166 643 107 128 12980 --
NM_170741chr171241 1154 ----
NM_170742chr171241 1154 ----
NM_170750chrX1630 ------
NM_170783chr61175 ------
NM_171998chrX42125 1747 788 68 12239 --11733
NM_171999chr18--1718 ----
NM_172037chr861305 1004 921 519 305 247 11514 ----
NM_172058chr881890 1853 1554 1422 728 642 463 414 1681 ----
NM_172059chr881890 1853 1554 1422 728 642 463 414 1681 ----
NM_172060chr881890 1853 1554 1422 728 642 463 414 1681 ----
NM_172069chr2--22114 658 ----
NM_172070chr22607 448 --2559 48 --
NM_172071chr1197086 6979 6950 6857 6544 6235 5492 5350 5210 5125 4940 4856 4652 2835 2666 2219 1756 1664 1047 21488 200 16682 14787
NM_172103chr641782 508 237 52 42583 2107 771 429 --1400
NM_172105chr641782 508 237 52 42583 2107 771 429 --1400
NM_172127chr451502 1379 764 731 437 11715 ----
NM_172128chr451458 1335 720 687 393 11671 ----
NM_172174chr43557 499 233 ------
NM_172193chr1451219 1179 830 336 181 31135 914 100 ----
NM_172196chr21163 ------
NM_172218chr85873 531 351 252 169 ------
NM_172240chr122989 548 2210 181 ----
NM_172242chr103720 569 146 ------
NM_172311chr2------1131
NM_172315chr1511375 ------
NM_172316chr1511375 ------
NM_172344chr241530 1434 1232 1155 1508 ----
NM_172373chr1331305 1024 364 11325 ----
NM_173054chr7--2317 302 ----
NM_173075chr461780 1766 1349 1250 1195 1163 --1118 --
NM_173076chr22419 298 ------
NM_173083chr131335 1009 865 1113 ----
NM_173171chr231129 1106 1076 ------
NM_173172chr231437 1414 1384 ------
NM_173173chr231129 1106 1076 ------
NM_173198chr932551 2357 2146 22997 1064 ----
NM_173200chr932551 2357 2146 22997 1064 ----
NM_173214chr16128162 6567 6309 5993 5512 5311 2815 2769 2751 2038 952 504 47821 7806 6544 5019 1237 --
NM_173359chr341724 749 474 108 ------
NM_173468chr4125958 5609 4776 4633 4477 3869 2145 1988 1918 1628 563 219 34108 3802 1664 14498 21614 1118
NM_173470chrX52511 2146 1924 532 197 1915 ----
NM_173475chr1671788 1497 1491 654 303 215 32 --1495 --
NM_173494chrX1624 1930 ----
NM_173495chrX32605 2492 635 12130 --12410
NM_173500chr1541271 1200 1102 323 ------
NM_173508chr171156 1002 950 471 442 342 323 ------
NM_173510chr2222751 532 1510 22920 2223 --
NM_173511chr273773 3652 3614 3176 3037 2636 1212 33835 3012 2534 23478 3201 --
NM_173519chr81336 --11961 11425
NM_173531chr1983858 3476 3334 3097 2846 2693 2544 2382 21203 907 32509 832 669 13109
NM_173536chr4124746 3504 1629 1618 1299 1253 801 350 282 255 181 54 44560 3882 733 87 ----
NM_173552chr352321 2171 1843 375 301 --1811 22221 936
NM_173557chr182774 272 ------
NM_173576chr1062233 2189 2124 1737 728 532 32222 1486 644 ----
NM_173582chr11146254 6107 5680 4901 4331 4283 2266 2196 2084 1164 905 806 614 501 55897 4478 995 958 763 21902 982 25439 4589
NM_173591chr1251021 705 408 183 136 ------
NM_173602chr1293417 3361 3205 2935 2515 2408 1197 654 319 23742 3371 22569 991 1334
NM_173632chr1953183 2326 390 340 256 32788 2647 2320 12614 --
NM_173642chr188851 8671 6766 6756 6187 3386 1556 71 --48014 7686 2168 673 1804
NM_173644chr2041823 1760 1688 1660 --11240 --
NM_173648chr241062 777 753 364 1198 ----
NM_173654chr382251 2154 1559 902 874 795 306 81 ------
NM_173683chr821675 665 1580 ----
NM_173797chr531360 931 352 21141 921 ----
NM_173808chr194438 4283 3391 3372 3146 1507 796 283 64 1838 ----
NM_173822chr231956 505 415 12074 11635 1814
NM_173825chr352090 1133 1114 738 307 22189 774 12950 --
NM_173829chr576175 3759 2248 1653 1102 648 71 55899 4285 1126 442 31 12381 --
NM_173830chr62921 741 2276 74 ----
NM_173848chr81107 ------
NM_173851chr873747 3638 3044 2830 2716 1095 798 ------
NM_173854chr142100 1866 182 147 --1307 --
NM_174858chr111176 ------
NM_174905chr19--1193 ----
NM_174909chr51708 ------
NM_174911chr822764 1592 33454 3233 900 --11361
NM_174916chr1572261 2168 2126 1718 1660 418 211 12370 1240 --
NM_174921chr41845 1834 ----
NM_174938chr92451 367 ------
NM_175056chr372076 2043 1742 1606 1546 1339 80 ------
NM_175607chr371685 1321 1087 623 471 304 174 11581 ----
NM_175610chr1521381 1305 153 ----
NM_175612chr371685 1321 1087 623 471 304 174 11581 ----
NM_175623chr12127197 7138 6234 5961 5036 4899 4735 2067 1806 1099 230 160 26228 1112 27035 6686 --
NM_175624chr12127292 7233 6329 6056 5131 4994 4830 2162 1901 1194 325 255 26323 1207 27130 6781 --
NM_175625chr12127292 7233 6329 6056 5131 4994 4830 2162 1901 1194 325 255 26323 1207 27130 6781 --
NM_175748chr143734 673 543 12161 ----
NM_175854chr1342095 1936 1051 426 12034 1222 --
NM_175859chrX21769 656 1565 --1156
NM_175861chr1285968 4745 4556 4146 3995 2013 1753 1115 64923 2041 1683 1328 1129 321 35895 5486 4488 15928
NM_175884chr731177 946 391 --1424 --
NM_175907chr1842206 1981 396 75 42288 2031 1972 1949 1466 --
NM_175924chr33912 705 144 ----1103
NM_176081chr1085129 5062 5033 4490 3805 737 170 114 25454 96 14373 --
NM_176083chr1085129 5062 5033 4490 3805 737 170 114 25454 96 14373 --
NM_176812chr201242 ------
NM_176814chr71994 ------
NM_177424chr162059 614 472 414 357 183 1713 ----
NM_177438chr1473558 3457 3192 2998 1477 1248 871 13937 --23680 121
NM_177538chr2118535 8323 8151 7602 6122 5817 5669 3471 3006 2375 64 18262 --12619
NM_177966chr341912 1747 671 648 21448 60 ----
NM_177967chr1311055 ------
NM_177968chr22708 470 11800 ----
NM_177976chr32354 305 --147 --
NM_177988chr32322 22 ------
NM_177990chr2051665 1541 1328 474 441 21804 1752 --11497
NM_178006chr1372026 1991 1958 1820 1700 770 164 1727 --11762
NM_178007chr1372026 1991 1958 1820 1700 770 164 1727 --11762
NM_178010chr121539 ------
NM_178011chr10113074 2695 2674 2520 2363 2107 1192 1147 567 253 179 32655 2005 368 --12141
NM_178014chr6180 ------
NM_178033chr1150 ------
NM_178123chr241086 1002 790 387 11021 ----
NM_178127chr111386 1104 ----
NM_178140chr532578 2088 939 12262 --1963
NM_178150chr101258 ------
NM_178151chrX116658 6504 6437 6279 5070 4931 4776 1942 1052 894 452 36271 2495 1471 14841 --
NM_178152chrX116658 6504 6437 6279 5070 4931 4776 1942 1052 894 452 36271 2495 1471 14841 --
NM_178153chrX116658 6504 6437 6279 5070 4931 4776 1942 1052 894 452 36271 2495 1471 14841 --
NM_178154chr142754 735 2318 96 ----
NM_178155chr142754 735 2318 96 ----
NM_178156chr142754 735 2318 96 ----
NM_178157chr142754 735 2318 96 ----
NM_178161chr10--183 ----
NM_178424chr53559 177 140 1487 ----
NM_178427chr121631 199 12307 12012 --
NM_178502chr12--1622 ----
NM_178539chr1252050 1912 1442 249 123 11667 ----
NM_178549chr13498 405 130 2515 385 1187 --
NM_178558chr72110 60 11045 1501 --
NM_178566chr951414 1370 337 303 185 3473 400 394 ----
NM_178812chr841383 1046 388 169 2256 105 1418 --
NM_178815chr1052162 1879 753 508 95 --11054 --
NM_178826chr121683 1752 ----
NM_180989chr1351987 1894 1871 1813 1724 1708 ----
NM_180991chr582602 2506 2228 2213 1925 563 368 40 22678 470 --1528
NM_181077chr1522216 133 --11920 --
NM_181265chr483003 2622 2436 1215 844 817 794 142 32319 270 182 12536 --
NM_181302chr141174 1496 1486 --
NM_181308chr141174 1496 1486 --
NM_181351chr1162992 1203 1056 976 357 184 --1335 --
NM_181353chr201666 ------
NM_181358chr121194 971 24124 449 13253 23007 1207
NM_181443chr203934 478 337 2826 771 22772 1142 --
NM_181453chr21322 11272 2364 40 --
NM_181481chr1876763 6083 6031 5177 5107 2007 1003 14335 --16135
NM_181482chr1876763 6083 6031 5177 5107 2007 1003 14335 --16135
NM_181483chr1876763 6083 6031 5177 5107 2007 1003 14335 --16135
NM_181492chr221292 1407 ----
NM_181521chr1667204 6483 5588 1012 442 101 25148 4440 ----
NM_181527chr201142 1413 ----
NM_181581chr72612 314 1354 ----
NM_181598chr14----1290 --
NM_181659chr2022083 938 11223 --11364
NM_181659chr2022083 938 11223 --11364
NM_181670chr1241494 1139 947 376 ------
NM_181671chr173377 173 23 2699 307 1263 1925
NM_181672chrX61680 1585 1542 1314 220 209 ------
NM_181673chrX61680 1585 1542 1314 220 209 ------
NM_181702chr82820 66 ------
NM_181706chr1182170 2117 1892 648 600 426 292 191 1590 ----
NM_181714chr641973 1500 1392 1242 --11286 --
NM_181723chr842249 1999 717 365 22059 705 ----
NM_181755chr11264 ------
NM_181783chr1251965 1684 1602 1307 243 21384 1258 --1421
NM_181787chr8103776 3751 3585 3035 2995 2974 1040 822 573 320 43657 1061 718 478 --13024
NM_181794chr641062 407 81 31 ------
NM_181795chr641062 407 81 31 ------
NM_181836chr582477 2370 2200 2012 1887 1053 487 242 2717 585 ----
NM_181839chr82911 902 ------
NM_181861chr124808 599 547 323 11799 --12822
NM_181868chr124808 599 547 323 11799 --12822
NM_181869chr124893 684 632 408 11884 --12907
NM_181886chr421154 251 --1520 --
NM_181887chr421154 251 --1520 --
NM_181888chr421154 251 --1520 --
NM_181889chr421154 251 --1520 --
NM_181890chr421154 251 --1520 --
NM_181891chr421154 251 --1520 --
NM_181892chr421201 298 --1567 --
NM_181893chr421154 251 --1520 --
NM_181897chr362431 2267 2051 713 662 277 11771 ----
NM_182472chr41141 ------
NM_182480chr14--192 ----
NM_182485chr453000 2614 1496 1367 392 43672 2493 1243 549 1832 --
NM_182503chr664376 4116 2009 1477 1416 109 55500 1953 941 934 887 14995 --
NM_182511chr1821077 932 11466 ----
NM_182515chr1986579 5530 5438 5380 5362 5052 2209 231 46589 2529 1371 509 21405 1244 35432 5332 5007
NM_182522chr351147 901 886 844 283 1988 ----
NM_182540chrX3797 577 139 ------
NM_182551chr233443 2443 690 ------
NM_182565chr171138 1751 ----
NM_182643chr842433 2252 1498 238 11792 ----
NM_182646chr453000 2614 1496 1367 392 43672 2493 1243 549 1832 --
NM_182648chr142585 564 ------
NM_182689chr11304 ------
NM_182690chr11366 ------
NM_182691chr71377 ------
NM_182692chr71377 ------
NM_182715chr72903 480 11282 ----
NM_182744chr1--1191 ----
NM_182757chr6153367 3320 3269 3064 2603 2292 2169 1394 1383 1115 1080 857 700 392 281 12541 ----
NM_182758chr1552528 2503 945 882 29 43921 435 410 313 ----
NM_182762chr7125850 5346 4391 3844 3792 2495 2466 2271 1892 824 369 159 34059 4017 3974 46239 6123 2355 1784 --
NM_182763chr152376 1913 1841 706 369 1901 1737 --
NM_182765chr1032322 2154 1959 12108 1330 --
NM_182767chr1221833 370 ------
NM_182789chr51773 ------
NM_182797chr2041320 1205 1140 233 11103 ----
NM_182830chr1421909 58 ----12073
NM_182896chr321854 1825 21389 500 1267 --
NM_182898chr7115769 5039 4664 4640 4634 4054 4048 1801 1495 1356 336 35328 5253 2347 45676 4120 4040 1984 --
NM_182899chr7115769 5039 4664 4640 4634 4054 4048 1801 1495 1356 336 35328 5253 2347 45676 4120 4040 1984 --
NM_182907chr672203 1933 1591 1518 717 381 369 ------
NM_182918chr2131469 1390 1277 ------
NM_182931chr7--1496 ----
NM_182943chr34915 285 278 30 ------
NM_182948chr153097 2531 2364 2087 536 --12170 --
NM_182962chr11140 1609 ----
NM_182964chr1143092 2981 2253 2211 --12917 --
NM_182972chr152525 2234 2108 1972 572 ----12535
NM_182976chr1--169 ----
NM_183004chr1453928 3369 2791 478 130 11333 ----
NM_183043chr135895 874 761 680 163 3888 703 175 ----
NM_183044chr135895 874 761 680 163 3888 703 175 ----
NM_183050chr682218 2162 2155 2016 1616 572 226 176 11732 ----
NM_183065chr1731206 440 149 1475 1947 --
NM_183228chr173749 693 234 ----1246
NM_183229chr173749 693 234 ----1246
NM_183230chr173749 693 234 ----1246
NM_183231chr173749 693 234 ----1246
NM_183232chr173749 693 234 ----1246
NM_183234chr1541562 365 283 49 11400 ----
NM_183235chr1541562 365 283 49 11400 ----
NM_183236chr1541562 365 283 49 11400 ----
NM_183244chr20123 ------
NM_183246chr20123 ------
NM_183323chr51773 ------
NM_183353chrX21208 260 2974 214 --11031
NM_183376chr1542390 1642 696 478 12569 1317 --
NM_183387chr141306 2915 847 ----
NM_183393chr3184 2853 263 ----
NM_183394chr3184 2853 263 ----
NM_183398chr521052 204 11379 ----
NM_183399chr521052 204 11379 ----
NM_183400chr521052 204 11379 ----
NM_183401chr521052 204 11379 ----
NM_183416chr142054 1792 528 395 1343 1697 --
NM_194247chr273851 3657 3211 2799 512 374 117 --24114 567 1695
NM_194250chr21301 ------
NM_194282chr482904 2284 2088 965 400 319 216 191 145 1896 --
NM_194283chr564101 3173 2851 1442 417 350 23223 1601 23759 760 14125
NM_194285chr1163418 998 957 618 484 189 --1519 --
NM_194291chr8102720 2330 2219 2125 2032 1147 1077 957 784 116 --12738 --
NM_194314chr134908 1470 496 65474 4939 4475 1689 1020 894 1503 14207
NM_194317chr23868 447 43 11708 --1187
NM_194328chr9123278 2953 2853 2406 2368 2239 2161 1012 561 366 77 23 12178 ----
NM_194329chr9123278 2953 2853 2406 2368 2239 2161 1012 561 366 77 23 12178 ----
NM_194330chr9123278 2953 2853 2406 2368 2239 2161 1012 561 366 77 23 12178 ----
NM_194332chr9123278 2953 2853 2406 2368 2239 2161 1012 561 366 77 23 12178 ----
NM_194434chr18115570 4965 4910 4727 1872 1513 1322 1308 1121 505 321 25751 1949 25263 4942 --
NM_194454chr71610 --21721 444 --
NM_194455chr71610 --21721 444 --
NM_194456chr71610 --21721 444 --
NM_194463chrX21110 817 189 11133 --
NM_197941chr543068 3049 2939 719 2533 502 --11957
NM_197955chr152265 43 ------
NM_198066chr1453116 2831 1091 639 251 1606 22315 185 --
NM_198081chr682468 1920 1213 1115 933 842 699 150 1578 12509 1170
NM_198086chr1452027 1946 1495 633 328 1667 11857 --
NM_198098chr711845 ------
NM_198120chr81548 ------
NM_198123chr841503 1117 594 452 ------
NM_198124chr841503 1117 594 452 ------
NM_198128chr1862325 2179 2085 871 751 292 21713 412 ----
NM_198129chr181387 ----1127
NM_198181chr15112223 2189 232 215 202 185 172 157 144 127 114 32480 1853 240 12524 --
NM_198195chr31165 1646 1497 --
NM_198215chr101461 1300 ----
NM_198217chr132918 903 --11024 --
NM_198218chr132918 903 --11024 --
NM_198219chr132918 903 --11024 --
NM_198240chr1251315 1009 922 218 124 --11155 --
NM_198261chr122513 116 1487 ----
NM_198262chr122513 116 1487 ----
NM_198268chr121194 971 24124 449 13253 23007 1207
NM_198269chr121194 971 24124 449 13253 23007 1207
NM_198270chrX62794 2663 2264 659 428 130 1736 ----
NM_198273chr583037 2369 2213 2193 1157 386 340 196 1229 22847 93 --
NM_198320chr1214838 25221 3264 35211 5143 3324 14150
NM_198329chr331533 1420 1398 1305 --11473
NM_198336chr771643 1580 1425 1192 1170 632 64 ------
NM_198391chr2041104 1054 339 140 21025 474 ----
NM_198395chr54963 851 265 58 ------
NM_198399chr341685 1213 1128 77 2427 421 134 1321
NM_198400chr1552894 2203 1087 313 102 12741 ----
NM_198439chr1121417 73 21701 202 ----
NM_198459chr1--1846 ----
NM_198468chr694116 4042 3815 3172 3029 1828 1612 1489 1077 24414 3729 1578 --
NM_198503chr142219 1708 952 596 52174 804 335 252 246 11732 --
NM_198506chr411082 1486 ----
NM_198507chr52470 54 1414 ----
NM_198513chr8--1720 --21327 536
NM_198549chr182920 2620 2554 2100 1315 1307 1300 126 12348 ----
NM_198568chr631048 221 63 1356 ----
NM_198578chr1251286 507 402 297 261 2278 144 ----
NM_198581chr2187356 7065 7042 6450 6245 5491 5005 4862 4755 3027 2463 1796 1717 1594 1196 998 879 787 11672 --27552 1209
NM_198584chr82193 105 12685 11902 --
NM_198715chr1105709 2499 1995 1703 1452 1438 1036 225 208 112 26349 1494 44244 4211 1933 69 1346
NM_198719chr13337 251 50 --2904 638 --
NM_198793chr3114124 3862 3208 3172 3028 1659 993 923 536 205 182 14047 ----
NM_198829chr721415 234 ------
NM_198889chr441217 1078 507 335 1567 --1922
NM_198901chr731251 974 198 21189 278 ----
NM_198968chr1393746 3588 3451 3119 2490 1476 941 832 328 --11198 --
NM_198990chr752957 2297 1330 989 864 33200 3119 2422 12786 --
NM_199000chr752300 2062 648 411 171 11835 --1908
NM_199039chr42738 50 1724 ----
NM_199040chr1272415 2338 900 762 595 210 104 23290 910 ----
NM_199072chr793268 3239 3223 3055 2508 2144 2084 163 103 22899 2258 12708 --
NM_199136chr72189 141 ------
NM_199188chr1293765 3055 1447 1086 1043 965 635 562 440 13564 13671 12667
NM_199189chr51318 ------
NM_199190chr1293765 3055 1447 1086 1043 965 635 562 440 13564 13671 12667
NM_199229chr261233 1092 1075 491 366 203 11180 --11352
NM_199320chr452063 763 578 546 315 32616 2054 1898 22015 959 --
NM_199320chr452063 763 578 546 315 32616 2054 1898 22015 959 --
NM_199334chr171512 ------
NM_199421chr14124980 4356 3585 3246 1986 1234 1095 1029 647 421 295 270 44811 4144 3864 3148 24655 4219 --
NM_199436chr251051 940 797 587 114 12894 1831 --
NM_199437chr1121715 255 1481 --1753
NM_199438chr1121715 255 1481 --1753
NM_199439chr1121715 255 1481 --1753
NM_199454chr144797 1408 592 192 14101 44769 4489 1398 469 --
NM_199462chr144129 1448 1130 71 11648 11111 11358
NM_199482chr222102 1414 11402 1254 --
NM_201413chr21----1259 --
NM_201414chr21----1259 --
NM_201435chr12144 1739 ----
NM_201439chr12187 ------
NM_201440chr12187 ------
NM_201515chr12187 ------
NM_201567chr331304 1175 436 1572 ----
NM_201591chr441859 1447 1221 176 1562 ----
NM_201592chr441859 1447 1221 176 1562 ----
NM_201613chr12--1657 ----
NM_201624chr13906 855 247 ------
NM_201995chr111150 ------
NM_201998chr111215 ------
NM_201999chr421121 922 ------
NM_203281chrX193 ------
NM_203301chr1421411 563 ------
NM_203327chr2064459 3455 3439 1215 1153 292 ------
NM_203341chr141072 835 826 147 ------
NM_203350chr151612 1526 1501 597 96 31343 1246 284 ----
NM_203351chr1732137 2019 1532 ------
NM_203354chr142652 162 ------
NM_203355chr142652 162 ------
NM_203356chr142652 162 ------
NM_203364chr113982 474 349 ------
NM_203372chr21251 11723 11118 11165
NM_203382chr541607 1144 419 313 11363 ----
NM_203390chr861832 1721 1707 1636 540 367 21822 204 1156 --
NM_203391chrX71838 1584 1340 1206 656 378 334 --11593 --
NM_203434chr911258 21071 178 ----
NM_203437chr21188 --1703 --
NM_203446chr2192907 2854 2319 2035 1122 502 489 84 22 ------
NM_203451chr1341758 734 482 219 12119 1243 --
NM_203458chr193185 3123 3115 2813 2799 1474 816 706 521 11215 13650 --
NM_203459chr141606 972 788 290 21841 890 --11806
NM_203463chr273364 3319 1621 1207 839 441 280 ------
NM_203504chr441824 405 206 198 --12553 --
NM_203505chr441824 405 206 198 --12553 --
NM_205768chr162064 1841 772 431 162 152 ------
NM_205836chr51625 1228 ----
NM_205849chrX1328 ------
NM_205852chr1231991 178 160 21588 861 --11670
NM_205860chr163160 2612 2483 2007 1029 364 --1536 1144
NM_206594chr132545 1154 126 33373 3234 2238 --11101
NM_206595chr132545 1154 126 33373 3234 2238 --11101
NM_206853chr673925 3542 2955 2849 1152 308 193 1745 --33423 479 47
NM_206854chr685186 4803 4216 4110 3715 1569 1454 954 12006 --34684 1740 1308
NM_206855chr6116151 5768 5181 5075 4680 2534 2419 1919 820 213 165 1508 14111 25649 2273
NM_206866chr2153208 2538 2239 543 131 1336 22959 857 --
NM_206876chr283584 3468 3070 2782 2380 2219 579 141 22436 2205 ----
NM_206886chr12176 38 ------
NM_206907chr543112 2594 363 310 22917 852 1892 --
NM_206909chr8108318 6965 5409 3325 3148 2632 2594 2431 2143 1146 38175 2940 2000 37621 3370 517 26462 364
NM_206915chrX--1220 ----
NM_206917chrX--1220 ----
NM_207015chr332224 2041 735 3654 262 61 ----
NM_207297chr372755 2435 2233 2207 1275 595 30 22984 847 ----
NM_207299chr94900 399 391 216 --1842 --
NM_207303chr1073944 3405 2732 2527 1587 1074 903 ------
NM_207304chr131280 3924 876 752 --22585 2254
NM_207311chr1221326 1251 ------
NM_207325chr1921818 1767 --1745 --
NM_207337chr122857 267 11144 --1396
NM_207354chr11154 ------
NM_207361chr13126115 6027 5467 5269 5256 3948 3914 2121 1574 609 551 306 12470 32377 1781 351 26203 6086
NM_207396chr121860 416 ------
NM_207406chr4116347 6218 6070 5901 5847 5817 5714 5531 4134 1005 108 1816 13971 --
NM_207517chr1522007 662 ------
NM_207578chr14726 318 243 65 1510 ----
NM_207660chr1441757 1715 1603 1332 --1528 11549
NM_207661chr1441757 1715 1603 1332 --1528 11549
NM_207662chr1441757 1715 1603 1332 --1528 11549
NM_212460chr731872 1649 284 1563 ----
NM_212471chr1762017 1700 1621 865 837 616 32312 2063 1548 12155 --
NM_212472chr1762017 1700 1621 865 837 616 32312 2063 1548 12155 --
NM_212543chr31121 ------
NM_212558chr9104175 3623 3214 2977 941 849 824 588 332 260 32884 1082 926 --14186
NM_213589chr254800 4303 2018 1431 1155 34297 1950 263 ----
NM_213590chr1395124 4546 4483 3219 1855 918 388 171 128 54523 4502 3971 1711 288 35268 4652 2042 --
NM_213594chr1221036 429 --1399 --
NM_213606chr1042458 2148 808 25 11681 22755 1719 --