TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-379-3p
miRNA Sequence: UAUGUAACAUGGUCCACUAACU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX65159 4803 711 543 265 147 25929 4830 1215 --
NM_000091chr282892 2870 2813 2686 2439 1824 1783 268 --22821 1091 1784
NM_000092chr2104460 4158 3995 3772 3417 3345 1664 1283 1243 322 14585 ----
NM_000108chr731868 344 163 2602 177 --11179
NM_000109chrX82210 2127 2103 1007 521 388 347 294 1573 --1716
NM_000168chr752362 449 420 229 141 1997 11280 --
NM_000217chr1274450 4109 4004 3649 1530 982 478 --23720 152 --
NM_000259chr1586301 5688 2237 2161 1854 1667 884 743 21528 247 --11730
NM_000297chr431678 701 81 31998 1905 153 11729 --
NM_000314chr1093265 2767 2609 2346 2161 2142 2066 1293 112 22397 2388 ----
NM_000332chr652202 900 380 141 90 36009 4976 1812 15267 15391
NM_000441chr751595 1542 920 807 235 2893 561 22212 2043 --
NM_000448chr1163241 3086 2970 2762 537 405 22404 476 2608 56 1596
NM_000462chr1531335 1257 1164 11873 --1271
NM_000489chrX63442 3222 2192 2165 1252 1132 43431 2846 389 374 23129 729 12799
NM_000495chrX31066 1014 839 1285 --1742
NM_000555chrX107431 7228 6663 6015 5557 2516 1259 1241 1204 816 27183 363 1307 --
NM_000618chr12126610 6529 6264 6183 6107 5864 5616 4488 2280 692 513 337 16195 26391 926 --
NM_000618chr12126610 6529 6264 6183 6107 5864 5616 4488 2280 692 513 337 16195 26391 926 --
NM_000633chr1895131 4862 3882 3524 3426 1723 1476 493 236 21729 587 12068 --
NM_000686chrX71272 1042 632 526 515 394 339 ------
NM_000719chr1286666 5065 2501 1903 1574 1543 1376 742 24885 1885 15178 16014
NM_000782chr2051182 1142 286 219 167 ----1942
NM_000809chr499267 9209 7822 7342 6918 6752 5958 2875 851 47933 5685 2743 2309 28294 3030 --
NM_000813chr5115442 5262 5238 4577 4453 4058 2013 1902 1395 1262 1202 24203 2025 ----
NM_000860chr43296 96 49 1466 11723 11658
NM_000868chrX42558 2504 1838 457 22463 122 21960 386 --
NM_000875chr1576566 6256 5661 5241 2642 2436 1615 36966 6869 1190 --16821
NM_000885chr272180 2063 1723 1618 1414 1354 847 11851 1819 --
NM_000891chr1742726 1053 425 71 13673 --1601
NM_000902chr362959 2850 2422 2072 2059 753 2728 523 ----
NM_000945chr261891 1832 1581 1564 806 595 41625 1616 473 335 ----
NM_000950chrX103570 3288 3240 3148 3014 2722 2394 1062 555 161 1992 12923 --
NM_000963chr162289 1801 859 277 72 31 12195 11610 --
NM_001001419chr593811 3798 1034 979 930 810 601 86 26 15213 34818 4289 3908 --
NM_001001420chr593811 3798 1034 979 930 810 601 86 26 15213 34818 4289 3908 --
NM_001001481chr893456 3410 2450 1018 998 880 614 510 447 1595 23268 2461 --
NM_001001664chr284106 4018 3889 3830 3004 2905 1504 141 ----12706
NM_001001890chr2174287 3346 1323 1170 963 830 530 31293 564 554 13490 --
NM_001003652chr18128564 7979 7948 7838 3294 2724 2688 2555 1848 1510 1128 427 58594 6469 6102 371 354 1806 --
NM_001003674chr1895882 5526 2589 2016 790 779 626 583 162 64789 4765 2621 1608 754 410 35904 5410 5286 16888
NM_001003675chr1895882 5526 2589 2016 790 779 626 583 162 64789 4765 2621 1608 754 410 35904 5410 5286 16888
NM_001003712chr12103941 3649 3345 3288 3245 2824 2676 2626 1251 683 43485 2901 1240 622 ----
NM_001003760chr693241 3192 2697 2559 2392 1025 800 322 276 ------
NM_001004317chr674450 4218 3975 3752 458 162 39 43873 464 322 281 ----
NM_001005473chr52487 447 15689 1609 14298
NM_001007075chr451031 814 799 715 416 11051 --1762
NM_001008239chr1843692 2695 668 536 --12860 13767
NM_001008405chr741677 1510 1454 342 31848 613 455 190 --
NM_001008495chr852273 2024 1569 832 577 12103 1738 --
NM_001008564chr1382191 2143 2134 2113 725 323 245 87 42048 1957 1764 1678 11503 --
NM_001008707chr1461755 1658 716 545 248 238 --1525 11867
NM_001008738chr512601 22794 826 --12549
NM_001009554chr4104256 4208 3931 3688 3135 3089 1670 964 630 606 13129 31893 1170 879 --
NM_001009554chr4104256 4208 3931 3688 3135 3089 1670 964 630 606 13129 31893 1170 879 --
NM_001009899chr3136553 6545 5300 4951 4168 3964 2146 1044 912 817 770 763 239 --11775 --
NM_001009909chr1173976 3147 2947 2751 2741 2551 1082 --13610 13905
NM_001010000chr1842859 1320 866 35 13350 13526 1588
NM_001010853chr643044 2030 854 400 43157 3123 2538 1099 12702 --
NM_001010861chr132560 977 574 1940 22722 584 --
NM_001010888chrX83173 3000 1291 1153 967 874 449 118 23006 1031 ----
NM_001010891chr5116727 6350 2379 2305 1863 1841 1822 1782 1771 1520 41 16303 24370 1647 1619
NM_001010986chrX52434 2409 1899 908 187 11706 11819 1802
NM_001011513chr463398 2794 2636 1355 744 88 --43465 2698 2545 914 --
NM_001011666chr776521 5713 4667 2251 1100 896 693 25461 2035 26449 4994 1171
NM_001012755chrX95053 4170 4145 3707 2032 1903 673 565 124 2946 822 --14266
NM_001012761chr5--1283 --22728 660
NM_001013620chr12107667 7411 7118 7032 6975 6262 5237 2499 1715 122 68351 7562 5856 5832 5494 1274 ----
NM_001013629chr1062140 1632 1473 834 470 273 11978 --11340
NM_001014797chr10106399 6333 5083 3063 2136 1441 1256 1209 992 205 12124 27835 6599 --
NM_001015887chr371837 1353 1233 1209 700 539 107 ----1460
NM_001017371chr241180 1100 192 127 --11214 2474 248
NM_001017434chr13217 211 201 --1632 --
NM_001017923chr1471469 1184 1139 1033 274 215 195 31352 396 158 ----
NM_001018065chr985900 5339 5088 4488 2398 2351 1832 1216 --34439 3785 943 --
NM_001018066chr985900 5339 5088 4488 2398 2351 1832 1216 --34439 3785 943 --
NM_001018067chr194619 4185 3966 1992 1726 1560 716 682 60 35258 618 448 --1597
NM_001018068chr194619 4185 3966 1992 1726 1560 716 682 60 35258 618 448 --1597
NM_001018069chr194619 4185 3966 1992 1726 1560 716 682 60 35258 618 448 --1597
NM_001018090chr1592836 1815 1054 1026 470 353 128 114 46 42859 2367 2289 1781 12361 --
NM_001018091chr15102946 1925 1164 1136 580 463 238 224 156 33 42969 2477 2399 1891 12471 --
NM_001018102chr1592836 1815 1054 1026 470 353 128 114 46 42859 2367 2289 1781 12361 --
NM_001024649chr572140 2127 1863 1006 749 481 403 22736 2662 12260 --
NM_001024948chr153505 3017 2948 2884 799 13031 21403 1336 1823
NM_001024956chr1184875 4591 4380 4188 2357 1283 879 637 14936 25151 4096 --
NM_001025077chr1097574 6394 5349 5073 5003 2582 1884 1564 1314 17415 ----
NM_001025079chr354081 3850 1409 819 146 33965 3746 2728 21548 1084 --
NM_001025366chr611654 41224 410 379 364 ----
NM_001025366chr611654 41224 410 379 364 ----
NM_001025367chr611654 41224 410 379 364 ----
NM_001025367chr611654 41224 410 379 364 ----
NM_001025368chr611654 41224 410 379 364 ----
NM_001025368chr611654 41224 410 379 364 ----
NM_001025369chr611670 41240 426 395 380 ----
NM_001025369chr611670 41240 426 395 380 ----
NM_001025370chr611654 41224 410 379 364 ----
NM_001025370chr611654 41224 410 379 364 ----
NM_001025595chr441631 1420 402 373 --2483 40 11454
NM_001030055chr14104014 3520 3199 1605 1596 1089 434 303 158 118 13857 11317 1899
NM_001031695chr2225041 4241 14690 14753 23859 3392
NM_001031812chr5102245 2010 1815 1541 938 880 836 706 156 37 --1682 21803 355
NM_001033045chr294336 4326 3879 3671 3577 1434 1084 775 175 3955 681 332 ----
NM_001033057chr361951 1827 1647 1405 634 623 ------
NM_001033602chr1352276 2066 2008 874 296 12041 --12695
NM_001033756chr611588 41158 344 313 298 ----
NM_001033756chr611588 41158 344 313 298 ----
NM_001033925chr1041948 1881 767 697 --12188 11628
NM_001034841chr1675304 3892 1757 1524 1185 731 683 33534 2019 1992 1753 13595
NM_001037132chr741519 1488 686 137 ----11587
NM_001037133chr741519 1488 686 137 ----11587
NM_001037317chr132560 977 574 1940 22722 584 --
NM_001037954chr1163433 3140 3046 2886 402 372 21410 1233 13333 --
NM_001039538chr293549 1105 883 601 551 288 261 218 138 12306 179 --
NM_001039590chrX53362 2780 2600 818 343 32459 883 835 ----
NM_001039591chrX53362 2780 2600 818 343 32459 883 835 ----
NM_001039618chr1145456 4405 2231 260 55613 3977 3628 1822 1030 15579 15830
NM_001039693chr293835 3104 3015 1491 1224 1031 753 460 154 12679 12605 13783
NM_001039840chrX75886 5437 4176 4003 2188 1634 1355 44720 648 607 576 --15895
NM_001039937chr1363973 2904 2563 1095 671 78 11546 --1679
NM_001040157chr482743 2525 1916 1910 1053 445 352 141 22220 2162 ----
NM_001040159chr44548 441 196 151 11467 --21338 1136
NM_001040284chr16115888 5215 5206 4390 4088 2230 1192 1051 1021 913 326 65287 3912 1640 1593 568 478 23801 2109 14629
NM_001040402chr483097 2467 2246 2188 2172 2005 798 579 22392 2292 12705 --
NM_001040429chr1363301 2654 1344 1137 1118 1006 --12430 --
NM_001040441chr1105227 4892 4673 4198 3585 3493 1493 996 135 43 65445 4930 4881 4848 1572 673 --13603
NM_001040450chr1572503 2156 1870 1849 330 206 149 12235 --1665
NM_001040453chr1572503 2156 1870 1849 330 206 149 12235 --1665
NM_001040665chr7114792 4360 3973 3822 1717 1624 686 609 565 270 76 --14633 --
NM_001040712chr953595 2946 2867 2445 1400 --13533 1611
NM_001042355chr1675416 5008 4204 4157 3296 1906 525 13934 31976 1828 53 --
NM_001042357chr1021412 1364 ----1254
NM_001042358chr1021412 1364 ----1254
NM_001042360chr1021412 1364 ----1254
NM_001042363chr1021412 1364 ----1254
NM_001042389chr1021412 1364 ----1254
NM_001042390chr1021412 1364 ----1254
NM_001042392chr1021412 1364 ----1254
NM_001042395chr1021412 1364 ----1254
NM_001042412chr1675416 5008 4204 4157 3296 1906 525 13934 31976 1828 53 --
NM_001042413chr954074 2829 1119 619 592 33910 3008 2624 --13531
NM_001042537chrX82390 2350 2004 1808 1700 947 199 122 --12216 --
NM_001042550chr931839 1387 327 41626 259 131 82 ----
NM_001042555chr1284057 3784 3744 3680 3623 3528 3000 969 34292 1435 197 ----
NM_001042599chr277668 2272 1406 873 731 682 612 35860 2108 1574 37832 7246 6210 --
NM_001042601chr363281 3237 3216 3187 2367 2128 1856 ----
NM_001042603chr1264405 4325 1858 1425 152 78 14199 1170 --
NM_001042604chr3104723 4691 3412 2980 1269 1231 1211 1081 411 263 11169 34760 1709 1286 11811
NM_001042683chr671624 1471 1402 476 362 141 69 11792 ----
NM_001044722chr5102245 2010 1815 1541 938 880 836 706 156 37 --1682 21803 355
NM_001044723chr5102245 2010 1815 1541 938 880 836 706 156 37 --1682 21803 355
NM_001046chr552826 2815 2529 811 615 12844 12782 --
NM_001106chr399730 9519 9294 8712 6261 6117 3678 2305 1596 39391 8850 1494 15947 1446
NM_001167chrX96537 6230 5495 4998 4681 1744 1653 1325 525 15143 16557 12271
NM_001173chr14104014 3520 3199 1605 1596 1089 434 303 158 118 13857 11317 1899
NM_001177chr1242313 2054 521 338 1613 32443 957 874 --
NM_001186chr2173211 3099 2939 2907 2344 1226 1107 22567 2388 12857 --
NM_001204chr2197438 7143 6736 6604 6555 6420 5606 5592 5428 5416 5396 5044 2929 2834 2651 2279 1403 1031 39 15710 2263 236 24700 1647
NM_001206chr962890 2589 2416 2410 877 731 ------
NM_001241chr271959 1893 1675 1634 957 514 299 21868 914 ----
NM_001241chr271959 1893 1675 1634 957 514 299 21868 914 ----
NM_001270chr531117 178 76 1358 --11150
NM_001310chr1233060 2678 342 12918 12882 12904
NM_001438chr163561 3200 3150 3050 2314 816 12649 23401 774 --
NM_001527chr674681 3739 3486 3364 966 814 786 --23666 1649 --
NM_001609chr10134474 3731 3570 3493 3474 3131 2734 1505 1335 1290 758 663 566 --34380 4164 2959 24452 711
NM_001621chr762615 2607 2485 2192 1913 969 52990 2513 764 595 195 ----
NM_001621chr762615 2607 2485 2192 1913 969 52990 2513 764 595 195 ----
NM_001663chr1492596 2328 2085 1083 664 593 528 465 446 ------
NM_001742chr731477 1192 648 11833 --11447
NM_001746chr572140 2127 1863 1006 749 481 403 22736 2662 12260 --
NM_001754chr2174287 3346 1323 1170 963 830 530 31293 564 554 13490 --
NM_001755chr1672200 2192 1694 1541 652 573 468 21734 85 --11652
NM_001777chr354081 3850 1409 819 146 33965 3746 2728 21548 1084 --
NM_001821chr174442 4246 4060 3317 1573 571 402 23162 467 --34709 3428 103
NM_001918chr1137484 6842 6537 3551 2574 2310 2293 1841 1515 1320 837 514 91 28783 702 ----
NM_001944chr1842406 1615 783 389 ----12199
NM_002009chr1542586 2347 2165 902 12183 11707 1407
NM_002024chrX51877 1737 759 581 558 21439 702 123 --
NM_002025chrX99108 7261 7154 5834 3446 3346 3272 3147 1735 22339 377 38396 7283 2328 --
NM_002040chr2162337 2309 1015 901 744 517 73138 3041 2024 1218 1073 557 425 ----
NM_002128chr1342256 822 711 409 --1869 1295
NM_002146chr1761181 1132 1074 963 949 394 ------
NM_002158chr263656 3401 3365 2636 2614 1248 33829 3222 258 12557 1580
NM_002203chr584135 3995 3447 1280 1123 289 277 228 13826 ----
NM_002210chr2123097 2902 2810 2623 1433 1350 1157 1001 931 664 640 145 22431 296 ----
NM_002214chr7135252 5064 4749 4718 4554 4518 4474 4459 4359 4031 3892 3844 3477 --13817 --
NM_002239chr251002 744 291 252 174 1277 1972 --
NM_002247chr1062382 2139 2131 1977 921 601 52042 2020 2001 778 128 ----
NM_002264chr374530 4310 4008 3959 3452 534 271 ----13950
NM_002270chr5195643 5329 5003 4092 3756 3569 3493 1989 1936 1915 1618 1283 989 935 772 602 516 433 249 54666 4636 4570 3674 1687 13847 11241
NM_002310chr5136628 6409 5997 5892 5018 5007 4917 4722 4460 4280 1208 852 136 --12590 --
NM_002336chr1234918 3629 3285 74600 3663 3646 1981 1088 903 180 ----
NM_002374chr293549 1105 883 601 551 288 261 218 138 12306 179 --
NM_002381chr22962 325 2998 864 --1738
NM_002397chr561531 689 332 313 293 91 22253 2079 ----
NM_002481chr177487 5282 5186 2715 2544 705 388 15653 12793 17896
NM_002577chr394004 3345 2812 2759 2461 1184 941 289 184 --33847 696 569 --
NM_002581chr995463 5102 4283 3927 3915 3860 2176 1917 751 34938 4920 235 11708 --
NM_002595chr1281923 1624 784 599 391 376 240 165 11244 ----
NM_002623chr205724 494 301 215 166 2525 205 --1488
NM_002641chrX51647 1376 432 418 290 --1508 --
NM_002645chr1163048 2743 1101 631 326 40 22364 1130 ----
NM_002655chr874970 4810 4430 3891 2069 1464 1118 24362 2109 11030 --
NM_002670chr331587 1469 1116 1539 --1117
NM_002709chr273446 3021 2572 2488 2383 566 202 --1249 --
NM_002734chr1772263 1779 1752 1674 1642 633 381 21437 127 11458 11910
NM_002736chr742139 1655 567 123 --11881 11776
NM_002740chr352549 442 345 155 92 22648 1902 1322 --
NM_002745chr22103788 3711 3704 3491 3427 3224 3116 1388 866 545 23151 1803 --11590
NM_002822chr1281837 1801 1699 1456 1382 545 527 160 11784 ----
NM_002839chr953595 2946 2867 2445 1400 --13533 1611
NM_002906chr1152368 2361 1659 1498 1484 11999 12113 --
NM_002977chr2123477 3432 3411 2882 2567 2346 2184 1359 1060 582 566 298 43346 2337 2124 855 13422 --
NM_002990chr1622234 1585 ----21765 797
NM_002994chr431898 730 354 51888 1809 1793 1785 1778 ----
NM_003034chr12117891 6725 6089 5429 5358 2320 1586 1522 1270 781 97 35158 2477 617 13230 --
NM_003071chr331327 490 120 11980 11865 1207
NM_003099chr15136514 6422 6413 6321 6259 5866 4651 2316 1854 1797 1601 1519 1052 46452 6440 1534 827 22163 1891 22539 1625
NM_003108chr277297 6903 6607 6531 4946 4839 1138 --16363 1306
NM_003111chr241180 1100 192 127 --11214 2474 248
NM_003112chr782902 2773 2698 2055 865 818 398 374 22254 882 11134 11971
NM_003155chr872677 2577 2571 2545 2519 622 138 2819 656 12837 --
NM_003199chr1885491 4617 4367 3911 3486 1955 1461 1108 --11947 11866
NM_003201chr104671 375 339 113 1872 --1641
NM_003262chr3105273 4808 4749 4166 3752 1241 1188 1169 1009 290 --25239 141 --
NM_003298chr396121 6084 5957 5590 4867 4063 2230 1921 646 ------
NM_003304chr371498 1371 638 626 619 517 310 21199 62 --11452
NM_003338chr1061313 1219 770 656 458 332 ------
NM_003376chr611654 41224 410 379 364 ----
NM_003376chr611654 41224 410 379 364 ----
NM_003387chr292705 2518 2438 2349 1796 652 562 334 285 22678 2194 ----
NM_003410chrX62750 2586 645 358 287 272 32598 910 863 12110 --
NM_003411chrY91692 1668 1411 1247 695 608 496 481 145 1288 ----
NM_003463chr6103238 3039 2362 1182 1052 705 597 509 175 58 23371 2069 ----
NM_003468chr274234 3988 3744 2650 1512 927 251 13802 1282 --
NM_003478chr1173110 2917 2749 1101 739 233 193 31154 879 105 ----
NM_003506chr85927 884 418 125 42 --2111 86 --
NM_003566chr12103479 3042 2768 2324 1326 1035 508 442 422 103 32775 2728 957 1531 --
NM_003574chr1885067 4812 3549 2187 1738 1197 699 237 24565 1791 ----
NM_003583chr1253214 3084 3013 2940 835 11526 22518 362 --
NM_003590chr253494 3358 3084 1518 1451 24049 3620 1887 23073 3036
NM_003615chr3103908 3263 3145 2829 1239 1212 1182 1012 719 350 33774 1335 1080 ----
NM_003622chr1252231 1821 970 394 249 1493 2357 263 --
NM_003630chr61253 2690 304 --1638
NM_003672chr14723 608 311 305 21330 331 1325 --
NM_003774chr1232656 2500 651 2435 225 22480 2458 --
NM_003794chr331058 909 415 ----1700
NM_003799chr1883661 1205 895 793 559 493 370 179 --14500 23796 425
NM_003800chr651494 853 627 563 403 1318 22355 1960 --
NM_003887chr292206 2048 1997 1901 1451 764 584 571 319 1157 11540 1689
NM_003909chr883037 2966 2384 2150 1089 448 221 130 ------
NM_003913chr6104303 4092 3937 3737 3488 3350 685 384 258 187 21167 808 13101 --
NM_003966chr597782 7186 7068 6538 6332 5430 5337 2916 599 --27224 5405 --
NM_003992chr153210 202 196 ------
NM_004006chrX82210 2127 2103 1007 521 388 347 294 1573 --1716
NM_004007chrX82210 2127 2103 1007 521 388 347 294 1573 --1716
NM_004009chrX82210 2127 2103 1007 521 388 347 294 1573 --1716
NM_004010chrX82210 2127 2103 1007 521 388 347 294 1573 --1716
NM_004011chrX82210 2127 2103 1007 521 388 347 294 1573 --1716
NM_004012chrX82210 2127 2103 1007 521 388 347 294 1573 --1716
NM_004013chrX82210 2127 2103 1007 521 388 347 294 1573 --1716
NM_004014chrX82210 2127 2103 1007 521 388 347 294 1573 --1716
NM_004015chrX82210 2127 2103 1007 521 388 347 294 1573 --1716
NM_004016chrX82124 2041 2017 921 435 302 261 208 1487 --1630
NM_004017chrX82210 2127 2103 1007 521 388 347 294 1573 --1716
NM_004018chrX82124 2041 2017 921 435 302 261 208 1487 --1630
NM_004020chrX82210 2127 2103 1007 521 388 347 294 1573 --1716
NM_004021chrX82124 2041 2017 921 435 302 261 208 1487 --1630
NM_004022chrX82124 2041 2017 921 435 302 261 208 1487 --1630
NM_004023chrX82124 2041 2017 921 435 302 261 208 1487 --1630
NM_004124chr1493532 2539 2225 1387 1312 1104 998 969 203 ------
NM_004171chr11127552 6993 6877 6618 6606 6282 3027 2928 2265 1591 1376 1136 49601 3744 3019 745 36959 3012 641 17888
NM_004232chr1863639 3243 3148 2525 1057 706 1477 11347 --
NM_004330chr1571179 1142 324 281 238 231 106 1266 ----
NM_004338chr1895882 5526 2589 2016 790 779 626 583 162 64789 4765 2621 1608 754 410 35904 5410 5286 16888
NM_004384chr5102245 2010 1815 1541 938 880 836 706 156 37 --1682 21803 355
NM_004392chr1342549 2269 1960 30 22005 637 21727 522 --
NM_004412chr10105665 5121 4739 4470 4140 4085 1634 1563 954 173 ------
NM_004432chr951934 1572 488 437 242 2319 29 11800 --
NM_004434chr1461755 1658 716 545 248 238 --1525 11867
NM_004458chrX42542 1934 1038 981 22171 183 --1562
NM_004459chr1751956 1862 1327 405 149 1649 --21814 482
NM_004464chr4123849 3720 3456 3432 3106 2924 2850 1701 1493 1403 636 563 13196 ----
NM_004501chr163756 2970 2906 1520 934 451 21378 1110 1673 14059
NM_004537chr1231054 239 75 ----11417
NM_004580chr1551491 393 384 370 167 11671 ----
NM_004586chrX65038 4040 1833 1702 416 367 35466 5204 887 --15127
NM_004612chr994482 4439 4335 4010 1526 1385 1130 928 614 11868 11773 --
NM_004685chr1352885 2711 2235 2055 179 2815 427 21206 1067 --
NM_004744chr463942 2738 1310 1085 366 51 33981 2991 966 ----
NM_004745chr846998 4664 1090 334 26931 6881 --12590
NM_004748chr1573417 2945 1595 1117 560 268 138 ------
NM_004768chr151077 402 157 125 115 ----11046
NM_004775chr1881937 741 555 475 451 414 401 392 32413 2126 2035 ----
NM_004834chr253152 2466 2233 1314 1005 22954 166 23118 1282 --
NM_004850chr271727 1433 1312 1103 694 612 572 11465 1645 --
NM_004857chr1494262 3239 3140 3061 2997 1831 1436 853 537 11844 24818 499 14627
NM_004859chr1762974 2542 2396 1061 984 550 --32330 2320 1229 --
NM_004866chr5114038 3275 1973 1875 1597 1495 887 614 594 418 217 43954 3439 1815 750 23454 3186 --
NM_004904chr776521 5713 4667 2251 1100 896 693 25461 2035 26449 4994 1171
NM_004956chr774486 4386 3177 1515 961 719 560 44447 4258 3815 592 1144 --
NM_004985chr12144544 4196 4132 3851 3638 2854 1767 1715 1646 995 963 774 595 527 33421 1658 1366 ----
NM_005010chr741519 1488 686 137 ----11587
NM_005056chr1274649 4569 2102 1669 396 322 132 14443 1414 --
NM_005065chr14115213 5130 4941 4909 2018 1919 1798 1145 939 425 64 11582 ----
NM_005121chr1773165 2837 2601 735 585 480 71 23202 809 43231 3112 1024 900 12692
NM_005156chr995204 4935 4724 4649 4620 4233 3615 1310 482 25090 1335 ----
NM_005160chr2286354 5581 5415 5394 4936 4592 1617 1300 12727 ----
NM_005164chr1252456 1730 1646 918 61 --12576 --
NM_005168chr251658 1649 1134 349 324 --11678 11250
NM_005171chr1241170 1136 1115 358 11097 --1393
NM_005188chr1198102 6027 2582 2083 1858 1560 1166 558 258 27118 883 27455 1205 --
NM_005235chr277668 2272 1406 873 731 682 612 35860 2108 1574 37832 7246 6210 --
NM_005259chr261499 1185 1175 1091 450 248 1953 21528 1159 1412
NM_005358chr1341679 706 409 30 1143 --21631 1527
NM_005359chr1896119 5855 5171 4685 2545 1687 1230 1144 701 --1571 15455
NM_005385chr341697 725 145 23 4794 436 425 317 ----
NM_005433chr1882291 1935 901 534 463 360 139 21 22379 2126 1756 --
NM_005497chr17116017 5686 4440 4003 3990 3809 1492 383 374 231 220 14622 ----
NM_005502chr973231 2743 2562 2417 2369 1229 349 11171 32965 2095 724 --
NM_005504chr1276485 5499 4839 2178 2079 851 134 12644 45094 413 341 69 15520
NM_005587chr155863 817 766 735 97 2904 126 --1173
NM_005596chr9146283 5861 5351 5263 5171 5160 5050 4729 2214 1672 1484 1322 896 440 --66356 5588 4392 4262 1143 361 --
NM_005611chr1641309 1237 468 103 ----1845
NM_005665chr1114851 4759 4523 3935 3390 3238 1949 1398 1318 1108 1089 14474 11729 --
NM_005668chr534240 1541 1299 33962 1428 1305 --14027
NM_005725chr132256 2125 132 1539 --1287
NM_005746chr772746 2656 2432 2416 752 486 354 3688 325 293 21718 996 --
NM_005840chrX86503 6260 5833 4746 2752 1973 1584 884 35818 2903 2829 --15368
NM_005901chr18128564 7979 7948 7838 3294 2724 2688 2555 1848 1510 1128 427 58594 6469 6102 371 354 1806 --
NM_005903chr593811 3798 1034 979 930 810 601 86 26 15213 34818 4289 3908 --
NM_005941chr863944 3892 1470 1360 919 763 --24063 1440 --
NM_005955chr1105340 4569 4316 4068 1580 1300 1291 1265 1223 227 11066 ----
NM_005966chr272216 2020 1498 937 886 255 201 ------
NM_005999chr121424 180 4388 216 202 102 21119 382 11056
NM_006007chr994486 4085 1570 1169 1076 839 622 165 112 34439 2800 1213 13244 --
NM_006047chr2053137 2325 1349 438 194 23166 111 22162 986 --
NM_006095chr4114347 4168 3710 3560 3135 2968 1719 1491 966 942 702 11764 12772 --
NM_006106chr1173293 3214 2817 2536 2288 1065 81 43404 2296 2194 927 23415 473 --
NM_006134chr2151656 1367 1351 1023 120 1177 2284 36 --
NM_006166chr1261762 1747 975 923 472 464 --22566 722 --
NM_006197chr882116 1937 1876 1437 1430 650 430 332 41821 740 365 38 11740 --
NM_006203chr5115144 4558 4185 3728 3544 2108 1785 1251 891 852 624 65409 5031 4061 4009 806 482 1993 --
NM_006206chr492944 2815 2783 2759 2716 2627 2295 2270 785 ------
NM_006251chr5103063 2700 2585 2298 973 357 351 337 277 85 2896 314 --2989 345
NM_006252chr1197487 6678 6468 6291 6054 6006 5774 5700 5273 5195 2604 2501 2336 2099 1792 1722 1313 823 758 47471 7253 5643 749 32629 2520 48 17391
NM_006267chr251632 636 550 173 160 11436 11251 --
NM_006283chr8114927 4900 4876 4260 4230 4094 3720 3665 1995 1919 1436 24241 1205 11513 1194
NM_006315chr433980 3840 1167 14044 --1502
NM_006322chr135607 599 311 303 43 1858 --1945
NM_006359chrX82390 2350 2004 1808 1700 947 199 122 --12216 --
NM_006364chr1451171 1060 976 845 220 21099 958 21262 1230 --
NM_006393chr1054516 1619 958 643 520 24188 3694 21626 770 --
NM_006420chr2063209 2554 2519 2148 1390 494 23388 281 --1197
NM_006457chr463398 2794 2636 1355 744 88 --43465 2698 2545 914 --
NM_006482chr1253214 3084 3013 2940 835 11526 22518 362 --
NM_006544chr1465864 4838 4546 4213 3752 2047 33938 2429 1233 --15985
NM_006575chr1441489 532 428 362 --31184 204 114 --
NM_006599chr16158171 7780 7626 6844 6605 6422 5009 3287 3280 3138 1930 1814 1350 208 169 57429 5247 2797 2042 852 58083 7384 5942 5554 1295 --
NM_006614chr343493 3082 2341 206 53338 1229 876 860 334 ----
NM_006626chr952704 2455 2390 1812 110 42713 2621 263 216 --124
NM_006654chr1284057 3784 3744 3680 3623 3528 3000 969 34292 1435 197 ----
NM_006717chr983007 2689 2643 2413 2111 1286 1020 235 --1821 --
NM_006729chrX85010 4622 4117 1410 1283 1193 850 781 45441 3918 2089 1559 ----
NM_006731chr984427 4361 3818 1661 1430 1329 890 202 13641 ----
NM_006734chr671634 1591 1247 430 411 265 106 1124 1138 --
NM_006775chr6123123 3075 3013 2920 2802 2768 2340 2238 2185 1010 580 567 13005 --12814
NM_006873chr263418 3236 2794 2404 1395 1110 23374 3175 ----
NM_006874chr431256 399 289 ----2374 329
NM_006915chrX72532 2513 2477 2458 2367 1697 148 --22441 503 22091 485
NM_006918chr1184875 4591 4380 4188 2357 1283 879 637 14936 25151 4096 --
NM_006920chr282074 1912 1723 1617 1317 563 439 360 11901 ----
NM_006922chr262467 2128 2011 1584 450 324 32614 2415 1724 12389 --
NM_006924chr1783718 3533 3488 3252 1401 765 662 122 21120 567 --14281
NM_006948chr2162436 895 773 688 545 318 31749 533 143 ----
NM_006981chr983012 2715 2275 2256 923 861 249 214 11967 ----
NM_007007chr1274043 3223 3070 1040 657 362 241 33853 3532 1232 --1270
NM_007038chr2195446 4636 4618 4338 4064 1722 1611 890 420 35755 5632 5521 25612 2126 13920
NM_007054chr543671 1386 574 282 13288 23880 524 1431
NM_007106chr1342773 2224 1898 362 42294 2160 984 434 ----
NM_007114chr332820 2623 2193 1371 --22393 2378
NM_007124chr631629 403 395 41575 774 606 372 --11998
NM_007125chrY4990 904 893 498 11186 ----
NM_007195chr1893559 3224 2955 653 515 476 328 226 140 43367 2468 969 305 ----
NM_007207chr12844 652 1977 --1866
NM_007231chrX62393 1989 927 579 263 194 1962 22075 338 --
NM_007249chr13129024 8453 8200 8030 7988 7723 6389 5738 3728 2550 1857 439 18995 13151 --
NM_007287chr362959 2850 2422 2072 2059 753 2728 523 ----
NM_007288chr362959 2850 2422 2072 2059 753 2728 523 ----
NM_007289chr362959 2850 2422 2072 2059 753 2728 523 ----
NM_007315chr251393 590 527 442 363 31467 1250 518 ----
NM_007347chr1593017 2399 2198 2066 971 607 304 241 126 3721 261 47 ----
NM_012120chr642985 2555 577 542 1162 --12761
NM_012141chr1363973 2904 2563 1095 671 78 11546 --1679
NM_012164chr9147213 6811 5900 5733 5630 5260 5204 5104 2377 1473 990 962 604 436 ------
NM_012214chr2135644 5415 5315 5248 4654 3994 2257 1856 1794 1627 1616 950 852 1408 1295 1327
NM_012234chr3123782 3611 2978 2873 2594 2281 1338 637 579 445 217 76 2904 499 23328 880 --
NM_012249chr243515 3117 1126 1041 32808 1398 1058 1973 --
NM_012262chr1105194 4969 3794 3441 2105 1717 998 935 413 228 1970 ----
NM_012287chr3104332 3891 3284 1755 1596 1166 1082 895 580 277 34272 4082 4027 11112 --
NM_012290chr261632 1505 1450 1437 1418 252 --1644 --
NM_012347chr692871 2748 2657 2564 2274 2168 808 72 33 ------
NM_012382chr574112 3803 1776 1747 988 710 196 12813 21467 510 --
NM_012395chr752480 2180 993 833 754 1632 12103 23343 2908
NM_012431chr792880 1449 1225 1144 787 726 135 86 39 22240 179 ----
NM_013231chr1453960 3648 894 101 86 11265 ----
NM_013255chr7137960 7688 6724 6631 6423 6293 3408 3299 3136 3048 2905 2734 1261 35924 2463 1727 1587 18895
NM_013261chr452941 2502 1147 697 185 11281 11000 --
NM_013374chr383084 3002 2952 2876 2535 840 235 198 1432 ----
NM_013381chr1262428 2327 1772 794 424 314 1463 ----
NM_013386chr191437 1297 645 584 461 375 355 323 164 1396 ----
NM_014028chr6113282 3247 2776 2691 2293 762 750 710 652 586 385 ----1461
NM_014043chr371602 1590 1418 665 455 277 259 ------
NM_014048chr1665296 5209 4752 2131 628 97 21255 1237 190 --
NM_014089chr1382191 2143 2134 2113 725 323 245 87 42048 1957 1764 1678 11503 --
NM_014106chr1562916 2446 2012 1176 479 434 --22720 418 12503
NM_014112chr875525 2202 2024 1992 1624 1511 1351 1365 25489 1063 --
NM_014141chr765329 1445 1332 928 807 465 34352 851 487 ----
NM_014155chr1177465 7446 7196 6758 6005 5888 5044 57087 6845 1601 1158 1102 47311 6120 2434 2354 --
NM_014309chr2225031 4231 14680 14743 23849 3382
NM_014331chr4187743 7716 7322 6664 5636 5206 4932 3085 2490 2366 1563 1363 1056 886 494 483 191 175 77858 5093 2845 2729 2715 1732 1641 15227 --
NM_014363chr132991 814 31104 823 273 --11266
NM_014372chr172112 2048 1948 1750 1546 1473 609 --11715 --
NM_014393chr862157 1725 1584 1543 440 110 31822 1760 383 11789 --
NM_014415chr351456 1284 504 365 335 21449 100 21127 606 --
NM_014423chr575436 5291 5212 1169 835 745 275 65398 5270 5024 3837 3526 423 --13440
NM_014447chr441630 1419 402 373 --2483 40 11453
NM_014584chr1431449 522 135 31572 1509 107 ----
NM_014616chr342861 833 308 136 12391 23498 457 13142
NM_014636chr964117 3558 3230 2643 918 605 13242 14314 14027
NM_014674chr361120 841 728 596 392 262 13763 11570 --
NM_014707chr782278 1813 1564 1452 859 551 201 55 ------
NM_014721chr687433 7169 6333 5309 2264 1966 1415 1311 --46126 5854 5591 723 --
NM_014733chr542245 2229 1527 757 41573 615 600 24 ----
NM_014739chr663569 3456 2839 1661 1610 1111 23187 934 1262 23172 213
NM_014743chr472928 2744 2252 1258 1249 823 295 --32504 755 334 --
NM_014752chr1161831 1660 1636 1445 596 225 31546 1525 308 1548 --
NM_014755chr2154281 3750 2772 1628 1425 1205 1162 1144 938 713 680 553 515 333 263 --24174 509 --
NM_014765chr152248 954 878 864 639 12470 1733 1274
NM_014803chr1052330 1814 781 688 558 ----12241
NM_014829chr562205 1581 1547 645 607 477 1786 21627 438 --
NM_014860chr262435 2202 1629 909 295 174 12596 2806 161 --
NM_014864chr194302 3775 3328 3143 3129 2989 1707 1347 489 13535 1442 --
NM_014873chr1124534 4474 4389 4330 4029 3837 2978 1113 531 508 327 72 1650 1361 --
NM_014877chr17177643 7426 7224 6921 6819 5326 5133 2944 2771 2257 2251 1850 1353 993 376 266 185 65126 4981 4870 2792 2567 2304 --26360 257
NM_014897chr1771298 1189 1010 955 755 325 236 32352 2262 2104 22438 2274 --
NM_014904chr1073282 1468 1318 1270 659 450 424 44037 1442 458 109 1957 22730 1062
NM_014912chr1032546 1316 905 33211 1345 1196 12772 11175
NM_014920chr653371 856 748 705 607 22939 613 12663 13463
NM_014923chr1341862 1670 146 32 32347 1815 902 ----
NM_014932chr331519 1412 632 1443 --1272
NM_014934chr1353106 1366 1018 1000 419 1768 21116 948 12895
NM_014936chr692815 2762 2704 2628 2563 2237 2135 1987 472 22057 390 ----
NM_014946chr232939 2269 324 22901 120 --13095
NM_014950chr1451739 644 308 283 147 1398 11202 --
NM_014953chr1364160 4135 3411 3291 1512 980 14004 22798 766 13705
NM_014961chr431782 880 648 21727 1454 --1513
NM_014982chr14105387 5278 4744 4659 4274 4194 3871 3818 1102 242 24736 614 14701 --
NM_015000chr122689 228 32404 2094 761 1694 1995
NM_015026chr1294518 3475 3136 1923 1630 1581 935 897 617 24086 3943 ----
NM_015071chr576481 6158 5831 1730 772 517 34 2974 551 ----
NM_015076chr6104526 4510 4332 4325 3480 3353 3290 1544 1324 547 44204 4045 1012 134 11766 --
NM_015087chr1362416 2106 888 645 325 185 32140 1910 1034 21958 211 --
NM_015110chr982540 1787 1698 883 808 801 794 327 22216 1711 22267 423 --
NM_015115chr483097 2467 2246 2188 2172 2005 798 579 22392 2292 12705 --
NM_015137chr872591 2326 1969 1904 1017 911 734 ------
NM_015192chr2092768 2668 2366 2308 1909 1188 1172 492 30 ------
NM_015206chr1543119 2740 1373 356 21416 22 --13777
NM_015216chr52493 368 1601 11436 1417
NM_015225chr962644 2463 2228 1069 627 392 23024 2265 1712 --
NM_015233chr1352276 2066 2008 874 296 12041 --12695
NM_015235chr1051820 1592 881 564 246 22039 1548 ----
NM_015247chr1675416 5008 4204 4157 3296 1906 525 13934 31976 1828 53 --
NM_015271chr443939 3550 1696 237 11156 11461 1408
NM_015275chr1281544 1534 1520 1496 872 631 263 123 1339 ----
NM_015310chr8158324 8097 7624 7573 6911 6494 6352 5738 5520 5374 2903 1772 1323 1156 439 12383 17730 --
NM_015336chr1262553 2171 741 687 603 418 22657 1702 12009 --
NM_015355chr1761977 574 487 331 181 42 1580 ----
NM_015435chr821425 477 2994 309 --1523
NM_015455chr594038 4012 3692 3474 3315 1427 1119 1009 567 23699 687 --13406
NM_015458chr885285 4804 4221 3608 3372 915 647 251 ------
NM_015532chr1592836 1815 1054 1026 470 353 128 114 46 42859 2367 2289 1781 12361 --
NM_015535chr294111 3033 3020 2692 1625 1227 1047 753 356 32756 1442 1365 ----
NM_015553chr6114913 4189 3235 1653 1165 981 837 494 71 60 29 11078 ----
NM_015554chr1532262 392 163 22838 1826 1543 22722 638
NM_015564chr553510 3031 2826 1382 844 31168 269 50 ----
NM_015569chr151122 930 793 216 70 11660 24543 814 --
NM_015571chr662512 1775 1756 971 491 420 1666 --11001
NM_015575chr243572 1457 617 565 13538 23081 539 13610
NM_015602chr181398 1344 1335 1288 1189 681 596 238 21674 127 ----
NM_015640chr194619 4185 3966 1992 1726 1560 716 682 60 35258 618 448 --1597
NM_015678chr1371280 1174 532 524 342 225 211 ------
NM_015852chr732437 2430 134 33500 3367 2395 ----
NM_015879chr1898163 8002 7135 7011 6434 5226 2923 2756 2046 21768 446 2589 229 --
NM_015886chr874906 4206 3915 1959 956 293 277 45544 651 479 380 23701 747 --
NM_015891chr671968 1310 738 682 340 237 56 ------
NM_015906chr184755 4647 3925 3362 1463 1257 719 516 34059 3940 3445 --13859
NM_015990chr451031 814 799 715 416 11051 --1762
NM_016023chr852176 1536 1392 827 108 --21831 1807 12025
NM_016040chr15674 628 421 387 62 1498 --12047
NM_016076chr1113200 3140 3058 2051 1268 1127 777 692 441 310 142 11155 ----
NM_016087chr771363 1279 1180 1163 1157 369 225 11546 11121 --
NM_016206chr3147913 7697 6717 6566 5999 5802 5692 3403 1939 1774 716 662 561 29 47288 6636 6224 5941 --21337 917
NM_016255chr652835 2310 1197 977 74 2985 947 --23054 859
NM_016260chr287491 6747 5955 4915 4813 1499 1281 1225 26652 2785 25606 2692 --
NM_016287chr161392 660 467 357 344 96 --22031 1518 --
NM_016396chr1582935 2870 1043 1008 696 486 152 94 12010 12043 --
NM_016513chr653371 856 748 705 607 22939 613 12663 13463
NM_016531chr453449 3305 2777 134 88 33750 2761 2559 ----
NM_016599chr471389 1247 1238 1034 618 314 84 11396 11041 --
NM_016950chr44548 441 196 151 11467 --21338 1136
NM_017420chr1463859 3216 3052 2413 1333 1205 23585 2796 23553 3377 12376
NM_017447chr2163792 3682 3501 495 418 268 34360 3047 2881 14331 --
NM_017594chr993305 3284 3265 3243 3214 2883 1126 765 112 23322 2667 ----
NM_017610chr1591786 1689 1639 1571 1521 1475 710 261 244 21624 357 ----
NM_017628chr485127 4405 3851 3414 2042 482 106 53 1655 ----
NM_017633chr683768 2670 1425 1374 1072 1032 801 793 22789 1060 13596 --
NM_017637chr9129465 9071 8409 8159 7418 6639 6561 3147 2781 1938 1386 1139 49367 8372 5812 2884 26947 609 11167
NM_017644chr395116 4742 4676 4343 4330 4122 3611 612 392 25143 4417 ----
NM_017645chr973054 2625 2420 2303 775 732 328 12386 12402 --
NM_017650chr785836 5617 5600 4298 4226 4165 2327 2240 25109 5018 ----
NM_017651chr681044 1036 1000 389 274 263 248 206 ------
NM_017658chr14104197 4156 3116 2984 2870 1621 1481 1187 1150 1018 23023 864 ----
NM_017666chrX41891 1659 361 289 --22167 2001 --
NM_017719chr352251 2164 1944 1838 222 --1993 12243
NM_017737chr162214 1726 1657 1593 534 320 11740 3454 112 45 --
NM_017754chr645002 4117 3622 652 21369 997 --14874
NM_017769chr1463201 2890 2758 2328 655 558 42915 2067 609 355 --21074 458
NM_017824chr1042598 1073 884 488 2648 437 --11660
NM_017831chr1874634 3529 1688 1374 758 189 140 23259 862 21284 249 --
NM_017919chr9105807 5301 5050 4905 4400 3884 3851 3567 2328 1692 12159 24947 1998 --
NM_017987chr1062041 1697 1436 1359 828 508 ----2676 160
NM_018003chr1542459 1752 615 477 1841 2885 471 --
NM_018017chr1042568 2407 1865 736 1704 --12590
NM_018018chr1251633 1530 381 49 42 11436 ----
NM_018027chr1053280 3211 2900 2456 473 13038 42495 2380 2372 2149 --
NM_018084chr262990 2212 1143 1005 652 437 ------
NM_018105chr851216 1009 981 218 192 21115 103 1400 --
NM_018126chr43979 358 87 2119 110 11227 --
NM_018155chr363379 2969 2836 2196 937 788 2834 336 ----
NM_018254chr142051 967 908 334 62433 2272 2140 1843 772 639 ----
NM_018290chr441190 1045 436 28 31037 1028 305 ----
NM_018293chr352887 2620 2229 1120 282 32601 2186 2120 ----
NM_018299chr893456 3410 2450 1018 998 880 614 510 447 1595 23268 2461 --
NM_018313chr352607 2347 1648 472 110 4373 222 142 26 2909 182 --
NM_018325chr961583 1521 1223 334 181 131 ----11642
NM_018339chr941810 1789 1703 260 ----181
NM_018351chr1284283 4215 3963 3662 3063 1492 621 345 23819 1890 23137 897 --
NM_018361chr883902 3376 3280 2727 1574 1405 1174 595 13404 --12695
NM_018362chr1173766 2628 1553 1279 746 322 278 ------
NM_018364chr193389 3353 3178 1640 1339 1283 1270 455 56 33877 1612 1475 ----
NM_018374chr7145204 5050 4874 4795 4650 4531 4104 4044 3868 3750 1797 1242 876 674 34819 4578 3740 1464 15001
NM_018394chr331479 549 303 2495 146 --1534
NM_018416chr1242626 2566 934 237 --1739 21686 262
NM_018429chr562933 2607 2559 642 264 60 ----12897
NM_018439chr1832529 2382 636 22463 43 2927 152 --
NM_018440chr8108731 8647 8604 7477 6535 6359 5243 3356 2119 1487 ------
NM_018482chr882040 1913 1670 1587 1008 909 250 94 12281 ----
NM_018638chr1265663 5412 3944 3527 1700 979 34608 4169 3981 11089 21626 1106
NM_018710chr881365 932 863 387 381 274 234 169 ------
NM_018834chr551025 957 909 815 159 ----1947
NM_018841chr163718 3612 3293 2683 553 398 33043 2797 292 ----
NM_018844chr741919 1752 1696 584 32090 697 238 1332 --
NM_018847chr921951 1401 31966 1479 475 1449 1249
NM_018948chr121469 1326 2278 263 11431 133
NM_018999chr1084474 4274 3598 3352 1651 1397 889 664 33918 3132 1371 1321 11386
NM_019001chr3104723 4691 3412 2980 1269 1231 1211 1081 411 263 11169 34760 1709 1286 11811
NM_019027chr422541 511 32134 1018 144 --11003
NM_019050chr452169 2125 1620 876 669 --12243 130
NM_019067chrX54477 4122 3605 1807 411 23326 1922 13418 14464
NM_019083chr171631 1484 1104 438 222 65 57 ------
NM_019084chr1082528 2155 2103 2088 1691 777 424 207 2905 607 ----
NM_019114chr91661 2928 790 11628 1533
NM_019117chrX53202 2161 521 325 144 22616 192 11021 --
NM_020122chr284914 3856 3709 1996 1896 1694 931 496 15944 1116 --
NM_020177chr562200 2099 1260 1198 1033 627 12045 12983 --
NM_020357chr361486 1473 1295 1019 545 241 2285 182 ----
NM_020390chr394786 4527 4332 3104 3076 1372 833 597 448 23673 434 ----
NM_020432chr78767 754 509 400 195 177 148 122 1550 ----
NM_020452chr122134 1351 21988 406 12073 12010
NM_020466chr664678 3982 3452 1931 517 98 23157 840 151 --
NM_020473chrX51647 1376 432 418 290 --1508 --
NM_020654chr351646 1362 1220 1144 324 21417 1081 ----
NM_020718chr16106526 6518 6128 6075 5996 5374 4794 4598 1261 602 16564 1960 11106
NM_020727chr2183751 3616 2879 2501 1463 759 461 119 1969 1780 --
NM_020734chr1243199 2062 1065 636 12843 --22316 1058
NM_020739chr1573417 2945 1595 1117 560 268 138 ------
NM_020766chrX74354 4214 3741 3689 3548 2858 353 21179 299 ----
NM_020771chr651270 972 426 408 377 1602 ----
NM_020772chr17158523 8139 7100 6815 6590 6452 6437 5728 2845 2667 1294 1279 1164 800 591 25370 1487 26356 5637 27298 748
NM_020774chr1882326 1827 1765 1365 1090 781 610 295 24837 1379 14726 --
NM_020782chr1274563 4170 1823 1572 1053 734 653 21868 611 --1711
NM_020794chr131442 622 573 21409 387 11384 11425
NM_020803chr472399 2023 2010 1997 1869 827 534 --11912 1726
NM_020819chr67966 821 338 323 132 116 66 ------
NM_020841chr12103941 3649 3345 3288 3245 2824 2676 2626 1251 683 43485 2901 1240 622 ----
NM_020844chr8127367 7196 6967 6479 6473 5525 5023 4971 4653 897 413 80 25586 4896 57611 6113 5265 1369 1014 --
NM_020871chrX72131 986 903 575 510 338 136 1609 12335 --
NM_020872chr331443 1430 336 2223 216 ----
NM_020917chr1972788 2768 906 401 331 103 34 23145 2678 1580 --
NM_020935chr283801 3139 1591 1437 1152 726 682 561 1752 23443 2874 --
NM_020940chr1092948 2810 2774 2717 2645 2104 1967 1047 964 --1337 --
NM_020948chr153213 2448 1273 1115 1013 33046 1437 549 ----
NM_021038chr353190 2804 2285 1255 145 12356 --1739
NM_021072chr512138 52349 2314 2180 2108 2043 1228 --
NM_021111chr971405 1326 1217 1194 876 550 260 11055 1408 --
NM_021148chr752389 1684 1678 711 415 22030 562 12491 21966 1598
NM_021252chr1051888 1731 1442 261 114 21393 27 11555 --
NM_021629chr3124782 4650 4513 4280 4266 3779 3719 2017 1934 1683 327 86 11020 1943 14394
NM_021647chr4104256 4208 3931 3688 3135 3089 1670 964 630 606 13129 31893 1170 879 --
NM_021911chr5115442 5262 5238 4577 4453 4058 2013 1902 1395 1262 1202 24203 2025 ----
NM_021954chr13103673 3488 3418 3256 2844 2801 2762 2716 563 196 22723 1010 ----
NM_021961chr1186314 6206 6168 4893 2716 1794 1375 911 --37212 4524 904 --
NM_021964chr3116104 5505 5277 4593 2370 1825 1519 1501 828 559 193 54529 2429 2003 1165 900 32310 1479 1292 --
NM_022048chr1595675 5658 4985 4087 2290 2268 1820 749 606 --1814 --
NM_022133chr871832 506 498 411 378 354 208 31675 1215 134 1694 --
NM_022351chr873342 3171 3148 1085 820 597 519 11551 ----
NM_022459chr13116268 5409 5035 4848 4754 4689 2353 1882 1674 1613 1541 24337 1521 ----
NM_022475chr41548 1737 --2729 223
NM_022716chr123133 720 3975 967 946 ----
NM_022763chr372525 2403 1957 865 839 360 344 22833 102 ----
NM_022781chr972455 2416 2164 1300 950 624 191 42885 2243 2146 375 ----
NM_022841chr1572804 2173 1835 1111 671 657 271 22496 2455 ----
NM_022843chr1371514 1413 1354 1247 1030 1020 168 ------
NM_022845chr1672154 2146 1648 1495 606 527 422 21688 39 --11606
NM_022977chrX42542 1934 1038 981 22171 183 --1562
NM_023074chr1951351 1023 961 842 134 2937 848 ----
NM_023929chr862816 2784 2094 319 213 169 22219 2072 ----
NM_024345chr9125536 5525 5487 5249 4896 4519 4387 3921 2335 1965 1052 274 15872 24812 1312 --
NM_024408chr183701 3208 3079 2862 2664 2321 1373 518 12899 ----
NM_024524chr393099 3074 2783 2684 2666 2038 1129 622 290 32238 406 242 ----
NM_024583chr22341 247 3859 303 88 21046 386 1932
NM_024584chr231180 1071 956 1969 1987 --
NM_024590chr471768 1732 1696 1638 1294 414 372 1558 ----
NM_024641chr682871 2488 2462 2229 1112 347 341 236 31185 1157 619 22999 111 12373
NM_024665chr3114673 4659 4075 4028 3044 1613 1535 1519 1186 539 384 13684 ----
NM_024713chr151660 11455 1274 11017
NM_024744chr272383 2041 1939 1775 1728 1027 538 22662 2469 42121 1838 937 587 --
NM_024770chr295975 5497 4826 4463 4096 2133 1143 862 235 35681 2329 2307 16006 16566
NM_024817chr1575428 5298 5049 4089 3761 951 938 25770 5198 ----
NM_024913chr751409 1389 1367 1168 1132 21416 1356 ----
NM_024930chr572830 2714 2324 1965 880 858 281 22595 2220 ----
NM_024947chr3219580 9571 9245 9112 8353 7103 6826 5956 3814 3532 2963 2850 2825 2262 2229 1969 1542 1313 354 279 244 19094 36087 1884 221 11958
NM_024989chr2178007 7985 7409 7369 6605 6393 5655 5402 5371 2935 2696 2660 1973 1965 1450 1167 558 47194 6252 5943 1830 --16598
NM_025134chr1662313 2271 2033 616 475 156 32299 1797 1646 11627 --
NM_025154chr741096 1018 285 279 ----11353
NM_025160chr164248 3761 3741 3668 1127 603 13072 13028 --
NM_025179chr143995 3498 1201 314 24749 491 --14955
NM_025208chr1132280 213 22 2521 334 11975 1239
NM_025235chr1091842 1836 1764 1510 1372 552 527 441 284 --12099 --
NM_030621chr14113811 3711 3646 3632 3573 3171 1649 1383 727 556 523 1646 23148 1144 13982
NM_030627chr583691 3104 3092 2946 2930 2872 1205 1054 22741 930 23747 221 14018
NM_030647chr776130 4815 2146 2045 1068 873 699 25632 615 32115 1702 481 --
NM_030648chr4115439 4280 3853 3788 3536 2185 2030 1961 1587 799 623 1410 25076 1727 --
NM_030650chr294226 3617 3332 3281 3256 1356 1240 701 491 --23231 190 1158
NM_030665chr1721418 1235 ----21251 945
NM_030674chr1295104 4901 1978 1843 1075 1035 976 533 144 ------
NM_030755chr1482123 1120 994 956 845 547 320 304 12713 1684 --
NM_030806chr168467 8442 2176 846 243 51 19385 19424 11783
NM_030816chr183259 3201 1251 1048 1025 618 612 606 ------
NM_030945chr571902 1873 1068 764 120 92 59 12523 22318 742 --
NM_031362chr272818 2796 2739 2612 2365 1750 194 --22747 1017 1710
NM_031365chr282954 2932 2875 2748 2501 1886 1845 330 --22883 1153 1846
NM_031366chr282954 2932 2875 2748 2501 1886 1845 330 --22883 1153 1846
NM_031418chr1172513 2451 2437 723 680 603 579 32529 2146 792 ----
NM_031427chr1455631 4790 1742 924 645 51440 1398 1350 197 66 25513 819 1258
NM_031435chr1293410 3013 2713 2512 2239 957 773 357 198 13482 ----
NM_031438chr551791 1720 726 677 568 ----11290
NM_031483chr2053247 1260 962 571 69 --32690 2242 1021 12461
NM_031844chr163756 2970 2906 1520 934 451 21378 1110 1673 14059
NM_031845chr293549 1105 883 601 551 288 261 218 138 12306 179 --
NM_031847chr293549 1105 883 601 551 288 261 218 138 12306 179 --
NM_032012chr995278 4805 4627 4183 1246 1086 1076 1009 591 35104 325 138 23386 3211 --
NM_032047chr362319 2273 1623 682 619 225 1874 ----
NM_032105chr177620 5415 5319 2848 2677 838 521 15786 12926 18029
NM_032373chr1084957 4909 4109 1446 1287 852 434 367 55943 4434 3813 2256 2171 21746 153 --
NM_032439chr1021342 501 11259 21202 614 1304
NM_032440chr1052875 2154 2044 220 122 1851 2591 346 1168
NM_032446chr5103857 3564 3185 3134 3014 1195 1089 923 373 312 22935 1149 23432 2527 --
NM_032457chr473108 2687 1263 742 311 209 33 33863 2508 781 ----
NM_032458chrX62709 2591 2095 1003 308 274 53426 2221 1235 532 156 13364 --
NM_032505chr372775 2519 2445 2322 2028 1862 476 12241 --12045
NM_032510chr181706 32499 1696 1649 22282 1725 12250
NM_032521chr2073096 3075 2854 2421 2280 1222 121 --1231 1327
NM_032810chr1031187 1145 423 ----1160
NM_032859chr13103924 3603 3297 3141 1164 1037 492 305 160 24 23016 2935 2981 541 --
NM_032873chr1194401 4277 3698 3195 3041 1791 1446 1440 519 --1906 --
NM_032968chrX74247 3611 3569 3274 3051 2915 227 23137 1668 ----
NM_032969chrX74247 3611 3569 3274 3051 2915 227 23137 1668 ----
NM_032973chrY74239 3603 3565 3269 3046 2910 227 23132 1662 ----
NM_033020chr184755 4647 3925 3362 1463 1257 719 516 34059 3940 3445 --13859
NM_033083chr333369 3103 248 11138 --13147
NM_033135chr1132280 213 22 2521 334 11975 1239
NM_033143chr4114180 4051 3787 3763 3437 3255 3181 1824 1734 967 894 13527 ----
NM_033222chr941276 1183 1073 449 --1321 1926
NM_033224chr7136467 6362 6332 5752 5293 4915 2817 2322 2057 1015 815 666 396 11747 26072 386 --
NM_033285chr8114467 3773 3331 2903 1795 1660 919 739 285 160 46 23214 3041 ----
NM_033360chr12134665 4317 4253 3972 3759 2975 1836 1767 1116 1084 895 716 648 33542 1779 1487 ----
NM_033380chrX31066 1014 839 1285 --1742
NM_033381chrX31066 1014 839 1285 --1742
NM_033389chr1754872 3660 1267 1052 586 ----11067
NM_033393chr422902 94 1358 --12280
NM_033394chr261309 1239 1139 1039 437 215 1467 --11359
NM_033425chr1163433 3140 3046 2886 402 372 21410 1233 13333 --
NM_033480chr692871 2748 2657 2564 2274 2168 808 72 33 ------
NM_033481chr692871 2748 2657 2564 2274 2168 808 72 33 ------
NM_052832chr853021 2951 2586 2571 2499 12351 11985 --
NM_052860chr5--11003 --2276 176
NM_052885chr12104498 4224 3868 3735 3615 3582 3287 1370 697 490 24914 370 --24698 950
NM_052886chr831954 208 52 11765 --1669
NM_052937chr852749 726 713 465 390 32074 362 334 ----
NM_052966chr143449 1374 1208 50 13546 172 11148
NM_053016chr996238 5977 3209 2516 1782 1713 1061 856 443 74909 2654 2379 2123 2093 723 549 17239 12885
NM_053042chr442852 1181 504 473 12407 12774 22984 2155
NM_053056chr1173094 2524 1215 673 612 409 325 1246 --12486
NM_053064chr1462614 2330 2195 2047 1925 772 --1793 --
NM_057168chr771363 1279 1180 1163 1157 369 225 11546 11121 --
NM_058241chr271859 1793 1575 1534 857 414 199 21768 814 ----
NM_058241chr271859 1793 1575 1534 857 414 199 21768 814 ----
NM_080759chr1342549 2269 1960 30 22005 637 21727 522 --
NM_080760chr1342549 2269 1960 30 22005 637 21727 522 --
NM_080867chr1464800 4761 4582 4133 251 177 1442 13086 --
NM_080872chr863584 3130 2653 1280 968 843 2196 153 11533 --
NM_080927chr352728 2348 1125 1074 936 22217 93 ----
NM_130391chr953595 2946 2867 2445 1400 --13533 1611
NM_130392chr953595 2946 2867 2445 1400 --13533 1611
NM_130393chr953595 2946 2867 2445 1400 --13533 1611
NM_130438chr2173046 3008 2601 1282 1257 480 82 22961 952 12099 --
NM_130768chr7194 --1275 126
NM_130809chr521088 1016 21195 1106 --12863
NM_130838chr1531335 1257 1164 11873 --1271
NM_130839chr1531335 1257 1164 11873 --1271
NM_133334chr454356 1485 1234 1014 775 36286 4545 2346 24486 2459 --
NM_133372chr512601 22794 826 --12549
NM_133468chr76992 815 734 191 168 159 ------
NM_133477chr483273 2967 2853 2707 2290 2257 287 267 --33045 1269 1262 --
NM_133496chr184458 4204 3606 3584 3356 3228 1236 846 11608 --14252
NM_133646chr285286 5183 4476 4005 892 748 373 132 24492 1369 ----
NM_138270chrX63442 3222 2192 2165 1252 1132 43431 2846 389 374 23129 729 12799
NM_138286chr1943821 3781 2703 448 33418 2999 2724 22821 1065 --
NM_138400chr783469 3068 2797 2720 2465 1041 641 127 --12765 --
NM_138444chr1354772 4569 1933 1672 627 23218 1241 ----
NM_138468chr296345 5959 4669 3938 2404 1330 1309 838 383 2969 959 ----
NM_138635chr752217 1161 869 383 219 13080 22964 1069 --
NM_138713chr16158171 7780 7626 6844 6605 6422 5009 3287 3280 3138 1930 1814 1350 208 169 57429 5247 2797 2042 852 58083 7384 5942 5554 1295 --
NM_138714chr16158171 7780 7626 6844 6605 6422 5009 3287 3280 3138 1930 1814 1350 208 169 57429 5247 2797 2042 852 58083 7384 5942 5554 1295 --
NM_138731chr1483320 3029 1528 1061 1004 607 266 242 43967 3527 3418 3235 ----
NM_138782chr572117 2092 1856 1770 741 593 313 52394 2216 1740 1601 752 --11587
NM_138959chr186632 6312 5925 5851 4987 2549 2252 260 26129 2188 ----
NM_139207chr1231728 749 425 ----12091
NM_139279chr242246 863 379 135 13545 --129
NM_139283chr1262105 2017 1770 598 567 511 --21982 450 --
NM_144571chr486282 6068 4244 2453 1787 1419 584 249 36221 2006 692 25443 879 --
NM_144599chr1575423 5020 4868 4813 4347 769 454 --34373 1117 350 --
NM_144632chr262392 2352 2228 2000 1679 839 1651 --12203
NM_144728chr12844 652 1977 --1866
NM_144729chr12844 652 1977 --1866
NM_144963chr862415 2208 717 681 371 333 1864 ----
NM_144973chr1295170 5102 4506 3601 3454 3267 1115 540 250 34617 3689 554 14213 --
NM_145011chr1082126 2120 2029 1812 1761 885 621 604 ------
NM_145055chr1843692 2695 668 536 --12860 13767
NM_145259chr276490 5795 5765 2831 2822 2583 301 12688 27023 2777 --
NM_145263chr441978 592 281 186 1574 --1805
NM_145307chr1074464 4439 3812 3576 3533 3469 716 34085 3567 86 ----
NM_145686chr253152 2466 2233 1314 1005 22954 166 23118 1282 --
NM_145687chr253152 2466 2233 1314 1005 22954 166 23118 1282 --
NM_145735chr1342854 2813 2250 754 22595 1915 12748 12788
NM_147189chr882164 2064 1740 1716 1633 534 316 264 --22029 131 --
NM_148955chr15136514 6422 6413 6321 6259 5866 4651 2316 1854 1797 1601 1519 1052 46452 6440 1534 827 22163 1891 22539 1625
NM_148957chr1372593 1910 1879 899 857 793 93 12625 22212 826 --
NM_152409chr5113505 3431 3307 3203 2756 2442 1284 1115 829 753 514 13262 ----
NM_152424chrX73492 3485 3476 1571 1395 940 641 24088 326 13416 --
NM_152529chr294336 4326 3879 3671 3577 1434 1084 775 175 3955 681 332 ----
NM_152538chr371837 1353 1233 1209 700 539 107 ----1460
NM_152551chr642982 2949 932 214 2627 82 12657 1616
NM_152556chr752145 1994 949 583 490 32080 173 102 ----
NM_152594chr1562239 1704 1698 710 510 200 41907 1591 846 542 1720 --
NM_152624chr5127017 6539 6006 4987 4618 2716 2568 1659 1051 880 356 183 --42555 919 885 680 11073
NM_152629chr954074 2829 1119 619 592 33910 3008 2624 --13531
NM_152641chr1232352 2019 414 ----22737 1116
NM_152734chr674061 3984 3951 3747 2011 551 124 1627 --14702
NM_152756chr594178 4141 3931 3682 3238 3104 1652 1064 667 23125 632 ----
NM_152758chr852938 2919 2254 1982 583 22841 1149 11950 --
NM_152774chr761983 596 463 325 93 87 --1623 --
NM_152826chr15136514 6422 6413 6321 6259 5866 4651 2316 1854 1797 1601 1519 1052 46452 6440 1534 827 22163 1891 22539 1625
NM_152836chr871832 506 498 411 378 354 208 31675 1215 134 1694 --
NM_152837chr871832 506 498 411 378 354 208 31675 1215 134 1694 --
NM_152838chr2053137 2325 1349 438 194 23166 111 22162 986 --
NM_152999chr7114792 4360 3973 3822 1717 1624 686 609 565 270 76 --14633 --
NM_153188chr5195643 5329 5003 4092 3756 3569 3493 1989 1936 1915 1618 1283 989 935 772 602 516 433 249 54666 4636 4570 3674 1687 13847 11241
NM_153207chr1293851 3414 3105 2580 1122 674 366 302 82 13435 11456 11065
NM_153332chr863217 3024 2401 1181 880 481 1954 --1223
NM_153343chr432388 2250 1808 --1238 12318
NM_153371chr1352104 1834 951 226 29 --1178 12090
NM_153607chr582841 2681 2674 2546 2479 974 177 79 12629 1119 --
NM_153686chr4101974 1803 1554 707 607 175 166 153 144 112 ----1467
NM_153689chr241810 1541 283 61 11804 12075 --
NM_170710chr473180 2935 2893 2529 719 536 471 23135 2156 12719 1653
NM_170725chr13217 211 201 --1632 --
NM_172071chr1137485 7377 7274 6739 6052 5023 4829 4821 4682 2056 1425 1153 749 64562 1771 1760 1646 394 328 ----
NM_173082chr661361 1208 1139 491 213 99 11529 ----
NM_173083chr141256 1133 239 181 164 --1230
NM_173198chr983012 2715 2275 2256 923 861 249 214 11967 ----
NM_173200chr983012 2715 2275 2256 923 861 249 214 11967 ----
NM_173214chr16158171 7780 7626 6844 6605 6422 5009 3287 3280 3138 1930 1814 1350 208 169 57429 5247 2797 2042 852 58083 7384 5942 5554 1295 --
NM_173468chr442005 724 634 615 --36100 2276 70 1780
NM_173496chr1052997 2327 2044 1220 1091 41159 901 693 521 ----
NM_173511chr253901 3515 3325 3049 2937 --23267 446 --
NM_173536chr4135195 5005 4449 3874 3734 3625 3168 3153 1533 876 262 201 184 14699 1650 11052
NM_173545chr241853 1698 748 33 1464 --21407 314
NM_173552chr382324 2309 1969 759 671 624 382 351 --31768 702 100 --
NM_173582chr11115598 5337 4906 4249 2239 2089 1974 1671 1174 1009 561 25809 3880 --1395
NM_173694chrX62500 2475 1965 974 253 61 11772 21885 1575 1868
NM_173698chrX61751 1680 1551 1323 743 466 11332 ----
NM_173808chr173098 2972 2709 1692 1348 324 112 23074 1138 --11190
NM_173826chr361459 1427 488 375 261 172 195 1612 21745 1635
NM_173829chr575624 5605 5383 5109 4346 3800 1179 15416 35199 4134 1143 --
NM_173851chr822739 2452 31284 646 196 --12499
NM_175056chr372068 1995 1807 1502 1476 774 169 --22052 358 --
NM_175061chr752066 2010 1490 677 602 1467 --1301
NM_175607chr331262 1175 265 2284 254 11444 --
NM_175612chr331262 1175 265 2284 254 11444 --
NM_175861chr1265801 5194 4759 4659 4338 1156 15989 --11849
NM_175876chr131923 65 59 149 12324 --
NM_175921chr554191 4179 3886 3212 916 43836 3032 1728 170 13583 13415
NM_176081chr10105665 5121 4739 4470 4140 4085 1634 1563 954 173 ------
NM_176083chr10105665 5121 4739 4470 4140 4085 1634 1563 954 173 ------
NM_176824chr441346 1190 1069 110 31305 1076 384 ----
NM_177438chr14113811 3711 3646 3632 3573 3171 1649 1383 727 556 523 1646 23148 1144 13982
NM_178011chr1062882 2721 2119 2093 1294 374 22954 647 1949 --
NM_178140chr532510 2490 1860 12660 --12727
NM_178151chrX107431 7228 6663 6015 5557 2516 1259 1241 1204 816 27183 363 1307 --
NM_178152chrX107431 7228 6663 6015 5557 2516 1259 1241 1204 816 27183 363 1307 --
NM_178153chrX107431 7228 6663 6015 5557 2516 1259 1241 1204 816 27183 363 1307 --
NM_178815chr1072748 2600 2531 2077 2058 2043 615 ------
NM_180989chr1352153 1828 993 821 228 22038 131 ----
NM_181265chr473180 2935 2893 2529 719 536 471 23135 2156 12719 1653
NM_181358chr183862 3851 2700 1635 1477 905 883 685 33792 1254 1152 --1634
NM_181481chr1895882 5526 2589 2016 790 779 626 583 162 64789 4765 2621 1608 754 410 35904 5410 5286 16888
NM_181482chr1895882 5526 2589 2016 790 779 626 583 162 64789 4765 2621 1608 754 410 35904 5410 5286 16888
NM_181483chr1895882 5526 2589 2016 790 779 626 583 162 64789 4765 2621 1608 754 410 35904 5410 5286 16888
NM_181706chr1152400 2216 1975 228 194 --11913 --
NM_181723chr872317 2309 2160 2051 1729 1474 571 ----1204
NM_181787chr883740 3623 3323 3258 1571 1406 1277 1217 1526 1244 11344
NM_181836chr582187 1989 1845 1712 856 780 766 264 --12034 --
NM_181869chr1262866 2814 2783 2418 2179 200 165 ----
NM_182485chr453709 3494 919 880 264 33016 2804 2325 22845 1438 11328
NM_182493chr16125078 4616 4524 4164 3812 3768 3518 3264 1565 1498 664 294 13708 ----
NM_182503chr6105147 4812 4381 3682 3551 1566 1267 1227 738 519 23835 95 55184 3588 1430 1298 1132 --
NM_182515chr19135640 5500 5365 4889 4763 4383 2573 1543 1536 1247 1130 1012 61 12238 ----
NM_182641chr1751956 1862 1327 405 149 1649 --21814 482
NM_182646chr453709 3494 919 880 264 33016 2804 2325 22845 1438 11328
NM_182758chr1573592 3476 3441 3399 2476 1504 899 23539 359 13332 13427
NM_182762chr7136210 5787 5379 4568 4486 4473 3906 3833 3798 2292 1479 398 175 35065 4330 1160 ----
NM_182765chr1042299 930 872 31 22145 253 22095 718 --
NM_182848chr1321063 38 2252 158 --1170
NM_182896chr361857 1802 555 435 375 296 21689 1492 11796 --
NM_182898chr776521 5713 4667 2251 1100 896 693 25461 2035 26449 4994 1171
NM_182899chr776521 5713 4667 2251 1100 896 693 25461 2035 26449 4994 1171
NM_182972chr182756 1990 1896 1802 1784 932 920 787 --11767 1755
NM_183050chr672415 2228 1745 1650 718 510 193 ------
NM_183234chr1551491 393 384 370 167 11671 ----
NM_183235chr1551491 393 384 370 167 11671 ----
NM_183236chr1551491 393 384 370 167 11671 ----
NM_183419chr821425 477 2994 309 --1523
NM_194282chr453030 2397 2287 2260 2163 21949 230 --1427
NM_194283chr584199 3630 3417 1476 962 688 303 107 --13435 --
NM_194291chr872983 2678 1161 1061 960 737 261 --1376 --
NM_194314chr1125185 5091 5030 5011 4986 4622 4531 1815 1187 1070 746 463 74965 4120 4068 3516 2041 1980 1059 21800 39 --
NM_194318chr1332331 1802 1032 12039 --12071
NM_194328chr972455 2416 2164 1300 950 624 191 42885 2243 2146 375 ----
NM_194329chr972455 2416 2164 1300 950 624 191 42885 2243 2146 375 ----
NM_194330chr972455 2416 2164 1300 950 624 191 42885 2243 2146 375 ----
NM_194332chr972455 2416 2164 1300 950 624 191 42885 2243 2146 375 ----
NM_194434chr1885067 4812 3549 2187 1738 1197 699 237 24565 1791 ----
NM_198268chr183862 3851 2700 1635 1477 905 883 685 33792 1254 1152 --1634
NM_198269chr183862 3851 2700 1635 1477 905 883 685 33792 1254 1152 --1634
NM_198270chrX73355 3264 3197 2756 2687 992 404 12821 ----
NM_198273chr5102928 2859 2606 2459 2381 2281 1088 879 735 417 22116 831 165 42172 2149 969 857
NM_198468chr674530 3804 3207 1311 639 507 133 34618 4578 4248 --24070 1062
NM_198503chr172097 2050 1920 1804 1640 624 407 11927 12399 --
NM_198513chr871870 1755 1607 1591 625 550 380 --11847 --
NM_198581chr2127505 7197 6944 6220 5637 5110 2167 1908 790 694 342 144 1172 34579 2412 739 17494
NM_198584chr84828 810 776 688 --12574 11969
NM_198715chr196273 6170 5523 4989 3908 3841 696 456 21 1938 ----
NM_198793chr354077 3846 1405 815 142 33961 3742 2724 21544 1080 --
NM_198794chr1441489 532 428 362 --31184 204 114 --
NM_198935chr2032358 1097 948 11073 11034 1557
NM_198968chr1353106 1366 1018 1000 419 1768 21116 948 12895
NM_199003chr861500 1293 1265 957 502 476 21399 387 ----
NM_199039chr451031 814 799 715 416 11051 --1762
NM_199072chr763090 2844 2716 2380 639 227 12269 12035 12212
NM_199189chr551025 957 909 815 159 ----1947
NM_199320chr462812 2678 2602 2466 1129 468 11919 21069 496 --
NM_199320chr462812 2678 2602 2466 1129 468 11919 21069 496 --
NM_199324chr4113596 3435 3426 2319 1402 1288 1202 1196 1147 1006 441 23744 703 ----
NM_199421chr1464800 4761 4582 4133 251 177 1442 13086 --
NM_199436chr232939 2269 324 22901 120 --13095
NM_201999chr431256 399 289 ----2374 329
NM_203301chr1451558 1490 1459 686 402 3620 526 127 11196 134
NM_203406chr562863 2735 2062 1913 1103 811 2111 36 ----
NM_203459chr182422 1855 1646 1616 1034 963 934 575 ------
NM_203463chr2103890 3715 3376 1678 928 807 717 479 233 66 13162 13511 --
NM_206594chr163561 3200 3150 3050 2314 816 12649 23401 774 --
NM_206595chr163561 3200 3150 3050 2314 816 12649 23401 774 --
NM_206853chr633954 2906 1441 43060 2998 2831 1408 ----
NM_206854chr655215 4167 1053 458 38 34321 4259 4092 13728 --
NM_206855chr686180 5132 2018 1423 1003 868 243 83 35286 5224 5057 14693 --
NM_206866chr2173211 3099 2939 2907 2344 1226 1107 22567 2388 12857 --
NM_206876chr273446 3021 2572 2488 2383 566 202 --1249 --
NM_206907chr5103063 2700 2585 2298 973 357 351 337 277 85 2896 314 --2989 345
NM_206909chr8158324 8097 7624 7573 6911 6494 6352 5738 5520 5374 2903 1772 1323 1156 439 12383 17730 --
NM_207292chr353190 2804 2285 1255 145 12356 --1739
NM_207293chr353190 2804 2285 1255 145 12356 --1739
NM_207294chr353190 2804 2285 1255 145 12356 --1739
NM_207295chr353190 2804 2285 1255 145 12356 --1739
NM_207296chr353190 2804 2285 1255 145 12356 --1739
NM_207297chr363215 2829 2310 2075 1280 170 12381 --1764
NM_207303chr1094157 3982 3582 3526 3514 1503 1239 960 324 11650 21667 1642 --
NM_207361chr1396030 5982 5232 4211 2431 1826 931 758 173 34247 2244 655 14080 --
NM_207366chr782365 2315 2171 1834 919 727 670 369 12153 21580 894 --
NM_207647chr952548 2079 958 767 693 21954 315 --1905
NM_212471chr1772263 1779 1752 1674 1642 633 381 21437 127 11458 11910
NM_212472chr1772263 1779 1752 1674 1642 633 381 21437 127 11458 11910
NM_212558chr963701 3533 3115 2795 1129 720 21295 855 13722 1441
NM_213589chr2115575 5562 5267 5053 4772 4711 3931 3642 3529 1348 1172 31741 992 433 ----
NM_213651chr191437 1297 645 584 461 375 355 323 164 1396 ----