TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-377-5p
miRNA Sequence: AGAGGUUGCCCUUGGUGAAUUC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr531868 1762 511 --1279 --
NM_000051chr1192755 789 669 495 437 329 312 68 34 1740 12231 --
NM_000052chrX52537 2223 1391 1301 1289 11235 21122 1083 --
NM_000081chr121304 246 21414 588 ----
NM_000084chrX107005 6694 4995 4404 4333 1726 850 630 365 159 12530 26149 5248 25769 2517
NM_000088chr17143 --21264 1167 1223
NM_000089chr7----1260 --
NM_000090chr21356 1265 ----
NM_000091chr242584 2372 1944 815 1427 ----
NM_000092chr284475 3941 3722 1642 863 207 200 40 1336 ----
NM_000093chr93477 446 396 22170 43 2493 34 --
NM_000108chr721279 513 11760 11557 --
NM_000109chrX1927 12583 ----
NM_000110chr111100 ------
NM_000115chr1332305 462 216 31027 774 635 1274 12205
NM_000125chr664277 4214 3169 2601 2591 1553 ------
NM_000129chr641340 1047 390 207 21400 1006 ----
NM_000138chr1532421 473 99 12626 1900 1782
NM_000163chr552214 1735 889 849 89 11864 21623 1583 11445
NM_000165chr621371 112 ------
NM_000176chr5123803 3407 3218 2980 2543 1512 1392 1128 1026 738 692 280 22827 262 ----
NM_000208chr1973300 3028 1861 1720 1465 392 66 54460 3052 1601 1046 822 ----
NM_000210chr232189 568 132 22252 1690 ----
NM_000216chrX53402 1156 860 142 54 13019 --13060
NM_000217chr1284946 4903 4503 3888 3532 3336 2102 1889 44821 4730 4081 820 14653 --
NM_000248chr352720 2689 2452 2364 2259 13064 ----
NM_000259chr15145379 5223 4813 4595 4517 2423 2414 2074 1290 1129 1038 403 364 141 11334 1997 --
NM_000264chr953303 2888 2864 894 698 1931 ----
NM_000266chrX1183 ------
NM_000267chr1783513 3208 2423 2365 2160 1218 1150 32 2546 295 13332 --
NM_000271chr181219 1247 1229 --
NM_000272chr281436 1281 1136 1002 958 928 340 103 ------
NM_000280chr1111022 ------
NM_000284chrX41764 385 113 57 --1784 --
NM_000291chrX286 46 ------
NM_000297chr4--11743 11528 --
NM_000307chrX1333 ------
NM_000314chr1063085 3034 2558 982 735 140 --13102 12123
NM_000321chr13--11660 ----
NM_000332chr6116517 6227 5901 4985 4938 4463 1961 1650 1524 636 125 --26081 5513 --
NM_000334chr1751638 669 326 269 251 32005 609 468 ----
NM_000335chr351615 1406 635 85 40 12207 --1260
NM_000337chr586491 6058 6048 6038 5426 5218 4466 531 1449 24776 687 25627 5461
NM_000340chr3--11036 ----
NM_000346chr1721936 357 --1252 --
NM_000351chrX93771 3676 3653 2934 2881 1270 932 811 330 13687 33887 3755 2998 13862
NM_000362chr2243166 3139 1100 296 --33321 2685 2212 --
NM_000369chr1431634 602 174 ----1728
NM_000376chr1242566 2241 2065 165 1208 1782 21216 633
NM_000378chr1111239 1100 1123 --
NM_000379chr23460 374 318 1329 11535 --
NM_000386chr172707 142 ------
NM_000390chrX63194 2476 2072 1328 804 30 22715 955 1998 --
NM_000393chr241503 754 463 296 ------
NM_000416chr6123 ------
NM_000421chr171306 ------
NM_000428chr1471887 1676 881 843 525 152 121 --22265 2247 --
NM_000430chr1753305 2447 2306 836 602 32365 666 654 11168 --
NM_000439chr532555 2171 2022 11658 1184 --
NM_000441chr732221 1894 49 --1332 --
NM_000448chr1131085 669 619 13083 12219 --
NM_000460chr32345 176 ------
NM_000461chr374490 3617 3538 3441 3154 1305 452 1981 13369 --
NM_000489chrX32268 658 120 ------
NM_000493chr64424 217 193 148 ------
NM_000495chrX187 ------
NM_000509chr41188 ------
NM_000523chr22176 162 1329 ----
NM_000533chrX153 21842 1275 --1650
NM_000538chr131572 ------
NM_000555chrX117499 7177 6940 5796 5466 4969 4851 2382 2367 1123 584 47323 3003 2848 2141 24986 708 1503
NM_000575chr21978 ------
NM_000599chr2144570 4333 3813 3356 3302 3047 2915 1447 1406 605 548 405 154 146 13684 2907 172 --
NM_000609chr1052846 2364 2244 1153 427 11233 22906 80 12623
NM_000615chr1142856 860 710 185 1502 ----
NM_000618chr1286161 5111 4377 2005 1770 788 696 507 36091 5256 1078 55544 5410 5372 1553 388 --
NM_000618chr1286161 5111 4377 2005 1770 788 696 507 36091 5256 1078 55544 5410 5372 1553 388 --
NM_000621chr1341282 1262 332 312 ------
NM_000633chr1854771 4195 4153 3180 1685 24605 636 14338 --
NM_000671chr421275 145 1379 189 182
NM_000683chr42521 446 ------
NM_000693chr1521681 1540 ------
NM_000719chr12106366 6313 6070 5669 4558 4170 2627 2374 1009 397 24575 4296 14545 --
NM_000724chr1051945 1620 1402 1381 1296 11820 ----
NM_000726chr211157 ------
NM_000739chr72276 84 ------
NM_000756chr81398 ------
NM_000767chr1931561 962 473 --41111 338 300 87 --
NM_000788chr431452 977 598 21270 68 ----
NM_000794chr52961 721 ------
NM_000810chr151213 1170 ----
NM_000811chr52537 274 ------
NM_000813chr5105483 5351 4485 3994 2002 1932 1399 280 246 59 35214 4493 1477 ----
NM_000814chr1563593 3585 2925 2884 2816 1332 13263 --21447 1378
NM_000817chr2165 1140 11092 1442
NM_000818chr102467 73 ------
NM_000826chr432496 740 182 12610 ----
NM_000828chrX31805 1728 725 22144 1987 ----
NM_000829chr1141979 1800 748 417 1905 11778 --
NM_000831chr175724 5648 5145 5104 3865 1147 133 35282 4857 23 25402 1716 35742 5448 4259
NM_000836chr194851 840 739 202 --2931 722 --
NM_000838chr622472 1052 ------
NM_000840chr72509 352 ------
NM_000845chr7121 ------
NM_000849chr143066 2806 2781 751 ------
NM_000859chr521488 1065 1466 ----
NM_000868chrX12265 --1137 --
NM_000875chr1596542 5063 4408 4370 1588 1362 1320 912 95 56042 5035 2715 1713 250 ----
NM_000877chr242987 2692 2162 1926 ------
NM_000879chr5--1113 ----
NM_000891chr1763513 2696 2630 2372 1120 636 1816 ----
NM_000900chr122232 24 ------
NM_000901chr422085 1028 ------
NM_000912chr833017 2822 1293 32764 2256 244 1438 --
NM_000917chr10--2210 126 ----
NM_000926chr11158851 8400 8251 8182 8058 7940 7573 7279 7106 6889 6471 2963 701 627 430 28169 1647 11089 17153
NM_000933chr2031434 255 44 --11441 --
NM_000935chr321065 438 ----1121
NM_000941chr71342 ------
NM_000944chr412258 ------
NM_000945chr221683 1460 22069 141 ----
NM_000959chr183598 3288 3241 3203 3161 2847 1151 349 43370 3320 3027 472 23346 530 --
NM_000961chr2073442 1586 1499 1333 1203 53 43 --33293 2902 64 --
NM_000963chr13758 735 273 ------
NM_001001132chr2131365 1240 96 11230 11462 --
NM_001001323chr1221126 54 21252 96 ----
NM_001001342chr1051436 1278 1093 217 176 1204 11310 --
NM_001001395chr1242554 2410 2232 933 1487 ----
NM_001001396chr1114267 3647 1647 1579 1552 1476 1455 1131 833 465 416 --13821 --
NM_001001419chr5113873 3781 3459 1697 1547 1381 1060 1026 881 773 444 25246 4058 11167 --
NM_001001420chr5113873 3781 3459 1697 1547 1381 1060 1026 881 773 444 25246 4058 11167 --
NM_001001436chr163875 753 29 1895 ----
NM_001001481chr843415 982 893 84 12193 1729 --
NM_001001484chr1052441 2391 1521 955 192 12310 ----
NM_001001549chr782742 2552 2530 2002 944 937 921 433 --1850 --
NM_001001550chr782742 2552 2530 2002 944 937 921 433 --1850 --
NM_001001551chr92337 64 ------
NM_001001555chr782742 2552 2530 2002 944 937 921 433 --1850 --
NM_001001557chr861684 1636 1527 180 167 129 --1731 --
NM_001001664chr253646 2901 2554 1200 474 --14034 --
NM_001001701chr441867 1584 664 67 --12314 --
NM_001001890chr2154198 3098 2975 1133 1107 13329 1175 --
NM_001001933chr11426 ------
NM_001001974chr1031763 859 324 1807 ----
NM_001001995chrX21764 158 ------
NM_001002026chr392465 2391 2196 1935 606 520 462 295 120 2809 158 ----
NM_001002033chr172737 63 2550 339 ----
NM_001002233chr852153 1936 1557 811 590 11843 11996 --
NM_001002257chr242760 896 180 58 ----11407
NM_001002759chr102552 42 --2184 146 --
NM_001002843chr152344 144 1993 ----
NM_001002860chr1454458 4123 4045 911 68 23844 3247 23529 562 --
NM_001002906chrY1531 ------
NM_001002909chr1712140 12181 11627 --
NM_001003406chr2263214 3107 2324 2253 1197 881 ----12224
NM_001003652chr18137080 6930 6858 6706 6365 5654 5416 2442 2112 1950 733 723 415 58187 6621 5811 5762 5290 12233 --
NM_001003674chr18146762 5944 5803 5559 5453 5440 4302 2305 2114 1808 1232 1220 749 191 --16484 --
NM_001003675chr18146762 5944 5803 5559 5453 5440 4302 2305 2114 1808 1232 1220 749 191 --16484 --
NM_001003698chr651625 1583 763 326 185 11565 11777 1661
NM_001003699chr651625 1583 763 326 185 11565 11777 1661
NM_001003712chr1254052 3990 3401 1134 384 13742 ----
NM_001003760chr663425 3264 1018 879 647 65 23647 1212 1895 --
NM_001003800chr963571 2955 2281 1060 447 87 13448 --1467
NM_001003945chr951841 1449 691 316 297 1746 ----
NM_001004065chr973635 3067 2557 880 652 403 259 --1335 --
NM_001004127chr131783 ----183
NM_001004304chr1212922 32459 2066 168 1317 1406
NM_001004317chr672890 2737 1302 1220 924 858 603 33660 3235 653 13888 --
NM_001004329chr1241489 1268 202 105 ------
NM_001004342chr1135947 5550 5318 4772 4612 4515 4420 4233 4113 4021 2258 628 118 --24556 3753 --
NM_001004360chr231670 414 367 ------
NM_001004419chr1244034 3922 1248 816 24570 3819 14046 --
NM_001004441chr551362 1172 1121 647 93 11247 1251 --
NM_001004720chr21972 1694 ----
NM_001004722chr211141 1863 ----
NM_001005335chr191220 ------
NM_001005386chr242200 1783 524 60 ------
NM_001005404chr1784496 4271 4045 3489 1814 1581 1275 1206 ------
NM_001005463chr1062214 2010 1720 1707 767 185 1586 ----
NM_001005473chr595784 5651 4918 4565 4078 2197 1762 1414 328 25393 4770 2756 361 --
NM_001005476chr2140 ----1542
NM_001005502chr12115071 3861 3666 3516 3293 1697 1537 1368 1036 570 497 15044 24931 4893 --
NM_001005609chrX143476 3428 3206 3137 2410 1525 1480 1072 1019 874 811 464 238 67 --13290 --
NM_001005611chrX1423 --146 --
NM_001005732chr211638 1646 --1474
NM_001005733chr211595 1603 --1431
NM_001005746chr211157 ------
NM_001005747chr211157 ------
NM_001005849chr172596 504 ------
NM_001005920chr161354 1307 --11067
NM_001006115chr342331 2183 2168 598 --1681 --
NM_001006600chr521505 879 32232 2226 2198 11601 --
NM_001006610chr16180 141 ----
NM_001006612chrX2169 97 --1350 --
NM_001006613chrX2169 97 --1350 --
NM_001006614chrX2169 97 --1350 --
NM_001006617chr92341 22 --11081 --
NM_001006618chr9194 ------
NM_001006619chr92341 22 --11081 --
NM_001006620chr92341 22 --11081 --
NM_001006621chr92341 22 --11081 --
NM_001006623chr231958 1810 471 --146 --
NM_001006626chr72276 84 ------
NM_001006627chr72276 84 ------
NM_001006628chr72276 84 ------
NM_001006629chr72276 84 ------
NM_001006630chr72276 84 ------
NM_001006631chr72276 84 ------
NM_001006632chr72276 84 ------
NM_001006641chr971776 1574 1421 1364 555 536 50 11414 --11617
NM_001006642chr971776 1574 1421 1364 555 536 50 11414 --11617
NM_001006643chr971776 1574 1421 1364 555 536 50 11414 --11617
NM_001006657chr242782 1255 1012 552 --12576 21047 112
NM_001006939chr101741 ------
NM_001007024chr1784076 3613 3531 3515 2686 1547 1033 559 23054 1677 3761 710 533 --
NM_001007025chr1784076 3613 3531 3515 2686 1547 1033 559 23054 1677 3761 710 533 --
NM_001007097chr944918 4073 1185 869 13465 ----
NM_001007102chr621157 398 ----11088
NM_001007156chr152462 345 --31839 1611 478 1392
NM_001007226chr1721044 87 11253 ----
NM_001007227chr1721044 87 11253 ----
NM_001007228chr1721044 87 11253 ----
NM_001007229chr1721044 87 11253 ----
NM_001007230chr1721044 87 11253 ----
NM_001007246chr2121917 1724 21733 299 ----
NM_001007257chr12353 58 128 --1959
NM_001007466chr655152 4878 3881 3845 869 23596 3508 11046 13906
NM_001007559chr1851988 1937 717 151 117 11848 21736 1698 11683
NM_001007794chr11683 ------
NM_001008225chr71672 1725 ----
NM_001008239chr1853294 2882 2751 784 256 ------
NM_001008392chr363124 2689 1361 614 381 43 --11139 --
NM_001008408chr745682 4692 4560 4532 15044 25761 1378 12356
NM_001008495chr842163 2091 1827 789 --11836 --
NM_001008529chr1721321 1074 1851 ----
NM_001008541chr1042330 633 494 192 1667 2757 65 --
NM_001008541chr1042330 633 494 192 1667 2757 65 --
NM_001008564chr135832 758 596 297 278 ------
NM_001008567chr92263 127 --1320 --
NM_001008701chr1962914 2671 2489 2401 1906 162 1969 12474 --
NM_001008738chr552969 2924 2098 505 431 --32055 1883 733 --
NM_001008777chr172248 112 ----1189
NM_001008801chr1921446 1414 61940 688 437 214 166 82 21540 127 --
NM_001008860chr154726 677 530 110 1193 ----
NM_001008892chr154726 677 530 110 1193 ----
NM_001008894chr154726 677 530 110 1193 ----
NM_001009185chr5--1518 ----
NM_001009552chr81398 ------
NM_001009554chr454623 4472 3278 3220 2902 24080 1276 ----
NM_001009554chr454623 4472 3278 3220 2902 24080 1276 ----
NM_001009555chr421383 484 11716 --1433
NM_001009881chr11480 ------
NM_001009882chr11480 ------
NM_001009894chr1241449 639 373 188 11614 --1367
NM_001009899chr376265 5591 5212 4192 2494 1558 543 12088 32093 2054 1446 --
NM_001009909chr1163077 2405 1481 1147 467 100 33476 2610 185 ----
NM_001009959chr232243 1820 434 52199 1770 1054 231 181 ----
NM_001009993chr294485 3596 3323 3101 3018 1300 561 397 329 34515 4245 1775 1504 --
NM_001010853chr683019 2566 1068 625 534 340 295 58 2738 397 2588 572 --
NM_001010861chr162533 1877 1046 370 339 141 ------
NM_001010862chrX72701 2448 2418 621 411 164 133 1927 1184 22933 405
NM_001010867chr155958 5763 5033 4617 4451 35523 4182 372 95403 5256 5224 2227 2099 2061 2045 1526 786 45843 5789 5219 1370
NM_001010888chrX84401 3937 3870 1822 1023 895 811 708 33434 1849 439 2530 492 --
NM_001010891chr586953 6762 5780 5752 5640 5021 1604 49 46947 6006 5311 2730 45199 5161 2616 2578 --
NM_001010908chr101562 1522 --1551
NM_001010934chr711164 ------
NM_001010942chr1231146 440 76 ------
NM_001010971chr1--1736 1962 128
NM_001010980chr152977 1331 993 486 42 11279 51370 1083 962 159 133 --
NM_001010984chr122206 985 --1253 --
NM_001010986chrX22489 831 ------
NM_001010989chr161547 ------
NM_001010990chr161547 ------
NM_001011513chr463206 2853 1388 777 611 323 ------
NM_001011515chr4------167
NM_001011516chr4------167
NM_001011537chr312207 ------
NM_001011553chr71849 1642 ----
NM_001011658chrX52020 1365 811 479 314 --51404 700 662 369 331 --
NM_001011663chr1021108 159 ------
NM_001011666chr7145984 5644 5594 4891 4727 4641 2092 1843 1800 1661 1619 741 486 274 15775 ----
NM_001011708chr282926 2611 2401 2216 1153 1117 423 289 --134 --
NM_001011885chr1531407 401 247 11558 ----
NM_001012264chr141955 --2681 23 --
NM_001012267chr931736 1598 1554 1714 11935 1313
NM_001012393chr11105141 5001 1966 1337 1275 994 919 900 731 396 34234 1746 370 11076 13629
NM_001012420chr1552178 2107 872 567 68 ------
NM_001012423chr1552178 2107 872 567 68 ------
NM_001012426chr663072 2414 2310 1261 875 648 194 32797 2659 2621 22792 2774
NM_001012427chr663072 2414 2310 1261 875 648 194 32797 2659 2621 22792 2774
NM_001012454chr71147 ------
NM_001012755chrX44561 3786 443 149 21545 232 31482 1301 1263 11412
NM_001012756chr1932399 2139 706 32806 2565 689 22454 2416 12692
NM_001012761chr532626 1759 1692 12416 --1989
NM_001012989chrX1651 ------
NM_001012990chrX1311 ------
NM_001013031chr1043125 3058 1230 811 22732 2469 ----
NM_001013399chr631158 404 188 ------
NM_001013406chr741402 1253 1098 174 41693 1632 1613 656 11618 --
NM_001013415chr421513 597 --11537 --
NM_001013438chr31853 ------
NM_001013439chr31699 ------
NM_001013635chr121387 21196 853 ----
NM_001013693chr152846 2369 2199 915 898 ------
NM_001013693chr152846 2369 2199 915 898 ------
NM_001013717chr51342 11104 ----
NM_001013843chr156689 594 327 210 82 45 ------
NM_001014431chr144957 921 795 743 ------
NM_001014432chr144957 921 795 743 ------
NM_001014434chr12770 325 ------
NM_001014442chr131118 ------
NM_001014449chr16----1205 --
NM_001014451chr16----1205 --
NM_001014797chr10148042 7995 7911 7871 7756 6863 3146 3019 2367 2097 1518 1503 1486 366 27681 175 11025 --
NM_001014809chr41913 ------
NM_001014812chr15184 ------
NM_001015877chrX32139 518 479 22846 2293 12078 --
NM_001017368chr1742715 2175 1961 1792 12264 ----
NM_001017369chr41835 1773 1133 --
NM_001017395chr372720 2308 749 595 306 284 69 13681 ----
NM_001017440chr788106 4989 2634 2070 1908 1864 1713 1407 35374 5010 303 15646 12059
NM_001017524chr1111114 21657 71 11356 --
NM_001017535chr1242566 2241 2065 165 1208 1782 21216 633
NM_001017926chr841533 579 227 75 ------
NM_001017930chrX31067 187 147 --1537 --
NM_001017962chr10--2210 126 ----
NM_001017977chr12267 134 ------
NM_001017979chr42188 125 ------
NM_001017999chr152270 1518 1505 1474 178 ------
NM_001017999chr152270 1518 1505 1474 178 ------
NM_001018000chr152270 1518 1505 1474 178 ------
NM_001018000chr152270 1518 1505 1474 178 ------
NM_001018001chr152270 1518 1505 1474 178 ------
NM_001018038chr92567 106 ------
NM_001018054chr111021 ------
NM_001018057chr1131446 1020 410 ------
NM_001018064chr92615 321 22082 1463 ----
NM_001018065chr9115771 3855 2408 2272 2007 1786 803 675 632 534 146 ------
NM_001018066chr9115771 3855 2408 2272 2007 1786 803 675 632 534 146 ------
NM_001018067chr153766 1883 1497 1168 162 23307 1594 34081 4046 1936 --
NM_001018068chr153766 1883 1497 1168 162 23307 1594 34081 4046 1936 --
NM_001018069chr153766 1883 1497 1168 162 23307 1594 34081 4046 1936 --
NM_001018074chr5123803 3407 3218 2980 2543 1512 1392 1128 1026 738 692 280 22827 262 ----
NM_001018075chr5123803 3407 3218 2980 2543 1512 1392 1128 1026 738 692 280 22827 262 ----
NM_001018076chr5123803 3407 3218 2980 2543 1512 1392 1128 1026 738 692 280 22827 262 ----
NM_001018077chr5123803 3407 3218 2980 2543 1512 1392 1128 1026 738 692 280 22827 262 ----
NM_001018100chr151822 ------
NM_001018837chr11162 ------
NM_001020825chr531278 882 455 1302 ----
NM_001023567chr155875 634 611 570 68 11647 --11778
NM_001023587chr35940 766 196 42 24 1409 --1909
NM_001024094chr5123803 3407 3218 2980 2543 1512 1392 1128 1026 738 692 280 22827 262 ----
NM_001024226chr151187 1081 946 733 149 11051 1982 --
NM_001024227chr151187 1081 946 733 149 11051 1982 --
NM_001024228chr151187 1081 946 733 149 11051 1982 --
NM_001024401chr1652431 2213 980 947 817 --22207 1070 --
NM_001024455chrX52092 1738 1707 830 640 ------
NM_001024649chr512312 22981 105 ----
NM_001024660chr31136 1333 ----
NM_001024808chr1272650 1751 1052 871 443 206 68 --12126 --
NM_001024847chr362111 1977 1825 1658 943 755 --11668 --
NM_001024912chr1971671 1542 1377 1196 429 404 243 --31555 351 81 176
NM_001024947chr541030 891 348 275 ----1951
NM_001024948chr173520 3313 3011 2296 2254 856 612 2722 659 ----
NM_001024959chr32329 294 --1649 --
NM_001024960chr32329 294 --1649 --
NM_001025068chr321734 1330 1461 ----
NM_001025069chr321734 1330 1461 ----
NM_001025076chr1085167 4998 4974 4441 2323 2016 1622 1407 2215 149 --11374
NM_001025077chr10126525 6356 6332 5799 4672 2980 2765 1090 965 268 106 65 21573 1507 --12732
NM_001025079chr343898 2900 1449 427 --13131 --
NM_001025105chr541563 1386 339 195 ------
NM_001025108chr254077 3815 3506 1217 933 1409 12836 12799
NM_001025233chr1262704 1763 844 781 486 441 --12227 --
NM_001025252chr862842 2495 727 652 628 391 22330 2312 12668 --
NM_001025253chr862842 2495 727 652 628 391 22330 2312 12668 --
NM_001025266chr354881 3943 1910 1399 677 1653 43831 1698 1660 26 --
NM_001025366chr641701 1570 695 23 --11409 --
NM_001025366chr641701 1570 695 23 --11409 --
NM_001025367chr641701 1570 695 23 --11409 --
NM_001025367chr641701 1570 695 23 --11409 --
NM_001025368chr641701 1570 695 23 --11409 --
NM_001025368chr641701 1570 695 23 --11409 --
NM_001025369chr641717 1586 711 39 --11425 --
NM_001025369chr641717 1586 711 39 --11425 --
NM_001025370chr641701 1570 695 23 --11409 --
NM_001025370chr641701 1570 695 23 --11409 --
NM_001025580chrX54049 3776 3497 575 43 12934 ----
NM_001025596chr112535 496 1340 ----
NM_001029858chr643117 2103 851 335 22794 2582 32840 1310 1272 --
NM_001029863chr652622 2141 2035 1055 69 1452 1305 --
NM_001029875chr582508 2405 2158 2117 2070 1901 466 62 12196 ----
NM_001029884chr651885 996 293 251 146 --31940 1902 32 --
NM_001029999chr183357 236 228 ------
NM_001030006chr1752306 1827 1818 157 134 1661 12163 --
NM_001030007chr1631603 1058 748 22795 1323 --13147
NM_001030055chr1454468 4340 1719 425 379 34088 3888 1522 --1257
NM_001030272chr111151 1168 ----
NM_001030273chr111151 1168 ----
NM_001030287chr111183 --1784 --
NM_001031679chr1253356 2656 1104 926 232 12460 12593 12503
NM_001031680chr182516 2372 2233 1786 1037 983 419 148 2403 300 2275 48 --
NM_001031684chr231309 475 82 21037 316 ----
NM_001031690chr721010 293 21933 492 --22838 1157
NM_001031695chr2255420 4920 3901 802 654 --13607 --
NM_001031710chr72913 859 ------
NM_001031711chr54598 428 82 46 --1370 --
NM_001031732chr443584 2963 2627 697 --1481 --
NM_001031804chr1673592 3501 2991 1691 1261 775 283 11198 31203 800 564 --
NM_001031812chr541719 874 379 191 1911 ----
NM_001032221chr991521 1512 1461 1309 701 679 582 532 399 11748 ----
NM_001032280chr621551 625 11217 2224 198 --
NM_001032282chr83881 349 125 ------
NM_001032283chr12127 ------
NM_001032284chr12127 ------
NM_001032288chr2051581 1306 1191 473 250 21520 103 ----
NM_001032289chrX1114 1601 ----
NM_001032293chr17251 41 1560 ----
NM_001032380chr102724 525 ------
NM_001032393chrX--1265 ----
NM_001032394chr641107 920 894 159 22044 337 182 --
NM_001033044chr131725 1502 444 --11411 --
NM_001033045chr2103418 3309 1774 1648 1606 1467 1079 687 601 433 21220 108 197 --
NM_001033047chr432360 1870 883 11673 ----
NM_001033056chr131725 1502 444 --11411 --
NM_001033057chr331916 324 285 1771 124 --
NM_001033081chr171583 1324 1219 579 353 175 57 21349 366 ----
NM_001033082chr171583 1324 1219 579 353 175 57 21349 366 ----
NM_001033087chr2052839 2433 2392 502 278 --11261 --
NM_001033088chr153376 165 71 1333 ----
NM_001033112chr52762 609 2800 287 ----
NM_001033117chr374401 3265 3115 1878 634 314 195 --14279 --
NM_001033503chr51140 ------
NM_001033507chr132003 768 418 11440 1311 --
NM_001033557chr2----1508 --
NM_001033561chr172144 121 ------
NM_001033576chr1772491 2335 1998 1952 1725 573 438 --12037 --
NM_001033578chr881835 1700 1518 935 682 276 259 59 ------
NM_001033659chr1741421 1257 296 130 11672 ----
NM_001033756chr631635 1504 629 --11343 --
NM_001033756chr631635 1504 629 --11343 --
NM_001033910chr152113 2040 1755 1746 145 ------
NM_001033925chr102660 126 ------
NM_001034841chr16115192 5015 4913 4797 4768 4490 4103 4096 3814 2203 1769 14629 34452 2050 775 --
NM_001034845chr42395 159 1190 ----
NM_001034850chr531597 1200 1135 ------
NM_001034852chr1441434 497 272 67 --11713 --
NM_001035chr121214 884 --1363 --
NM_001035260chr1041426 337 76 47 21336 1103 --11634
NM_001037132chr721809 1430 1456 ----
NM_001037133chr721809 1430 1456 ----
NM_001037164chr721484 735 ------
NM_001037317chr162533 1877 1046 370 339 141 ------
NM_001037331chr183780 649 301 ------
NM_001037339chr141620 1499 672 395 1356 1468 --
NM_001037340chr141620 1499 672 395 1356 1468 --
NM_001037341chr141620 1499 672 395 1356 1468 --
NM_001037341chr141620 1499 672 395 1356 1468 --
NM_001037442chr4------1532
NM_001037535chrX21046 1020 --136 --
NM_001037536chrX21046 1020 --136 --
NM_001037540chrX21046 1020 --136 --
NM_001037738chr51222 1122 ----
NM_001038493chr22476 172 --21266 341 --
NM_001038702chr562148 2011 1053 1024 944 917 22210 424 ----
NM_001038707chr132153 740 643 1546 1837 --
NM_001038707chr132153 740 643 1546 1837 --
NM_001039091chrX51269 1250 1244 479 313 ------
NM_001039199chr20155051 4807 4791 4304 4017 3717 3550 1935 1715 1683 1509 752 490 427 128 12016 ----
NM_001039538chr233474 3172 2262 1113 22809 2791 --
NM_001039569chr253354 2975 2179 1218 953 32777 2701 88 22483 2445 12593
NM_001039570chr22114519 3666 2968 2941 2852 1604 1253 1152 1012 846 608 --163 --
NM_001039571chr22114519 3666 2968 2941 2852 1604 1253 1152 1012 846 608 --163 --
NM_001039580chr485027 3842 1823 1633 1360 1301 1151 1108 11333 --13376
NM_001039585chr193855 3545 3498 3460 3418 3104 1408 606 122 43627 3577 3284 729 23603 787 --
NM_001039590chrX33226 3091 530 --32582 857 60 --
NM_001039591chrX33226 3091 530 --32582 857 60 --
NM_001039618chr113698 286 201 14827 15011 --
NM_001039690chr1641490 634 573 550 22252 808 11811 --
NM_001039711chr1--11138 ----
NM_001039712chr1--11138 ----
NM_001039840chrX105962 5794 5133 4834 3886 1807 1723 1717 1483 98 35314 4120 2025 --14923
NM_001039888chr1----1635 2623 590
NM_001039937chr1353185 2599 1190 821 253 --22618 315 --
NM_001040057chr711383 ------
NM_001040092chr81406 ------
NM_001040101chr431585 1056 374 ------
NM_001040108chr1463073 2147 1266 1166 991 827 12358 ----
NM_001040110chr741768 1433 1425 118 --21548 1281 --
NM_001040113chr165789 780 335 148 26 1356 1798 --
NM_001040144chr1641490 634 573 550 22252 808 11811 --
NM_001040146chr1641490 634 573 550 22252 808 11811 --
NM_001040151chr1174212 3586 3434 3196 1837 1451 201 34222 4203 1228 33208 1251 1078 1262
NM_001040152chr794909 4818 4427 3288 3104 1478 1409 963 277 11727 11068 1153
NM_001040202chr43650 607 427 1953 ----
NM_001040260chr431163 1001 320 ------
NM_001040261chr431163 1001 320 ------
NM_001040284chr1675674 5571 5255 5036 4426 1031 842 25751 92 ----
NM_001040402chr443061 2456 2340 970 2880 465 22631 485 --
NM_001040409chr23873 381 235 1764 ----
NM_001040429chr13103374 3261 3200 2907 2864 2292 2251 1440 633 316 ------
NM_001040431chr172118 29 ------
NM_001040439chr165566 200 114 106 26 ----1899
NM_001040441chr1145393 5093 4705 3953 1933 1883 1718 1619 1274 1029 883 863 739 520 25001 1324 14016 24045 2201
NM_001040450chr1572732 2465 1982 1119 991 760 684 32111 2055 899 ----
NM_001040453chr1572732 2465 1982 1119 991 760 684 32111 2055 899 ----
NM_001040619chr121633 411 --21234 348 --
NM_001040624chr862567 2528 1960 1725 988 823 ------
NM_001040625chr862567 2528 1960 1725 988 823 ------
NM_001040626chr862567 2528 1960 1725 988 823 ------
NM_001040627chr862567 2528 1960 1725 988 823 ------
NM_001040628chr862567 2528 1960 1725 988 823 ------
NM_001040629chr862567 2528 1960 1725 988 823 ------
NM_001040630chr862567 2528 1960 1725 988 823 ------
NM_001040665chr7104997 4897 4233 4077 3943 3734 3342 1434 1186 415 ------
NM_001040666chr72699 599 ------
NM_001040712chr942293 736 196 99 11121 ----
NM_001042355chr1685135 3978 3785 3628 1620 902 536 330 ------
NM_001042361chr1051292 1077 454 254 136 ------
NM_001042364chr1051292 1077 454 254 136 ------
NM_001042365chr1051292 1077 454 254 136 ------
NM_001042387chr1051292 1077 454 254 136 ------
NM_001042388chr181394 --1759 --
NM_001042393chr1051292 1077 454 254 136 ------
NM_001042396chr1051292 1077 454 254 136 ------
NM_001042397chr1051292 1077 454 254 136 ------
NM_001042403chr1221017 285 177 ----
NM_001042404chr121361 107 ------
NM_001042406chr641087 1079 493 79 ------
NM_001042412chr1685135 3978 3785 3628 1620 902 536 330 ------
NM_001042413chr963830 3182 2926 1514 847 603 32667 386 260 13903 12508
NM_001042424chr42998 341 13069 --22990 236
NM_001042425chr621551 625 11217 2224 198 --
NM_001042437chr24804 634 310 59 1395 ----
NM_001042473chr1012164 22123 48 1218 11444
NM_001042486chr2031508 387 121 --41524 1172 303 83 1607
NM_001042492chr1783513 3208 2423 2365 2160 1218 1150 32 2546 295 13332 --
NM_001042494chr1543726 2852 2569 1226 31353 374 145 42624 2586 2345 574 12745
NM_001042495chr1543726 2852 2569 1226 31353 374 145 42624 2586 2345 574 12745
NM_001042496chr1543726 2852 2569 1226 31353 374 145 42624 2586 2345 574 12745
NM_001042497chr1543726 2852 2569 1226 31353 374 145 42624 2586 2345 574 12745
NM_001042517chr131808 ------
NM_001042555chr1274104 3828 3215 2951 1663 1542 356 --1764 14185
NM_001042576chr203463 80 36 --1106 --
NM_001042599chr2105843 4833 4747 2597 2508 1954 1245 806 599 581 24953 2307 27598 7431 12033
NM_001042601chr342836 619 578 288 ------
NM_001042603chr1244417 1381 616 376 34170 895 566 ----
NM_001042604chr373831 3513 3012 1715 1263 630 259 14793 ----
NM_001042681chr152143 1932 872 558 276 ------
NM_001042682chr152143 1932 872 558 276 ------
NM_001042682chr152143 1932 872 558 276 ------
NM_001042724chr194696 671 619 80 1642 1250 1207
NM_001042749chrX31805 386 315 ------
NM_001042750chrX31805 386 315 ------
NM_001042751chrX31805 386 315 ------
NM_001043318chr1474153 3825 3527 2535 1353 986 900 33588 2843 1395 32723 2685 1374 --
NM_001044305chr631387 578 265 ------
NM_001044385chr263714 3559 1294 1161 571 411 21556 1347 13071 --
NM_001044722chr541719 874 379 191 1911 ----
NM_001044723chr541719 874 379 191 1911 ----
NM_001046chr522980 203 1721 11919 --
NM_001048183chr1113733 3646 2998 2493 2327 1421 1252 955 812 448 217 --63228 3015 2843 2709 2671 466 22820 2656
NM_001049chr1432216 2111 154 --1323 --
NM_001069chr6138 ------
NM_001071775chr13--11293 11474 --
NM_001083620chr432494 739 182 12608 ----
NM_001083621chr194633 4548 3966 2989 1699 1528 1437 846 828 13657 13268 --
NM_001092chr1772475 2277 2269 2222 759 499 50 --1461 22018 195
NM_001099678chr3126042 5290 5181 4987 4821 4231 4095 922 912 750 743 560 1661 14193 15437
NM_001100108chr1147843 7095 6298 6138 5939 5902 5663 5319 3193 2721 2507 1999 1792 669 37361 5829 2676 --11708
NM_001106chr356651 3170 1985 1253 430 58370 7369 3256 1428 299 27285 2641 --
NM_001113490chrX33465 3347 2581 32831 2640 2219 1767 --
NM_001117chr1842234 2001 1665 584 --11715 --
NM_001121chr1051850 1696 1597 627 462 ------
NM_001124chr11--1492 ----
NM_001126chr11700 ------
NM_001128chr1631603 1058 748 22795 1323 --13147
NM_001148chr461953 1827 1478 747 500 415 21837 488 1103 --
NM_001149chr101993 ------
NM_001153chr2--157 ----
NM_001156chr101251 --1444 --
NM_001159chr22191 53 ------
NM_001160chr1242490 1765 451 80 22186 801 31125 989 691 1952
NM_001167chrX156674 6565 6263 6099 5571 5428 5263 5202 4270 4105 2406 1794 1519 1006 398 35709 4837 2084 22651 1932 --
NM_001173chr1454468 4340 1719 425 379 34088 3888 1522 --1257
NM_001178chr111151 1168 ----
NM_001186chr2142884 2424 1086 234 ------
NM_001198chr642047 1932 1726 797 21670 169 1548 --
NM_001200chr2011152 ------
NM_001204chr2106807 6205 6086 5855 5077 2176 1788 1486 1296 775 55158 4928 2983 2735 1097 25703 1501 --
NM_001206chr952319 2249 2172 755 719 ------
NM_001219chr731810 1652 1581 32057 1992 1801 ----
NM_001222chr1062007 1979 1240 729 595 505 --147 --
NM_001237chr421139 288 ------
NM_001237chr421139 288 ------
NM_001241chr222058 1813 42237 1874 1701 729 11590 --
NM_001241chr222058 1813 42237 1874 1701 729 11590 --
NM_001256chr1742424 1889 936 271 ------
NM_001257chr1621379 422 1103 ----
NM_001259chr795983 5771 5726 2441 1571 1224 772 363 305 25193 4318 ----
NM_001271chr1532291 976 226 ------
NM_001278chr1061125 1090 910 781 355 193 1410 ----
NM_001282chr1752306 1827 1818 157 134 1661 12163 --
NM_001283chr71531 ------
NM_001292chr153735 206 200 --2986 128 --
NM_001300chr101340 ------
NM_001304chr1793632 3298 3186 987 878 661 447 193 168 ------
NM_001310chr1262989 2561 821 788 687 467 ------
NM_001313chr41913 ------
NM_001316chr202154 147 ------
NM_001329chr1051656 1559 1537 1465 435 11372 1223 --
NM_001331chr1132475 869 615 1681 1167 --
NM_001343chr521219 302 --1537 11116
NM_001344chr142238 188 --1216 --
NM_001346chr322135 666 22567 1795 42677 1776 565 277 12536
NM_001349chr21103 1233 ----
NM_001356chrX51635 1629 446 423 331 12383 ----
NM_001358chr42400 379 ------
NM_001362chr1431011 1002 673 --1167 --
NM_001364chr11104410 3864 3702 3527 3326 1511 1103 388 292 254 2605 381 13076 --
NM_001379chr192309 80 ------
NM_001380chr101977 ------
NM_001387chr553064 2776 2267 2187 1287 1125 32896 2577 2097 --
NM_001389chr21--1420 ----
NM_001390chr1863566 2423 1419 1339 414 123 --13242 1136
NM_001391chr1851142 987 450 386 26 ------
NM_001396chr2131923 828 542 --12817 --
NM_001399chrX143476 3428 3206 3137 2410 1525 1480 1072 1019 874 811 464 238 67 --13290 --
NM_001400chr131354 146 75 ------
NM_001402chr641962 373 241 134 11271 21319 1281 --
NM_001412chrX43777 1375 1187 921 12554 ----
NM_001419chr19113850 3831 3798 3713 3516 3190 1857 1538 1050 312 199 --23881 3232 --
NM_001427chr752130 1817 1766 1747 360 ----1676
NM_001431chr63928 161 34 1843 --11190
NM_001438chr11760 12983 1746 --
NM_001448chrX21707 1628 ------
NM_001482chr152668 179 ------
NM_001494chr103716 584 281 ------
NM_001497chr992583 2131 2056 1708 1081 1052 178 67 45 ------
NM_001518chr71115 1277 1907 --
NM_001527chr694567 4520 3932 3280 1482 1473 1379 1195 1065 24612 3129 54171 3311 3016 2978 2962 --
NM_001530chr141362 ------
NM_001533chr191220 ------
NM_001543chr543554 3349 910 211 --34844 4300 545 1817
NM_001546chr62176 121 --11435 --
NM_001560chrX52633 1931 828 620 600 --1305 --
NM_001584chr1121059 491 ------
NM_001604chr1111022 ------
NM_001616chr252960 2666 1367 574 214 ------
NM_001621chr732494 2223 453 1514 11000 --
NM_001621chr732494 2223 453 1514 11000 --
NM_001635chr731089 121 49 ------
NM_001642chr1131355 1177 118 21284 221 --1413
NM_001650chr1822889 1232 1595 11069 23377 3302
NM_001654chrX1306 ----132
NM_001658chr151187 1081 946 733 149 11051 1982 --
NM_001659chr1212317 ----12106
NM_001660chr32693 552 --1275 --
NM_001663chr1412423 ------
NM_001664chr32871 273 ------
NM_001665chr113573 478 380 ------
NM_001674chr111183 --1784 --
NM_001678chr1741641 1445 1424 158 1127 21670 201 1212
NM_001681chr122234 124 1287 ----
NM_001682chr121840 1966 ----
NM_001684chr1113984 3364 1364 1296 1269 1193 1172 848 550 182 133 --13538 --
NM_001690chr341956 1946 1736 699 22474 849 1738 --
NM_001701chr9139 ----1445
NM_001704chr61151 1482 ----
NM_001709chr1152545 2338 465 205 152 --11862 --
NM_001714chr121218 ------
NM_001726chr1298 29 ------
NM_001731chr122708 353 ------
NM_001742chr731359 520 211 ------
NM_001743chr2--1181 ----
NM_001744chr5--1152 ----
NM_001746chr512312 22981 105 ----
NM_001748chr1--2797 91 --1419
NM_001753chr741711 1539 1452 605 1654 1728 1361
NM_001754chr2154198 3098 2975 1133 1107 13329 1175 --
NM_001755chr1642313 779 621 41 135 --1172
NM_001759chr1265254 4711 4690 3554 1634 1465 --24316 506 --
NM_001777chr343898 2900 1449 427 --13131 --
NM_001782chr92243 64 ------
NM_001788chr71849 1642 ----
NM_001792chr18--1753 ----
NM_001797chr162796 530 --1224 --
NM_001806chr1932983 1991 1100 1602 ----
NM_001821chr174396 1888 1869 1149 943 170 34 24145 3342 13927 --
NM_001829chr42791 71 ------
NM_001830chrX63066 2796 2771 899 593 150 13487 --11399
NM_001839chr11313 ------
NM_001843chr121254 ------
NM_001845chr132483 166 11131 --1989
NM_001859chr973815 3649 2991 2797 2495 763 190 1424 ----
NM_001866chrX1122 ------
NM_001873chr42153 133 ------
NM_001874chr12115071 3861 3666 3516 3293 1697 1537 1368 1036 570 497 15044 24931 4893 --
NM_001884chr51492 ------
NM_001892chr541563 1386 339 195 ------
NM_001904chr341030 981 301 253 172 ----
NM_001918chr1179287 8684 8529 7258 6598 6202 5837 5818 5772 3240 2607 2443 1874 1567 1003 547 381 67804 7782 7131 6839 2464 2307 27205 6982 --
NM_001938chr111783 2554 301 ----
NM_001939chrX42768 2614 1334 68 1622 21495 80 --
NM_001942chr1841704 1535 1260 689 1666 21770 94 --
NM_001946chr122911 252 11161 ----
NM_001949chr651229 928 615 607 396 1131 1976 --
NM_001951chr82258 67 1158 ----
NM_001954chr61616 ------
NM_001957chr452335 1591 1571 849 82 --11602 --
NM_001962chr51139 ----1160
NM_001968chr42342 73 ------
NM_001969chr1473631 3350 2684 1386 1308 1157 865 23930 612 12936 --
NM_001977chr431771 1239 522 11339 ----
NM_001981chr132221 1874 1776 3929 639 601 ----
NM_001987chr1284186 4012 3779 3053 2905 1294 1200 259 1439 1699 --
NM_001992chr572237 1945 1543 855 656 392 53 1869 ----
NM_001995chr4--21372 477 145 --
NM_001999chr5--21290 233 ----
NM_002006chr485268 4920 3604 2165 2003 1111 812 578 124 ----
NM_002009chr15--1984 ----
NM_002015chr1393238 3078 3039 2902 2575 1188 601 542 516 12227 12117 --
NM_002023chr131688 580 175 3651 314 270 ----
NM_002024chrX22082 1939 --1397 --
NM_002025chrX139330 8751 8726 8034 7374 7303 3093 2859 2674 2167 1985 487 174 36052 3526 3121 ----
NM_002026chr221050 696 ------
NM_002035chr1873771 3386 3211 2691 1504 1448 405 --1796 12603
NM_002037chr61141 ------
NM_002040chr2133012 2583 1007 ------
NM_002054chr21419 ------
NM_002061chr1101951 1786 1585 1476 1311 1213 1201 1183 599 190 11387 ----
NM_002063chrX11219 1458 ----
NM_002065chr131725 1502 444 --11411 --
NM_002072chr92887 249 ------
NM_002074chr121118 48 1123 1550 --
NM_002076chr1223159 2209 22826 2291 32717 2679 1290 --
NM_002077chr941716 1544 1447 1333 2300 173 ----
NM_002080chr162831 244 --3861 47 32 --
NM_002092chr423632 420 14876 34642 4604 4230 --
NM_002126chr1744136 3609 3126 3059 --180 --
NM_002128chr1362325 2089 1866 816 736 211 ------
NM_002130chr52666 353 1257 ----
NM_002136chr122487 452 ------
NM_002137chr731871 933 364 ------
NM_002146chr172508 70 1521 1927 --
NM_002148chr22651 102 ------
NM_002154chr5156 ------
NM_002156chr22371 287 177 1434 --
NM_002158chr2103758 3729 3707 3159 2535 2364 1357 1154 996 374 --1275 --
NM_002166chr21484 ------
NM_002167chr1170 --1110 --
NM_002184chr5------128
NM_002196chr203966 307 104 --21038 398 --
NM_002196chr203966 307 104 --21038 398 --
NM_002202chr51686 ------
NM_002205chr124631 406 385 308 1813 1267 --
NM_002214chr7125583 5282 5059 4957 4949 4898 4890 4616 4159 2300 2044 1057 44696 3900 1497 1392 21280 1242 1544
NM_002221chr162958 2660 2312 2288 411 340 1169 --1565
NM_002226chr141158 --1643 --
NM_002230chr173742 399 58 ------
NM_002232chr11988 31366 354 266 ----
NM_002235chr1241552 1496 1481 427 1507 1160 11125
NM_002241chr182189 2129 2051 1912 1140 955 775 659 --1513 --
NM_002249chr13506 470 188 ------
NM_002252chr21459 169 ----
NM_002254chr251736 1701 746 397 268 2600 548 21723 567 1558
NM_002264chr3104443 3585 3375 3320 1739 1575 1322 627 170 90 23200 1207 ----
NM_002265chr1741210 421 47 25 11160 ----
NM_002267chr1351993 831 813 749 436 ----1237
NM_002268chr341430 1266 739 644 ------
NM_002270chr575359 4630 4503 1907 1266 1158 68 --15459 --
NM_002271chr1321811 439 ----12407
NM_002285chr254077 3815 3506 1217 933 1409 12836 12799
NM_002290chr64979 395 382 177 11178 ----
NM_002310chr555567 2471 2132 2032 489 1119 ----
NM_002334chr1151958 1748 1602 1508 527 1235 11392 1535
NM_002336chr1264381 1539 1497 1196 755 523 24131 1038 ----
NM_002349chr251616 1255 1136 596 329 --1634 --
NM_002350chr851180 1026 875 489 209 1887 ----
NM_002351chrX1599 --1552 --
NM_002356chr62860 356 ------
NM_002359chr1784326 4154 3839 3754 3381 3276 535 139 --13801 --
NM_002374chr233474 3172 2262 1113 22809 2791 --
NM_002376chr141195 1433 ----
NM_002381chr22905 397 --1812 --
NM_002384chr182912 841 --1392 --
NM_002387chr5113929 3409 3162 1473 1225 917 696 687 529 407 266 --11774 13497
NM_002395chr63584 477 47 ------
NM_002397chr541786 1645 1412 255 ------
NM_002399chr1521181 1055 ------
NM_002402chr711183 ----11170
NM_002408chr142569 217 ------
NM_002430chr2252097 920 886 696 346 32025 1719 200 --22165 72
NM_002442chr1241742 1395 487 32 182 ----
NM_002451chr9103722 3485 3364 2833 2762 2756 2727 798 582 317 13092 13766 1186
NM_002467chr8----198 191
NM_002481chr1127510 7092 7081 5680 5290 2724 2299 1792 1716 1443 1184 602 47741 5495 5059 766 22157 302 26022 2888
NM_002482chr11754 188 ----
NM_002486chr922151 1903 ----1324
NM_002487chr151538 ------
NM_002489chr72436 135 1344 ----
NM_002495chr5191 ------
NM_002505chr621094 546 1438 1350 --
NM_002508chr14336 138 123 62 --21602 383 --
NM_002515chr1411318 --11602 11487
NM_002519chr1131351 313 236 31549 1404 122 ----
NM_002522chr1793811 3424 3409 3037 1320 831 508 438 139 21188 412 12506 1477
NM_002524chr13993 908 162 11109 ----
NM_002527chr12--1117 ----
NM_002541chr711025 ------
NM_002545chr11105141 5001 1966 1337 1275 994 919 900 731 396 34234 1746 370 11076 13629
NM_002547chrX43362 3273 348 75 1502 ----
NM_002568chr8--1139 ----
NM_002577chr351125 857 721 256 108 13476 22604 2566 --
NM_002578chrX2384 131 ------
NM_002581chr994884 4703 4676 4125 1492 1270 714 424 259 ----23654 1379
NM_002583chr12----2528 417 --
NM_002592chr201208 ------
NM_002594chr2032180 932 172 ------
NM_002595chr1241676 1556 98 36 ------
NM_002600chr141620 1499 672 395 1356 1468 --
NM_002605chr1531047 409 150 ------
NM_002610chr242601 1227 249 162 1873 11260 --
NM_002613chr1685246 5207 4821 4507 3871 3431 1152 125 11146 ----
NM_002618chr2--1461 --1451
NM_002623chr201263 ------
NM_002628chr3----1332 --
NM_002641chrX3793 189 67 --11826 --
NM_002648chr621328 884 ------
NM_002652chr7188 ------
NM_002655chr854486 3652 3317 1729 1567 13278 23601 977 --
NM_002656chr641039 990 421 172 ------
NM_002664chr251600 1220 1071 621 518 ----1244
NM_002667chr61936 31189 894 221 ----
NM_002698chr1982358 2258 2202 1113 1062 841 690 66 2707 628 1159 22758 922
NM_002706chr2147 ------
NM_002709chr221276 876 13622 12268 --
NM_002710chr12152 ------
NM_002715chr54811 337 159 47 1848 ----
NM_002716chr1173130 3040 3013 2725 1167 126 94 11011 ----
NM_002718chr382172 2090 2009 1657 646 624 388 199 1676 ----
NM_002719chr1431835 815 428 ----1491
NM_002726chr61345 141 ----
NM_002730chr1931331 1263 970 --1457 --
NM_002731chr153032 2844 2423 1267 704 1832 11153 12566
NM_002736chr732175 1608 880 11566 ----
NM_002737chr17156627 6619 6459 6084 5713 5568 5372 5320 4364 4346 2626 1926 1898 1792 801 46317 4908 1269 631 44796 4758 4742 1043 --
NM_002740chr342684 2344 435 355 ----12162
NM_002742chr14----1714 --
NM_002748chr151311 ------
NM_002755chr152881 858 ------
NM_002760chrY75212 5146 3942 2101 1949 1183 63 11432 21579 107 15742
NM_002765chrX51269 1250 1244 479 313 ------
NM_002776chr1931336 305 129 2807 368 2600 276 --
NM_002790chr1123 ------
NM_002803chr7--148 ----
NM_002815chr172191 55 ------
NM_002816chr171274 ------
NM_002819chr19--11006 141 --
NM_002821chr61837 --1305 --
NM_002822chr122662 507 11203 ----
NM_002823chr23466 430 216 ------
NM_002829chr941176 821 141 67 1866 ----
NM_002830chr2--1132 ----
NM_002833chr1551423 1321 309 148 34 11465 1106 --
NM_002834chr1253323 1050 912 876 453 13593 --1474
NM_002835chr7--1199 ----
NM_002838chr1132 1473 1236 --
NM_002839chr942293 736 196 99 11121 ----
NM_002841chr3136 ------
NM_002843chr1132986 1311 1069 1585 ----
NM_002844chr631268 1063 999 11313 ----
NM_002849chr123981 869 256 --131 --
NM_002858chr11291 ------
NM_002868chr1251947 1815 1668 405 56 --1757 --
NM_002869chr1161606 1430 1423 440 368 93 31747 1731 323 123 --
NM_002874chr942281 1655 1543 587 --12052 --
NM_002886chr395151 4607 4378 1644 1212 1090 1081 672 334 ------
NM_002890chr52910 227 --2238 177 1878
NM_002902chr153643 461 449 1480 ----
NM_002906chr1121852 395 --1803 --
NM_002911chr1931613 1120 388 ------
NM_002941chr331247 1064 1018 ----1414
NM_002942chr321185 468 ------
NM_002955chr651625 1583 763 326 185 11565 11777 1661
NM_002956chr1241314 1237 1008 286 11119 11016 --
NM_002957chr993035 2550 1501 1233 1053 812 223 127 72 21285 541 ----
NM_002959chr154029 3777 3475 487 239 1945 --175
NM_002968chr163199 160 50 --1831 --
NM_002970chrX--1263 256 26 --
NM_002973chr121508 ------
NM_002977chr242444 1196 1177 31 --12729 12694
NM_002998chr821793 542 1737 ----
NM_003010chr172914 811 21557 220 11957 --
NM_003011chr911621 11553 126 --
NM_003012chr852894 1278 736 374 32 22842 931 ----
NM_003017chr631371 1168 292 ------
NM_003022chrX31058 376 329 ------
NM_003027chr151104 ------
NM_003028chr952891 2665 2622 1252 958 --22529 1466 --
NM_003030chr351946 1576 585 95 47 ------
NM_003031chr16180 141 ----
NM_003036chr121137 362 --1989 --
NM_003042chr351378 832 735 94 43 ------
NM_003043chr323930 1207 14043 1869 13019
NM_003051chr151933 1658 1492 1384 322 11785 ----
NM_003068chr831043 960 271 ------
NM_003070chr91673 ------
NM_003071chr331947 1358 396 1183 ----
NM_003074chr352278 307 246 77 22 31976 626 504 ----
NM_003081chr2031070 916 411 ------
NM_003095chr122322 67 ------
NM_003106chr321060 832 ------
NM_003108chr2127335 6200 6153 6069 4952 2867 2688 2205 2028 885 833 607 31252 936 893 ----
NM_003110chr171986 ------
NM_003113chr23610 546 202 186 ----
NM_003114chr81168 --1880 --
NM_003128chr242344 1056 1042 466 11927 ----
NM_003137chr632269 1483 531 21983 711 1257 --
NM_003144chr632199 586 38 ------
NM_003149chr331239 1223 1154 11272 1466 --
NM_003150chr1752393 1846 461 155 129 1902 1914 --
NM_003153chr1211159 ------
NM_003155chr852458 2297 2035 1826 1035 --21942 256 126
NM_003161chr1743315 2304 1078 502 --1625 1257
NM_003162chr2--11077 ----
NM_003174chr101198 125 1661 --
NM_003178chr342046 1770 553 444 12202 ----
NM_003181chr62557 128 ----2268 120
NM_003188chr61776 168 --1244
NM_003189chr142399 2201 2188 542 11178 23034 2437 22163 1096
NM_003199chr1875289 4954 4948 828 340 302 214 12258 11610 --
NM_003216chr2272664 918 584 354 292 247 46 12759 --12543
NM_003217chr1242036 652 524 245 1490 11624 2483 310
NM_003220chr621551 625 11217 2224 198 --
NM_003221chr674090 3929 3597 3343 2799 1057 826 23721 854 ----
NM_003234chr332142 703 173 1622 --22087 395
NM_003236chr253275 3049 2232 645 135 ------
NM_003242chr362111 1977 1825 1658 943 755 --11668 --
NM_003243chr131034 987 84 ------
NM_003253chr214545 489 412 158 ------
NM_003257chr1521419 1092 21405 287 ----
NM_003268chr13174 134 22 ------
NM_003269chr61987 3934 71 50 ----
NM_003270chrX2925 740 ------
NM_003286chr2031182 399 189 171 ----
NM_003292chr141870 1697 767 722 1870 ----
NM_003298chr395915 5257 4757 4708 4498 4434 4293 2439 235 11477 22396 1894 --
NM_003305chr41124 ------
NM_003317chr141113 ----1251
NM_003319chr24976 345 153 117 ------
NM_003326chr142470 2309 1012 95 --1658 12130
NM_003336chrX11158 1949 ----
NM_003337chr531587 587 581 1420 ----
NM_003338chr1031916 1637 160 --11479 --
NM_003339chr531531 1186 23 --1641 --
NM_003341chr32527 196 ------
NM_003342chr1762283 2078 921 811 235 191 21202 26 22533 2110 --
NM_003344chr761738 1707 1557 1118 274 185 ------
NM_003348chr1231500 1144 641 --11515 --
NM_003349chr2051581 1306 1191 473 250 21520 103 ----
NM_003350chr8--1339 139 --
NM_003360chr41231 ------
NM_003370chr191735 1633 ----
NM_003373chr1041543 1477 733 34 11431 ----
NM_003376chr641701 1570 695 23 --11409 --
NM_003376chr641701 1570 695 23 --11409 --
NM_003380chr101290 ------
NM_003381chr61685 1600 2571 37 1118
NM_003385chr25929 921 876 848 225 ------
NM_003387chr2102645 2341 1982 1808 1141 939 816 616 485 225 ------
NM_003392chr353560 3184 3165 988 509 --21737 1642 --
NM_003403chr142279 217 ------
NM_003404chr201740 ----1127
NM_003405chr221571 ------
NM_003406chr821647 679 ------
NM_003410chrX72754 2645 2413 2404 2153 833 794 1680 ----
NM_003411chrY11613 --11710 11227
NM_003412chr352744 1052 1010 980 618 12067 1174 --
NM_003417chr19189340 9176 8950 8919 8879 8585 7963 7308 6619 6151 3344 3181 2192 1904 1614 472 329 138 28049 7897 48192 8154 7785 7746 11111
NM_003418chr3------1564
NM_003430chr1921274 647 --1248 --
NM_003439chr763537 3333 3161 2494 2329 1067 ----193
NM_003442chr111333 ------
NM_003445chr193784 324 229 --1524 1771
NM_003452chr91649 ------
NM_003453chr13--1668 ----
NM_003457chr17251 41 1560 ----
NM_003458chr364063 874 607 476 116 60 --32868 2600 1618 --
NM_003462chr161786 1573 1394 1221 278 130 21693 1524 ----
NM_003463chr673254 2782 948 894 737 638 183 22797 2253 32802 991 160 --
NM_003468chr273660 3631 3025 2894 1738 1106 641 23231 3210 22723 1351 --
NM_003470chr1641397 1292 483 57 --11628 --
NM_003471chr342391 1856 777 701 --2934 112 --
NM_003477chr114730 638 250 82 ------
NM_003478chr11102829 2781 2526 2416 1300 1233 932 622 257 119 22971 1026 12445 --
NM_003482chr121388 12288 147 1996
NM_003483chr122301 272 22398 171 32922 1859 1023 1842
NM_003487chr17----1196 --
NM_003489chr2152948 2838 1027 634 379 ------
NM_003506chr811296 ------
NM_003507chr251941 1659 1628 1343 502 11488 11811 11271
NM_003559chr17123966 3960 3649 3499 2898 2867 2827 1272 1004 404 298 142 23427 942 1595 12572
NM_003563chr1721044 87 11253 ----
NM_003566chr122894 666 22765 2579 ----
NM_003568chr11316 ------
NM_003574chr1845284 1569 1307 988 ----15188
NM_003581chr21972 1694 ----
NM_003583chr1243669 1049 951 27 1717 --11177
NM_003586chr161189 1426 155 --
NM_003590chr263912 3602 3513 3015 1020 594 ----12549
NM_003591chr101379 ------
NM_003597chr252069 1524 578 439 43 --1321 --
NM_003603chr432162 1623 1509 --2580 348 --
NM_003607chr193845 3698 3430 1659 1271 585 470 177 22 34008 2684 1249 23999 3456 --
NM_003615chr363922 3444 2671 701 621 300 1331 ----
NM_003617chr164720 4638 4481 4076 3971 633 --14450 14600
NM_003618chr2196 1256 ----
NM_003620chr1731075 704 410 ------
NM_003628chr2140 ----1542
NM_003629chr153496 2886 942 563 341 --13181 --
NM_003631chr102409 311 1867 1136 --
NM_003633chr552278 2143 957 534 431 --11699 --
NM_003644chr17106141 5988 5957 5243 4651 4448 4145 1761 1594 154 1835 12310 --
NM_003645chr15172 ------
NM_003651chr121447 ----192
NM_003657chr201944 1346 ----
NM_003659chr241095 796 364 193 1957 ----
NM_003663chr343163 2929 2381 931 11154 ----
NM_003671chr943324 3054 2425 644 ------
NM_003672chr111417 --184 --
NM_003680chr11498 ------
NM_003685chr193764 376 267 1741 ----
NM_003690chr22185 107 ------
NM_003713chr141511 1379 1252 1159 ----172
NM_003714chr532600 1202 712 1954 1408 --
NM_003718chr72357 167 --1544 --
NM_003721chr191137 ------
NM_003722chr352707 2282 2039 1838 598 --12715 --
NM_003725chr121290 ------
NM_003743chr23779 251 93 21916 881 --12200
NM_003758chr154633 602 579 359 --166 --
NM_003758chr154633 602 579 359 --166 --
NM_003759chr493720 3228 3216 1383 850 760 564 558 145 --11040 --
NM_003760chr11719 2197 190 ----
NM_003762chr131171 225 100 --11223 --
NM_003774chr1283288 2960 2927 2619 2230 2161 1290 878 168 11054 --
NM_003783chr131135 845 200 ------
NM_003787chr1841261 1104 217 183 ------
NM_003790chr1----1219 --
NM_003800chr661944 956 549 356 237 155 ----11786
NM_003816chr811174 11346 11558 --
NM_003822chr163200 3143 2871 2693 814 595 --22995 2550 --
NM_003829chr94444 408 244 174 1996 ----
NM_003831chr181691 11400 ----
NM_003861chr1432541 2103 1789 12241 ----
NM_003872chr242874 2424 474 98 1727 21222 1100 --
NM_003873chr1052117 1751 1713 1661 622 1539 11624 --
NM_003884chr321478 145 ------
NM_003888chr1541737 1364 631 31 ------
NM_003895chr2141892 1404 805 331 31808 677 314 1736 --
NM_003896chr24804 634 310 59 1395 ----
NM_003901chr1062691 2676 465 293 78 37 32739 718 141 41868 747 602 564 --
NM_003902chr12720 52 ------
NM_003913chr674210 3810 2939 2923 2720 1049 791 --11367 --
NM_003916chrX11517 ------
NM_003924chr431462 424 228 ------
NM_003929chr161765 1598 1346 1159 704 559 --11145 --
NM_003930chr741938 957 792 89 11013 --11594
NM_003932chr2231879 585 44 ------
NM_003934chr921305 87 ------
NM_003941chr732006 1755 1709 1308 ----
NM_003954chr1761439 1361 1215 1161 360 42 21292 1031 11297 --
NM_003966chr5147214 6670 5861 5568 5193 5146 4778 3116 2843 2258 1568 1447 974 494 17506 ----
NM_003968chr31146 --1275 --
NM_003971chr17--1212 ----
NM_003983chr16124421 3686 3606 3559 3432 3222 1645 1344 1093 1034 951 913 33929 1127 714 11231 1185
NM_004006chrX1927 12583 ----
NM_004007chrX1927 12583 ----
NM_004009chrX1927 12583 ----
NM_004010chrX1927 12583 ----
NM_004011chrX1927 12583 ----
NM_004012chrX1927 12583 ----
NM_004013chrX1927 12583 ----
NM_004014chrX1927 12583 ----
NM_004015chrX1927 12583 ----
NM_004016chrX1841 12497 ----
NM_004017chrX1927 12583 ----
NM_004018chrX1841 12497 ----
NM_004020chrX1927 12583 ----
NM_004021chrX1841 12497 ----
NM_004022chrX1841 12497 ----
NM_004023chrX1841 12497 ----
NM_004024chr121542 320 --21143 257 --
NM_004028chr1822889 1232 1595 11069 23377 3302
NM_004034chr101251 --1444 --
NM_004060chr5128 1101 152 --
NM_004061chr5181 ------
NM_004064chr1211334 1884 ----
NM_004086chr141577 1268 ----
NM_004087chr3--11922 21590 473 --
NM_004090chr1782901 2801 2669 2437 1215 838 487 362 1403 ----
NM_004094chr1442603 2034 692 367 195 ----
NM_004096chr1032013 1425 362 11633 ----
NM_004100chr631047 741 706 22156 1947 ----
NM_004109chr1132383 763 377 4788 557 300 242 31702 1567 1529 --
NM_004112chr1751516 1283 691 549 61 21569 1385 --11444
NM_004115chr131136 ------
NM_004124chr1463101 2460 2292 2263 484 40 13402 --1938
NM_004133chr832535 1772 504 1396 ----
NM_004134chr51582 185 ----
NM_004136chr154821 812 706 329 1450 ----
NM_004156chr81398 ------
NM_004161chr22214 43 1191 ----
NM_004170chr961571 1488 1208 426 156 124 --11835 --
NM_004171chr11149614 7769 6353 6013 3544 3464 2917 2891 2512 2488 1821 1561 1258 461 88760 6597 6294 6131 3677 2794 2171 1670 38591 6032 2059 22587 1301
NM_004172chr531884 424 364 ------
NM_004187chrX41279 1238 956 227 2495 182 11064 --
NM_004203chr162133 31 ------
NM_004225chr821103 219 1227 --11338
NM_004229chrX41681 1474 603 65 ------
NM_004236chr152386 193 ------
NM_004241chr10151 ------
NM_004242chr6149 ------
NM_004272chr51290 ------
NM_004273chr1044940 3986 3642 384 11588 34861 3178 233 14430
NM_004274chr1443091 2525 2486 440 22752 1988 12757 --
NM_004277chr641726 1621 1511 431 ----11209
NM_004279chr731470 927 654 --1678 --
NM_004293chr953014 2883 2367 1264 793 --12434 --
NM_004296chr1483674 3158 2992 2882 2708 1446 1360 1217 ----23527 598
NM_004319chr182916 2753 1256 1027 869 680 160 107 12128 12832 --
NM_004327chr22102454 2410 2334 2226 1962 1844 977 906 81 47 --22063 735 --
NM_004329chr103451 181 146 21213 1200 ----
NM_004330chr152921 100 ------
NM_004331chr841797 1041 610 100 1186 ----
NM_004337chr871847 1690 1605 698 475 328 220 2130 114 ----
NM_004338chr18146762 5944 5803 5559 5453 5440 4302 2305 2114 1808 1232 1220 749 191 --16484 --
NM_004350chr182516 2372 2233 1786 1037 983 419 148 2403 300 2275 48 --
NM_004352chr162163 105 --1426 --
NM_004362chr41171 ------
NM_004369chr23523 459 59 ------
NM_004370chr651955 1504 800 517 357 31896 285 109 --11649
NM_004380chr1652332 2237 2197 2045 1993 ----12403
NM_004384chr541719 874 379 191 1911 ----
NM_004386chr1942325 1826 835 749 --21458 616 --
NM_004392chr1342689 2000 260 103 --12666 --
NM_004393chr342233 959 889 655 12032 --12295
NM_004397chr1111624 13446 1397 --
NM_004415chr61590 ------
NM_004417chr5--1117 ----
NM_004423chr392697 2476 2054 1949 1787 1050 550 457 194 22709 1864 22345 870 1987
NM_004426chr1261282 301 260 112 61 26 11783 ----
NM_004430chr822765 973 --1162 --
NM_004432chr942088 740 631 179 ------
NM_004433chr151609 1314 685 653 56 ------
NM_004437chr183281 2962 2860 552 306 300 231 77 2821 472 21418 1380 --
NM_004438chr262836 2823 2730 2206 2135 763 12878 --12575
NM_004440chr61277 1534 ----
NM_004441chr311288 --1162 --
NM_004443chr31186 ----1287
NM_004454chr341840 906 861 350 ------
NM_004456chr72238 56 ------
NM_004457chr251700 1589 1243 1091 211 21736 291 ----
NM_004458chrX21888 1695 --156 --
NM_004459chr1721542 118 11554 21473 535 --
NM_004460chr2--143 ----
NM_004464chr4103972 3820 3643 3530 3301 2730 1289 1203 736 329 11483 ----
NM_004469chrX----1136 --
NM_004474chr12954 155 11068 144 --
NM_004490chr2--1211 ----
NM_004491chr1944198 1719 1343 651 33270 757 134 1308 --
NM_004492chr151238 ------
NM_004496chr14----1148 --
NM_004500chr1472015 1964 1470 1297 751 607 309 ----1387
NM_004501chr143515 2673 1273 43 1207 ----
NM_004504chr232413 1893 189 13011 ----
NM_004505chr1711716 ------
NM_004506chr6--1487 ----
NM_004514chr1743001 2986 735 570 --12671 --
NM_004516chr192418 33 ------
NM_004521chr10186 1377 ----
NM_004529chr91559 --1149 1218
NM_004530chr1641193 879 488 407 1955 1339 --
NM_004537chr1241544 1085 585 31 21305 567 ----
NM_004540chr212695 102 ------
NM_004571chr2173367 3328 2732 2643 2552 2161 2149 11061 ----
NM_004586chrX104613 4322 4162 3876 3549 1843 1735 1568 1155 738 24603 1358 --14356
NM_004587chr203463 80 36 --1106 --
NM_004588chr1163809 3638 3213 2943 2933 1373 --23193 23 --
NM_004598chr582797 2187 916 898 569 400 260 124 12081 ----
NM_004602chr2021413 499 ------
NM_004612chr974430 4095 3691 3677 3649 3629 147 23704 535 ----
NM_004619chr152113 2040 1755 1746 145 ------
NM_004621chr1111252 11207 ----
NM_004631chr111021 ------
NM_004637chr311200 ------
NM_004645chr173742 553 142 ------
NM_004654chrY21344 394 --1403 --
NM_004660chrY82250 1982 1579 1571 781 444 421 329 ----1593
NM_004673chr151389 1265 1127 449 207 11424 ----
NM_004677chrY1531 ------
NM_004684chr42150 25 ------
NM_004685chr1362977 2696 2269 568 528 314 1337 ----
NM_004686chr82661 339 --11714 --
NM_004703chr1752334 2192 2169 1757 870 ----12415
NM_004719chr1262572 1042 1022 856 703 334 --1176 --
NM_004723chr15900 853 763 246 59 2951 917 ----
NM_004725chr102581 121 ------
NM_004726chrX75730 5432 5091 4849 1442 1006 371 45669 5266 2059 357 41947 1909 1893 976 --
NM_004730chr552129 1654 371 330 209 1774 --1584
NM_004733chr32233 151 ------
NM_004734chr1342581 2210 1085 631 ------
NM_004736chr141948 825 762 507 --171 --
NM_004739chr112610 64 ------
NM_004742chr371816 1686 1482 1308 1194 428 110 --169 --
NM_004745chr866252 4809 4791 2443 1840 458 46868 4311 2806 1811 1606 --
NM_004748chr1564106 3454 3174 3096 1322 1081 ----21294 1255
NM_004760chr742476 958 357 65 22499 24 ----
NM_004766chr32263 97 ------
NM_004774chr1753175 3150 2530 981 458 1889 22433 1926 12834
NM_004775chr1811973 1578 --1694
NM_004781chr151644 626 380 358 39 ------
NM_004781chr151644 626 380 358 39 ------
NM_004788chr1141874 1705 1053 330 1516 21094 616 --
NM_004792chr22172 68 ------
NM_004796chr1442119 2105 1963 327 21569 1495 ----
NM_004798chr2042288 623 436 144 1725 ----
NM_004801chr241441 1071 480 471 11409 ----
NM_004804chr272666 2434 2286 2119 1704 1116 938 12741 12774 --
NM_004815chr174902 4556 4374 3339 1839 1632 1262 21745 1026 24670 4444 --
NM_004827chr42691 215 ------
NM_004831chr1921041 749 1804 ----
NM_004834chr243041 2889 2127 1322 22746 125 ----
NM_004836chr22722 163 ------
NM_004841chr121017 145 ------
NM_004842chr641610 1581 112 39 --1567 --
NM_004845chrX104045 3604 2713 1583 1539 1518 768 373 253 219 43193 910 625 231 64100 3907 3081 3043 3027 503 --
NM_004849chr651122 600 555 283 95 1216 --11480
NM_004857chr1484399 4020 3740 2989 1913 1258 720 340 43905 3885 3865 1710 21597 1222 --
NM_004859chr1773035 743 596 558 355 288 105 22258 170 ----
NM_004863chr14115195 4910 4630 4286 4212 3962 3591 1601 598 395 49 24764 202 1481 --
NM_004865chr62165 26 ------
NM_004866chr554763 4352 3944 1734 150 11239 21267 584 --
NM_004871chr1784076 3613 3531 3515 2686 1547 1033 559 23054 1677 3761 710 533 --
NM_004896chr1021341 252 21251 1018 --11549
NM_004897chr10--1284 ----
NM_004902chr201832 ------
NM_004904chr7145984 5644 5594 4891 4727 4641 2092 1843 1800 1661 1619 741 486 274 15775 ----
NM_004912chr741402 1253 1098 174 41693 1632 1613 656 11618 --
NM_004922chr102994 729 1102 1416 --
NM_004926chr1451565 672 449 367 21 ------
NM_004934chr5----121 160
NM_004947chr362373 2337 1824 1648 592 422 --11849 --
NM_004956chr773905 3804 1671 1594 1328 1052 486 --23210 3101 12920
NM_004960chr16173 ------
NM_004966chr101866 ------
NM_004973chr611620 ------
NM_004985chr1273862 3370 3056 1707 1692 1018 901 --11320 11145
NM_004990chr12----165 --
NM_004992chrX128521 8169 7158 6683 6545 5860 5164 3137 1993 1686 1446 338 36671 3285 1694 36468 5963 2999 --
NM_004992chrX128521 8169 7158 6683 6545 5860 5164 3137 1993 1686 1446 338 36671 3285 1694 36468 5963 2999 --
NM_004993chr142564 435 --11434 --
NM_004999chr644252 3914 3707 1266 13593 14263 23151 842
NM_005006chr23885 245 166 ------
NM_005010chr721809 1430 1456 ----
NM_005011chr741768 1433 1425 118 --21548 1281 --
NM_005028chr1052047 1441 705 634 113 ------
NM_005044chrX73731 3665 1491 1249 1045 760 512 24024 899 --14298
NM_005056chr1254661 3467 1625 860 620 34414 1139 810 ----
NM_005065chr14114880 4852 4804 4771 4299 4274 1963 1435 1359 718 232 13376 14868 --
NM_005066chr1158 1797 ----
NM_005067chr32673 172 ------
NM_005076chr1104236 4028 3958 3582 3529 3198 955 770 712 228 11558 22584 1254 13007
NM_005077chr91120 ------
NM_005079chr862842 2495 727 652 628 391 22330 2312 12668 --
NM_005087chr31699 ------
NM_005095chr151695 1425 1370 842 499 21600 339 ----
NM_005103chr113332 118 85 --122 --
NM_005105chr141778 741 103 55 11408 ----
NM_005109chr342520 2207 547 106 2693 658 1510 1533
NM_005110chr51298 1618 2676 623 --
NM_005116chr2074252 3855 3563 3456 3312 1656 441 13655 --14080
NM_005121chr1741518 1335 490 252 13834 ----
NM_005134chr181394 --1759 --
NM_005135chr1543726 2852 2569 1226 31353 374 145 42624 2586 2345 574 12745
NM_005144chr81904 --21137 472 169
NM_005153chr161184 ------
NM_005154chr152510 224 1527 ----
NM_005156chr985347 4912 4334 1727 1004 338 228 52 31956 978 447 11961 11364
NM_005163chr144957 921 795 743 ------
NM_005168chr22630 399 11196 ----
NM_005174chr101130 ------
NM_005180chr101594 2582 339 ----
NM_005188chr1167646 5557 5510 681 419 271 27114 2571 22031 1271 36530 5569 537
NM_005190chr631158 404 188 ------
NM_005197chr1464710 3955 3792 2218 2076 1580 ------
NM_005201chr331127 798 272 11107 --11089
NM_005202chr152261 1966 440 76 56 --41795 1613 809 620 --
NM_005206chr1751436 1386 1269 1113 169 ------
NM_005207chr2243323 1350 1271 1161 23648 444 52649 1369 826 691 637 --
NM_005215chr182756 474 ------
NM_005216chr12510 109 1607 ----
NM_005224chr19--1652 ----
NM_005227chr11529 ------
NM_005233chr342193 1992 914 851 ------
NM_005235chr2105843 4833 4747 2597 2508 1954 1245 806 599 581 24953 2307 27598 7431 12033
NM_005238chr1153296 3011 3002 2822 1289 12756 ----
NM_005241chr321014 911 11281 --11189
NM_005249chr142769 754 ------
NM_005250chr1681933 1804 1788 1467 1193 268 44 37 21779 1290 21904 1410 --
NM_005254chr1531075 431 53 1321 ----
NM_005259chr2126 11271 ----
NM_005260chr5122 1313 ----
NM_005261chr81847 ------
NM_005271chr1041225 280 259 46 ------
NM_005274chr11126 ------
NM_005277chr451767 1463 560 430 223 --173 --
NM_005311chr782742 2552 2530 2002 944 937 921 433 --1850 --
NM_005316chr1121095 1063 195 ----
NM_005324chr1721953 1895 21437 164 ----
NM_005328chr82530 199 ------
NM_005329chr1682117 2063 1782 1643 864 367 339 272 ------
NM_005338chr783925 3695 3404 2881 1387 1308 1288 915 32980 2624 1340 ----
NM_005339chr454140 4090 4052 3490 874 11507 ----
NM_005342chrX52630 2250 1979 1102 755 --12225 --
NM_005359chr1856520 5135 5034 4775 3973 54506 2308 2054 1305 30 22197 2159 21377 611
NM_005374chr1741842 1493 809 534 22301 1678 12119 --
NM_005376chr13872 730 306 --2804 87 --
NM_005385chr352459 2137 642 543 48 12410 ----
NM_005392chr961864 1707 1338 1261 597 283 --1416 --
NM_005399chr184266 2921 1628 753 589 513 239 126 23310 2983 ----
NM_005400chr222992 1171 ----1319
NM_005402chr721864 206 --11668 --
NM_005406chr1811092 1529 ----
NM_005409chr43777 365 134 --11096 --
NM_005417chr2021715 1249 12036 --1340
NM_005433chr1852566 2470 2206 2130 512 ------
NM_005435chr73461 443 223 1372 ----
NM_005436chr1064023 3989 3683 1505 734 256 13745 13326 --
NM_005439chr123536 193 154 --121 --
NM_005440chr1783321 2415 1266 599 591 504 430 82 22621 628 22943 2568 --
NM_005461chr2031436 283 105 1582 ----
NM_005465chr141910 1700 812 265 11625 1287 --
NM_005466chr143515 490 95 ------
NM_005475chr1232969 2821 1259 --32638 2271 1227 --
NM_005477chr1562471 2030 943 834 828 469 22258 455 ----
NM_005477chr1562471 2030 943 834 828 469 22258 455 ----
NM_005493chr63616 573 203 ------
NM_005494chr73525 229 145 ------
NM_005497chr17145984 5939 5868 5855 5554 5378 4991 4781 4774 4473 4308 1915 1291 925 31931 672 632 65661 4948 4813 1872 1729 1691 14760
NM_005502chr922360 2339 22683 1269 ----
NM_005504chr1286151 5547 4394 4263 1680 801 562 425 22260 2047 ----
NM_005506chr422535 966 1360 32229 2199 2058 --
NM_005509chr511587 11685 ----
NM_005512chr1142045 1519 1414 346 11582 11343 --
NM_005517chr121167 450 --11194 --
NM_005520chr51578 1191 1155 --
NM_005522chr711388 ------
NM_005542chr71663 --11210 --
NM_005544chr2--3269 110 43 --1281
NM_005562chr11360 --11215 --
NM_005565chr54587 461 404 65 ------
NM_005566chr111557 ------
NM_005568chr17150 ------
NM_005570chr1811091 1152 1239 --
NM_005573chr51537 ------
NM_005578chr384503 4330 3860 3175 1455 1270 407 118 34715 4251 3853 23651 3412 --
NM_005584chr13164 --1106 --
NM_005587chr1511014 ------
NM_005591chr1182725 2512 1916 1835 900 522 333 172 1824 ----
NM_005595chr13915 127 78 ----138
NM_005596chr9106363 6136 6074 5929 5760 2200 1781 673 618 86 12172 26121 1102 --
NM_005599chr121342 257 ------
NM_005603chr1831770 701 458 11416 ----
NM_005604chr6190 22218 927 ----
NM_005605chr82320 293 ----196
NM_005607chr81114 ------
NM_005611chr1641281 916 107 50 11208 ----
NM_005613chr131816 1479 723 21761 784 1810 --
NM_005627chr631004 961 131 ------
NM_005629chrX21067 158 ------
NM_005637chr1851988 1937 717 151 117 11848 21736 1698 11683
NM_005638chrX11416 1194 ----
NM_005639chr1221744 515 1652 11329 --
NM_005647chrX83154 2717 2616 2476 2385 1270 508 251 --1747 11154
NM_005657chr151155 ------
NM_005665chr174904 4120 3985 3610 1656 1434 792 23509 726 3749 613 575 --
NM_005667chr2----1359 --
NM_005668chr543381 993 887 542 --2879 775 --
NM_005677chr341358 579 229 214 11189 199 --
NM_005688chr321077 91 ------
NM_005708chr131137 1313 ----
NM_005715chr682866 2726 2720 2614 2216 2089 790 593 12375 --12210
NM_005717chr12296 255 11309 1828 --
NM_005718chr32329 294 --1649 --
NM_005722chr242200 1783 524 60 ------
NM_005725chr141935 748 300 28 ------
NM_005734chr111131 1520 ----
NM_005738chr721484 735 ------
NM_005739chr155667 646 600 341 24 ------
NM_005746chr731743 431 247 1597 ----
NM_005748chr1293445 3114 3043 2864 2749 2421 1209 546 433 12971 ----
NM_005759chr244492 4481 4234 4106 24334 416 13220 --
NM_005767chr132296 242 ------
NM_005779chr543291 2350 921 89 23251 838 ----
NM_005795chr262987 2462 2116 977 290 248 --1756 --
NM_005797chr1151802 1563 1249 1110 465 11411 --1198
NM_005801chr172692 316 2648 90 1610 --
NM_005802chr9--1720 ----
NM_005803chr63347 264 254 ----130
NM_005808chr363124 2689 1361 614 381 43 --11139 --
NM_005822chr672279 2219 2101 1991 1826 260 133 --1728 --
NM_005826chr11466 1529 ----
NM_005828chr1774918 4722 4634 3525 3207 1015 777 23952 899 15034 --
NM_005832chr3--2577 74 ----
NM_005833chr91163 ------
NM_005836chr8175 ------
NM_005840chrX157072 6020 5982 5456 4636 2763 2756 2610 2299 2028 1918 1905 1093 934 231 --25402 440 --
NM_005841chr451057 913 817 292 224 ------
NM_005842chr13----1578 --
NM_005843chr261732 1363 679 204 133 66 11700 ----
NM_005859chr521526 163 1549 ----
NM_005862chr3----1821 --
NM_005871chr1041108 407 303 232 ------
NM_005875chr31122 ------
NM_005885chr521683 242 21231 1134 ----
NM_005898chr1162579 2503 2142 2086 913 302 11282 ----
NM_005899chr1731287 627 394 1276 --2617 282
NM_005901chr18137080 6930 6858 6706 6365 5654 5416 2442 2112 1950 733 723 415 58187 6621 5811 5762 5290 12233 --
NM_005902chr1564451 3881 2878 1762 1438 969 43650 3413 788 442 ----
NM_005903chr5113873 3781 3459 1697 1547 1381 1060 1026 881 773 444 25246 4058 11167 --
NM_005906chr61573 --3668 448 319 --
NM_005907chr631173 312 240 1609 1501 --
NM_005909chr553760 3320 2943 2622 857 ------
NM_005910chr1773875 3742 3101 2847 819 749 138 23929 1396 21348 493 22686 1238
NM_005920chr152622 2561 2509 1298 693 23029 1559 128 152
NM_005922chr63403 371 100 ------
NM_005933chr1172994 2889 2848 2020 1903 1843 1169 22555 2409 ----
NM_005935chr435074 4506 507 24109 57 1648 --
NM_005937chr1784029 3937 3870 3661 3517 1189 934 897 33900 3704 2722 2620 611 --
NM_005941chr862976 1674 788 691 502 109 --13937 --
NM_005943chr631598 1355 644 1294 11240 --
NM_005955chr185369 5247 4890 4337 4287 3858 1909 344 23545 2214 21961 1926 11074
NM_005962chr1042330 633 494 192 1667 2757 65 --
NM_005962chr1042330 633 494 192 1667 2757 65 --
NM_005966chr231725 1629 205 --11982 --
NM_005977chr136974 950 794 701 317 237 ------
NM_005986chr1341869 1764 948 232 ------
NM_005997chr1126 ------
NM_006007chr944163 3488 663 310 53877 2934 2898 1500 446 13745 --
NM_006015chr141070 989 825 497 ------
NM_006016chr652286 2143 2052 1674 876 ------
NM_006024chr72620 196 ------
NM_006036chr251855 1816 880 576 203 1916 ----
NM_006037chr224616 3822 14555 --1208
NM_006038chr2061795 1777 788 383 248 45 ------
NM_006048chr12881 389 ------
NM_006055chr252758 2520 859 642 537 ------
NM_006062chr23946 374 86 1179 1898 --
NM_006064chrX3346 273 137 1403 ----
NM_006067chr161308 1843 ----
NM_006079chr6----142 --
NM_006080chr722375 854 124 ----
NM_006089chrX3355 339 154 11461 21337 416 --
NM_006090chr11683 ------
NM_006091chr1561826 1639 1186 163 115 62 21277 173 1157 --
NM_006094chr832311 681 571 ------
NM_006095chr484205 4027 3972 3956 3852 3583 3163 1623 11744 ----
NM_006099chr16821 340 321 261 186 23 ------
NM_006106chr1152810 2519 2393 902 188 ------
NM_006118chr11162 ------
NM_006135chr141090 1025 975 949 21126 132 ----
NM_006136chr71538 ------
NM_006141chr1652756 2703 2256 2151 932 21866 142 ----
NM_006143chr12191 ------
NM_006145chr1941170 743 373 150 ------
NM_006147chr12316 89 ------
NM_006152chr12156 ------
NM_006154chr1521900 159 --12681 --
NM_006158chr861483 1154 624 517 365 226 1341 ----
NM_006162chr1851693 1589 1122 151 23 ------
NM_006166chr1262629 2601 2284 2121 1603 480 12373 11040 --
NM_006167chr882354 2289 2059 1630 847 747 636 448 1135 ----
NM_006180chr92615 321 22082 1463 ----
NM_006186chr21193 ------
NM_006194chr141370 ----11147
NM_006195chr931053 401 114 1355 ----
NM_006196chr21120 ------
NM_006203chr5105576 4743 4608 4500 3810 2130 2118 1946 843 549 21310 651 13607 --
NM_006206chr472573 2468 2321 2249 2095 2082 1036 32066 518 343 1593 --
NM_006209chr81406 ------
NM_006224chr1752519 2021 732 670 125 --2404 315 --
NM_006237chr1312301 ----1540
NM_006241chr342232 851 806 479 ------
NM_006243chr12777 191 2398 82 1996 --
NM_006246chr1441028 370 90 30 ------
NM_006251chr51480 1434 32562 2130 573 --
NM_006252chr1117557 6873 6618 6322 5637 5535 5113 5055 4967 2974 735 46822 6581 5405 5353 11668 --
NM_006256chr142688 2393 877 44 12438 ----
NM_006257chr102721 86 1834 ----
NM_006265chr81464 ------
NM_006267chr21390 1284 ----
NM_006275chr2031951 916 98 42520 1807 1009 596 --11694
NM_006277chr22632 163 ------
NM_006281chr81290 ------
NM_006281chr81290 ------
NM_006282chr20104456 4428 4316 3839 3554 1526 1311 1073 1020 606 33338 3012 1866 33152 3114 542 13769
NM_006283chr8104368 3951 3565 3265 3170 3038 1613 1554 652 232 34647 4592 1357 14597 11525
NM_006293chr156968 953 768 644 405 197 1788 2883 863 --
NM_006298chr621010 103 22378 945 ----
NM_006301chr121664 ------
NM_006306chrX94877 4725 4385 3865 1401 1361 1272 1224 1087 35025 1307 488 35084 79 57 --
NM_006310chr172943 341 21147 1111 ----
NM_006313chr1211635 --1577 --
NM_006317chr51273 --144 --
NM_006320chr42839 460 1138 ----
NM_006325chr12--2773 184 ----
NM_006328chr111173 1615 ----
NM_006330chr8160 ------
NM_006334chr91248 1277 ----
NM_006352chr131435 404 252 1154 1543 --
NM_006366chr621154 369 --11077 --
NM_006367chr131065 996 883 ------
NM_006372chr61398 ------
NM_006373chr174988 889 467 171 --51338 531 512 421 88 --
NM_006378chr95990 969 941 458 318 ----21082 133
NM_006380chr17104297 4170 3641 3557 2957 2680 1630 730 386 235 13677 23520 1638 --
NM_006386chr2212190 12032 1294 --
NM_006393chr1052942 551 348 160 86 23796 699 13074 --
NM_006395chr31212 ------
NM_006403chr631792 1381 144 --11137 --
NM_006408chr721086 271 1954 ----
NM_006416chr61530 ----171
NM_006420chr2063288 2351 2326 1030 906 407 ------
NM_006421chr821188 345 ------
NM_006449chr242045 1951 1643 1572 32192 1854 347 ----
NM_006451chr51132 1675 ----
NM_006457chr463206 2853 1388 777 611 323 ------
NM_006459chr1041739 1268 720 475 --1543 --
NM_006466chr20186 2825 103 11049 --
NM_006482chr1243669 1049 951 27 1717 --11177
NM_006486chr223675 570 221 ------
NM_006489chr1411318 --11602 11487
NM_006496chr151580 1447 723 592 444 21350 305 ----
NM_006504chr1062974 2953 2935 2367 888 556 ----12263
NM_006517chrX42017 399 310 265 2906 838 32257 1461 133 1707
NM_006526chr2041706 744 683 257 ------
NM_006534chr2072639 2177 1189 939 897 446 342 13138 11214 --
NM_006538chr264175 4032 3588 2771 1543 633 --23491 3163 --
NM_006540chr831451 1156 257 11555 ----
NM_006544chr1455784 5493 4462 1404 1393 31772 1374 1196 11517 14618
NM_006546chr1766453 5535 5316 4488 415 373 ------
NM_006547chr72505 142 ------
NM_006549chr1292703 2382 2037 1910 1189 1018 778 553 111 1801 121 --
NM_006557chr93601 428 413 ------
NM_006560chr112535 496 1340 ----
NM_006561chr1085167 4998 4974 4441 2323 2016 1622 1407 2215 149 --11374
NM_006565chr162972 800 21074 137 ----
NM_006572chr17102803 2310 2270 1256 855 824 458 257 121 102 1270 ----
NM_006575chr141484 ------
NM_006591chr1151715 1617 1604 549 485 1682 ----
NM_006593chr25613 229 216 209 171 ------
NM_006595chr1141937 1601 484 274 11704 ----
NM_006599chr16117958 7892 7140 6923 6453 6308 6071 5926 5240 5133 1559 27695 7647 ----
NM_006601chr1241022 443 136 44 2812 219 ----
NM_006603chrX31805 386 315 ------
NM_006609chr25741 680 593 540 492 --1555 --
NM_006614chr353671 2915 2868 2727 2372 32856 2773 1472 142 --
NM_006618chr141621 610 563 105 172 ----
NM_006620chr641866 1820 220 49 44515 3816 1386 1038 ----
NM_006621chr151957 1749 1424 796 347 ------
NM_006624chr1041679 437 296 110 ------
NM_006625chr11198 ------
NM_006625chr11198 ------
NM_006625chr11198 ------
NM_006626chr931649 147 97 --12600 --
NM_006628chr1561833 1301 1020 913 369 254 33664 3244 36 54348 3552 3514 874 745 11385
NM_006629chr1862018 1913 688 583 497 329 22128 816 ----
NM_006636chr23873 381 235 1764 ----
NM_006654chr1274104 3828 3215 2951 1663 1542 356 --1764 14185
NM_006667chrX2364 160 ------
NM_006670chr61576 ----1569
NM_006699chr162138 953 946 161 145 96 ------
NM_006703chr61411 ------
NM_006709chr6------1211
NM_006713chr52246 185 ------
NM_006717chr942134 765 753 678 23234 2606 22965 119 --
NM_006718chr641039 990 421 172 ------
NM_006722chr352720 2689 2452 2364 2259 13064 ----
NM_006724chr63403 371 100 ------
NM_006729chrX125631 4654 4531 4370 4242 4062 3814 3737 3521 2144 1340 1162 24177 4026 ----
NM_006731chr995850 5552 5381 5343 5320 5263 5095 1621 742 44236 3927 3729 3572 ----
NM_006734chr621525 203 --11108 --
NM_006744chr10134 ------
NM_006745chr41835 1773 1133 --
NM_006746chrX21046 1020 --136 --
NM_006750chr16128096 6829 5987 5820 5186 4982 3172 2346 2280 1035 591 452 --12040 12177
NM_006751chr23991 264 218 ------
NM_006756chr81111 21487 1270 ----
NM_006763chr131478 743 73 ----11904
NM_006766chr862518 2116 889 839 210 52 1807 2947 459 --
NM_006772chr631668 1230 424 --11443 1387
NM_006775chr683117 3085 2719 2507 2065 810 571 471 11948 ----
NM_006777chrX52868 2825 2587 2434 1001 --2720 533 --
NM_006790chr51307 ------
NM_006805chr521604 419 ------
NM_006806chr21--154 ----
NM_006807chr171354 11331 1231 --
NM_006814chr2052089 1678 1074 979 139 --1292 --
NM_006815chr121113 ------
NM_006822chr172295 32 ------
NM_006823chr851071 1033 864 296 46 ------
NM_006826chr23446 390 41 1156 ----
NM_006827chr141802 22714 2186 42781 2737 2602 2564 --
NM_006828chr6--1112 1104 --
NM_006832chr143958 342 118 --1803 --
NM_006838chr1241390 750 538 394 1768 ----
NM_006851chr1241832 1807 931 233 11077 12394 138
NM_006852chr1742523 2464 1152 183 --11139 --
NM_006854chr741870 1711 1528 809 ------
NM_006868chr1842575 1144 945 283 --22261 430 --
NM_006873chr243366 2961 876 163 23301 2513 ----
NM_006875chrX2775 252 1635 1795 --
NM_006884chr351946 1576 585 95 47 ------
NM_006885chr1653947 3083 2833 1125 926 ------
NM_006888chr1463540 3027 2857 2190 1306 735 --11021 --
NM_006892chr2021281 226 11275 ----
NM_006892chr2021281 226 11275 ----
NM_006895chr2--12229 --11449
NM_006896chr72186 145 1451 ----
NM_006899chr201239 --123 --
NM_006908chr741362 1190 124 42 --1472 --
NM_006915chrX42341 840 330 45 11940 21963 1828 --
NM_006920chr251896 1387 490 121 45 1762 ----
NM_006922chr262246 1708 1676 343 154 43 --1980 --
NM_006924chr1761592 1346 1125 682 640 65 24129 3503 11728 --
NM_006927chr1672024 1868 1848 795 753 225 163 --1382 --
NM_006931chr122822 275 169 12049 22039 361
NM_006937chr172596 504 ------
NM_006939chr144925 831 793 421 ------
NM_006940chr1231631 634 297 1155 --1161
NM_006947chr411250 11611 ----
NM_006948chr2132190 1863 1826 ------
NM_006981chr952952 2666 2390 499 167 ----12178
NM_006982chr121283 ------
NM_006988chr211217 --1780 --
NM_007007chr1274380 3451 2974 1305 773 578 254 23414 3408 ----
NM_007008chr2187 ------
NM_007011chr1596654 5801 5633 5467 4391 2178 2107 1745 1309 1106 31871 1838 632 --
NM_007017chr52157 85 ------
NM_007023chr22795 46 ------
NM_007030chr594801 3609 3371 1625 987 935 876 648 358 11719 14754 --
NM_007038chr21125711 5473 5428 5303 5027 4997 4260 4226 4029 1923 1488 718 13999 35896 3812 502 11482
NM_007039chr1462221 1743 1593 528 436 192 ------
NM_007040chr193809 700 248 ------
NM_007043chr1241708 1526 1327 631 ------
NM_007050chr20117864 6195 2829 2729 1775 1574 991 742 624 579 225 25016 3070 27774 478 11817
NM_007052chrX2184 175 --1153 --
NM_007064chr31136 1333 ----
NM_007067chr1761285 1254 1236 552 385 149 ----11481
NM_007073chr664073 3809 2774 1623 1108 797 22689 460 31126 684 305 --
NM_007084chr1321452 1315 --1557 --
NM_007106chr1321805 492 22617 826 1256 --
NM_007107chr392366 2357 2305 2188 855 806 704 605 310 11657 1396 --
NM_007111chr131788 ------
NM_007114chr312928 12277 ----
NM_007124chr621879 427 ------
NM_007125chrY31250 948 404 1583 1115 --
NM_007146chr1752728 2652 1134 409 52 2772 621 ----
NM_007157chrX52177 742 681 475 203 1492 ----
NM_007159chr32673 639 11635 ----
NM_007170chr13586 219 74 --2671 131 --
NM_007172chr2223181 154 13277 ----
NM_007174chr1271765 1731 1692 1524 1470 812 768 --1569 --
NM_007175chr842652 2563 1313 256 22393 2248 ----
NM_007191chr12155 ------
NM_007195chr1843657 3338 2344 434 --31283 1245 398 --
NM_007203chr973635 3067 2557 880 652 403 259 --1335 --
NM_007207chr12858 267 ------
NM_007214chr641258 449 201 173 --11300 --
NM_007222chr841533 579 227 75 ------
NM_007231chrX4719 565 395 166 163 21737 1699 11848
NM_007236chr1541996 1956 815 502 31704 995 495 21592 1554 --
NM_007242chr16----1205 --
NM_007249chr13189461 9328 9286 8720 8527 7568 7494 7389 6484 3178 2914 2885 2759 1536 598 470 443 393 46315 2745 1800 1041 ----
NM_007271chr641871 1569 1197 573 ----1553
NM_007275chr33794 435 131 ------
NM_007276chr731051 1007 949 --1940 --
NM_007282chr3--1734 ----
NM_007325chrX31805 1728 725 22144 1987 ----
NM_007331chr422138 1070 12495 ----
NM_007347chr1531051 574 180 22120 408 52481 2344 2306 2290 2187 12458
NM_007350chr1294456 4030 3803 3188 1335 1037 789 724 233 13129 ----
NM_007358chr1--11551 ----
NM_007361chr141175 --1262 --
NM_007363chrX21066 901 --1425 --
NM_007365chr141640 1529 624 198 --21457 533 --
NM_007371chr92707 671 ----1259
NM_007373chr101363 11211 ----
NM_007374chr141533 --1546 --
NM_007375chr162776 2517 1761 785 533 427 ------
NM_012064chr1241138 853 794 205 ------
NM_012069chrX82560 2499 705 680 648 561 421 271 12051 32074 1939 1901 11934
NM_012074chr14197 ------
NM_012080chrX3972 115 96 ------
NM_012081chr522564 1053 ------
NM_012082chr81702 ------
NM_012090chr1----1859 --
NM_012092chr251779 1702 1336 136 53 ------
NM_012095chr10113417 3320 3249 3083 2715 2661 1310 928 867 314 186 12203 ----
NM_012096chr322707 1207 23148 1262 33421 3250 3035 --
NM_012098chr951062 1027 618 330 22 ----11327
NM_012099chr1941110 939 917 369 --51152 805 767 459 219 --
NM_012102chr152143 1932 872 558 276 ------
NM_012104chr1173536 3511 2758 2710 1080 754 295 2683 283 --11371
NM_012104chr1173536 3511 2758 2710 1080 754 295 2683 283 --11371
NM_012105chr213798 689 637 1223 2349 117 --
NM_012120chr652782 2204 2126 872 677 42818 2274 1006 60 --1906
NM_012129chr742353 953 339 32 32492 2119 43 1787 12367
NM_012137chr142919 1981 222 88 ------
NM_012141chr1353185 2599 1190 821 253 --22618 315 --
NM_012161chr431176 804 446 1751 --1136
NM_012164chr9157128 6607 6341 6251 6122 6052 4802 4655 1933 1142 1136 694 514 489 443 52826 2436 1756 1644 601 32324 2286 64 26371 1174
NM_012176chr51222 ------
NM_012183chr11608 ------
NM_012193chr11105284 5240 5229 4794 4231 3898 3507 1345 991 445 34155 3375 93 54176 4044 4006 3329 1513 11103
NM_012197chr941557 360 294 253 11145 1169 --
NM_012199chr194359 4143 3596 3480 3205 3048 1474 893 193 --1813 42872 1855 972 207
NM_012210chr921108 94 1130 143 --
NM_012214chr2116156 4855 4338 4315 2509 2276 2126 2049 1510 231 151 25572 4116 12262 --
NM_012215chr1021553 687 11733 184 --
NM_012218chr1963028 2762 2258 1091 999 231 --12839 13041
NM_012219chr383203 2977 2671 2359 2197 1038 593 517 ------
NM_012223chr22425 171 ------
NM_012224chr441053 989 910 785 1220 ----
NM_012229chr1031244 1076 414 2979 930 ----
NM_012232chr1752181 1985 1861 837 47 11663 1330 --
NM_012234chr393393 3189 3038 3025 2910 2725 1141 961 54 13303 1107 --
NM_012238chr1031713 1494 1234 2553 164 ----
NM_012239chr1111114 21657 71 11356 --
NM_012244chr141286 11788 51654 1365 1306 622 189 --
NM_012249chr231053 577 204 --1242 --
NM_012250chr1131104 522 449 1461 ----
NM_012252chr794592 4375 3867 3508 3347 2042 1265 405 309 --13481 --
NM_012257chr71756 1238 ----
NM_012259chr641412 1214 224 65 2236 141 ----
NM_012261chr201657 ----1458
NM_012262chr164573 4354 3853 3672 1266 232 11114 --13209
NM_012281chr732013 845 143 155 ----
NM_012287chr371529 1486 1475 953 773 499 198 11463 34148 1352 1314 --
NM_012288chr6124976 4722 4346 3754 3570 1770 1662 1607 1444 853 735 534 25427 3853 24087 2211 --
NM_012294chr763790 3460 1313 1252 1107 511 --22879 1294 --
NM_012297chr4196 3698 627 540 ----
NM_012300chr531879 1655 142 1799 22118 1639 --
NM_012302chr11144 ------
NM_012307chr181190 1409 ----
NM_012308chr1172420 1921 1770 949 901 652 65 21957 555 1320 --
NM_012309chr1194202 4016 3572 3509 3385 1926 1760 386 266 --24104 1360 11868
NM_012310chrX3611 171 147 1552 ----
NM_012316chr1105176 5128 5012 4697 4574 3887 1368 1196 922 725 13633 34034 2204 1353 21524 880
NM_012325chr2041281 1143 1019 509 ----1325
NM_012328chr731170 1047 382 ------
NM_012329chr1721253 356 11374 1683 --
NM_012333chr11500 ------
NM_012343chr51751 ----1275
NM_012383chr9132 ------
NM_012384chr2062371 2227 1836 858 486 186 --11770 --
NM_012395chr753450 3100 2994 538 195 --1763 --
NM_012405chr183735 3408 3300 1359 1343 646 473 47 12876 32762 2724 439 --
NM_012408chr20--1807 ----
NM_012414chr12633 144 ------
NM_012416chr92986 207 ------
NM_012420chr1061773 1490 881 486 344 253 1621 ----
NM_012446chr5--1106 1125 --
NM_012465chr1073280 2526 2259 1111 928 337 134 ------
NM_012467chr161113 ------
NM_012471chrX1286 21722 384 1604 --
NM_012482chr13665 643 124 ------
NM_013229chr1242490 1765 451 80 22186 801 31125 989 691 1952
NM_013230chrY51770 1498 689 463 33 ------
NM_013231chr1464224 3852 3801 3628 3431 1478 14368 ----
NM_013233chr2--11183 ----
NM_013236chr2211115 --1458 --
NM_013243chr1541489 1432 279 133 ------
NM_013253chr1131446 1020 410 ------
NM_013255chr768696 8652 7325 1668 1425 787 77290 6276 5586 2761 2039 759 169 17542 35509 3555 2603
NM_013257chr881835 1700 1518 935 682 276 259 59 ------
NM_013261chr463374 2888 1383 1170 662 624 23449 464 --13765
NM_013269chr1243961 3849 1175 743 24497 3746 13973 --
NM_013277chr12----3795 775 76 --
NM_013283chr52840 331 ------
NM_013286chr393548 3489 3438 3313 2782 2653 1062 928 304 1831 ----
NM_013309chr1562672 2328 2170 1665 416 144 22112 627 1598 --
NM_013313chr2293345 2688 2621 2214 774 611 445 230 88 2949 107 12568 11237
NM_013314chr10--181 ----
NM_013316chr731002 907 900 ------
NM_013341chr282926 2611 2401 2216 1153 1117 423 289 --134 --
NM_013354chr831325 1150 512 ------
NM_013372chr1562412 1339 846 528 449 358 22293 1011 ----
NM_013377chr121601 ------
NM_013381chr1222031 1894 ----12184
NM_013382chr1471880 1596 902 707 467 38 23 1502 22330 2009 --
NM_013386chr131629 1613 256 --148 --
NM_013411chr142767 2542 1899 652 22468 348 22455 1063 --
NM_013433chr191542 --11873 1735
NM_013436chr22695 637 ------
NM_013437chr821002 156 ------
NM_013438chr931808 1723 1475 ------
NM_013444chrX2936 777 --1388 --
NM_013448chr143646 619 475 ------
NM_013449chr1222088 768 22176 1817 1826 22555 1025
NM_013937chr62913 448 --1311 --
NM_013993chr61616 ------
NM_013994chr61616 ------
NM_013995chrX42119 1965 712 75 ------
NM_014000chr1041543 1477 733 34 11431 ----
NM_014011chr232157 1818 406 12045 ----
NM_014016chr31239 ------
NM_014028chr672857 2593 2326 2160 1283 550 57 12926 ----
NM_014043chr321301 358 11646 ----
NM_014048chr1654992 4091 1503 817 361 24605 3674 24366 740 --
NM_014055chr121351 158 ----
NM_014071chr202381 139 ------
NM_014089chr135832 758 596 297 278 ------
NM_014109chr81943 ------
NM_014112chr895463 4481 4199 4059 4030 3859 3547 989 855 21301 874 ----
NM_014117chr1642335 2236 1727 1012 22032 1080 ----
NM_014141chr754503 1455 996 572 179 24062 1207 33940 3899 3882 1452
NM_014155chr1166622 6358 6178 6156 5522 2690 47076 2478 1758 1414 11365 --
NM_014171chr22503 76 ------
NM_014181chr282657 2513 1994 1910 1855 1836 1065 749 ------
NM_014191chr124738 264 108 66 ------
NM_014214chr182299 270 1328 ----
NM_014231chr1251361 822 626 523 197 ------
NM_014232chr1731461 1171 660 ------
NM_014232chr1731461 1171 660 ------
NM_014233chr1742090 1870 714 264 --12039 1193
NM_014241chr10182 ------
NM_014243chr421748 91 --149 --
NM_014253chrX62120 2091 1860 797 725 712 ------
NM_014263chr1031121 1066 574 21304 1233 ----
NM_014267chr11----1237 --
NM_014268chr182453 107 1950 --1241
NM_014279chr91656 ------
NM_014280chr14587 322 274 28 1793 ----
NM_014283chr12319 163 ------
NM_014289chrX61411 1202 1194 956 181 85 ------
NM_014294chr811355 ------
NM_014309chr2255410 4910 3891 792 644 --13597 --
NM_014313chr1----21338 73 --
NM_014314chr971804 1244 1190 466 453 385 354 21537 234 ----
NM_014319chr1221700 1291 1456 ----
NM_014331chr4117711 6375 5359 4761 2982 1596 1431 1241 329 94 28 46825 5496 3114 1507 --15075
NM_014335chr152938 49 ------
NM_014345chr62391 209 11088 ----
NM_014363chr131847 1169 1889 --
NM_014368chr951983 1896 1592 1358 260 ----1297
NM_014372chr121439 603 ------
NM_014381chr1463073 2147 1266 1166 991 827 12358 ----
NM_014382chr32183 152 ------
NM_014386chr5--1120 ----
NM_014392chr431585 1056 374 ------
NM_014397chr931418 1194 138 ----1243
NM_014408chr11122 ------
NM_014421chr431399 375 216 --11753 --
NM_014423chr584970 4794 4619 4524 4472 4220 3488 1947 --12033 --
NM_014445chr322157 518 --1535 --
NM_014452chr62967 411 1815 ----
NM_014456chr101220 1724 ----
NM_014458chr121305 1265 --1960 --
NM_014488chr111561 ------
NM_014491chr73953 919 888 1900 ----
NM_014496chrX----1250 --
NM_014504chr771741 1579 1355 1346 1325 790 243 1165 11901 --
NM_014517chr351455 1330 1263 305 162 1407 ----
NM_014521chr231835 1629 498 21433 1284 ----
NM_014548chr1531180 469 218 ------
NM_014554chr1211872 ----1300
NM_014563chrX52020 1365 811 479 314 --51404 700 662 369 331 --
NM_014569chr73464 139 27 ----173
NM_014572chr1321243 420 ------
NM_014577chr221661 ------
NM_014606chr421061 392 --21255 171 --
NM_014607chr251727 1446 818 442 254 ------
NM_014608chr151417 ------
NM_014612chr921534 993 1971 ----
NM_014613chr563002 2787 2359 1152 391 198 13124 ----
NM_014614chr22472 188 --1990 --
NM_014615chr1653364 3344 1275 959 778 23121 1348 23280 2616 --
NM_014616chr353027 1321 1226 1031 647 1721 ----
NM_014634chr2243303 2657 2226 859 2223 65 32837 2646 2639 23119 2394
NM_014637chr81525 ------
NM_014660chr731047 911 48 ----1856
NM_014666chr51341 1914 ----
NM_014667chr32516 274 1878 ----
NM_014673chr81285 ------
NM_014677chr81255 21075 275 ----
NM_014678chr22177 ------
NM_014679chr114999 986 934 411 ------
NM_014682chr832012 2002 673 31734 1551 1496 ----
NM_014683chr172759 715 ------
NM_014685chr161547 ------
NM_014689chr2158 --1149 --
NM_014690chr721010 293 21933 492 --22838 1157
NM_014701chr1553037 1058 699 594 504 1640 13261 --
NM_014702chr633019 1136 693 ----1844
NM_014707chr71874 ----11899
NM_014711chr1621449 704 ------
NM_014715chr113951 826 766 --131 --
NM_014717chr193606 343 170 ------
NM_014720chr1041624 1517 1339 372 --21606 526 --
NM_014721chr6107358 7187 6919 6368 5793 5533 5401 2081 790 521 14785 17224 --
NM_014723chr2032001 1122 878 11116 42674 1275 1017 567 --
NM_014729chr81851 --11883 --
NM_014730chr1254932 4195 3442 1027 232 44044 3491 3478 1415 14909 11114
NM_014730chr1254932 4195 3442 1027 232 44044 3491 3478 1415 14909 11114
NM_014733chr541707 1521 1458 33 1367 ----
NM_014735chrX12045 --129 --
NM_014742chr2041518 1217 559 469 --31279 583 548 11490
NM_014743chr422706 90 1526 11938 --
NM_014751chr872175 2088 1841 1729 845 658 164 ------
NM_014752chr1121552 1357 --1426 --
NM_014755chr284118 3802 3741 3648 3571 3437 1235 750 2665 420 11181 --
NM_014758chr1152123 1785 948 609 573 --1439 1861
NM_014761chr1651137 1019 928 87 35 1942 1400 --
NM_014764chr122398 85 11056 ----
NM_014765chr142000 1077 822 489 129 ----
NM_014766chr753358 2825 2356 1516 919 1162 ----
NM_014767chr1073640 3337 3092 2480 2455 1256 1026 --167 23121 624
NM_014771chr163812 305 215 --31011 858 696 --
NM_014772chr1863431 3030 2671 2413 885 404 --1368 22933 628
NM_014779chr32882 42 ------
NM_014788chr952757 1951 339 330 226 2885 595 125 --
NM_014790chr5131 ------
NM_014802chr121265 11006 147 --
NM_014810chr173371 2259 1086 871 778 637 172 11369 13454 1496
NM_014812chr121361 107 ------
NM_014819chr552233 767 755 476 141 ------
NM_014822chr44490 460 206 47 1146 ----
NM_014824chr1131960 1577 759 1538 --11787
NM_014826chr193845 3698 3430 1659 1271 585 470 177 22 34008 2684 1249 23999 3456 --
NM_014828chr1442447 2111 992 853 12253 --1977
NM_014829chr51201 --1679 --
NM_014830chr1293777 3454 3346 3003 2613 2382 1079 902 704 13163 1310 1367
NM_014832chr1331874 1674 147 1309 ----
NM_014835chr203564 95 75 ------
NM_014836chr102724 525 ------
NM_014839chr122159 330 --11693 --
NM_014840chr1263331 2094 996 731 475 145 --1868 --
NM_014841chr61125 1531 ----
NM_014850chr374401 3265 3115 1878 634 314 195 --14279 --
NM_014859chr1731212 1180 561 --1274 --
NM_014862chr1583812 3716 2861 2839 1412 1329 848 301 --12591 13997
NM_014864chr193686 3267 3022 2854 1435 822 485 357 27 13920 41294 1256 1030 407 --
NM_014870chr194633 4548 3966 2989 1699 1528 1437 846 828 13657 13268 --
NM_014872chr942373 2067 1833 765 ------
NM_014873chr1--33057 1431 1266 21319 1183 --
NM_014877chr17127679 6914 6853 6828 6431 5733 3045 2125 1436 1419 893 600 37315 6134 5229 36999 6021 5983 --
NM_014891chr761538 1489 1322 662 614 53 21158 515 ----
NM_014893chrY41900 1841 576 81 ------
NM_014897chr1743264 3068 2339 731 --22713 2580 --
NM_014899chr543176 2607 1092 602 --13073 --
NM_014902chr2031508 387 121 --41524 1172 303 83 1607
NM_014903chr1222198 631 22010 936 1428 --
NM_014906chr1752761 1529 1391 708 171 22845 368 11328 --
NM_014912chr1053407 2926 2836 2386 1245 1484 11321 --
NM_014920chr631515 300 24 --22415 1494 33798 2358 1317
NM_014921chr1962914 2671 2489 2401 1906 162 1969 12474 --
NM_014923chr1371899 1753 1710 1689 803 452 345 32124 2104 1951 ----
NM_014932chr351934 1680 1605 178 76 ----11218
NM_014934chr1373943 3781 3587 2950 1609 1475 1042 --21327 1093 --
NM_014935chr183713 3198 3007 2637 2605 1465 1118 455 1313 22894 2828 22938 964
NM_014938chr1252486 2308 2007 922 393 22450 237 2249 98 --
NM_014939chr181307 --11095 --
NM_014945chr551556 1297 1276 639 53 1546 11860 --
NM_014946chr232232 815 89 12408 ----
NM_014947chr132951 2182 2140 --31165 1030 992 --
NM_014950chr1461466 1427 631 470 121 40 ------
NM_014953chr1363444 3091 1571 1260 1145 457 1660 1414 1261
NM_014961chr43691 592 43 --11619 11520
NM_014962chr2042509 2490 145 54 1431 ----
NM_014974chr1031401 706 520 ------
NM_014978chr102475 339 --21291 242 --
NM_014988chr432571 2220 694 ------
NM_014989chr62188 105 ------
NM_014990chr141541 ------
NM_014991chr432329 1123 617 1485 22303 245 --
NM_014992chr141249 1831 ----
NM_014996chr31842 ------
NM_014997chr742013 1910 1058 462 --12130 --
NM_015000chr1262911 2626 2247 927 798 387 22968 610 ----
NM_015001chr1----1934 --
NM_015008chr372720 2308 749 595 306 284 69 13681 ----
NM_015013chr1--1315 ----
NM_015017chr121097 973 2960 451 2340 302 --
NM_015020chr1653384 2391 929 805 529 1337 2223 186 --
NM_015024chr821200 315 11483 1263 --
NM_015025chr222028 1055 12356 21883 885 --
NM_015033chr973327 3135 2271 2191 598 46 21 22199 1186 31209 1074 1036 --
NM_015035chr20166705 6550 6491 6074 5518 5352 5219 4651 4601 4457 4122 4109 1896 1845 994 937 ----14267
NM_015039chr133534 3100 1426 --33403 790 669 24121 616
NM_015040chr273259 2294 1323 1156 1020 677 476 ------
NM_015042chr1541159 978 643 171 2939 540 14072 --
NM_015045chr1022062 194 ------
NM_015049chr233047 2489 990 22803 2647 1716 --
NM_015052chr721372 184 11333 ----
NM_015053chr142329 1555 436 328 --32214 1986 346 --
NM_015054chr122350 185 ------
NM_015055chr1162881 2029 1009 687 185 176 12346 ----
NM_015057chr131589 ------
NM_015059chr1574009 3651 2925 1542 1482 1039 359 23165 2970 13894 --
NM_015064chr12103646 3486 2525 2317 1033 698 607 572 481 446 21453 472 11458 1844
NM_015068chr773761 3670 3279 1521 1458 330 261 21362 579 ----
NM_015071chr575895 4621 4009 955 831 725 673 16285 45750 4824 563 325 --
NM_015074chr1124954 4594 4389 4093 3927 3820 1923 1849 1323 1158 326 205 ------
NM_015076chr663714 3211 3082 1484 768 279 1130 22854 2816 --
NM_015079chr1592841 2608 2574 2444 800 745 653 431 404 --22759 395 12754
NM_015082chr521877 1627 1628 22074 1848 160
NM_015090chr1126108 6066 5836 5279 4680 4625 4336 4215 2389 1739 1438 1403 21986 1597 25740 1726 --
NM_015091chr141134 ----1165
NM_015092chr1653472 2926 2881 1766 138 --22893 773 166
NM_015093chr6--1486 --11335
NM_015094chr2284295 3599 3567 3516 2955 1770 1406 1372 64218 4195 4026 3700 3535 2833 --11663
NM_015097chr321937 301 22157 595 1559 --
NM_015107chrX41739 956 924 573 --11929 1627
NM_015115chr443061 2456 2340 970 2880 465 22631 485 --
NM_015116chr1331665 494 89 11600 31241 644 46 --
NM_015125chr192473 236 ------
NM_015130chr41905 11370 ----
NM_015132chr711698 21377 558 ----
NM_015133chr165566 200 114 106 26 ----1899
NM_015138chr1582426 2108 1805 980 827 790 164 80 11824 21006 195 12469
NM_015144chr1673385 2688 977 868 756 527 476 11565 11087 11479
NM_015155chr102632 308 1205 12203 --
NM_015161chr1631204 1156 304 --1283 --
NM_015176chr131179 559 121 11601 21282 1258 --
NM_015180chr143651 631 76 ------
NM_015192chr2052201 1962 1100 272 194 ------
NM_015199chr3102904 2435 2267 2206 2191 2046 1184 301 183 92 12007 1941 --
NM_015200chr422533 1926 ------
NM_015205chr1385124 4742 4671 4467 4461 4271 4212 4119 --24104 3520 --
NM_015206chr1553613 3449 3025 2606 716 ------
NM_015209chr152270 1518 1505 1474 178 ------
NM_015215chr172649 913 877 613 591 253 217 12489 12141 --
NM_015216chr531157 557 386 ------
NM_015221chr1051194 603 192 174 25 ------
NM_015225chr93598 561 551 23161 2331 --12254
NM_015226chr1693451 3360 3344 3090 2959 2843 2348 1365 487 22678 2547 13056 --
NM_015230chr441362 403 209 52 1319 ----
NM_015231chr112881 692 1769 1210 --
NM_015245chr6102801 2756 2660 933 626 416 406 346 327 126 12684 1578 --
NM_015247chr1685135 3978 3785 3628 1620 902 536 330 ------
NM_015250chr941873 583 340 96 11750 ----
NM_015256chr5--1518 ----
NM_015265chr231936 1851 1723 11736 ----
NM_015267chr1262083 1722 1422 648 537 326 ------
NM_015268chr31504 ------
NM_015269chr11480 ------
NM_015270chr1261554 1547 657 260 252 97 22130 1527 11681 --
NM_015271chr433859 421 369 24322 454 1615 --
NM_015272chr1631723 1690 625 ------
NM_015275chr1221601 652 ------
NM_015284chr152117 2110 2082 1786 166 11403 1772 11644
NM_015288chr562593 2504 1419 1405 1330 1315 --23226 850 --
NM_015291chr152944 2643 964 690 161 ----1520
NM_015293chr63535 457 269 1242 ----
NM_015299chr14123957 3790 3530 3249 2795 2753 2623 1403 648 226 219 212 43421 3357 723 183 21478 833 --
NM_015310chr8158180 7874 7709 7633 7202 7151 6296 3222 2404 2109 1943 1461 1429 1228 204 46932 5705 3160 1825 --11480
NM_015313chr1164693 4113 3630 1834 1772 1698 23289 1788 ----
NM_015317chr242514 1939 1144 471 12783 --12246
NM_015320chr211067 ------
NM_015326chr182654 2477 1868 705 662 538 149 131 --12686 12985
NM_015328chr772237 2185 1999 1217 1118 874 481 13119 12330 --
NM_015335chr1222384 214 --1356 151
NM_015336chr1242385 2363 2154 263 1649 ----
NM_015338chr2091978 1866 1791 1273 1216 1197 641 360 230 1517 ----
NM_015339chr204651 641 189 38 ------
NM_015347chr1231871 370 60 --22471 2129 --
NM_015361chr22887 803 ------
NM_015365chrX54049 3776 3497 575 43 12934 ----
NM_015375chr184692 4368 4202 4044 1986 943 776 136 34576 720 376 --13635
NM_015393chr4113659 3427 2961 2928 1398 872 632 493 384 237 99 33026 2750 2620 22375 164 --
NM_015396chr341475 1326 953 441 --11411 168
NM_015397chr931787 551 37 ------
NM_015419chrX41071 981 408 199 --1782 --
NM_015429chr351089 945 896 414 112 ------
NM_015443chr1751358 1038 514 352 60 ------
NM_015455chr563889 3660 2925 732 122 24 --12799 1706
NM_015458chr864156 3482 2043 1638 1520 366 44983 4763 4748 1120 --11753
NM_015460chr331834 795 456 --11438 11308
NM_015461chr181694 ------
NM_015463chr22820 32 ------
NM_015475chr21402 ----1755
NM_015477chr152999 154 1102 --1643
NM_015497chr153783 383 274 ------
NM_015508chr331291 578 318 ------
NM_015509chr1251535 428 307 119 64 1479 1436 --
NM_015520chr362614 1860 1712 1022 983 665 --1722 1690
NM_015535chr243884 3049 2846 302 43360 2939 1106 769 23772 957 --
NM_015541chr3----135 --
NM_015542chr1041220 1092 1005 232 --2882 166 --
NM_015550chr763124 3067 2436 2385 1347 1226 12702 21305 374 --
NM_015553chr674818 4590 3627 1976 1805 1589 725 24248 1383 24152 4114 11751
NM_015564chr583249 2952 2663 2419 1411 1034 287 40 21260 1067 1726 --
NM_015567chr131474 ------
NM_015569chr194565 4410 4376 3870 3582 1900 1676 200 172 14784 ----
NM_015571chr62793 521 22640 639 1278 --
NM_015576chr342992 2882 2575 2167 32631 910 448 12256 --
NM_015577chr521202 1190 --11319 --
NM_015601chr103639 358 125 ------
NM_015605chr1051292 1077 454 254 136 ------
NM_015607chr1157 ------
NM_015630chr221128 396 ------
NM_015635chr942100 1733 320 300 --41725 1621 1584 1402 --
NM_015640chr153766 1883 1497 1168 162 23307 1594 34081 4046 1936 --
NM_015646chr1231146 440 76 ------
NM_015652chr102482 47 ------
NM_015657chr2------123
NM_015678chr134528 481 366 326 --2385 99 --
NM_015689chr7124 ------
NM_015691chrX72963 2641 2358 1945 1801 780 744 12271 22124 2092 12087
NM_015695chr641355 692 441 62 --31869 1482 759 --
NM_015726chr141412 333 258 40 ----11350
NM_015844chr182912 841 --1392 --
NM_015845chr182690 619 1280 1170 --
NM_015846chr182912 841 --1392 --
NM_015847chr182912 841 --1392 --
NM_015866chr12353 58 128 --1959
NM_015878chr861889 1838 1819 1558 1541 88 32098 1875 1614 ----
NM_015879chr18138343 8267 7370 7142 6222 6054 2957 2536 2295 2190 1763 1749 887 22324 1554 18362 26517 5375
NM_015881chr1131446 1020 410 ------
NM_015886chr8125697 5126 5091 4975 4941 1981 1526 1394 1275 646 443 208 ------
NM_015891chr631572 1391 1343 ----1169
NM_015892chr104725 361 328 66 2856 554 --1909
NM_015895chr6--1238 ----
NM_015902chr82790 683 --1216 --
NM_015906chr154468 4296 3658 1393 419 13411 --1663
NM_015907chr42372 248 ------
NM_015912chr831836 811 430 32124 997 79 ----
NM_015946chr53715 196 28 ------
NM_015960chr102110 82 ------
NM_015976chr11130 1139 ----
NM_015981chr563213 2876 1221 667 517 418 1565 --32193 289 180
NM_015999chr14521 109 57 33 ------
NM_016009chr194923 4301 4124 3607 3441 3239 3225 1761 453 21826 268 ----
NM_016018chr842740 2106 1768 166 2937 577 ----
NM_016021chr642631 2210 1890 970 22794 933 21928 1862 --
NM_016023chr832120 1930 666 11904 ----
NM_016026chr144506 122 115 92 ----1418
NM_016037chr12293 161 21015 63 3897 843 332 --
NM_016053chr121162 ------
NM_016057chr1271148 1119 1039 965 944 484 125 1511 1155 --
NM_016059chr62956 353 ------
NM_016061chr221562 140 ------
NM_016072chr1242193 1988 1504 1479 ------
NM_016076chr142612 2383 2347 942 12241 ----
NM_016083chr673579 3290 3045 2953 2867 343 268 1602 12573 --
NM_016089chr321590 1433 51917 740 572 355 152 --11648
NM_016090chr112912 182 ------
NM_016103chr51140 ------
NM_016107chr5--1938 ----
NM_016127chr82761 642 1732 ----
NM_016133chr251600 1498 598 209 174 178 ----
NM_016147chr113921 374 293 --31191 1095 149 --
NM_016156chr1162061 2040 2031 1755 1597 131 12372 1519 --
NM_016162chr121767 ------
NM_016169chr1053198 2074 1260 1023 272 22238 589 --1873
NM_016185chr172737 63 2550 339 ----
NM_016201chr331614 744 260 --32065 1916 882 1579
NM_016205chr421111 1074 193 ----
NM_016206chr377615 7342 7231 5450 3297 2566 2174 38957 6143 671 27504 7466 --
NM_016217chr653061 1196 772 473 378 ------
NM_016226chr121395 ------
NM_016227chr12319 163 ------
NM_016230chr63184 159 112 ------
NM_016231chr1751399 1327 1228 1139 464 11459 --11649
NM_016235chr1661515 1417 1321 1290 1004 438 ----1240
NM_016247chr32453 79 ------
NM_016250chr142152 56 --1793 --
NM_016255chr623267 324 12533 ----
NM_016257chr173540 3016 1056 605 477 64 55 ------
NM_016260chr297651 7283 5129 2945 2124 1312 1168 1079 742 67548 7035 4932 4727 2436 1471 15619 --
NM_016271chr1831937 1551 401 1161 ----
NM_016272chr2222419 881 --11734 1515
NM_016275chr352535 1985 1776 938 684 21895 154 ----
NM_016281chr123441 374 200 ------
NM_016282chr92247 43 ------
NM_016284chr162280 267 1778 1149 --
NM_016287chr142043 1351 511 445 --31373 833 795 1780
NM_016289chr241787 1764 1632 1559 1575 1553 --
NM_016297chr282662 2496 2366 1511 1133 1116 1013 323 21361 757 11291 1306
NM_016303chrX2169 97 --1350 --
NM_016308chr12787 572 22067 201 --21727 400
NM_016322chr933251 1001 210 1551 ----
NM_016333chr164513 457 181 109 ------
NM_016340chr521348 929 ----11196
NM_016351chr7147 ------
NM_016374chr121377 211 --11112 --
NM_016374chr121377 211 --11112 --
NM_016376chr1793520 3316 3201 3116 1506 920 399 275 68 1905 --21401 1027
NM_016377chr641610 1581 112 39 --1567 --
NM_016396chr1543023 2562 2241 478 ------
NM_016403chr112754 286 ------
NM_016422chr1172479 2238 1949 1193 1031 373 162 22869 1107 ----
NM_016427chr183363 99 80 ------
NM_016436chr2042234 1938 1059 659 52311 2004 903 679 280 ----
NM_016441chr222396 2050 ------
NM_016467chr221263 886 ------
NM_016472chr143450 388 125 21474 1447 ----
NM_016480chr52762 609 2800 287 ----
NM_016505chr12111 95 --1262 --
NM_016507chr1752915 2332 2042 1232 1165 ------
NM_016513chr631515 300 24 --22415 1494 33798 2358 1317
NM_016522chr1111419 --2332 300 1125
NM_016530chr1583311 2967 1649 1020 817 617 330 127 1711 11159 2160 78
NM_016531chr473129 2600 1669 1024 546 147 123 12635 ----
NM_016533chr12137 ------
NM_016544chr232806 1354 1066 22495 96 12832 12568
NM_016545chr11917 1656 ----
NM_016547chr12591 495 ------
NM_016557chr33942 837 111 192 ----
NM_016559chr331488 1461 606 11169 ----
NM_016570chr12149 ------
NM_016577chr394340 4319 4190 3847 3803 3127 1593 1371 379 11091 3748 621 566 13575
NM_016587chr731051 1007 949 --1940 --
NM_016603chr52658 351 21465 112 --1312
NM_016621chr1164646 4331 4029 4012 3788 2851 --33573 3016 315 --
NM_016623chr81560 ------
NM_016626chr1841408 610 275 80 ------
NM_016628chr103725 675 59 ------
NM_016645chr153376 165 71 1333 ----
NM_016654chr1531075 431 53 1321 ----
NM_016656chrX3346 273 137 1403 ----
NM_016821chr33410 324 117 ------
NM_016823chr1751306 1256 1139 983 39 ------
NM_016824chr1051850 1696 1597 627 462 ------
NM_016827chr32714 628 1580 1118 --
NM_016834chr1773875 3742 3101 2847 819 749 138 23929 1396 21348 493 22686 1238
NM_016835chr1773875 3742 3101 2847 819 749 138 23929 1396 21348 493 22686 1238
NM_016841chr1773875 3742 3101 2847 819 749 138 23929 1396 21348 493 22686 1238
NM_016929chr674184 1841 1397 1293 944 242 147 21027 118 ----
NM_016952chr1133904 3762 3154 23886 657 3555 517 231 134
NM_017415chr574078 3671 3593 1807 829 437 88 43434 2819 1471 1411 --14061
NM_017420chr1443252 3190 2438 192 1625 ----
NM_017423chr441562 423 121 25 11836 ----
NM_017426chr41195 ------
NM_017437chr1422414 311 1818 12071 12220
NM_017439chr7--156 ----
NM_017447chr2184211 4167 3979 3744 3343 1497 1414 788 1865 13757 --
NM_017451chr172338 199 31063 971 408 1185 --
NM_017452chr2021413 499 ------
NM_017453chr2021413 499 ------
NM_017454chr2021413 499 ------
NM_017489chr821209 310 3984 335 194 2481 443 --
NM_017519chr6------11185
NM_017522chr111021 ------
NM_017544chrX3901 680 320 ------
NM_017545chr202450 192 ------
NM_017548chr331876 529 423 11866 1381 --
NM_017551chr1012557 ------
NM_017594chr932064 822 372 22462 2157 1521 --
NM_017599chr1252117 1565 1556 1351 257 11574 ----
NM_017610chr151402 ------
NM_017628chr485099 4058 3760 1866 1824 1366 1247 263 199 54960 2097 2080 1301 1145 --
NM_017629chr12428 268 11748 --148
NM_017633chr643586 3059 2588 432 --23732 2764 --
NM_017634chr811726 ----11539
NM_017635chr111283 11600 ----
NM_017637chr988618 8417 8206 6774 2769 1661 997 454 28501 7952 28949 7105 11729
NM_017640chr61589 ------
NM_017643chr1732528 2299 398 --12572 --
NM_017644chr374581 4523 4511 1097 791 470 150 34064 1069 75 23780 3745 --
NM_017650chr775996 4744 4271 1546 1489 961 462 ----14051
NM_017658chr1453939 3868 3627 3147 1864 13862 ----
NM_017661chr152344 144 1993 ----
NM_017664chr134137 119 94 76 ----1259
NM_017666chrX2620 29 22259 658 1684 --
NM_017668chr162776 90 ----1739
NM_017672chr152863 413 ----11032
NM_017680chr91689 1252 ----
NM_017693chr1321295 128 ------
NM_017709chr184087 4033 3749 3567 2812 1175 450 68 14230 13367 --
NM_017712chr19136008 5151 4663 4524 3901 1562 1525 1005 839 458 438 420 260 127 35232 1882 1844 12530
NM_017714chr202631 606 --1116 --
NM_017719chr362367 2225 723 482 321 277 1549 ----
NM_017728chr1752945 2853 2253 2158 436 12428 22606 2303 --
NM_017736chr1652843 2084 1964 776 181 1630 ----
NM_017737chr142229 2022 1720 613 1150 ----
NM_017741chr472420 2392 2319 2153 1119 423 257 ------
NM_017742chr1841207 748 238 183 --11962 1454
NM_017747chr5----1286 --
NM_017754chr644424 3136 1010 735 --13841 11699
NM_017762chr1582406 2014 1583 588 404 85 70 42 32367 576 535 11673 --
NM_017768chr13699 658 650 1634 ----
NM_017769chr1433209 696 71 2649 247 ----
NM_017776chrX2351 58 2489 240 ----
NM_017780chr81613 ------
NM_017790chr9136 175 ----
NM_017793chr154768 207 107 75 1257 ----
NM_017799chr1431826 1711 1600 11450 ----
NM_017801chr342201 996 974 557 --1677 --
NM_017805chr19130 ------
NM_017812chr72705 299 --1690 --
NM_017813chr845154 4050 3669 1233 21720 1296 43924 2058 2020 1580 12172
NM_017826chr13157 ------
NM_017845chr4283 47 1821 ----
NM_017848chrX74118 3240 3032 2880 1826 1474 510 24557 3529 33570 1796 1725 --
NM_017849chr233122 3045 125 12507 42735 2393 2355 928 --
NM_017880chr22166 61 --1310 --
NM_017893chr104447 288 121 39 --21318 997 --
NM_017902chr10125623 5517 5244 4152 3790 2135 1467 1151 1125 903 846 438 25635 4026 34446 983 319 24870 426
NM_017907chr112179 100 ----174
NM_017919chr9115522 5441 5167 5028 4888 4434 3899 2113 861 817 698 44085 1925 1606 1244 1580 14874
NM_017922chr142419 103 ------
NM_017933chr251406 1091 1008 552 526 ------
NM_017935chr43637 603 511 1127 ----
NM_017938chrX31868 1693 1398 ------
NM_017943chr142929 890 ------
NM_017944chr1162864 2675 2309 855 303 266 22370 351 12272 --
NM_017953chr12161 33 --1400 --
NM_017955chr1431163 1104 94 21238 835 1312 --
NM_017958chr232554 1134 999 23067 2478 --12683
NM_017987chr1042192 2057 1983 258 ------
NM_017988chr122839 586 ----1254
NM_018003chr1551619 779 678 417 265 21903 500 ----
NM_018014chr25967 925 304 151 103 ------
NM_018030chr182785 408 ------
NM_018061chr111108 11762 ----
NM_018084chr252923 2697 2025 352 183 12205 12342 --
NM_018085chr1147411 7136 6352 6184 5298 5090 4949 2659 1915 1844 1678 832 240 93 25228 540 22273 1992 --
NM_018086chr241779 1309 1277 302 1429 11681 --
NM_018092chr162601 128 --21066 51 --
NM_018105chr841256 1021 441 235 1229 ----
NM_018120chr81953 31394 1140 359 ----
NM_018121chr1052712 1983 1178 515 284 12055 1868 --
NM_018126chr431138 348 336 196 --11500
NM_018133chr311434 2291 218 1482 --
NM_018137chr12132 38 31289 544 250 ----
NM_018157chr1223033 380 22388 607 --1552
NM_018176chr441249 1018 549 393 --11047 11513
NM_018178chr131350 569 419 ----1143
NM_018181chr1821827 1785 ------
NM_018182chr1772290 2056 1946 1887 397 307 187 ----11912
NM_018184chr331904 1733 467 11822 ----
NM_018195chr1142137 1587 579 548 ------
NM_018196chrX2295 254 ------
NM_018199chr142908 124 ----1490
NM_018211chr111457 172 11864 --
NM_018214chr631059 429 267 176 ----
NM_018216chr11215 ------
NM_018222chr1151752 1372 1167 526 215 ------
NM_018230chr11476 ------
NM_018243chr453270 2824 1307 810 353 12896 ----
NM_018244chr2041200 1049 104 47 --1902 --
NM_018247chr652875 2595 424 286 58 23152 991 ----
NM_018254chr151989 1556 806 211 200 ------
NM_018263chr252514 1051 1043 686 505 ------
NM_018286chr172756 370 ------
NM_018287chr1021311 1058 ------
NM_018293chr342534 2285 2175 689 ------
NM_018299chr843415 982 893 84 12193 1729 --
NM_018302chr452060 1520 677 443 109 21675 504 ----
NM_018315chr421513 597 --11537 --
NM_018317chr4--1340 1229 --
NM_018327chr2031670 1151 47 11199 ----
NM_018334chr71471 ----1181
NM_018340chr1695071 4056 3837 1781 1616 1107 1025 683 361 34813 4302 4241 33876 3862 78 1351
NM_018342chr431705 1681 542 ------
NM_018348chr163789 86 25 ------
NM_018351chr12114602 4560 4249 4195 3868 3565 3543 1525 1359 743 356 11814 34043 3679 3420 11301
NM_018362chr1173792 3399 3117 2748 1283 1136 426 1955 33286 3243 2776 13466
NM_018364chr143462 2561 898 703 --2934 263 --
NM_018373chr14116283 5645 4761 4123 3965 2215 1633 1535 1363 804 130 1825 45534 5496 4393 1010 --
NM_018374chr765064 4149 1449 1229 431 242 13600 ----
NM_018383chr252075 692 442 182 51 1534 11333 --
NM_018388chrX21201 43 ------
NM_018400chr1174212 3586 3434 3196 1837 1451 201 34222 4203 1228 33208 1251 1078 1262
NM_018403chr362834 2610 886 817 406 69 ----2365 39
NM_018429chr51744 2869 721 1389 --
NM_018440chr898202 8183 7522 6443 6392 5616 3138 2018 1612 47474 5414 2667 1451 1701 --
NM_018442chr12267 134 ------
NM_018444chr832179 540 276 --12193 --
NM_018445chr15----1580 --
NM_018452chr6_random73723 3285 3171 2894 1379 1146 241 ----1147
NM_018469chr1731010 530 343 ------
NM_018482chr852080 1666 786 468 193 22431 2305 11823 1619
NM_018489chr11708 122 ----
NM_018490chr111453 1444 ----
NM_018553chr1741552 1384 365 74 2528 514 ----
NM_018555chr193578 434 163 11984 ----
NM_018557chr231397 358 310 ------
NM_018566chr134737 1892 1159 15038 ----
NM_018584chr141126 860 832 129 11135 ----
NM_018590chr102184 144 1234 1452 --
NM_018638chr1255287 3906 3729 438 272 14336 --15492
NM_018640chr1242554 2410 2232 933 1487 ----
NM_018644chr1152002 1604 1428 146 21 --21676 1463 --
NM_018650chr131655 1461 99 ------
NM_018682chr7199 ------
NM_018685chr721023 1003 21056 245 --1389
NM_018695chr521505 879 32232 2226 2198 11601 --
NM_018700chr531678 153 63 11466 ----
NM_018704chr142015 1820 1779 785 --11761 11370
NM_018710chr81470 1522 ----
NM_018712chr1121295 1254 41057 1018 444 361 ----
NM_018717chr462818 2729 2615 2402 2393 878 1431 1932 --
NM_018718chr732001 1717 88 ------
NM_018723chr16122 ------
NM_018834chr52271 63 ------
NM_018837chr202926 21 1185 ----
NM_018841chr171582 1515 1376 894 698 422 206 --12582 --
NM_018846chr72913 859 ------
NM_018890chr741362 1190 124 42 --1472 --
NM_018898chr531817 1811 55 22084 115 ----
NM_018899chr531817 1811 55 22084 115 ----
NM_018900chr531817 1811 55 22084 115 ----
NM_018901chr531817 1811 55 22084 115 ----
NM_018902chr531817 1811 55 22084 115 ----
NM_018903chr531817 1811 55 22084 115 ----
NM_018904chr531817 1811 55 22084 115 ----
NM_018905chr531817 1811 55 22084 115 ----
NM_018906chr531817 1811 55 22084 115 ----
NM_018907chr531817 1811 55 22084 115 ----
NM_018908chr531817 1811 55 22084 115 ----
NM_018909chr531817 1811 55 22084 115 ----
NM_018910chr531817 1811 55 22084 115 ----
NM_018911chr531817 1811 55 22084 115 ----
NM_018945chr673433 3111 3025 1332 1004 743 563 21486 1119 --11303
NM_018948chr11538 ------
NM_018959chr19--1268 199 --
NM_018963chr2121426 373 ----1972
NM_018970chr731098 773 40 22008 173 23196 2732 --
NM_018976chr1222346 828 21898 464 ----
NM_018979chr121943 12220 11873 --
NM_018993chr2031204 605 157 ------
NM_018999chr1034672 3252 100 31101 582 465 31983 1967 768 --
NM_019000chr531597 1200 1135 ------
NM_019001chr373831 3513 3012 1715 1263 630 259 14793 ----
NM_019004chr712286 1174 1460 --
NM_019008chr2253575 2560 2354 1183 932 --1614 --
NM_019016chr172199 79 ------
NM_019022chr1843210 2504 1130 915 ------
NM_019027chr452349 545 342 184 98 ------
NM_019035chr4------11956
NM_019036chr641087 1079 493 79 ------
NM_019042chr721236 1126 ------
NM_019063chr22739 170 21739 521 ----
NM_019072chr5104248 3507 3222 3189 3135 3074 2717 1721 282 136 1850 53279 1713 1610 1572 1405 --
NM_019080chr1321515 72 ------
NM_019083chr141579 1236 1216 421 ------
NM_019084chr1052022 1947 572 532 73 ------
NM_019087chr5--1539 ----
NM_019091chr21794 1209 122 --
NM_019096chr61143 ------
NM_019098chr841555 739 724 344 1701 ----
NM_019102chr7----1334 --
NM_019102chr7----1334 --
NM_019106chr2233344 3222 1301 --11113 --
NM_019114chr942288 2239 1895 839 ------
NM_019116chr16123737 3559 3221 2921 2760 2731 2285 1256 995 933 871 123 ------
NM_019117chrX63238 2902 2821 2810 2319 1217 33357 2382 776 --12306
NM_019555chr341644 1173 1160 170 1306 --1599
NM_019558chr21301 ------
NM_019590chr1021483 592 1497 ----
NM_019593chr2042181 597 584 546 12207 22922 2862 --
NM_019595chr22632 163 ------
NM_019596chr2151011 721 681 511 148 22108 1954 ----
NM_019597chrX--1265 ----
NM_019610chr122206 607 1468 21662 816 --
NM_019885chr252603 2455 2194 963 511 22107 972 1485 --
NM_019903chr1051850 1696 1597 627 462 ------
NM_020062chr202976 874 ------
NM_020116chr451839 1451 1128 540 76 ------
NM_020122chr2145756 5724 5022 4947 4782 4449 4390 4348 3968 1872 1358 877 668 297 21599 909 --13992
NM_020123chr1021414 481 --1633 --
NM_020139chr451957 1861 255 185 174 ----11551
NM_020144chr741978 808 490 361 11484 --1243
NM_020148chr1852707 2096 1053 473 314 ------
NM_020156chr71127 ------
NM_020157chr203832 283 273 ------
NM_020159chr43541 144 43 11582 ----
NM_020177chr5--33029 961 483 --1595
NM_020178chr1741032 407 345 62 1110 1270 --
NM_020179chr111354 --1438 --
NM_020180chr182307 83 ------
NM_020194chr22518 64 ------
NM_020198chr1721630 1468 ----189
NM_020204chr12770 325 ------
NM_020205chr153435 2884 2680 994 278 ------
NM_020239chr132153 740 643 1546 1837 --
NM_020240chr562148 2011 1053 1024 944 917 22210 424 ----
NM_020245chr655058 4784 3787 3751 775 23502 3414 1952 13812
NM_020318chr11365 ------
NM_020336chr2042423 1547 967 480 2653 414 13275 --
NM_020338chr1073448 2483 2416 1315 864 559 426 12686 33589 1384 892 11349
NM_020341chr2021750 644 ------
NM_020342chr272187 1953 1786 627 483 473 313 ----11828
NM_020346chr1121162 167 ------
NM_020347chr322297 2015 11814 ----
NM_020348chr102633 191 42409 943 815 682 ----
NM_020369chr71111 ------
NM_020379chr11902 --2780 138 --
NM_020381chr611780 41969 1835 760 273 2649 611 11252
NM_020384chrX91868 1667 1618 1193 643 518 472 269 215 11531 ----
NM_020390chr3104836 4238 4104 3933 3209 3199 1866 1713 1693 458 44906 3912 1150 594 51173 1036 998 982 910 1101
NM_020403chr1321252 558 ----1727
NM_020431chr1472720 2678 2538 2326 2280 760 85 12255 12769 --
NM_020436chr20145 ----1145
NM_020440chr163060 2690 2301 1095 587 262 1116 ----
NM_020443chr1156946 6741 6502 5515 4878 4703 4568 4515 4487 2030 1665 743 706 550 177 35964 5261 737 55987 5852 5814 5246 1164 --
NM_020449chrX1758 ------
NM_020455chr641107 920 894 159 22044 337 182 --
NM_020463chr231249 1187 544 1375 ----
NM_020466chr6134654 4632 4552 4360 4081 3770 3256 3161 1925 1394 861 550 383 21811 404 ----
NM_020473chrX3793 189 67 --11826 --
NM_020474chr1831411 1402 178 11426 ----
NM_020482chr61839 ------
NM_020532chr2187 ------
NM_020630chr102204 92 1484 ----
NM_020640chr322068 413 11808 ----
NM_020647chr811757 ------
NM_020651chr241557 574 557 513 ------
NM_020653chr173375 151 35 ------
NM_020673chr20107517 7121 5117 4762 1765 1471 1079 978 206 188 26196 5266 47251 6043 5154 1017 11220
NM_020689chr2021746 1550 ------
NM_020699chr194989 4524 4368 4302 4251 3887 1294 425 407 --169 --
NM_020711chr232243 1820 434 52199 1770 1054 231 181 ----
NM_020713chr2071260 1057 998 983 831 436 77 --22169 864 12039
NM_020717chrX63934 1298 1195 1081 980 59 23847 3382 24266 367 24049 3985
NM_020718chr16105390 4897 4567 4151 2563 2180 2129 1547 905 75 56191 5870 4863 1297 1282 15463 --
NM_020727chr2131562 563 48 23210 495 ----
NM_020728chr773198 3143 2914 2862 2691 1258 910 11038 ----
NM_020732chr6------11185
NM_020734chr122156 71 1383 ----
NM_020739chr1564106 3454 3174 3096 1322 1081 ----21294 1255
NM_020740chr171127 ------
NM_020742chrX42091 1967 1842 590 --21908 212 --
NM_020747chr51177 ------
NM_020748chr1711977 1493 ----
NM_020750chr63978 556 113 11520 ----
NM_020752chr1072928 2582 2117 941 667 614 438 ------
NM_020766chrX11520 ----14033
NM_020768chr562897 1118 913 700 597 52 --12187 --
NM_020769chrX4750 689 662 94 1999 1116 --
NM_020772chr1797770 6912 5261 2849 2807 830 365 249 26 12956 ----
NM_020773chr462631 2456 2166 1673 1060 580 --11070 --
NM_020774chr1866177 6148 4656 2383 1173 911 35594 4214 2274 ----
NM_020779chr242782 1255 1012 552 --12576 21047 112
NM_020782chr1261768 1703 1593 683 639 189 ------
NM_020783chr1821822 1518 4833 760 713 159 11597 22252 318
NM_020791chr1711334 11418 178 1561
NM_020792chr372664 2555 829 422 156 41 24 --1228 --
NM_020796chr522246 451 ----1416
NM_020802chr11123083 3023 2848 2736 2508 2211 924 875 750 404 391 250 22757 2290 --1950
NM_020804chr692119 2033 1957 1945 1865 1803 912 826 400 --11015 11687
NM_020805chr1861757 1703 1498 1298 476 203 21663 333 --1564
NM_020808chr12803 155 1921 ----
NM_020813chr1952926 2589 833 697 110 22212 297 12020 --
NM_020818chr141372 ------
NM_020819chr61165 --1493 --
NM_020824chr102244 100 ------
NM_020825chr1663818 3795 3372 3053 2922 288 23324 1093 ----
NM_020830chr262633 2004 918 546 339 244 ------
NM_020832chr12694 126 --1171 --
NM_020834chr142600 49 1230 1774 1721
NM_020839chr351192 1102 1035 381 38 ------
NM_020841chr1254052 3990 3401 1134 384 13742 ----
NM_020844chr8107637 6770 6225 5821 5550 3004 2850 2807 1044 913 --66654 6616 5010 2605 2122 1394 15894
NM_020845chr1282371 1984 916 796 595 418 340 247 --11846 2701 457
NM_020856chr1921458 509 --11216 --
NM_020859chr443234 2481 1047 463 44066 3744 3564 592 ----
NM_020860chr4------1846
NM_020861chr6--1973 ----
NM_020865chr31435 1503 ----
NM_020868chr231670 414 367 ------
NM_020871chrX41851 1683 456 174 31987 1631 721 ----
NM_020888chr171909 1694 1394 1352 127 121 98 1252 --151
NM_020899chr1741739 342 306 299 12094 ----
NM_020918chr1052941 2705 1054 312 192 2264 217 1222 --
NM_020921chr1483329 1392 1316 1292 682 573 89 72 1981 ----
NM_020925chr141467 1310 282 95 ------
NM_020935chr254677 4359 3652 1103 508 33271 3097 2824 ----
NM_020940chr1022322 815 1260 ----
NM_020946chr92702 198 1599 ----
NM_020948chr153537 3410 3339 3012 1453 ------
NM_020951chr1942443 2194 1750 1621 --21713 1578 11555
NM_020964chr1844698 3125 1340 318 44051 1938 952 806 33485 3450 388 --
NM_020973chr41231 ----182
NM_020975chr1041842 1566 1334 151 --1614 --
NM_020977chr461953 1827 1478 747 500 415 21837 488 1103 --
NM_020980chr1551694 1261 1178 679 237 ------
NM_020983chr1261554 1547 657 260 252 97 22130 1527 11681 --
NM_020987chr101993 ------
NM_020988chr1641098 132 106 23 ------
NM_020993chr1272650 1751 1052 871 443 206 68 --12126 --
NM_021003chr14290 59 2672 140 ----
NM_021005chr151238 ------
NM_021019chr121139 ------
NM_021020chr893146 3127 2903 2798 2681 2524 1065 870 752 23240 536 2727 377 12691
NM_021033chr1363448 2826 2767 2613 1025 229 22547 926 ----
NM_021038chr353401 3266 3163 1216 1047 12835 ----
NM_021064chr621384 257 21608 1536 11272 --
NM_021069chr432162 1623 1509 --2580 348 --
NM_021072chr532445 896 293 22090 615 ----
NM_021076chr221404 ------
NM_021079chr1763045 2916 2586 1278 1114 903 2727 535 --1828
NM_021083chrX123444 3394 3003 2958 2697 2371 2323 2279 1375 884 375 184 --12220 --
NM_021090chr2294971 4663 4268 4156 3819 1274 1065 1015 62 --34804 3704 912 --
NM_021096chr2263214 3107 2324 2253 1197 881 ----12224
NM_021116chr7109046 8858 7481 7445 6495 6324 5900 3042 2234 1257 16029 33403 2334 1132 18384
NM_021120chrX53012 2828 2644 1018 777 13179 ----
NM_021136chr14--1132 ----
NM_021140chrX1438 --2291 123 --
NM_021145chr71862 --158 --
NM_021148chr732290 1623 1538 --2951 913 12205
NM_021155chr1982973 2893 2674 2664 2176 1178 64 52 --32967 649 346 2800 688
NM_021159chr431303 1282 553 ------
NM_021160chr61182 ------
NM_021183chrX32396 189 87 32448 2146 751 ----
NM_021190chr11288 ------
NM_021191chr1262374 1882 923 898 778 596 1849 ----
NM_021194chr1--1273 ----
NM_021202chr2082734 2630 1965 1933 1212 706 523 86 --12144 12414
NM_021215chr2032323 532 73 1133 31756 729 158 1120
NM_021224chr93388 373 131 130 ----
NM_021240chr91163 ------
NM_021252chr1021739 551 11404 ----
NM_021255chr1474135 3612 3525 3314 1519 1406 280 1623 11610 --
NM_021572chr62413 295 ------
NM_021574chr22102454 2410 2334 2226 1962 1844 977 906 81 47 --22063 735 --
NM_021620chr61776 ------
NM_021622chr1031763 859 324 1807 ----
NM_021627chr3--31161 1141 882 ----
NM_021629chr394527 3797 3273 1967 1801 1490 1074 240 58 24685 3709 ----
NM_021633chr121298 387 --11308 --
NM_021635chr641966 1799 1436 193 11348 --1112
NM_021638chr4115042 4629 3875 3464 3111 3063 1768 1262 876 662 222 14458 23996 3071 24464 26
NM_021643chr241906 1327 387 142 ------
NM_021647chr454623 4472 3278 3220 2902 24080 1276 ----
NM_021648chr622348 1762 12583 21786 967 --
NM_021705chr621094 546 1438 1350 --
NM_021722chr7147 ------
NM_021723chr7147 ------
NM_021724chr171191 ------
NM_021728chr142974 200 --1651 --
NM_021738chr101198 125 1661 --
NM_021783chrX41688 344 269 33 1677 ----
NM_021813chr675082 4772 1012 906 849 504 61 25748 4874 ----
NM_021911chr5105483 5351 4485 3994 2002 1932 1399 280 246 59 35214 4493 1477 ----
NM_021912chr1563593 3585 2925 2884 2816 1332 13263 --21447 1378
NM_021914chr144937 576 377 159 --1909 --
NM_021931chr2021149 810 ------
NM_021935chr32930 114 ------
NM_021940chr631387 578 265 ------
NM_021942chr41102 1209 ----
NM_021951chr9--1757 ----
NM_021954chr1373352 3223 3193 2664 1197 1134 401 --11466 --
NM_021960chr12111 88 21953 461 1787 --
NM_021961chr11187092 7054 6293 6010 5839 5690 5594 5332 4688 2871 1870 1482 1474 1174 1128 685 575 383 55473 2379 2208 733 99 --14899
NM_021962chr1772475 2277 2269 2222 759 499 50 --1461 22018 195
NM_021964chr346629 5521 1505 1210 14775 --14358
NM_021970chr42123 65 ------
NM_021973chr4--1675 ----
NM_021977chr673763 3403 2578 2411 685 673 329 1133 ----
NM_021979chr142148 27 1287 ----
NM_021988chr2051581 1306 1191 473 250 21520 103 ----
NM_021998chrX21025 226 11377 ----
NM_022037chr2------1862
NM_022048chr1576271 6244 4995 4107 2489 633 488 11322 ----
NM_022051chr13499 451 132 ----1194
NM_022062chr112708 251 11646 11924 --
NM_022073chr142612 515 21037 324 1103 --
NM_022079chr103639 358 125 ------
NM_022085chr611030 --21486 1415 11529
NM_022087chr72638 501 1569 ----
NM_022093chr12703 327 ------
NM_022133chr821750 1437 --11319 --
NM_022137chr1441434 497 272 67 --11713 --
NM_022140chr522127 1866 52026 1530 894 373 92 2396 223 11980
NM_022143chr721453 58 ------
NM_022144chrX1154 ------
NM_022166chr16165447 5245 5051 4921 4532 4231 3919 2137 1943 1524 1055 684 665 621 345 178 --25223 4112 11902
NM_022169chr1141314 1256 572 163 177 1982 --
NM_022170chr721104 53 21781 1545 ----
NM_022173chr2------1862
NM_022343chr931133 297 71 --1938 --
NM_022351chr873306 3023 1317 1091 577 567 254 --32880 2788 556 12842
NM_022362chr10135 ------
NM_022442chr2051581 1306 1191 473 250 21520 103 ----
NM_022454chr83893 350 24 ------
NM_022459chr1376121 5358 2472 1620 406 204 167 35743 4376 869 15885 --
NM_022462chr19103385 2731 2627 1396 1379 1135 771 746 212 176 93794 3097 2968 2533 2394 1282 1113 565 48 113774 3266 3123 3027 2433 1257 1001 963 804 740 708 --
NM_022465chr1242281 1003 816 545 22470 122 ----
NM_022469chr183394 3209 2790 2712 642 602 469 448 --33063 2588 543 --
NM_022473chr1574417 4106 3692 1523 1363 1241 690 24115 1048 1895 --
NM_022475chr42665 503 1608 ----
NM_022477chr2021446 121 11324 31347 1212 1174 11487
NM_022491chr12103577 3478 3078 2941 2795 2287 1101 313 177 114 11416 1202 --
NM_022497chr372871 2765 2643 2472 1214 1048 316 23203 2709 1909 1613
NM_022650chr52910 227 --2238 177 1878
NM_022652chr122911 252 11161 ----
NM_022659chr82538 489 ------
NM_022716chr132137 2122 2012 22538 431 23003 588 --
NM_022737chr19------21153 273
NM_022739chr17----155 1390
NM_022753chr142690 1021 857 388 ------
NM_022755chr931747 530 441 12055 1171 --
NM_022758chr672999 2909 2852 1212 1086 715 698 22922 2884 ----
NM_022763chr332881 2858 2655 ------
NM_022771chr121702 1832 ----
NM_022780chr251571 1495 1307 317 136 ----11680
NM_022781chr93850 844 365 ------
NM_022802chr1051656 1559 1537 1465 435 11372 1223 --
NM_022824chr51594 1247 ----
NM_022826chr21881 ----1776
NM_022832chr44984 898 538 351 ------
NM_022841chr151513 12475 ----
NM_022842chr3102735 2281 2218 2152 1198 915 611 256 234 198 --12515 1141
NM_022843chr1321485 1170 ------
NM_022844chr165789 780 335 148 26 1356 1798 --
NM_022845chr1632267 733 575 ----1126
NM_022893chr233156 3066 596 1816 ----
NM_022894chr231308 130 115 ------
NM_022898chr1464356 4242 2987 763 646 139 11085 11824 14216
NM_022918chr1122153 808 192 ----
NM_022977chrX21888 1695 --156 --
NM_023009chr12526 520 --1611 --
NM_023010chrX2798 639 ------
NM_023016chr262818 2090 1927 1760 1031 779 ------
NM_023018chr171517 1259 1005 446 393 352 68 ------
NM_023037chr131154 ------
NM_023914chr33522 325 23 --1569 --
NM_023923chr1113733 3646 2998 2493 2327 1421 1252 955 812 448 217 --63228 3015 2843 2709 2671 466 22820 2656
NM_023943chr3183 ------
NM_024007chr573155 3020 1960 1178 860 674 153 22010 935 ----
NM_024050chr191189 ----1139
NM_024052chr1762751 2442 1093 752 365 285 --22637 2375 --
NM_024077chr92597 317 1573 ----
NM_024086chr1793583 3431 3383 3170 2861 2697 1197 1115 701 1535 11485 --
NM_024104chr191748 11085 2396 105 --
NM_024117chr92341 22 --11081 --
NM_024122chrX1191 ------
NM_024294chr672999 2909 2852 1212 1086 715 698 22922 2884 ----
NM_024312chr1221445 1233 21642 1347 11199 11184
NM_024315chr73431 375 90 ------
NM_024332chrX2731 327 2673 340 ----
NM_024336chr16189 ------
NM_024408chr163381 1467 1302 649 566 94 ------
NM_024410chr81132 ------
NM_024423chr1833931 2864 2588 1422 --14197
NM_024424chr1111239 1100 1123 --
NM_024425chr1111239 1100 1123 --
NM_024426chr1111239 1100 1123 --
NM_024491chr31606 ------
NM_024496chr141203 ------
NM_024511chr483003 2850 2500 2385 1304 1217 640 545 32418 2319 1384 42171 537 433 395 --
NM_024513chr332538 1135 704 43830 3593 2910 22 32817 364 297 --
NM_024524chr343199 771 605 457 ------
NM_024529chr121120 473 ------
NM_024539chrX1165 ------
NM_024541chr1061828 1667 1465 1419 1247 287 21661 344 41179 673 635 24 --
NM_024548chr321460 1215 1621 11497 11120
NM_024551chr1222395 2179 --32071 1734 113 12256
NM_024551chr1222395 2179 --32071 1734 113 12256
NM_024581chr61236 ------
NM_024586chr1297 66 1225 1669 --
NM_024594chr531837 1666 1259 --1228 11462
NM_024595chr141227 812 146 96 137 ----
NM_024596chr885207 5003 4533 2094 1776 1191 1010 530 34582 3843 1933 53721 2133 338 300 284 --
NM_024607chr884279 3956 1687 1667 1573 1332 1258 102 11457 --13467
NM_024612chr173939 867 395 ------
NM_024613chr851591 1252 1199 126 51 --11850 --
NM_024617chr92940 105 ------
NM_024624chr231659 610 174 --1511 --
NM_024629chr4--2838 456 ----
NM_024639chr682880 2816 2778 2725 1174 718 600 365 52108 1055 424 284 77 ----
NM_024646chr183900 2984 2818 2525 2482 1296 997 942 --22644 2612 --
NM_024665chr393381 1720 1489 1474 1305 1130 874 710 344 24488 3591 --11225
NM_024674chr142762 2682 898 251 12314 32205 2167 2054 1804
NM_024686chr12578 222 ------
NM_024713chr1531652 1348 168 11387 ----
NM_024719chr13173 ------
NM_024721chr821848 498 1247 12300 --
NM_024740chr11113604 3582 3319 2829 2727 1568 1473 1423 507 414 326 --23044 3006 12991
NM_024749chr151929 1898 1726 918 349 --11802 --
NM_024755chr156689 594 327 210 82 45 ------
NM_024761chr994354 3988 3602 1608 1601 1173 448 279 174 24742 4622 24265 1831 --
NM_024770chr2126373 5639 5443 5322 4852 4720 2377 2166 1997 1718 846 729 36512 4817 1342 34840 1645 1533 11000
NM_024772chr12405 370 ------
NM_024814chr72370 57 ------
NM_024817chr15124940 4930 3702 2392 1746 1713 1206 1138 1114 765 683 118 1479 15246 --
NM_024830chr561928 1720 1529 453 74 59 --21583 333 --
NM_024834chr1051652 1368 1306 747 576 ------
NM_024835chr171271 ------
NM_024859chrX31095 803 44 ------
NM_024871chr34919 584 425 276 ----21413 198
NM_024884chr1464347 3324 796 627 414 293 44006 3785 1153 203 53688 1681 1176 1040 1002 --
NM_024911chr13784 738 644 1300 ----
NM_024930chr552689 2601 2255 2231 2092 11888 42246 1786 1748 1732 --
NM_024946chr1631190 692 140 ----11649
NM_024947chr3129636 9222 7739 7611 7417 7279 6211 3859 3807 2173 1409 1192 49007 8281 7631 7530 38304 8130 7380 --
NM_024949chr465039 4787 1688 793 348 233 13445 24833 1578 --
NM_024953chr1262717 2643 2156 1990 1889 103 1676 --1357
NM_024960chr20131 ------
NM_024989chr2137735 7689 6523 6303 5005 3116 2970 2860 2406 2096 1907 1533 1345 --45997 2295 2257 1470 --
NM_025054chr854018 3180 2898 1375 736 13166 11255 13537
NM_025073chr144246 4162 3847 415 14605 33979 3941 3689 --
NM_025074chr473019 2718 2157 2124 2113 632 77 ----12054
NM_025133chr211040 --1278 --
NM_025138chr1341489 1018 334 67 ------
NM_025140chr123572 398 257 159 1484 --
NM_025146chr332145 1886 1873 1866 ----
NM_025151chr852153 1936 1557 811 590 11843 11996 --
NM_025160chr111020 21260 1156 ----
NM_025179chr194700 4476 4445 3919 3880 3529 3408 701 430 44987 4130 3363 876 14390 --
NM_025181chr21254 --158 --
NM_025187chr1631317 1011 854 ----11105
NM_025191chr132720 914 784 13024 13082 --
NM_025195chr821641 1339 2627 23 21268 1196 --
NM_025208chr1172181 2053 1986 887 638 142 40 --1188 --
NM_025211chr9140 ------
NM_025227chr201323 --1307 --
NM_025235chr101278 --11404 --
NM_025250chr762995 2805 2755 2251 1846 320 11000 52878 2771 2350 2048 38 --
NM_025256chr6------1211
NM_025257chr61358 ----159
NM_030576chr1762655 2609 2577 1750 1008 419 --21768 246 1634
NM_030621chr1494248 3202 3047 2784 1301 698 678 377 222 11014 ----
NM_030623chr241752 417 201 46 --1296 --
NM_030625chr1032299 822 264 ----1958
NM_030627chr553542 3227 1571 975 270 13388 177 11350
NM_030629chr162758 216 --11302 --
NM_030636chr792048 1887 1806 917 803 748 737 517 165 11988 ----
NM_030637chr141224 ------
NM_030647chr745303 5274 4832 1316 25436 222 ----
NM_030648chr485098 4948 4755 4502 2036 1087 606 481 --24631 4265 --
NM_030650chr264259 4094 3974 3774 3098 1469 12982 13940 13623
NM_030657chr191261 ----124
NM_030660chr142564 435 --11434 --
NM_030664chr1052441 2391 1521 955 192 12310 ----
NM_030665chr17--1372 21194 318 --
NM_030674chr1255719 2329 1925 805 774 44780 3744 2186 1129 166 --
NM_030751chr1041766 1718 499 86 2290 217 ----
NM_030751chr1041766 1718 499 86 2290 217 ----
NM_030759chr101676 1555 ----
NM_030763chrX3856 233 99 ------
NM_030766chr123930 853 309 1728 ----
NM_030767chr952742 2715 2353 2033 1863 1271 12132 12536
NM_030780chr81374 --31072 611 573 --
NM_030782chr5135 ------
NM_030786chr151721 1459 1406 270 44 ------
NM_030791chr1421270 271 ------
NM_030799chr562166 1731 891 649 348 275 ------
NM_030806chr1178686 7714 7684 7668 7591 7470 7430 7223 6880 6095 5748 5736 3206 1572 378 333 247 29012 2980 --13464
NM_030810chr611030 --21486 1415 11529
NM_030816chr123372 747 22483 843 ----
NM_030881chr2212190 12032 1294 --
NM_030885chr33715 180 77 1218 ----
NM_030912chr102348 190 --2938 841 1618
NM_030915chr252303 2293 1785 1747 317 ------
NM_030918chr163548 3429 1711 1429 1326 1072 11160 44697 2081 1120 535 --
NM_030922chr154726 677 530 110 1193 ----
NM_030934chr131818 1809 1282 1637 ----
NM_030938chr173747 116 97 ------
NM_030952chr151345 1057 979 938 419 11042 21018 883 --
NM_030958chr8198 ------
NM_030964chr553128 2451 982 628 92 13347 --23556 1042
NM_030965chr12550 65 ------
NM_030966chr17125 --1105 --
NM_030979chr13--1147 ----
NM_031157chr122487 452 ------
NM_031208chr162787 732 ------
NM_031216chr1842011 1408 124 102 --11733 --
NM_031243chr731871 933 364 ------
NM_031267chr72357 167 --1544 --
NM_031268chr1685246 5207 4821 4507 3871 3431 1152 125 11146 ----
NM_031284chr153282 129 48 3867 708 385 ----
NM_031314chr1472015 1964 1470 1297 751 607 309 ----1387
NM_031362chr242510 2298 1870 741 1353 ----
NM_031365chr242646 2434 2006 877 1489 ----
NM_031366chr242646 2434 2006 877 1489 ----
NM_031371chr121377 211 --11112 --
NM_031371chr121377 211 --11112 --
NM_031372chr421539 1397 1257 ----
NM_031411chr531817 1811 55 22084 115 ----
NM_031442chrX32911 928 233 --1327 12421
NM_031445chr243401 824 476 215 --2511 384 --
NM_031453chr102801 22 12064 --167
NM_031468chr788106 4989 2634 2070 1908 1864 1713 1407 35374 5010 303 15646 12059
NM_031469chr653789 2918 2502 1555 1342 23104 936 --11074
NM_031483chr2072781 2350 825 732 624 402 209 22906 2802 --11014
NM_031844chr143515 2673 1273 43 1207 ----
NM_031845chr233474 3172 2262 1113 22809 2791 --
NM_031847chr233474 3172 2262 1113 22809 2791 --
NM_031849chr531817 1811 55 22084 115 ----
NM_031857chr531817 1811 55 22084 115 ----
NM_031858chr1731287 627 394 1276 --2617 282
NM_031860chr531817 1811 55 22084 115 ----
NM_031862chr1731287 627 394 1276 --2617 282
NM_031890chr2282812 2496 2405 2063 2005 1152 798 246 22285 672 1362 --
NM_031914chr142686 339 ------
NM_031935chr141074 1061 1042 95 1846 ----
NM_031990chr19--11006 141 --
NM_031991chr19--11006 141 --
NM_031992chr721104 53 21781 1545 ----
NM_032012chr985254 5240 4812 3653 1681 1506 964 125 1796 --13499
NM_032013chr2021446 121 11324 31347 1212 1174 11487
NM_032021chr111425 21147 856 ----
NM_032041chr862567 2528 1960 1725 988 823 ------
NM_032042chr562377 2146 1050 1035 921 433 ------
NM_032047chr3161 --12154 --
NM_032102chr1162341 2102 558 380 326 229 12289 ----
NM_032105chr1127643 7225 7214 5813 5423 2857 2432 1925 1849 1576 1317 735 47874 5628 5192 899 22290 435 26155 3021
NM_032121chrX72853 2078 2053 1735 1031 218 84 12243 ----
NM_032124chr183985 187 26 ------
NM_032144chr251463 1280 501 289 218 31603 1587 173 ----
NM_032147chr1221017 285 177 ----
NM_032154chr1021108 159 ------
NM_032160chr1864386 3342 2866 1267 683 634 31746 1620 357 33831 3728 3690 --
NM_032174chr141463 522 382 38 11318 --11440
NM_032182chr104573 439 427 150 ------
NM_032189chr1384926 4544 4473 4269 4263 4073 4014 3921 --23906 3322 --
NM_032199chr1093715 3627 3551 3189 2966 1345 1274 882 341 21055 468 12977 --
NM_032211chr101458 1871 ----
NM_032217chr411267 ------
NM_032221chr2011914 1592 ----
NM_032226chr92843 61 ------
NM_032239chr431323 1203 1176 ------
NM_032256chr122966 371 --140 --
NM_032268chr1653294 2964 1266 1213 439 12021 1504 --
NM_032283chr161442 739 606 439 247 198 11864 11181 21742 651
NM_032288chr312207 ------
NM_032295chr73945 512 115 1168 11363 --
NM_032299chr11130 ------
NM_032352chr1421020 531 21357 1030 ----
NM_032373chr10105582 5292 4244 4142 4084 2076 1701 1436 1371 683 34511 1630 1337 ----
NM_032382chr162504 388 ------
NM_032408chr74952 515 260 137 11278 ----
NM_032424chr1111104 1549 ----
NM_032438chr621157 398 ----11088
NM_032439chr1011472 --1469 --
NM_032440chr1042967 2344 1810 533 ----11058
NM_032444chr1641067 814 753 28 --3404 366 350 11022
NM_032445chr1542390 2353 2329 351 11901 1588 --
NM_032446chr543714 3246 3189 1114 ----1739
NM_032449chr1112730 2706 2563 2342 2315 2092 1950 1924 712 184 31 11852 11873 --
NM_032457chr453216 3190 2743 2407 1565 166 --1691
NM_032458chrX32469 848 809 23176 2623 12408 --
NM_032471chr61822 1399 ----
NM_032482chr1942622 1888 361 273 1967 11718 --
NM_032499chr1551506 1218 604 573 404 1102 ----
NM_032505chr362812 1964 1737 907 427 393 --1968 --
NM_032521chr2053181 1298 1093 772 335 1428 31085 990 604 1567
NM_032538chr692465 2177 1828 1801 1748 988 798 772 88 22200 959 32360 515 405 32026 488 284
NM_032547chr41508 --1992 --
NM_032552chr941575 1543 580 126 --21733 1479 --
NM_032558chr941354 1018 424 346 ------
NM_032560chr141754 1987 1120 --
NM_032574chr21107 ------
NM_032581chr741243 504 50 28 ------
NM_032594chr144956 736 213 81 ------
NM_032604chr2157 ------
NM_032632chr1451902 1492 764 127 44 ----1259
NM_032682chr342872 2728 2403 437 22927 648 ----
NM_032711chr1784326 4154 3839 3754 3381 3276 535 139 --13801 --
NM_032765chr521002 795 1897 ----
NM_032793chr11276 ------
NM_032801chr1162303 1664 860 837 672 467 12546 12240 11859
NM_032802chr15184 ------
NM_032804chr1032071 740 126 11927 ----
NM_032813chr131293 1361 11021 1747
NM_032818chr962543 2099 1933 888 830 264 1370 2997 691 --
NM_032828chr19124901 4681 3877 3483 3366 3344 3211 1015 571 551 416 212 34228 953 363 104116 4078 3061 1752 1717 1313 1275 840 802 251 23046 1260
NM_032829chr1221098 855 ----1180
NM_032833chr142221 1826 533 515 22171 1072 21712 1674 --
NM_032837chr1772122 1614 1484 1476 671 70 63 ------
NM_032838chr1941092 484 295 131 ------
NM_032839chr31419 1111 ----
NM_032858chr1----147 --
NM_032867chr111510 ----1230
NM_032873chr1154579 3633 3615 3516 1533 24021 3192 ----
NM_032876chr1422070 1736 2751 185 ----
NM_032883chr204916 900 762 220 --1157 --
NM_032906chr44232 217 188 41 1789 1172 --
NM_032961chr441351 918 440 67 ----177
NM_032968chrX63754 3283 1452 1107 881 680 22898 1293 ----
NM_032969chrX63754 3283 1452 1107 881 680 22898 1293 ----
NM_032973chrY63746 3278 1452 1107 881 680 22893 1293 ----
NM_032975chr1863566 2423 1419 1339 414 123 --13242 1136
NM_032978chr1851142 987 450 386 26 ------
NM_032979chr1851142 987 450 386 26 ------
NM_032980chr1863566 2423 1419 1339 414 123 --13242 1136
NM_032981chr1851142 987 450 386 26 ------
NM_032982chr782558 2409 2169 871 739 632 215 119 11860 11682 12268
NM_032998chr1--11138 ----
NM_032999chr71115 1277 1907 --
NM_033000chr71115 1277 1907 --
NM_033001chr71115 1277 1907 --
NM_033020chr154468 4296 3658 1393 419 13411 --1663
NM_033029chr31404 ------
NM_033030chr231170 1103 242 11406 ----
NM_033044chr1----1859 --
NM_033055chr12288 206 ------
NM_033056chr102263 33 2552 159 ----
NM_033071chr63535 457 269 1242 ----
NM_033081chr2011451 21104 491 ----
NM_033083chr362490 2118 1281 980 601 510 4700 537 431 353 --1201
NM_033103chr193505 390 170 11065 31088 952 914 --
NM_033116chr14--149 ----
NM_033127chr1----167 --
NM_033132chr1342132 931 498 63 ----1739
NM_033133chr1753172 1505 1214 479 115 13046 1586 11207
NM_033135chr1172181 2053 1986 887 638 142 40 --1188 --
NM_033136chr52313 149 21341 1331 ----
NM_033137chr52313 149 21341 1331 ----
NM_033143chr4104303 4151 3974 3861 3632 3061 1620 1534 1067 660 22901 1814 ----
NM_033181chr673579 3290 3045 2953 2867 343 268 1602 12573 --
NM_033201chr1631057 1016 387 ----1969
NM_033215chrX2349 340 ------
NM_033221chr962563 1757 1050 145 136 32 2691 401 ----
NM_033224chr795326 5160 2388 1792 1783 1684 569 217 178 26824 5407 47428 6711 6673 2891 --
NM_033225chr843185 2001 1107 935 1566 1121 --
NM_033254chr34592 562 507 398 ------
NM_033261chr103480 378 153 --1142 --
NM_033274chr583163 2986 2950 2821 2636 1252 144 126 22888 1025 ----
NM_033284chrY1146 ------
NM_033285chr884506 4478 4251 3932 3649 1257 1042 437 11128 ----
NM_033290chrX73455 3264 1419 1324 605 346 268 1101 1330 --
NM_033315chr1761781 1501 708 696 663 275 ----11683
NM_033331chr943324 3054 2425 644 ------
NM_033360chr1273983 3491 3177 1828 1813 1139 1022 --11441 11266
NM_033364chr341987 1950 1434 651 ------
NM_033380chrX187 ------
NM_033381chrX187 ------
NM_033389chr1764697 4203 3986 3356 1684 492 1240 --14257
NM_033394chr241438 1218 221 159 ------
NM_033407chr11611 ------
NM_033419chr1731680 1216 172 11081 2318 99 11583
NM_033427chr73575 232 31 1209 ----
NM_033429chr1542454 2187 419 22 12030 ----
NM_033430chr443548 2575 1405 138 23834 722 ----
NM_033437chr443548 2575 1405 138 23834 722 ----
NM_033495chrX----11053 --
NM_033512chr882961 2837 2477 2144 2061 1187 493 166 1803 11002 --
NM_033535chr431176 804 446 1751 --1136
NM_033542chr2071847 1436 1307 581 303 240 195 ------
NM_033626chrX51604 664 612 591 342 --11464 11449
NM_033632chr421513 597 --11537 --
NM_033644chr531879 1655 142 1799 22118 1639 --
NM_033645chr531879 1655 142 1799 22118 1639 --
NM_033656chr2185583 4263 3838 1924 1712 1517 712 416 --14928 --
NM_052845chr1263237 3023 2486 2177 2037 118 ------
NM_052867chr1331275 1048 78 ------
NM_052875chr1132056 1852 115 --21834 248 --
NM_052876chr192944 261 11780 1377 1589
NM_052877chr12441 43 ------
NM_052879chr1243890 3876 3754 812 2775 28 ----
NM_052885chr1254907 3895 3627 3327 104 ------
NM_052896chr11280 ------
NM_052898chr821868 1633 1763 ----
NM_052901chr971776 1574 1421 1364 555 536 50 11414 --11617
NM_052904chr641426 1312 1249 1118 ------
NM_052905chr251451 1437 1397 430 86 ------
NM_052911chr181762 1790 ----
NM_052913chr61963 1428 ----
NM_052918chr1053324 3257 1429 1010 29 22931 2668 ----
NM_052927chr542238 2140 1493 308 ------
NM_052934chr131450 274 183 42259 2218 1810 1477 1734 11918
NM_052937chr83967 608 366 1409 --12531
NM_052950chr133811 802 193 ----11673
NM_052971chr53354 347 107 ----1403
NM_052978chr1431570 763 199 --1580 --
NM_053002chr3--2851 303 ----
NM_053016chr9227891 7450 7432 7314 6842 5805 5653 5606 5057 4924 3071 3012 2338 2306 2194 2158 1696 1580 967 669 226 34 31956 1115 62 ----
NM_053023chr1142995 2948 481 331 --11006 --
NM_053025chr321621 575 --11094 --
NM_053026chr321621 575 --11094 --
NM_053027chr321621 575 --11094 --
NM_053028chr321621 575 --11094 --
NM_053031chr321621 575 --11094 --
NM_053032chr321621 575 --11094 --
NM_053043chr745682 4692 4560 4532 15044 25761 1378 12356
NM_053064chr14127 22576 876 ----
NM_053275chr12121 ------
NM_053281chrX1284 1421 ----
NM_054016chr141687 738 572 356 21518 649 11966 --
NM_054016chr141687 738 572 356 21518 649 11966 --
NM_054016chr141687 738 572 356 21518 649 11966 --
NM_054025chr1152002 1604 1428 146 21 --21676 1463 --
NM_054033chr22426 122 1241 ----
NM_054035chr171600 ------
NM_057089chr72329 191 ------
NM_057164chr23523 459 59 ------
NM_057165chr23523 459 59 ------
NM_057166chr23523 459 59 ------
NM_057167chr23523 459 59 ------
NM_057175chr421727 738 1936 ----
NM_057178chr1742715 2175 1961 1792 12264 ----
NM_057180chr121395 ------
NM_057749chr831336 1191 988 ----11133
NM_058170chr141659 1008 545 192 1663 ----
NM_058240chr1421327 140 21307 132 ----
NM_058241chr221958 1713 42137 1774 1601 629 11490 --
NM_058241chr221958 1713 42137 1774 1601 629 11490 --
NM_078470chr1032728 2573 122 42407 2069 834 394 2723 685 --
NM_078483chr583943 3695 3581 2623 1395 1367 931 158 43453 3351 1417 72 1791 11058
NM_078487chr993153 2923 2783 2749 2588 2471 770 665 467 13029 ----
NM_080283chr171210 21192 333 ----
NM_080538chr341358 579 229 214 11189 199 --
NM_080539chr341358 579 229 214 11189 199 --
NM_080541chr341358 579 229 214 11189 199 --
NM_080546chr9----1246 12198
NM_080597chr182785 408 ------
NM_080599chr1041220 1092 1005 232 --2882 166 --
NM_080632chrX2798 639 ------
NM_080645chr651955 1504 800 517 357 31896 285 109 --11649
NM_080658chr11------125
NM_080671chr241582 1545 851 742 --21637 1599 145
NM_080676chr2052839 2433 2392 502 278 --11261 --
NM_080738chr111983 11800 11504 --
NM_080743chr662228 1984 1871 1015 864 138 ------
NM_080759chr1342689 2000 260 103 --12666 --
NM_080760chr1342689 2000 260 103 --12666 --
NM_080764chr2272893 2317 2054 815 538 409 380 154 2551 373 --
NM_080792chr2062272 2131 1944 820 404 255 ------
NM_080821chr2041612 798 602 507 22109 814 --1780
NM_080832chrX3715 610 29 --11850 --
NM_080867chr1475109 3556 3195 1644 1495 751 116 13791 33813 3642 3626 --
NM_080872chr863591 3550 2535 2506 1048 103 13185 11213 --
NM_080921chr1132 1473 1236 --
NM_080927chr333088 853 807 --13374 --
NM_100264chr103725 675 59 ------
NM_100486chr103725 675 59 ------
NM_130387chr321164 227 --3907 881 507 --
NM_130391chr942293 736 196 99 11121 ----
NM_130392chr942293 736 196 99 11121 ----
NM_130393chr942293 736 196 99 11121 ----
NM_130435chr1062974 2953 2935 2367 888 556 ----12263
NM_130436chr2131923 828 542 --12817 --
NM_130438chr2132500 2189 1119 --23394 51 --
NM_130439chr1042330 633 494 192 1667 2757 65 --
NM_130439chr1042330 633 494 192 1667 2757 65 --
NM_130466chr1251786 1477 475 447 228 ----11694
NM_130807chr1942088 1664 582 355 1196 31455 618 598 11450
NM_130811chr2031070 916 411 ------
NM_130846chr123981 869 256 --131 --
NM_133170chr20117864 6195 2829 2729 1775 1574 991 742 624 579 225 25016 3070 27774 478 11817
NM_133264chr1743667 3411 3115 881 23732 927 ----
NM_133265chrX33465 3347 2581 32831 2640 2219 1767 --
NM_133326chr1273 46 1324 ----
NM_133330chr42998 341 13069 --22990 236
NM_133331chr42998 341 13069 --22990 236
NM_133334chr496353 6188 6180 5701 5107 4735 4103 1270 742 26263 1989 43989 3951 3935 676 --
NM_133335chr42998 341 13069 --22990 236
NM_133370chr443584 2963 2627 697 --1481 --
NM_133372chr552969 2924 2098 505 431 --32055 1883 733 --
NM_133378chr24976 345 153 117 ------
NM_133379chr22252 86 ------
NM_133432chr24976 345 153 117 ------
NM_133433chr51344 ------
NM_133437chr24976 345 153 117 ------
NM_133445chr973821 3384 3057 2793 1193 1004 286 ----11159
NM_133468chr742278 1618 1038 238 21889 851 ----
NM_133477chr443003 762 612 532 --2784 651 --
NM_133478chr272008 1850 1617 1597 979 813 269 11803 ----
NM_133493chr684488 3709 3437 1702 1278 1101 1001 447 11862 24445 897 13473
NM_133496chr143856 2848 904 792 34555 3131 740 32981 926 755 --
NM_133509chr1411000 11157 183 1151
NM_133631chr331247 1064 1018 ----1414
NM_133638chr521113 917 2576 484 ----
NM_133647chr1543726 2852 2569 1226 31353 374 145 42624 2586 2345 574 12745
NM_133650chr63535 457 269 1242 ----
NM_134268chr171828 --1121 --
NM_134440chr191137 ------
NM_138270chrX32268 658 120 ------
NM_138286chr1953704 1188 930 291 26 13093 33847 1336 1226 --
NM_138292chr1192755 789 669 495 437 329 312 68 34 1740 12231 --
NM_138316chr101923 1375 126 11105
NM_138324chr151183 --1734 --
NM_138333chr942506 2494 2024 154 42171 2123 1954 1780 11940 --
NM_138375chr183812 456 356 ------
NM_138419chr6238 29 ------
NM_138423chr1522172 472 1664 2527 489 --
NM_138426chr731920 1908 425 22175 1956 ----
NM_138444chr1383148 3047 1898 1729 699 520 212 69 14604 ----
NM_138457chr663072 2414 2310 1261 875 648 194 32797 2659 2621 22792 2774
NM_138468chr2145731 5687 5042 4984 4692 4175 3970 2437 2271 2151 2113 1609 228 133 15029 15671 --
NM_138473chr1275170 4887 4107 4012 3208 1636 286 24899 3787 14807 --
NM_138479chr141878 1805 1689 230 ------
NM_138559chr25957 915 294 141 93 ------
NM_138576chr1464356 4242 2987 763 646 139 11085 11824 14216
NM_138621chr264175 4032 3588 2771 1543 633 --23491 3163 --
NM_138633chr641610 1581 112 39 --1567 --
NM_138638chr144937 576 377 159 --1909 --
NM_138643chr18--174 ----
NM_138644chr18--174 ----
NM_138694chr662772 2710 1404 1069 288 137 13181 21210 531 --
NM_138713chr16117958 7892 7140 6923 6453 6308 6071 5926 5240 5133 1559 27695 7647 ----
NM_138714chr16117958 7892 7140 6923 6453 6308 6071 5926 5240 5133 1559 27695 7647 ----
NM_138730chr6174 ------
NM_138731chr1443993 3507 2833 2614 22963 425 ----
NM_138735chr241423 1071 480 471 11391 ----
NM_138736chr1684170 3274 3243 2892 1625 1581 500 340 1113 1247 --
NM_138782chr522039 1645 ------
NM_138795chr14973 592 543 210 ------
NM_138799chr252081 1915 699 339 54 ----1244
NM_138811chr72980 253 --132 --
NM_138927chr2131046 879 261 1111 ----
NM_138959chr1116658 5726 5333 4875 4678 4302 2487 1456 1402 966 300 25232 776 26487 2332 --
NM_138966chr181402 ------
NM_138970chr1442119 2105 1963 327 21569 1495 ----
NM_138971chr1173536 3511 2758 2710 1080 754 295 2683 283 --11371
NM_138971chr1173536 3511 2758 2710 1080 754 295 2683 283 --11371
NM_138972chr1173536 3511 2758 2710 1080 754 295 2683 283 --11371
NM_138972chr1173536 3511 2758 2710 1080 754 295 2683 283 --11371
NM_138973chr1173536 3511 2758 2710 1080 754 295 2683 283 --11371
NM_138973chr1173536 3511 2758 2710 1080 754 295 2683 283 --11371
NM_138991chr213798 689 637 1223 2349 117 --
NM_138992chr213995 886 834 2420 216 1314 --
NM_139045chr91673 ------
NM_139057chr1572726 2461 2389 1074 1003 459 72 22369 237 ----
NM_139076chr431124 367 206 ------
NM_139135chr141070 989 825 497 ------
NM_139136chr12----11062 --
NM_139167chr81572 --1121 --
NM_139168chr521593 1496 ------
NM_139182chr441362 403 209 52 1319 ----
NM_139207chr1262218 1759 679 587 74 31 11979 ----
NM_139215chr17----1196 --
NM_139242chr1521524 1128 156 51304 1272 337 204 166 11299
NM_139244chr61784 ----128
NM_139265chr1531196 1182 769 --1747 --
NM_139276chr1752393 1846 461 155 129 1902 1914 --
NM_139280chr1761207 1047 961 162 122 91 ------
NM_139312chr1031121 1066 574 21304 1233 ----
NM_139314chr19------1479
NM_139316chr731089 121 49 ------
NM_139318chr141244 ------
NM_139321chr2054241 3128 2918 899 194 --42838 1568 1260 1197 --
NM_139323chr201740 ----1127
NM_144498chr203564 95 75 ------
NM_144563chr22316 106 ------
NM_144563chr22316 106 ------
NM_144567chr142744 2589 2282 810 11949 31837 1799 865 1976
NM_144571chr476445 6130 5839 5691 5562 543 442 36876 5402 700 25282 845 --
NM_144578chr1434350 605 413 21047 823 --1352
NM_144582chr242207 1825 908 533 22430 199 42338 2122 2035 695 --
NM_144583chr241838 1541 432 261 2587 210 1695 11446
NM_144590chr1032651 2258 91 32906 2080 1147 11178 --
NM_144609chr17----11237 --
NM_144629chr281137 1112 1095 1028 1018 906 405 120 --1154 1806
NM_144664chr111574 2524 186 ----
NM_144710chr211499 ------
NM_144721chr411813 2260 61 --12567
NM_144726chr511155 ----3433 278 269
NM_144728chr12858 267 ------
NM_144729chr12858 267 ------
NM_144732chr193809 700 248 ------
NM_144778chr1321905 214 ------
NM_144949chr232157 1818 406 12045 ----
NM_144963chr862410 2113 1991 944 593 234 11672 ----
NM_144967chrX11053 1349 ----
NM_144973chr12115127 4999 4789 4487 4135 4084 3958 3371 1871 718 33 54891 4320 4015 1493 754 24020 1563 --
NM_144979chr41253 ------
NM_144982chr121199 ------
NM_145008chr111892 ------
NM_145011chr103412 259 114 ------
NM_145036chr171374 ------
NM_145044chr341290 671 480 85 51364 1209 697 206 190 11387 --
NM_145049chr5150 ------
NM_145055chr1853294 2882 2751 784 256 ------
NM_145056chr192841 745 ------
NM_145102chr73464 139 27 ----173
NM_145117chr1142944 2338 262 106 22880 590 2695 147 --
NM_145159chr141158 --1643 --
NM_145176chr673373 3301 1293 1259 814 293 146 33161 2455 177 23103 329 12934
NM_145203chr133910 338 194 --1934 --
NM_145206chr1083269 3141 2175 1135 1028 769 666 513 32955 2939 1008 12119 --
NM_145239chr164420 395 302 283 --2337 218 --
NM_145247chr102552 42 --2184 146 --
NM_145251chr1431541 494 141 ------
NM_145253chr162475 272 1257 ----
NM_145259chr2105986 5054 5005 4990 4979 4419 2489 2162 438 29 1887 1192 --
NM_145263chr432300 1669 867 31892 497 91 ----
NM_145266chr5148 ------
NM_145274chr172751 22 1946 --2729 365
NM_145307chr1034610 3882 1282 44134 1751 1621 1207 ----
NM_145320chr763124 3067 2436 2385 1347 1226 12702 21305 374 --
NM_145321chr763124 3067 2436 2385 1347 1226 12702 21305 374 --
NM_145322chr763124 3067 2436 2385 1347 1226 12702 21305 374 --
NM_145331chr61776 168 --1244
NM_145332chr62924 658 1216 --1392
NM_145333chr62924 658 1216 --1392
NM_145341chr101220 1724 ----
NM_145686chr243041 2889 2127 1322 22746 125 ----
NM_145687chr243041 2889 2127 1322 22746 125 ----
NM_145690chr821647 679 ------
NM_145698chr1012164 22123 48 1218 11444
NM_145714chr16--1279 ----
NM_145733chr2221133 1011 ------
NM_145735chr1372652 2234 1787 794 728 106 46 --1837 --
NM_145753chr351635 1324 1052 184 45 ------
NM_145756chr1841586 1391 86 37 --1428 --
NM_145759chr152113 2040 1755 1746 145 ------
NM_145808chr722174 233 ----11182
NM_145861chr111983 11800 11504 --
NM_145888chr1931336 305 129 2807 368 2600 276 --
NM_145891chr1621162 22 ------
NM_145892chr1621162 22 ------
NM_145893chr1621284 144 ------
NM_145912chr2284622 3699 3062 3004 2896 1631 1358 367 1889 44078 3819 3728 392 --
NM_145913chr121740 ------
NM_147147chr664073 3809 2774 1623 1108 797 22689 460 31126 684 305 --
NM_147150chr973635 3067 2557 880 652 403 259 --1335 --
NM_147156chr102205 123 ------
NM_147175chrX41610 1511 468 395 1189 ----
NM_147223chr25962 434 276 159 93 12099 --12383
NM_147233chr23779 251 93 21916 881 --12200
NM_148174chr861889 1838 1819 1558 1541 88 32098 1875 1614 ----
NM_148416chr16--1279 ----
NM_148894chr411051 ----11029
NM_148898chr73953 919 888 1900 ----
NM_148899chr73953 919 888 1900 ----
NM_148904chr1297 66 1225 1669 --
NM_148905chr1297 66 1225 1669 --
NM_148906chr1297 66 1225 1669 --
NM_148907chr1297 66 1225 1669 --
NM_148908chr1297 66 1225 1669 --
NM_148909chr1297 66 1225 1669 --
NM_148923chr18190 ------
NM_148957chr1321656 306 42006 1832 659 191 1664 --
NM_148977chr101923 1375 126 11105
NM_148978chr101923 1375 126 11105
NM_152238chr11130 1139 ----
NM_152253chr2284344 3478 2768 1514 855 429 359 58 22713 1010 12954 32949 1069 878
NM_152261chr1252052 1963 1715 810 384 1710 ----
NM_152263chr1105784 5496 4260 3857 1666 1533 1212 726 139 95 36061 2365 195 45677 2388 2253 2215 --
NM_152265chr121432 1417 ------
NM_152275chr272399 2288 2128 1940 1476 552 143 22040 1620 22069 1822 --
NM_152277chr522054 437 ------
NM_152280chr122316 2202 51124 869 808 455 91 2343 305 22771 2434
NM_152289chr191531 --11206 21595 1560
NM_152298chr11754 188 ----
NM_152342chr161440 --129 --
NM_152352chr1863016 2768 2584 2398 1111 727 22536 794 11151 --
NM_152365chr11346 ------
NM_152371chr151917 1850 1762 540 114 1338 ----
NM_152384chr22494 410 21926 163 4780 729 626 468 --
NM_152387chr22300 200 ------
NM_152388chr263714 3559 1294 1161 571 411 21556 1347 13071 --
NM_152390chr22150 99 --2660 158 --
NM_152407chr573273 2226 1289 1106 1072 825 812 22578 2516 1724 --
NM_152414chr83285 273 186 ------
NM_152420chr92631 293 1588 --199
NM_152424chrX74735 4644 4181 1204 1043 713 467 1994 11535 --
NM_152442chr1241409 1233 1183 1010 1881 ----
NM_152450chr1521989 730 --1455 --
NM_152451chr151822 ------
NM_152470chr1864145 2678 2638 1523 1364 565 --13495 1914
NM_152493chr151400 1034 242 122 113 ------
NM_152519chr22264 229 21714 1689 ----
NM_152529chr2103418 3309 1774 1648 1606 1467 1079 687 601 433 21220 108 197 --
NM_152546chr541455 1288 1137 311 ----1120
NM_152553chr61142 1574 ----
NM_152554chr61529 1230 ----
NM_152574chr9--1394 --164
NM_152581chrX21157 591 11520 ----
NM_152588chr124498 261 203 65 11366 21551 1392 --
NM_152594chr152781 402 ------
NM_152608chr132067 1711 52 --3802 731 597 --
NM_152622chr563095 2234 2222 1042 580 94 1766 ----
NM_152624chr546107 5080 4660 187 44536 2149 1418 1235 16816 12565
NM_152629chr963830 3182 2926 1514 847 603 32667 386 260 13903 12508
NM_152682chr411411 11325 --11685
NM_152699chr393204 3192 3158 2499 1257 1028 786 502 63 63368 2987 2913 2327 1169 1088 2667 513 --
NM_152733chr6146435 6224 6217 6026 5452 4902 3944 2166 1299 1232 786 714 241 123 22580 1087 35305 4968 4854 --
NM_152744chr7103553 3498 3061 2663 2635 2403 730 301 195 42 1295 23050 3038 1536
NM_152745chr72450 414 ------
NM_152753chr631610 1510 1345 21551 1337 ----
NM_152756chr544324 2993 1648 814 64023 3546 3520 586 567 69 1180 12728
NM_152758chr832110 391 209 1759 --1542
NM_152765chr852078 845 765 305 61 ------
NM_152774chr721751 488 31862 537 447 --11904
NM_152780chrX4442 309 278 188 ------
NM_152787chrX42555 1216 91 66 11312 13193 --
NM_152789chr711383 ------
NM_152792chr2122 ------
NM_152793chr785030 3950 3437 3204 1812 1682 1272 45 15164 24094 1151 --
NM_152835chr152843 2385 872 796 549 21805 973 1380 --
NM_152836chr821750 1437 --11319 --
NM_152837chr821750 1437 --11319 --
NM_152854chr20--1646 ----
NM_152857chr61176 1806 ----
NM_152858chr61176 1806 ----
NM_152890chr121285 990 1129 ----
NM_152903chr134776 610 438 122 11064 22770 200 --
NM_152914chr17154358 4340 4013 3817 3516 3162 2996 2907 2895 1558 1096 1060 1045 431 291 13740 34049 4039 3591 13311
NM_152924chr1596654 5801 5633 5467 4391 2178 2107 1745 1309 1106 31871 1838 632 --
NM_152989chr1231631 634 297 1155 --1161
NM_152996chr121748 350 2568 414 --1818
NM_152998chr72238 56 ------
NM_152999chr7104997 4897 4233 4077 3943 3734 3342 1434 1186 415 ------
NM_153000chr184571 404 254 203 ----1226
NM_153013chr522218 1624 11995 21773 1735 --
NM_153020chr621237 560 1283 ----
NM_153035chr163245 3079 2931 1147 626 323 ------
NM_153038chr23678 273 215 1580 --1540
NM_153040chr152656 269 1509 2243 24 --
NM_153047chr61141 ------
NM_153048chr61141 ------
NM_153050chr2294971 4663 4268 4156 3819 1274 1065 1015 62 --34804 3704 912 --
NM_153051chr2294971 4663 4268 4156 3819 1274 1065 1015 62 --34804 3704 912 --
NM_153181chr181402 ------
NM_153188chr575359 4630 4503 1907 1266 1158 68 --15459 --
NM_153207chr1283801 3786 3101 3016 1583 817 778 273 12770 ----
NM_153255chr61709 1908 ----
NM_153256chr1031299 595 274 11545 ----
NM_153260chr1561500 1423 1247 1003 76 48 126 ----
NM_153261chr1611371 1300 ----
NM_153262chr122975 2652 --1115 --
NM_153273chr342331 2183 2168 598 --1681 --
NM_153341chr11360 ------
NM_153346chrX51760 775 483 136 84 --1213 --
NM_153350chr1641284 1127 637 161 21697 1205 11250 11666
NM_153354chr52642 303 ------
NM_153365chr42914 236 11986 1194 --
NM_153367chr1093985 3692 1086 872 533 428 389 343 326 --33774 3761 2845 13639
NM_153371chr1342001 1597 844 212 1799 2718 584 1531
NM_153456chr1375729 5706 5621 5063 4271 4166 1177 2893 646 26257 1568 --
NM_153487chr644803 757 421 335 34562 3426 814 34755 3064 30 11412
NM_153499chr1282801 2480 2135 2008 1116 876 651 209 1899 1119 --
NM_153500chr1282801 2480 2135 2008 1116 876 651 209 1899 1119 --
NM_153605chr331187 1108 1086 1587 21327 139 11299
NM_153607chr512966 1440 ----
NM_153619chr1552670 2215 1085 995 238 --1312 12702
NM_153620chr711779 11108 11145 192
NM_153640chr20131 ------
NM_153645chr2223181 154 13277 ----
NM_153686chr432235 452 359 12413 ----
NM_153707chr91118 ------
NM_153712chr242579 864 304 232 22798 1119 ----
NM_153748chr12----11062 --
NM_153769chr18--174 ----
NM_153819chr111224 ------
NM_153825chr411554 ------
NM_153828chr2187 ------
NM_153831chr81114 ------
NM_170600chr9162 ------
NM_170606chr7--1489 ----
NM_170607chr172236 49 21140 326 21418 976 --
NM_170665chr1254069 3959 3698 1532 913 14122 --13480
NM_170674chr1521181 1055 ------
NM_170675chr152857 731 ------
NM_170676chr152857 731 ------
NM_170677chr1521181 1055 ------
NM_170679chr52995 362 1175 1483 --
NM_170692chr121017 145 ------
NM_170696chr1541737 1364 631 31 ------
NM_170697chr1541737 1364 631 31 ------
NM_170706chr133534 3100 1426 --33403 790 669 24121 616
NM_170709chr881835 1700 1518 935 682 276 259 59 ------
NM_170710chr442435 1104 938 456 32983 880 157 ----
NM_170719chr1341489 1018 334 67 ------
NM_170721chr173307 297 286 ------
NM_170731chr1152545 2338 465 205 152 --11862 --
NM_170732chr1152545 2338 465 205 152 --11862 --
NM_170733chr1152545 2338 465 205 152 --11862 --
NM_170734chr1152545 2338 465 205 152 --11862 --
NM_170735chr1152545 2338 465 205 152 --11862 --
NM_170743chr1184 42517 2444 2198 2123 52330 2292 2276 1818 466 --
NM_170768chr1151770 1524 1486 203 121 --11117 --
NM_170782chr13506 470 188 ------
NM_171825chr563213 2876 1221 667 517 418 1565 --32193 289 180
NM_171998chrX32099 787 118 11711 195 --
NM_172037chr851473 1345 1124 528 125 ------
NM_172071chr196892 6292 5466 4731 2787 2773 692 559 76 15584 42374 2312 2274 2180 27337 1482
NM_172103chr631047 741 706 22156 1947 ----
NM_172105chr631047 741 706 22156 1947 ----
NM_172159chr342391 1856 777 701 --2934 112 --
NM_172160chr342391 1856 777 701 --2934 112 --
NM_172164chr11754 188 ----
NM_172169chr1062007 1979 1240 729 595 505 --147 --
NM_172170chr1062007 1979 1240 729 595 505 --147 --
NM_172171chr1062007 1979 1240 729 595 505 --147 --
NM_172173chr1062007 1979 1240 729 595 505 --147 --
NM_172216chr1292703 2382 2037 1910 1189 1018 778 553 111 1801 121 --
NM_172218chr81168 --1880 --
NM_172226chr1282801 2480 2135 2008 1116 876 651 209 1899 1119 --
NM_172315chr1521181 1055 ------
NM_172316chr1521181 1055 ------
NM_172337chr142974 200 --1651 --
NM_172373chr1321132 1006 ------
NM_172388chr1851693 1589 1122 151 23 ------
NM_172389chr1851693 1589 1122 151 23 ------
NM_173064chr1184 42517 2444 2198 2123 52330 2292 2276 1818 466 --
NM_173065chr142272 781 468 407 43214 3141 2895 2820 53027 2989 2973 2515 1163 12295
NM_173075chr421131 80 2654 276 1397 11403
NM_173076chr2------123
NM_173078chrX2312 72 ------
NM_173083chr13823 118 86 ------
NM_173156chr141796 1400 872 366 --1602 --
NM_173167chr1772491 2335 1998 1952 1725 573 438 --12037 --
NM_173171chr21193 ------
NM_173172chr23501 314 198 ------
NM_173173chr21193 ------
NM_173198chr952952 2666 2390 499 167 ----12178
NM_173200chr952952 2666 2390 499 167 ----12178
NM_173214chr16117958 7892 7140 6923 6453 6308 6071 5926 5240 5133 1559 27695 7647 ----
NM_173353chr124691 452 192 82 ------
NM_173354chr2111956 3664 175 51 ----
NM_173359chr341904 1698 1436 314 11366 ----
NM_173454chr1531047 409 150 ------
NM_173462chr1461654 1366 542 437 266 246 31200 550 153 4749 711 573 402 1744
NM_173463chr484534 4485 3588 1612 1502 1378 1371 668 1438 62964 2826 2788 1524 1073 407 --
NM_173468chr474361 4202 4099 1987 1334 982 538 23697 2147 23720 1059 --
NM_173470chrX22905 679 ------
NM_173471chr321010 247 ------
NM_173473chr1062538 2310 2161 2141 1688 545 1741 11013 --
NM_173495chrX22482 451 11645 12551 --
NM_173496chr1052764 1054 236 155 110 1230 12448 --
NM_173500chr151386 21237 354 --11195
NM_173508chr12958 213 163 ----
NM_173510chr2252955 1976 1949 1916 524 31843 1794 1047 21070 898 --
NM_173511chr243115 2600 584 44 1592 31519 1481 1465 --
NM_173515chr6--1897 2411 69 186
NM_173531chr1952545 1548 1463 628 318 33548 3008 2465 43571 3428 3390 1401 --
NM_173546chr31606 ------
NM_173552chr342491 1868 1654 376 31995 1930 922 1652 --
NM_173554chr10--134 ----
NM_173557chr182620 37 ------
NM_173576chr102575 104 ------
NM_173582chr1175346 4855 4294 3893 1487 937 74 24161 4042 ----
NM_173595chr1285116 4764 3821 3811 3442 2044 764 707 --34344 1626 1406 --
NM_173602chr1262959 2846 1196 1050 835 58 32613 2445 858 ----
NM_173623chr174676 653 609 592 1616 1530 1510
NM_173654chr35848 778 563 420 80 --2525 358 --
NM_173694chrX32555 1589 897 ------
NM_173794chrX2191 139 ------
NM_173797chr531157 1016 391 1308 ----
NM_173808chr174227 3996 3650 1202 765 289 63 --11253 --
NM_173809chr1051436 1278 1093 217 176 1204 11310 --
NM_173825chr372896 2500 2089 1983 1059 124 87 --2811 467 --
NM_173829chr5156055 5294 5091 5056 4809 4473 4403 4319 4072 3833 1647 1399 716 507 105 56201 6138 5323 2309 1458 ----
NM_173851chr883746 3060 2913 2861 2614 2540 1455 1414 23657 3415 12627 --
NM_173854chr182394 2135 1918 1820 1778 1650 1592 335 11693 1832 1500
NM_174856chr201239 --123 --
NM_174890chr102731 209 1772 ----
NM_174911chr843331 3179 1489 298 --1601 13167
NM_174916chr153967 808 210 1760 1569 --
NM_174938chr91131 ------
NM_175038chr121254 ------
NM_175056chr352027 1605 1508 589 515 12104 ----
NM_175607chr31641 --11434 1671
NM_175610chr1521419 1092 21405 287 ----
NM_175612chr31641 --11434 1671
NM_175624chr1267498 6943 5481 2402 2077 1489 26616 6588 27540 6151 11928
NM_175625chr1267498 6943 5481 2402 2077 1489 26616 6588 27540 6151 11928
NM_175736chr12147583 6980 6389 6324 6177 5984 5469 5046 4971 2705 1713 1318 1117 279 32224 1236 847 27689 1472 25488 5134
NM_175767chr5--1101 1554 11712
NM_175847chr19--11006 141 --
NM_175848chr2021281 226 11275 ----
NM_175848chr2021281 226 11275 ----
NM_175849chr2021281 226 11275 ----
NM_175849chr2021281 226 11275 ----
NM_175850chr2021281 226 11275 ----
NM_175850chr2021281 226 11275 ----
NM_175854chr1322122 1045 12205 12691 --
NM_175861chr1275684 2150 1999 1701 1412 952 520 --13654 21872 23
NM_175863chr6------11185
NM_175873chr561190 1157 1130 487 475 127 197 ----
NM_175876chr14675 401 394 105 --1433 --
NM_175907chr182637 202 32877 2296 938 12503 --
NM_175921chr542934 1532 1518 1347 63076 2848 1430 1373 1189 373 --11248
NM_175929chr131136 ------
NM_176823chr163489 3430 3414 1528 1350 1142 --13093 --
NM_176880chr191346 1440 1445 --
NM_176894chr33522 325 23 --1569 --
NM_177398chr132003 768 418 11440 1311 --
NM_177399chr132003 768 418 11440 1311 --
NM_177402chr1--1884 1160 180
NM_177414chr141511 1379 1252 1159 ----172
NM_177438chr1494248 3202 3047 2784 1301 698 678 377 222 11014 ----
NM_177452chr1442398 2187 1543 254 11762 1714 --
NM_177524chr711183 ----11170
NM_177525chr711183 ----11170
NM_177952chr14290 59 2672 140 ----
NM_177966chr331858 1724 1366 2556 89 2406 390 --
NM_177968chr232148 1769 1686 ----1222
NM_177969chr2147 ------
NM_177974chr1522172 472 1664 2527 489 --
NM_177990chr2021750 644 ------
NM_177999chr962327 1268 612 358 335 263 21346 897 --12294
NM_178010chr1231631 634 297 1155 --1161
NM_178011chr1073137 2755 2730 2653 1088 731 503 23005 47 ----
NM_178013chr1482650 2056 1203 645 556 416 174 128 ------
NM_178037chr12103646 3486 2525 2317 1033 698 607 572 481 446 21453 472 11458 1844
NM_178038chr12103646 3486 2525 2317 1033 698 607 572 481 446 21453 472 11458 1844
NM_178123chr21849 ------
NM_178126chr1742232 1737 1573 1505 1667 4878 841 825 550 --
NM_178135chr471389 1191 1126 512 468 381 230 --11014 --
NM_178140chr532630 2170 119 --12752 --
NM_178151chrX117499 7177 6940 5796 5466 4969 4851 2382 2367 1123 584 47323 3003 2848 2141 24986 708 1503
NM_178152chrX117499 7177 6940 5796 5466 4969 4851 2382 2367 1123 584 47323 3003 2848 2141 24986 708 1503
NM_178153chrX117499 7177 6940 5796 5466 4969 4851 2382 2367 1123 584 47323 3003 2848 2141 24986 708 1503
NM_178171chr171704 1114 2