TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-378a-5p
miRNA Sequence: CUCCUGACUCCAGGUCCUGUGU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX55978 5687 5594 198 183 22542 221 16654 --
NM_000926chr1128289 8026 67046 6487 2670 2198 1777 634 23791 61 --
NM_001001928chr2298326 8220 6868 5188 3317 2938 1878 1788 224 47603 5877 2319 764 23059 1885 --
NM_001003800chr973680 3045 2924 2535 694 436 203 33171 2404 553 11016 --
NM_001005473chr546505 4171 2464 2386 24020 1285 14951 1232
NM_001010891chr535652 4386 866 32082 474 159 14912 1690
NM_001018065chr945047 1563 1540 255 14868 --12085
NM_001018066chr945047 1563 1540 255 14868 --12085
NM_001031732chr423286 3114 43056 1311 872 863 --12698
NM_001040001chr611516 11589 --31391 1345 1293
NM_001042599chr277551 6488 5082 2520 2498 2474 996 31720 1241 976 1241 15420
NM_001099678chr346389 5335 4909 1611 --14806 25104 4467
NM_001100108chr1108179 7024 5881 3272 2679 2543 2384 1484 1455 475 21635 1344 26123 5481 --
NM_001106chr378962 8363 3721 3691 2823 2786 2607 21031 396 12887 1943
NM_001527chr654706 3899 3534 1522 1078 33920 1496 1042 ----
NM_002006chr454666 3638 1477 769 534 25504 3685 --14864
NM_002481chr177286 7141 6623 6224 2221 2087 1436 77056 5951 5009 2892 2668 2515 565 12117 15971
NM_002959chr164246 4086 3732 2999 1739 912 2695 79 --11685
NM_003099chr1596291 5412 5344 4228 4188 1046 985 789 302 22047 315 11728 --
NM_003559chr1783298 3162 3000 901 109 62 56 48 ------
NM_003574chr1814542 24304 418 14589 15629
NM_003644chr1776056 5784 5573 2289 1018 575 395 26616 861 65984 5843 5706 1446 627 430 26166 2264
NM_004171chr1189236 9128 7539 3351 3142 3078 2716 2310 37490 3125 733 28673 1888 --
NM_004815chr133550 3291 1096 23714 912 --13086
NM_005036chr2298326 8220 6868 5188 3317 2938 1878 1788 224 47603 5877 2319 764 23059 1885 --
NM_005235chr277551 6488 5082 2520 2498 2474 996 31720 1241 976 1241 15420
NM_005504chr1245921 5843 1553 648 44076 2583 915 585 11511 --
NM_005840chrX46328 2257 984 107 11406 36798 2778 136 15338
NM_006599chr1637650 2837 1011 56359 5358 4985 1978 1002 15698 12319
NM_006838chr1211694 1635 11524 21383 262
NM_006914chr921409 576 1106 --11187
NM_007050chr20127949 6780 6764 6688 6462 6274 6230 6156 5922 486 391 86 23040 2959 ----
NM_014155chr1136727 2457 2289 13029 15483 27473 2420
NM_014331chr457132 6722 6277 6247 2599 42635 1106 755 707 35454 1416 264 --
NM_014730chr1275263 3311 1856 1518 1347 682 413 ----24945 4699
NM_014730chr1275263 3311 1856 1518 1347 682 413 ----24945 4699
NM_014739chr643821 3578 1619 684 13586 --12607
NM_015344chr831461 1449 286 --1465 1356
NM_016206chr3108960 7754 7427 5843 5778 3218 2532 1397 1292 69 23252 367 --1328
NM_016526chr1172492 2066 1846 973 930 899 892 ----1290
NM_016577chr344306 4139 2822 132 44270 3094 770 169 34017 3876 3613 1986
NM_018440chr846910 6740 6314 529 47787 7462 2992 1661 16208 --
NM_018708chr1941450 1274 294 111 1481 1444 21542 252
NM_020651chr2--21595 684 --21609 539
NM_020772chr1747887 7738 3268 1477 15888 --12690
NM_022484chr721102 1035 1257 --21363 1346
NM_024524chr332472 855 60 145 --1562
NM_024770chr296339 5792 5259 4889 4192 2088 817 714 640 22396 1266 11982 --
NM_030647chr735488 1951 1122 45511 4628 3827 1844 1260 15320
NM_030806chr189131 7785 7087 6741 3732 3483 2924 1378 48454 6999 2653 961 13303 17644
NM_032373chr1031244 954 173 11385 13962 11405
NM_032873chr1154532 3863 997 726 447 ----11083
NM_133170chr20127949 6780 6764 6688 6462 6274 6230 6156 5922 486 391 86 23040 2959 ----
NM_133370chr423286 3114 43056 1311 872 863 --12698
NM_138713chr1637650 2837 1011 56359 5358 4985 1978 1002 15698 12319
NM_138714chr1637650 2837 1011 56359 5358 4985 1978 1002 15698 12319
NM_138959chr165698 5253 4632 1386 1131 491 45770 5198 1887 406 --16415
NM_145207chr494654 4622 4481 4160 4102 3870 1877 1506 1079 14832 --14903
NM_148955chr1596291 5412 5344 4228 4188 1046 985 789 302 22047 315 11728 --
NM_152455chr1542664 2534 1096 117 62868 2682 2581 2472 1921 104 12201 --
NM_152826chr1596291 5412 5344 4228 4188 1046 985 789 302 22047 315 11728 --
NM_173214chr1637650 2837 1011 56359 5358 4985 1978 1002 15698 12319
NM_173642chr178060 8046 7999 2821 2745 2039 525 11093 25760 2775 29001 8189
NM_194434chr1814542 24304 418 14589 15629
NM_198859chr354873 4149 3115 1825 344 23745 3722 --24562 1222
NM_199320chr422597 952 12122 --2725 569
NM_199320chr422597 952 12122 --2725 569
NM_201432chr1776056 5784 5573 2289 1018 575 395 26616 861 65984 5843 5706 1446 627 430 26166 2264
NM_201433chr1776056 5784 5573 2289 1018 575 395 26616 861 65984 5843 5706 1446 627 430 26166 2264
NM_203394chr1252422 2086 1708 931 550 22720 446 --12184