TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-377-3p
miRNA Sequence: AUCACACAAAGGCAACUUUUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000176chr533302 1378 1289 --1332 23810 670
NM_000212chr1762312 201 190 180 158 149 12266 1204 --
NM_000334chr1742043 1684 1660 1404 11527 --21674 1517
NM_000719chr1254082 1734 1205 1185 1172 15339 26635 1190 --
NM_000875chr1555760 5748 5522 2558 2535 --22565 2550 --
NM_000912chr833535 3321 1170 1747 1519 2801 495
NM_001001433chr2042916 2436 50 23 31249 601 36 11153 --
NM_001003652chr1868604 2834 1692 469 384 65 --168 12733
NM_001004065chr954000 1324 1287 1261 1251 ----22826 1255
NM_001008220chr5143356 3126 2908 1566 1554 1522 1431 1360 1314 1255 1238 1196 850 284 --32911 2804 1104 12827
NM_001008408chr776348 5384 4285 2206 1762 1555 557 --16362 16305
NM_001011722chr13358 351 344 --1369 1382
NM_001011722chr13358 351 344 --1369 1382
NM_001018067chr133793 3781 967 1325 25032 3784 2971 509
NM_001018068chr133793 3781 967 1325 25032 3784 2971 509
NM_001018069chr133793 3781 967 1325 25032 3784 2971 509
NM_001018074chr533302 1378 1289 --1332 23810 670
NM_001018075chr533302 1378 1289 --1332 23810 670
NM_001018076chr533302 1378 1289 --1332 23810 670
NM_001018077chr533302 1378 1289 --1332 23810 670
NM_001024094chr533302 1378 1289 --1332 23810 670
NM_001024948chr111092 21108 207 32833 1068 30 22910 254
NM_001040110chr731482 287 271 1305 21485 298 --
NM_001106chr398948 8191 7603 2924 2908 2881 2750 2684 2123 26096 5978 16834 19718
NM_001167chrX15327 15884 25907 56 26684 426
NM_001332chr52999 991 --31044 1004 376 --
NM_001659chr1281937 1924 1909 1893 1865 956 466 95 --21940 1902 --
NM_002126chr1763958 3942 3918 2668 180 146 --23670 183 13962
NM_002594chr2062152 1928 1865 1814 1806 444 --1229 --
NM_002737chr1776400 4559 4432 1850 1767 1757 1540 1749 --16406
NM_002886chr354437 909 900 888 726 --1903 14441
NM_003298chr3115407 4886 4095 3954 1320 1033 1020 997 668 591 352 ------
NM_003763chr2042916 2436 50 23 31249 601 36 11153 --
NM_004430chr85573 547 533 523 507 --1540 --
NM_005011chr731482 287 271 1305 21485 298 --
NM_005056chr1274829 4598 4102 3890 1754 1681 490 14873 195 23894 1758
NM_005596chr945944 5258 4561 1997 --24972 1646 14610
NM_005901chr1868604 2834 1692 469 384 65 --168 12733
NM_006650chr5143356 3126 2908 1566 1554 1522 1431 1360 1314 1255 1238 1196 850 284 --32911 2804 1104 12827
NM_007203chr954000 1324 1287 1261 1251 ----22826 1255
NM_013261chr451314 337 328 312 300 --2364 331 12575
NM_014319chr1241501 705 697 679 11602 ----
NM_014747chr15409 182 170 162 33 --14479 21572 315
NM_014767chr10103499 2405 1154 607 212 204 192 181 148 130 --33359 223 151 --
NM_014905chr22473 406 --31880 1848 272 1624
NM_014947chr142778 1944 1920 1907 --21923 242 12386
NM_015317chr221022 58 ----22829 62
NM_015396chr31390 --1397 2435 334
NM_015397chr97759 747 489 472 456 424 414 --3463 431 87 --
NM_015477chr153139 46 34 --3142 51 37 --
NM_015569chr154242 4206 3243 3225 1334 --24251 3311 198
NM_015640chr133793 3781 967 1325 25032 3784 2971 509
NM_016376chr1763736 2993 1586 1203 185 143 --33641 3500 2998 23614 2981
NM_016577chr354357 3975 3927 3694 3206 1628 44258 3978 3243 939 13931
NM_017447chr2144133 4023 1709 956 ----24163 508
NM_017714chr204325 248 207 197 --2290 200 1239
NM_017848chrX103704 1577 1036 1024 1014 936 898 889 881 837 --31733 913 892 1875
NM_017902chr10155145 4904 4707 1727 1527 1039 953 935 913 874 864 852 337 329 299 55027 4578 3958 1805 1721 --33882 3717 266
NM_018125chr13358 351 344 --1369 1382
NM_018157chr1242570 1285 940 928 --2945 361 --
NM_018403chr343700 3418 2670 804 21072 690 13813 21614 808
NM_018534chr24484 450 428 405 --2461 453 2436 98
NM_020122chr265870 4708 741 604 547 315 --1621 21957 659
NM_020718chr1646047 1569 148 122 --21092 133 11573
NM_020772chr1777213 6760 3146 3112 2238 1335 338 1301 36879 6335 3151 --
NM_020951chr1952393 884 741 715 491 12051 3744 729 680 --
NM_021964chr334883 2593 1982 --14886 26091 349
NM_022048chr1565378 5363 5119 1966 1330 654 --25372 5348 25800 1721
NM_022114chr1114801 4111 3991 3360 2894 1839 1566 1558 1546 828 97 23333 1857 ----
NM_022648chr294322 4302 3917 3889 3622 3500 2909 584 577 13907 24305 1860 13467
NM_022781chr952475 528 453 244 203 --5468 446 273 137 82 --
NM_025090chr1715376 358 290 280 271 242 213 186 160 146 109 101 91 80 65 --6607 361 350 245 216 163 --
NM_025248chr17112835 2700 2662 2646 2578 2546 2525 2387 2358 2148 690 12339 42685 2581 2528 2437 --
NM_053043chr776348 5384 4285 2206 1762 1555 557 --16362 16305
NM_080546chr952296 779 105 83 71 --176 --
NM_138473chr1244487 3260 1844 1696 11680 34947 1833 1185 13479
NM_144973chr1244987 4765 1009 219 35078 4033 3901 23844 1012 14991
NM_147150chr954000 1324 1287 1261 1251 ----22826 1255
NM_152734chr635315 4515 1108 --13695 34837 1650 135
NM_152774chr742641 2001 726 716 ----1720
NM_182515chr1966639 6193 5391 5087 4939 4552 ----22275 594
NM_182920chr35187 135 123 104 90 --1107 11125
NM_194314chr135505 5293 1452 14097 --24822 1790
NM_194328chr952475 528 453 244 203 --5468 446 273 137 82 --
NM_194329chr952475 528 453 244 203 --5468 446 273 137 82 --
NM_194330chr952475 528 453 244 203 --5468 446 273 137 82 --
NM_194332chr952475 528 453 244 203 --5468 446 273 137 82 --
NM_198560chr353669 1257 1248 1237 1227 33484 2880 920 12779 --
NM_199454chr1114801 4111 3991 3360 2894 1839 1566 1558 1546 828 97 23333 1857 ----
NM_201267chr24484 450 428 405 --2461 453 2436 98