TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-379-5p
miRNA Sequence: UGGUAGACUAUGGAACGUAGG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr542069 2055 1846 688 --21970 505 --
NM_000044chrX3367 333 59 ------
NM_000081chr131284 413 131 ------
NM_000084chrX96596 6166 5374 5359 4810 1882 1818 1436 730 26685 2716 ----
NM_000089chr71116 ------
NM_000090chr2--1218 ----
NM_000092chr2--13791 13029 14533
NM_000109chrX62164 1938 896 690 272 163 1597 ----
NM_000112chr575563 5263 4933 4226 4137 1722 507 1799 ----
NM_000129chr631287 584 458 ------
NM_000138chr1522576 2451 --1919 --
NM_000153chr1421710 156 21485 1114 ----
NM_000165chr6--21478 377 ----
NM_000168chr743295 2734 2379 1243 ------
NM_000170chr91404 ------
NM_000176chr543772 3019 1113 465 ------
NM_000208chr1974372 4323 3849 3719 3258 1284 832 197 11103 --
NM_000212chr1761919 844 788 537 443 71 ------
NM_000230chr731892 830 718 22644 1772 ----
NM_000232chr483231 3002 2526 2371 1129 775 415 138 ------
NM_000233chr24650 604 157 137 ------
NM_000252chrX------11309
NM_000253chr43231 103 94 ------
NM_000255chr61320 ------
NM_000259chr1566095 6035 1753 708 617 244 25219 1159 15481 --
NM_000267chr1783326 2816 2648 2349 2171 1339 370 210 ----12209
NM_000276chrX2541 95 2576 158 ----
NM_000284chrX61910 1887 1840 1545 1527 522 1345 ----
NM_000297chr441892 1618 647 162 ------
NM_000304chr171353 1695 ----
NM_000314chr1023012 149 --22911 2786 --
NM_000321chr1341788 1219 1098 450 ------
NM_000332chr667003 6255 4951 2113 447 437 11715 ----
NM_000337chr535885 5552 1468 14428 --11010
NM_000351chrX54024 3812 2867 2834 1549 ------
NM_000362chr2273535 3436 3001 2903 748 573 141 13662 --12782
NM_000367chr631513 612 454 21767 278 ----
NM_000368chr953890 3736 1415 505 227 13507 1921 --
NM_000378chr1161272 1098 960 416 280 185 1378 ----
NM_000391chr1171767 1651 672 603 381 369 68 --11660 --
NM_000393chr231920 1766 1715 21683 758 ----
NM_000396chr14560 489 447 437 ------
NM_000408chr233239 2692 2293 --22596 541 --
NM_000411chr213996 362 352 --12225 13030
NM_000421chr171230 1273 ----
NM_000449chr11990 --1146 --
NM_000459chr91346 183 1872 --
NM_000461chr311523 ------
NM_000462chr1511255 ------
NM_000489chrX43363 3342 3317 1117 23197 709 ----
NM_000503chr861236 610 475 433 172 144 ----1260
NM_000522chr731010 795 449 11242 ----
NM_000555chrX96795 5497 5162 3123 3028 3020 2602 839 360 26161 1055 ----
NM_000572chr1--1727 ----
NM_000615chr1152632 2624 2397 880 727 32923 2373 706 ----
NM_000618chr12126192 6143 5853 5201 5163 4327 4148 2566 2295 1367 1311 483 45489 4169 1693 1209 16102 --
NM_000618chr12126192 6143 5853 5201 5163 4327 4148 2566 2295 1367 1311 483 45489 4169 1693 1209 16102 --
NM_000627chr21825 1781 ----
NM_000633chr1845038 4785 3252 1466 13764 ----
NM_000681chr1041383 1257 962 156 ------
NM_000684chr1031243 1054 64 11263 ----
NM_000693chr151125 --21748 722 --
NM_000719chr1256217 2266 1745 819 191 35120 4661 959 --14198
NM_000723chr1741329 609 322 201 ------
NM_000724chr1021335 86 11975 11430 --
NM_000758chr51284 ------
NM_000782chr2041045 894 284 101 ------
NM_000788chr431358 576 566 ------
NM_000800chr531628 364 174 --11196 --
NM_000811chr51554 1326 ----
NM_000812chr42254 160 ------
NM_000813chr544341 4334 1402 833 34357 3610 1638 ----
NM_000814chr1563991 3846 3232 1683 1157 59 31523 1041 282 ----
NM_000826chr432423 404 344 ------
NM_000829chr1132049 1951 846 --12273 --
NM_000859chr531528 1505 530 1651 ----
NM_000861chr362322 2232 2184 1819 1765 633 ------
NM_000866chr351902 1602 1524 375 313 ------
NM_000868chrX1968 12431 11791 11666
NM_000875chr1576988 6615 5804 5634 2623 2394 500 26470 1425 16665 --
NM_000880chr8159 --1810 --
NM_000885chr22854 73 1743 ----
NM_000891chr1733133 2826 371 --1987 --
NM_000899chr1213898 ----1774
NM_000901chr442390 2261 1822 930 1986 ----
NM_000902chr332327 1252 694 22766 2540 12664 2287 202
NM_000917chr10185 ------
NM_000929chr121155 73 ----11011
NM_000933chr203655 453 425 1522 ----
NM_000937chr171422 ------
NM_000944chr451877 925 757 417 148 ------
NM_000945chr231613 1297 585 ------
NM_000950chrX83568 3340 3286 2875 2496 2377 513 348 22895 69 ----
NM_000961chr2083323 3023 2868 1085 866 332 246 37 11363 --13175
NM_000965chr331054 870 305 --21268 451 1925
NM_001001132chr2121054 177 --1167 --
NM_001001323chr1273163 2331 2012 1940 900 738 234 22675 461 ----
NM_001001330chr101125 --1372 --
NM_001001395chr1221038 952 1434 --2609 522
NM_001001396chr1104168 4039 3207 2818 1790 1172 817 530 420 317 11359 1337 --
NM_001001415chr19--124 ----
NM_001001433chr2053120 2652 2610 728 309 --11193 12799
NM_001001436chr16------1200
NM_001001484chr1061821 1719 1538 858 597 267 1308 ----
NM_001001557chr83762 697 184 --12098 1689
NM_001001664chr223672 664 --11109 --
NM_001001701chr452284 2166 1803 1720 358 ----11659
NM_001001790chr92456 361 --1348 --
NM_001001890chr21103926 3871 3650 3205 2834 2701 1519 1195 961 208 11078 13372 --
NM_001001933chr11203 ------
NM_001001936chr1031061 816 223 11168 ----
NM_001001971chr1041351 1315 1246 523 164 ----
NM_001002027chr17--180 ----
NM_001002033chr17------1332
NM_001002257chr243110 2615 2546 1035 1951 ----
NM_001002269chr92395 29 ------
NM_001002814chr833765 2729 695 42373 1127 647 147 13383 --
NM_001002838chrX31715 235 115 11642 21877 519 11737
NM_001002860chr1454650 4489 3811 3006 396 23390 408 --13822
NM_001002901chr11452 ------
NM_001003406chr2242925 2869 2776 54 ----12699
NM_001003652chr18138634 8520 6215 5943 3488 2811 2782 2705 2446 2193 1876 551 86 45468 5378 2982 559 18031 18727
NM_001003674chr1866930 6921 5464 5178 4490 2518 56766 6119 1726 1420 745 ----
NM_001003675chr1866930 6921 5464 5178 4490 2518 56766 6119 1726 1420 745 ----
NM_001003679chr142157 1829 1408 56 ------
NM_001003688chr441196 971 312 211 ------
NM_001003712chr1263435 3358 3343 2951 619 250 ------
NM_001003760chr643444 2261 983 176 1705 13099 --
NM_001004065chr963798 3467 3325 3010 942 730 --12949 --
NM_001004196chr31346 1386 31111 199 41 --
NM_001004317chr654310 3417 1634 930 31 14115 148 --
NM_001004342chr185016 3817 3757 1988 1727 1609 1171 308 26073 3829 ----
NM_001004360chr221978 462 1371 1173 --
NM_001004720chr21888 ------
NM_001004722chr231057 804 149 --153 --
NM_001005207chr171224 ------
NM_001005366chr121898 ------
NM_001005404chr1784321 4305 4210 4067 3631 1700 1312 1042 13323 ----
NM_001005463chr1021604 815 ------
NM_001005473chr575458 5420 5403 1437 348 302 218 14269 15044 --
NM_001006600chr542240 2150 2095 797 12363 ----
NM_001006612chrX189 ------
NM_001006613chrX189 ------
NM_001006614chrX189 ------
NM_001006623chr24590 385 240 135 141 ----
NM_001006935chrX--122 ----
NM_001006936chrX--122 ----
NM_001006937chrX--122 ----
NM_001007067chr831076 259 123 ------
NM_001007068chr831076 259 123 ------
NM_001007069chr831076 259 123 ------
NM_001007070chr831076 259 123 ------
NM_001007237chr132611 1822 283 --22549 369 --
NM_001007246chr21--11685 ----
NM_001007267chr22231 163 ------
NM_001007277chr113948 441 56 1226 130 --
NM_001007466chr684564 3734 3153 1366 1059 1050 857 395 44689 4232 3762 1228 1423 --
NM_001008239chr1853053 1013 561 407 295 11471 ----
NM_001008405chr741546 1508 422 311 11759 --132
NM_001008495chr831619 748 239 32087 1495 1403 ----
NM_001008539chr854968 3867 1998 656 451 25363 3346 ----
NM_001008564chr132321 57 ------
NM_001008566chr222451 186 ------
NM_001008660chr1111300 ------
NM_001008707chr1441770 1656 606 246 11842 ----
NM_001008783chr61904 ------
NM_001008925chr423514 2715 22304 1341 ----
NM_001008938chr11140 ------
NM_001009554chr4114028 3978 3925 3811 3553 3475 3161 1817 909 388 236 24073 269 1772 --
NM_001009554chr4114028 3978 3925 3811 3553 3475 3161 1817 909 388 236 24073 269 1772 --
NM_001009555chr431774 525 220 ------
NM_001009567chr101689 1459 ----
NM_001009955chr11608 ------
NM_001009955chr11608 ------
NM_001009958chr72557 182 ------
NM_001009960chr722247 633 22567 1791 ----
NM_001010000chr1842788 954 567 455 13389 11411 --
NM_001010853chr662970 2474 994 592 251 113 1480 --13221
NM_001010854chr141706 2586 94 ----
NM_001010861chr132699 2497 1000 72728 2250 2060 1865 1829 1803 50 ----
NM_001010862chrX42675 2595 1309 137 12967 ----
NM_001010867chr1114868 4146 2461 2065 1726 1063 712 543 421 358 90 24481 2176 ----
NM_001010888chrX74098 4009 3764 3693 3183 1222 1072 --14507 --
NM_001010922chr164004 3470 3254 2718 1315 243 23334 924 ----
NM_001010923chr621232 200 1292 ----
NM_001010924chr101125 ------
NM_001010934chr71263 1303 ----
NM_001010986chrX22246 2135 1139 1511 --
NM_001011538chr41678 1949 ----
NM_001011553chr72858 318 ------
NM_001011645chrX3367 333 59 ------
NM_001011666chr766338 6027 5485 4441 4122 1737 1205 ----
NM_001012393chr114875 838 616 254 4923 811 325 209 ----
NM_001012420chr1511166 22836 1150 ----
NM_001012423chr1511166 22836 1150 ----
NM_001012426chr643339 3080 2077 1145 ------
NM_001012427chr643339 3080 2077 1145 ------
NM_001012751chr1031580 1191 525 --1142 --
NM_001013031chr1033501 2976 2948 ------
NM_001013438chr32745 176 ------
NM_001013439chr32591 22 ------
NM_001013635chr123449 399 192 --1937 --
NM_001013690chr1232420 2374 657 22173 179 32495 1799 136 --
NM_001013699chr121153 ------
NM_001013843chr15--1369 ----
NM_001014286chr13170 ------
NM_001014380chr1344889 4607 2330 844 15077 15147 1259
NM_001014434chr12211 175 ------
NM_001014443chr1180 --166 --
NM_001014449chr161238 ------
NM_001014451chr161238 ------
NM_001014797chr1058140 7711 2988 2844 2012 25949 1117 25272 284 --
NM_001014812chr151429 ------
NM_001015045chr462344 1771 1765 606 119 47 12084 ----
NM_001015881chrX146 1793 ----
NM_001015887chr311753 1518 11182 --
NM_001017368chr1762497 2291 2167 2108 2043 742 ----1535
NM_001017369chr421007 165 ------
NM_001017395chr353018 2957 2483 1016 121 12416 11405 --
NM_001017424chr12568 455 1142 1370 --
NM_001017425chr12568 455 1142 1370 --
NM_001017440chr747966 7349 2346 2074 28241 8176 ----
NM_001017523chr1241571 1381 172 124 11250 ----
NM_001017923chr1421694 1137 ------
NM_001017926chr81676 ------
NM_001017930chrX2948 241 2561 293 ----
NM_001017962chr10185 ------
NM_001017969chr92565 265 ------
NM_001017992chr521039 454 ------
NM_001017995chr594672 4633 4441 4240 3173 1813 1632 657 49 44801 4189 3434 2978 11774 --
NM_001018004chr15--195 ----
NM_001018006chr15--195 ----
NM_001018007chr15--195 ----
NM_001018020chr15--195 ----
NM_001018054chr121441 1136 11249 ----
NM_001018056chr91193 ------
NM_001018067chr134770 4073 1450 11370 14278 --
NM_001018068chr134770 4073 1450 11370 14278 --
NM_001018069chr134770 4073 1450 11370 14278 --
NM_001018072chr1241571 1381 172 124 11250 ----
NM_001018074chr543772 3019 1113 465 ------
NM_001018075chr543772 3019 1113 465 ------
NM_001018076chr543772 3019 1113 465 ------
NM_001018077chr543772 3019 1113 465 ------
NM_001018100chr151807 1865 ----
NM_001020658chr1----11453 --
NM_001020658chr1----11453 --
NM_001020825chr521247 494 ------
NM_001023567chr15--12228 ----
NM_001023587chr32995 884 ------
NM_001024094chr543772 3019 1113 465 ------
NM_001024226chr121063 986 ------
NM_001024227chr121063 986 ------
NM_001024228chr121063 986 ------
NM_001024596chr1993521 2982 2855 2587 2443 1175 995 814 372 ------
NM_001024660chr31584 1671 ----
NM_001024666chrX2253 60 1655 ----
NM_001024680chr221527 1417 31672 1282 673 ----
NM_001024688chr831949 798 51 ------
NM_001024847chr351582 996 814 772 343 1878 ----
NM_001024912chr1931586 1461 37 --1700 --
NM_001024947chr52894 189 ------
NM_001025068chr331856 1712 374 --1589 --
NM_001025069chr331856 1712 374 --1589 --
NM_001025076chr10115074 4839 4806 4683 4472 2424 2327 1540 1445 864 638 --14293 --
NM_001025077chr10126432 6197 6164 6041 5830 2898 2803 2222 1996 1105 642 276 1112 15651 --
NM_001025079chr343441 3214 3090 1252 ----1496
NM_001025108chr263143 3072 1324 1296 1248 596 --24177 1447 --
NM_001025252chr883191 2730 2563 2102 2087 2055 1052 474 192 ----
NM_001025253chr883191 2730 2563 2102 2087 2055 1052 474 192 ----
NM_001025266chr3114041 3797 3683 3476 3263 1664 1404 1343 1337 830 96 ------
NM_001025580chrX44314 3791 2955 1060 ------
NM_001025595chr41371 11290 ----
NM_001025603chr11990 --1146 --
NM_001025777chr22483 79 11330 1394 --
NM_001029835chr72377 150 ------
NM_001029839chr31593 ------
NM_001029840chr31593 ------
NM_001029858chr643209 2216 944 102 12089 ----
NM_001029863chr662506 2451 2098 1132 1000 805 --12838 --
NM_001029884chr632643 2378 640 1984 12065 --
NM_001030007chr1643213 2747 537 400 ------
NM_001030055chr1411748 44695 4263 3218 1862 ----
NM_001031679chr1212339 22856 789 ----
NM_001031684chr231501 1325 42 11200 ----
NM_001031692chr7168 ------
NM_001031695chr2244247 1404 1247 202 1320 ----
NM_001031700chr422445 589 22002 845 ----
NM_001031716chr2--11012 1320 --
NM_001031732chr421109 69 23566 2380 21026 99 --
NM_001031804chr1643349 3102 2997 1612 ----1859
NM_001031812chr521914 1759 ------
NM_001033002chr17------1237
NM_001033045chr241778 1563 980 624 23172 463 ----
NM_001033049chr21102103 1982 1968 1704 1692 1531 784 311 290 238 --11551 --
NM_001033057chr3128 ------
NM_001033081chr151638 1608 1589 1404 1256 --1278 --
NM_001033082chr151638 1608 1589 1404 1256 --1278 --
NM_001033085chr21118 ------
NM_001033117chr384807 4674 4624 4591 3806 3322 1474 517 24419 1096 23166 703 --
NM_001033507chr121789 431 --1356 --
NM_001033521chr203487 156 39 ------
NM_001033522chr203487 156 39 ------
NM_001033557chr211093 --1382 --
NM_001033578chr83324 311 41 1712 ----
NM_001033602chr132521 497 1218 12416 --
NM_001033723chr852541 1975 799 792 333 ------
NM_001033925chr101173 21850 1498 --12085
NM_001034025chr1231023 867 57 --1153 --
NM_001034915chr81113 ----1379
NM_001035003chr4--150 --1998
NM_001035004chr4--150 --1998
NM_001035254chr962305 2233 1830 965 898 396 --12339 12369
NM_001037132chr731669 1369 678 11392 ----
NM_001037133chr731669 1369 678 11392 ----
NM_001037164chr721251 73 21892 526 41916 604 325 94 --
NM_001037165chr7108850 7709 7222 7013 6601 2566 2397 2326 1556 661 27904 3494 ----
NM_001037172chr341229 918 908 385 ------
NM_001037174chr232143 1827 54 ------
NM_001037317chr132699 2497 1000 72728 2250 2060 1865 1829 1803 50 ----
NM_001037334chr1821776 355 --12369 --
NM_001037339chr141754 1361 1350 33 --11198 1391
NM_001037340chr141754 1361 1350 33 --11198 1391
NM_001037341chr141754 1361 1350 33 --11198 1391
NM_001037341chr141754 1361 1350 33 --11198 1391
NM_001037535chrX41528 1278 264 79 --1164 --
NM_001037536chrX41528 1278 264 79 --1164 --
NM_001037540chrX41528 1278 264 79 --1164 --
NM_001037872chr22648 265 ------
NM_001037954chr1143357 3274 3098 255 --21256 970 --
NM_001038707chr151645 725 528 168 126 41974 1871 832 25 --1628
NM_001038707chr151645 725 528 168 126 41974 1871 832 25 --1628
NM_001039350chr711804 ------
NM_001039479chr143905 875 164 1191 ----
NM_001039538chr243467 2923 1120 295 12702 ----
NM_001039547chr367819 6183 3078 3036 1660 1053 57490 5595 3016 2809 339 27159 997 --
NM_001039569chr212167 23005 1248 ----
NM_001039570chr2264242 4126 3958 3847 1672 110 21467 876 14109 --
NM_001039571chr2264242 4126 3958 3847 1672 110 21467 876 14109 --
NM_001039618chr1155312 5258 5215 3967 827 11692 35025 338 33 --
NM_001039693chr254118 4032 4015 1600 137 43958 3455 2911 2580 ----
NM_001039711chr13288 217 81 ------
NM_001039712chr13288 217 81 ------
NM_001039840chrX55000 4803 4345 4143 604 25829 2065 1882 --
NM_001039937chr1364065 3129 2756 2608 1581 748 ------
NM_001040001chr651929 1506 563 486 31 21513 183 ----
NM_001040020chr711079 ------
NM_001040057chr721307 469 --11293 --
NM_001040100chr34437 228 144 136 1877 ----
NM_001040108chr1463181 3126 2471 2004 1145 258 1535 21318 418 --
NM_001040113chr162945 713 1642 ----
NM_001040142chr272299 2249 1938 616 445 93 41 12282 ----
NM_001040143chr272299 2249 1938 616 445 93 41 12282 ----
NM_001040152chr785002 4756 4161 3662 1466 1433 1178 410 13208 23406 591 1532
NM_001040157chr482893 2708 2141 2010 925 769 350 195 12871 ----
NM_001040159chr431513 567 546 ------
NM_001040181chr321040 186 ------
NM_001040182chr321040 186 ------
NM_001040183chr321040 186 ------
NM_001040199chr321040 186 ------
NM_001040200chr321040 186 ------
NM_001040202chr432593 2238 1593 22354 663 ----
NM_001040214chr61895 31869 879 756 ----
NM_001040284chr1624398 2017 35713 2115 487 ----
NM_001040409chr2193 ------
NM_001040429chr1342722 2307 1004 479 --1404 11268
NM_001040432chr31133 ------
NM_001040441chr133548 317 34 35124 1748 893 ----
NM_001040446chr552099 958 922 878 299 ------
NM_001040450chr1532067 1860 554 22762 1149 1873 --
NM_001040453chr1532067 1860 554 22762 1149 1873 --
NM_001040653chr3199 1700 ----
NM_001040665chr7104953 4658 4334 3952 3702 3365 3184 2015 1555 39 24937 845 ----
NM_001040708chr81154 1785 ----
NM_001040712chr963316 3151 2827 1377 1147 926 12761 ----
NM_001042355chr1655244 5188 4053 3931 531 --1455 --
NM_001042357chr1031410 452 188 ------
NM_001042358chr1031410 452 188 ------
NM_001042360chr1031410 452 188 ------
NM_001042363chr1031410 452 188 ------
NM_001042389chr1031410 452 188 ------
NM_001042390chr1031410 452 188 ------
NM_001042392chr1031410 452 188 ------
NM_001042395chr1031410 452 188 ------
NM_001042403chr121383 1292 2789 217 --
NM_001042404chr141861 1833 1342 607 ------
NM_001042412chr1655244 5188 4053 3931 531 --1455 --
NM_001042413chr941625 1219 747 356 13895 22850 919 --
NM_001042414chr13164 ------
NM_001042424chr44974 911 704 187 21161 835 ----
NM_001042473chr1042007 1455 806 251 21752 223 1309 --
NM_001042478chr1121 ------
NM_001042481chr1442465 2184 928 755 1395 ----
NM_001042492chr1783326 2816 2648 2349 2171 1339 370 210 ----12209
NM_001042494chr1573814 3363 3346 2703 2590 1470 578 33305 2869 1168 ----
NM_001042495chr1573814 3363 3346 2703 2590 1470 578 33305 2869 1168 ----
NM_001042496chr1573814 3363 3346 2703 2590 1470 578 33305 2869 1168 ----
NM_001042497chr1573814 3363 3346 2703 2590 1470 578 33305 2869 1168 ----
NM_001042506chrX41326 450 330 58 ------
NM_001042510chr821585 43 ------
NM_001042511chr821585 43 ------
NM_001042533chr363144 2815 2671 2386 986 611 1111 ----
NM_001042537chrX42476 1962 1900 1547 ------
NM_001042543chr411527 21355 64 ----
NM_001042555chr1274138 3931 3511 3490 1263 1064 732 11606 ----
NM_001042599chr297820 7603 6903 6135 4751 2697 1757 729 86 15521 11056 11976
NM_001042601chr322674 2444 ------
NM_001042603chr1295367 3503 3445 3387 3329 991 766 558 251 2807 179 ----
NM_001042604chr323005 45 11320 --14700
NM_001042724chr191720 --1132 --
NM_001042749chrX21353 404 ------
NM_001042750chrX21353 404 ------
NM_001042751chrX21353 404 ------
NM_001044385chr243870 3736 3352 583 ------
NM_001044722chr521914 1759 ------
NM_001044723chr521914 1759 ------
NM_001071775chr1341806 1481 574 195 11545 --1313
NM_001079874chr131552 848 552 1467 ----
NM_001083620chr432421 403 343 ------
NM_001092chr1732460 1721 826 --22344 776 1797
NM_001095chr1251301 1200 174 168 83 --21373 304 1317
NM_001099678chr3115685 5582 5568 5127 5010 4482 2374 1766 1708 1068 153 25295 4851 35967 4272 2198 --
NM_001100108chr166973 6020 3056 2759 409 150 36168 5526 3230 16812 --
NM_001106chr3168103 7289 7262 7072 7064 6057 3802 3174 2152 1474 898 490 483 418 217 122 78868 8859 8245 7875 7584 2452 202 --11094
NM_001113490chrX32719 2237 176 23020 3010 11342 --
NM_001126chr11360 ------
NM_001128chr1643213 2747 537 400 ------
NM_001146chr831852 1579 189 ----11815
NM_001148chr4----11655 --
NM_001159chr21720 ------
NM_001167chrX76354 5845 5592 1651 1444 1392 836 14135 --26402 2254
NM_001173chr1411748 44695 4263 3218 1862 ----
NM_001186chr2112165 2958 730 --1120
NM_001198chr6102448 2388 2376 2308 2252 1878 1593 767 413 254 1793 ----
NM_001200chr2041045 955 949 450 ------
NM_001201chr443235 2747 1441 636 ------
NM_001204chr275997 5247 3110 2401 1764 1136 599 14937 13117 --
NM_001206chr932649 1973 620 ------
NM_001219chr722302 1523 ------
NM_001237chr42327 318 ------
NM_001237chr42327 318 ------
NM_001238chr191500 ------
NM_001241chr231710 911 559 ------
NM_001241chr231710 911 559 ------
NM_001254chr172309 189 1240 ----
NM_001256chr1712712 1208 ----
NM_001257chr16288 65 11236 ----
NM_001259chr7135740 5232 4629 4579 3843 2198 2080 1651 1443 1325 1315 764 164 21492 1085 35802 2167 1123 --
NM_001260chr131250 ------
NM_001270chr52258 147 1107 ----
NM_001284chr51522 ----274 59
NM_001304chr173939 582 331 13840 22548 775 11526
NM_001310chr1231026 980 860 2652 138 ----
NM_001319chr19--11039 ----
NM_001324chr203487 156 39 ------
NM_001329chr1041489 1233 419 174 ------
NM_001332chr52402 365 ------
NM_001356chrX2869 628 ------
NM_001364chr1184548 3593 3284 3134 3093 2968 1633 270 11711 11870 --
NM_001386chr811673 1748 12119 1909
NM_001390chr1853618 3162 2907 1380 444 13022 ----
NM_001391chr1811097 ------
NM_001396chr2142203 1915 1909 1865 ------
NM_001402chr621933 1743 11853 ----
NM_001407chr371501 1189 1156 1120 1080 695 130 ------
NM_001412chrX63325 3169 2840 2478 1420 454 --12916 1247
NM_001417chr1231555 395 74 --11737 --
NM_001418chr113568 483 279 1742 1691 1188
NM_001418chr113568 483 279 1742 1691 1188
NM_001430chr231849 211 32 ------
NM_001431chr63937 295 182 1817 ----
NM_001438chr143449 1330 350 189 22428 1069 33310 1211 328 --
NM_001448chrX21693 1583 166 ----
NM_001451chr161967 ------
NM_001463chr21108 ------
NM_001482chr153840 307 200 ------
NM_001491chr632579 1048 869 12252 ----
NM_001494chr101720 ------
NM_001497chr912164 32710 95 63 ----
NM_001498chr63951 465 354 ------
NM_001518chr721106 125 --1145 --
NM_001542chr132611 1822 283 --22549 369 --
NM_001546chr611064 1407 ----
NM_001554chr11660 ------
NM_001565chr42245 220 ------
NM_001587chrX2541 95 2576 158 ----
NM_001614chr171648 ------
NM_001614chr171648 ------
NM_001616chr263254 2866 2715 2625 2406 1132 ------
NM_001621chr73932 565 249 12089 ----
NM_001621chr73932 565 249 12089 ----
NM_001642chr1121261 886 ------
NM_001650chr181356 22964 883 --1338
NM_001658chr121063 986 ------
NM_001660chr3----1150 --
NM_001663chr1431095 1044 994 11794 ----
NM_001668chr11634 ------
NM_001677chr141055 762 400 197 ------
NM_001682chr1242877 2045 614 452 22389 175 ----
NM_001684chr193885 3756 2924 1507 889 534 247 137 34 11076 154 --
NM_001693chr82970 895 11083 --2852 100
NM_001698chr9----1349 --
NM_001701chr921382 45 ------
NM_001709chr1142476 1867 402 216 21911 935 ----
NM_001718chr631132 58 34 ----1422
NM_001729chr4--1365 ----
NM_001740chr162531 356 --166 1518
NM_001742chr721749 1606 1484 ----
NM_001743chr21609 ------
NM_001744chr51477 ------
NM_001754chr21103926 3871 3650 3205 2834 2701 1519 1195 961 208 11078 13372 --
NM_001755chr1661793 926 854 636 542 160 ----1615
NM_001759chr12114597 3868 3839 3489 3473 3278 1996 1986 1595 615 112 ------
NM_001769chr12----134 1367
NM_001777chr343441 3214 3090 1252 ----1496
NM_001788chr72858 318 ------
NM_001789chr3153 ------
NM_001792chr181733 ----198
NM_001797chr161568 ------
NM_001812chr4----1305 --
NM_001827chr92246 233 ------
NM_001830chrX44062 3645 2878 1572 13759 ----
NM_001845chr133877 380 170 ------
NM_001846chr13------1110
NM_001858chr655011 4141 1639 1473 534 11965 ----
NM_001859chr953901 3869 1574 1076 165 23679 627 11165 --
NM_001861chr16----1123 --
NM_001873chr42540 32 ------
NM_001881chr101379 ------
NM_001893chr172357 49 ------
NM_001901chr61984 ----1175
NM_001903chr51794 ------
NM_001918chr189188 7142 5961 2662 2206 1427 1135 913 46592 2715 2258 411 21270 1079 --
NM_001920chr123766 650 112 ------
NM_001924chr1--1473 ----
NM_001936chr711804 ------
NM_001939chrX21471 1400 12630 22500 435 --
NM_001949chr63932 876 454 1681 12677 --
NM_001950chr161648 ------
NM_001955chr611026 2989 746 ----
NM_001957chr452326 2230 2204 925 417 ------
NM_001964chr55974 255 177 156 140 ------
NM_001968chr41316 ------
NM_001970chr172573 420 ------
NM_001980chr1222184 1717 22294 563 ----
NM_002006chr455574 3608 1628 1078 405 25037 1509 --11819
NM_002009chr1552507 2156 822 520 302 ------
NM_002015chr1311144 12050 1830 --
NM_002025chrX159093 7887 7879 6679 6600 5784 3372 3041 2406 2333 1915 1123 911 421 43 150 16303 12105
NM_002033chr1133599 927 62 53784 1490 1409 347 144 ----
NM_002035chr1823240 902 ------
NM_002060chr11496 ------
NM_002061chr131702 1661 236 11341 ----
NM_002063chrX11032 ------
NM_002076chr1263190 2963 1085 1004 718 189 13128 ----
NM_002089chr42462 233 ------
NM_002090chr41158 ------
NM_002114chr61530 ------
NM_002126chr1743742 3580 2905 1380 3657 636 101 ----
NM_002128chr1341888 739 602 35 ------
NM_002156chr22173 21 ------
NM_002158chr233299 3219 1242 13794 ----
NM_002160chr9--160 ----
NM_002203chr573466 3333 3182 2708 1514 1034 275 ------
NM_002210chr233303 2574 462 13359 ----
NM_002214chr7105104 4822 4419 4324 4163 2127 2014 1403 1246 950 15055 ----
NM_002227chr111301 2957 823 ----
NM_002229chr191173 ------
NM_002240chr211159 1450 ----
NM_002264chr334878 1993 1292 23872 3740 34792 3764 3308 --
NM_002266chr17--168 ----
NM_002267chr1332134 800 641 21625 616 ----
NM_002268chr321703 729 ------
NM_002269chr61400 ------
NM_002270chr564060 2181 1613 1089 965 695 14941 33970 3748 301 1997
NM_002271chr1312124 2829 186 ----
NM_002285chr263143 3072 1324 1296 1248 596 --24177 1447 --
NM_002310chr5126040 5912 4735 4096 2460 2199 1914 1388 1270 509 449 264 ------
NM_002334chr111379 1226 --1156
NM_002336chr1244291 3749 1553 1294 22003 1641 1733 --
NM_002356chr652768 1754 553 260 93 12883 11940 11076
NM_002361chr191224 ------
NM_002374chr243467 2923 1120 295 12702 ----
NM_002381chr221038 1011 2675 294 ----
NM_002382chr1421004 447 ------
NM_002387chr5104953 3988 3670 3190 1778 1443 1259 958 489 27 14612 --13487
NM_002395chr63567 382 231 --11461 --
NM_002397chr531841 755 648 ------
NM_002399chr1511199 --11234 --
NM_002438chr101689 1459 ----
NM_002444chrX41431 1407 800 571 11501 ----
NM_002473chr2231344 1076 498 1948 2912 884 1428
NM_002480chr121285 ------
NM_002485chr831949 798 51 ------
NM_002499chr151406 1590 ----
NM_002500chr2166 ------
NM_002508chr131991 1608 51 ------
NM_002514chr811188 ------
NM_002515chr1431844 582 43 2277 167 ----
NM_002519chr1121454 617 ------
NM_002526chr661448 1174 1083 334 241 64 ------
NM_002537chr152279 22 ------
NM_002544chr172354 322 ------
NM_002545chr114875 838 616 254 4923 811 325 209 ----
NM_002552chr241258 453 291 132 ------
NM_002553chr7--1193 ----
NM_002570chr1531044 915 308 11000 1461 --
NM_002572chr111392 153 ----
NM_002577chr342817 800 629 101 --12728 --
NM_002581chr954901 4890 859 688 142 34585 3933 1855 34651 928 130 --
NM_002589chr4155 ------
NM_002600chr141754 1361 1350 33 --11198 1391
NM_002601chr22355 62 ------
NM_002605chr152801 340 --1958 --
NM_002607chr711179 --11243 --
NM_002612chr73527 438 43 11842 ----
NM_002613chr1644974 3668 3649 1964 14215 ----
NM_002628chr331232 779 99 ------
NM_002634chr173725 604 204 --1360 1168
NM_002641chrX21891 385 ----1641
NM_002645chr1132692 2167 1914 2855 390 ----
NM_002646chr142143 1630 1475 836 1741 1262 --
NM_002648chr63844 523 500 ------
NM_002655chr834104 3889 356 --1196 11777
NM_002657chr2083482 2795 2593 2499 934 748 661 583 22886 845 ----
NM_002660chr201423 ------
NM_002670chr321237 54 31339 194 23 ----
NM_002687chr14------1147
NM_002709chr223586 520 ------
NM_002713chr111040 ------
NM_002715chr531065 514 446 ------
NM_002719chr14--11715 1746 --
NM_002731chr122172 1053 ------
NM_002734chr1762018 1974 846 757 618 504 ------
NM_002737chr1766246 4917 1566 1508 1047 510 22335 2090 11702 --
NM_002748chr152908 491 ------
NM_002752chr51541 ------
NM_002760chrY65973 5215 5130 4494 752 229 --13855 --
NM_002814chrX2609 214 ------
NM_002815chr17197 ------
NM_002822chr1241719 1391 1328 502 ------
NM_002828chr183998 954 73 1675 ----
NM_002834chr1283919 3779 2760 2558 1242 1145 980 780 2908 481 ----
NM_002837chr1284590 3995 3752 3153 2967 2873 1623 375 13483 ----
NM_002839chr963316 3151 2827 1377 1147 926 12761 ----
NM_002840chr111537 11315 ----
NM_002841chr31215 ------
NM_002843chr1152284 1169 1147 410 403 --12963 --
NM_002844chr611173 ------
NM_002852chr31584 ------
NM_002857chr142378 738 715 374 21699 231 1105 --
NM_002858chr11350 11325 ----
NM_002868chr1242455 2259 2240 1848 ------
NM_002874chr941681 756 704 177 --12009 --
NM_002886chr344837 1039 745 637 1589 21756 780 14360
NM_002887chr5--135 ----
NM_002890chr51706 ------
NM_002892chr141668 ------
NM_002906chr111788 22327 451 ----
NM_002912chr61300 ------
NM_002923chr11436 ------
NM_002928chr121497 1439 11488 ----
NM_002938chr461982 1569 735 530 394 68 11864 31628 1409 378 --
NM_002942chr321216 472 ------
NM_002971chr311029 ------
NM_002973chr122495 48 158 ----
NM_002977chr243343 303 79 26 --12366 --
NM_002998chr841912 1493 686 412 11732 11520 --
NM_003010chr1732428 1795 876 2710 634 11882 1747
NM_003011chr941432 1196 208 141 1450 1467 --
NM_003017chr6----1565 --
NM_003026chr951116 1107 1002 966 260 ----1346
NM_003030chr321741 1416 ------
NM_003034chr12168105 7953 6944 6899 6596 6081 5717 5123 3053 2492 1584 1554 1396 947 760 578 25095 4909 16215 12145
NM_003036chr141198 1029 464 179 11236 ----
NM_003042chr322197 2051 ------
NM_003043chr343919 1407 74 43 21419 366 ----
NM_003046chr854968 3867 1998 656 451 25363 3346 ----
NM_003051chr131558 1260 63 179 ----
NM_003070chr92117 61 --1598 --
NM_003074chr311863 1328 ----
NM_003079chr172413 308 1723 ----
NM_003100chr5----1352 --
NM_003107chr652223 2147 1870 395 231 --12412 --
NM_003108chr265176 2074 1810 824 779 486 15999 16564 --
NM_003110chr172882 187 ----1924
NM_003112chr7143 32765 2289 1050 12630 --
NM_003113chr2132 --1755 --
NM_003153chr1211148 2196 42 1754 --
NM_003155chr82220 118 41831 569 264 251 ----
NM_003161chr1763247 2745 1388 1187 1122 793 13489 11138 --
NM_003178chr3----1171 --
NM_003188chr61633 ------
NM_003199chr1845631 5292 3577 1353 24160 3884 ----
NM_003211chr1211401 1541 ----
NM_003216chr2273173 2960 2887 2450 2060 544 50 --12495 --
NM_003217chr121255 11898 ----
NM_003221chr631566 1255 211 33247 2662 881 ----
NM_003242chr351582 996 814 772 343 1878 ----
NM_003246chr1541410 1276 302 267 11720 ----
NM_003247chr621270 316 ------
NM_003253chr2181901 1881 1834 1503 710 575 382 56 ------
NM_003257chr1511008 170 ----
NM_003262chr345069 4973 1211 107 11602 ----
NM_003274chr2162910 2454 2077 1972 1901 327 --2975 478 --
NM_003289chr91181 ------
NM_003292chr121560 839 22155 265 1230 --
NM_003302chr71145 ------
NM_003304chr321462 494 ------
NM_003318chr61229 ------
NM_003320chr1164356 3667 3456 3356 2706 1669 ------
NM_003337chr531446 1074 50 ------
NM_003338chr1031778 120 84 ------
NM_003339chr521326 517 --1128 --
NM_003340chr4----1131 --
NM_003342chr1763225 3042 1279 988 914 81 ------
NM_003345chr16158 ------
NM_003350chr84847 365 268 44 ------
NM_003369chr1142247 301 289 41 32258 1769 695 12010 --
NM_003373chr1051944 1783 1292 329 244 2699 39 ----
NM_003380chr101200 ------
NM_003383chr91193 ------
NM_003387chr231121 1013 22 11866 ----
NM_003392chr333014 1715 1505 ----12913
NM_003400chr21881 ----1829
NM_003410chrX43046 2064 602 304 1439 ----
NM_003411chrY1606 ------
NM_003412chr313021 21068 136 12873 --
NM_003439chr773154 2624 887 688 626 591 155 12359 ----
NM_003442chr112865 283 ------
NM_003445chr19--1104 ----
NM_003453chr13188 ------
NM_003458chr353902 3699 3444 1138 1026 22961 1210 11261 --
NM_003463chr632849 2502 507 2573 130 --23101 944
NM_003468chr234315 1307 299 --187 --
NM_003471chr331527 716 146 22375 2068 ----
NM_003478chr1153204 3190 857 837 123 11201 11219 --
NM_003483chr1232836 791 25 12709 ----
NM_003489chr2133439 3298 1359 ------
NM_003496chr73834 734 645 ------
NM_003557chr161586 1352 1303 1292 1199 95 138 ----
NM_003558chr91551 1205 1503 --
NM_003566chr1253277 2635 2168 686 494 ------
NM_003569chr65685 668 549 466 290 ------
NM_003574chr1854911 3880 1374 911 481 14968 166 --
NM_003580chr81527 2412 110 ----
NM_003581chr21888 ------
NM_003583chr1233141 1473 107 ------
NM_003590chr222895 923 1553 12955 --
NM_003591chr101127 ------
NM_003595chr222451 186 ------
NM_003597chr231445 1425 298 ------
NM_003603chr431974 1740 499 ------
NM_003607chr153512 3419 3117 898 270 13434 13072 --
NM_003615chr363934 3926 2603 939 820 434 --24035 287 12957
NM_003629chr123279 2179 --11374 12439
NM_003630chr61675 ------
NM_003642chr21118 ------
NM_003646chr111568 ------
NM_003651chr122590 162 ------
NM_003659chr2------1771
NM_003660chr192315 268 ------
NM_003663chr343307 3147 976 314 21373 1202 ----
NM_003692chr92369 248 1679 ----
NM_003714chr542641 2486 2390 2053 33043 2090 77 ----
NM_003749chr1362074 2020 1921 1495 810 617 ------
NM_003758chr15--31021 337 86 ----
NM_003758chr15--31021 337 86 ----
NM_003759chr443264 3076 2747 950 --22983 2708 --
NM_003763chr2053120 2652 2610 728 309 --11193 12799
NM_003766chr172451 104 ------
NM_003769chr12--1278 ----
NM_003778chr32749 741 ----1778
NM_003787chr1821393 1141 ------
NM_003797chr113186 152 143 ------
NM_003799chr1843058 1288 715 346 --22997 2916 --
NM_003800chr622339 823 1470 ----
NM_003816chr82953 373 ------
NM_003828chrX1516 ------
NM_003840chr83848 486 39 1112 ----
NM_003842chr842420 981 771 707 --2640 41 --
NM_003858chr141606 ------
NM_003870chr1511765 12033 ----
NM_003877chr123899 781 191 ------
NM_003884chr31406 21322 1170 1665 --
NM_003887chr252297 1845 1679 1509 929 ------
NM_003895chr211700 1395 ----
NM_003913chr663754 3558 3245 1211 1161 1101 13952 ----
NM_003930chr751998 711 665 261 36 1829 --1317
NM_003934chr911026 ------
NM_003941chr721717 221 32255 2218 98 ----
NM_003958chr683747 2934 2709 1565 1331 506 402 248 13468 23354 713 --
NM_003968chr31576 ------
NM_003971chr172243 64 1158 ----
NM_003980chr61384 11135 ----
NM_003982chr14----147 --
NM_003983chr1654032 3456 3052 2971 1173 13525 --12923
NM_003994chr1213898 ----1774
NM_004006chrX62164 1938 896 690 272 163 1597 ----
NM_004007chrX62164 1938 896 690 272 163 1597 ----
NM_004009chrX62164 1938 896 690 272 163 1597 ----
NM_004010chrX62164 1938 896 690 272 163 1597 ----
NM_004011chrX62164 1938 896 690 272 163 1597 ----
NM_004012chrX62164 1938 896 690 272 163 1597 ----
NM_004013chrX62164 1938 896 690 272 163 1597 ----
NM_004014chrX62164 1938 896 690 272 163 1597 ----
NM_004015chrX62164 1938 896 690 272 163 1597 ----
NM_004016chrX62078 1852 810 604 186 77 1511 ----
NM_004017chrX62164 1938 896 690 272 163 1597 ----
NM_004018chrX62078 1852 810 604 186 77 1511 ----
NM_004019chrX2402 294 ------
NM_004020chrX62164 1938 896 690 272 163 1597 ----
NM_004021chrX62078 1852 810 604 186 77 1511 ----
NM_004022chrX62078 1852 810 604 186 77 1511 ----
NM_004023chrX62078 1852 810 604 186 77 1511 ----
NM_004028chr181356 22964 883 --1338
NM_004040chr231314 954 127 11244 ----
NM_004067chr721591 437 11053 ----
NM_004079chr132963 2490 715 3669 653 258 ----
NM_004089chrX146 1793 ----
NM_004099chr941975 1462 1384 703 11401 ----
NM_004109chr1131533 767 37 11645 1310 --
NM_004112chr1751652 1426 456 449 135 ------
NM_004119chr133563 149 143 1669 ----
NM_004133chr811916 22647 912 ----
NM_004136chr1533156 2369 2299 13055 22134 1140 13127
NM_004171chr11119010 8948 8887 7861 7631 3481 3300 2769 2479 648 114 33828 1442 1115 ----
NM_004172chr511564 ------
NM_004180chr21259 ------
NM_004187chrX11317 ------
NM_004202chrY2545 26 ------
NM_004209chr1621085 833 ------
NM_004215chr81524 ------
NM_004225chr821277 1206 ------
NM_004226chr21250 ------
NM_004232chr1863714 2926 2460 1479 686 63 ----11236
NM_004235chr92790 623 1221 ----
NM_004242chr62439 431 2105 68 ----
NM_004251chrX--1102 ----
NM_004261chr11755 ------
NM_004263chr231754 1631 489 ------
NM_004267chr31357 ------
NM_004273chr1094943 4762 4608 4399 3627 3616 3332 3215 56 24619 3747 --23098 526
NM_004274chr1452924 2818 2609 2561 490 52181 1043 1031 666 290 ----
NM_004277chr621370 88 --11534 --
NM_004279chr73672 315 252 2502 359 ----
NM_004282chr63731 637 193 1614 ----
NM_004293chr943878 3664 3083 1007 ------
NM_004301chr32352 23 ------
NM_004302chr1282858 2544 2381 2168 833 530 198 94 32627 2492 2191 ----
NM_004319chr132461 349 327 1203 1774 1307
NM_004323chr992523 2238 2188 2042 1973 880 256 75 54 ------
NM_004326chr13492 335 165 ------
NM_004327chr2252191 1972 1735 816 337 1126 --12027
NM_004329chr103436 407 50 ------
NM_004330chr15--1975 ----
NM_004331chr842656 2356 1988 234 12050 ----
NM_004338chr1866930 6921 5464 5178 4490 2518 56766 6119 1726 1420 745 ----
NM_004342chr742351 2112 1817 257 12187 11696 --
NM_004344chrX123 ------
NM_004349chr81954 1349 ----
NM_004359chr19----130 --
NM_004362chr42499 86 1464 1703 --
NM_004379chr21284 11627 ----
NM_004384chr521914 1759 ------
NM_004392chr1322626 2458 ------
NM_004393chr3----1513 --
NM_004397chr1164261 3854 3407 1586 1415 608 ----21281 816
NM_004417chr5----1417 --
NM_004423chr372603 2424 796 673 507 468 223 22666 1817 ----
NM_004430chr822331 1805 11701 1609 --
NM_004432chr93486 435 229 21674 776 ----
NM_004434chr1441770 1656 606 246 11842 ----
NM_004438chr211308 --142 --
NM_004440chr611229 ------
NM_004441chr331341 1280 1134 ------
NM_004450chr141295 ------
NM_004480chr141263 ------
NM_004481chr142308 2127 484 276 --12179 --
NM_004482chr21247 ------
NM_004497chr192666 117 ------
NM_004500chr1431264 714 44 --11899 --
NM_004501chr123919 3506 ------
NM_004504chr232875 1897 564 2837 666 --12970
NM_004505chr171584 11720 --1326
NM_004514chr1752651 2635 929 486 248 12332 22860 1056 --
NM_004521chr102248 91 --1283 --
NM_004523chr1031169 1148 442 ------
NM_004537chr121492 --2523 44 --
NM_004538chrX3752 193 145 ----1649
NM_004559chr11337 123 ----
NM_004569chr14--1219 ----
NM_004571chr2143276 2132 1115 576 11025 ----
NM_004580chr1521903 1679 ------
NM_004586chrX35119 3727 3658 24365 1598 --14857
NM_004612chr954601 4519 4099 3892 79 --1240 --
NM_004631chr121441 1136 11249 ----
NM_004637chr361302 1250 1092 542 432 376 11045 1252 --
NM_004654chrY1448 ------
NM_004655chr1711303 ------
NM_004661chr541086 992 848 387 ----1380
NM_004663chr151256 ------
NM_004667chr151260 1641 ----
NM_004686chr821799 304 ------
NM_004694chr17196 ------
NM_004703chr1732177 1890 790 1534 ----
NM_004705chr113598 308 134 ------
NM_004713chr141186 --1652 --
NM_004715chr18----1194 --
NM_004717chr761568 1373 980 392 125 48 ------
NM_004719chr1231921 1115 165 1886 22847 662 --
NM_004726chrX45424 2298 815 764 1544 --142
NM_004730chr51691 ------
NM_004734chr1333224 927 201 ------
NM_004736chr11285 ------
NM_004737chr2231236 1199 187 ------
NM_004744chr413767 12437 ----
NM_004745chr866829 6007 5455 4422 1970 1088 32635 1832 934 25722 2211 15936
NM_004747chr104356 321 201 97 ------
NM_004748chr1543080 2893 653 611 --14006 13450
NM_004755chr143876 846 112 ----1325
NM_004760chr712260 12221 --1411
NM_004766chr3121 ------
NM_004768chr13948 783 461 --1798 --
NM_004772chr531202 1074 230 ------
NM_004775chr1822169 135 --11727 --
NM_004776chr203338 84 27 13075 ----
NM_004781chr131726 568 485 ------
NM_004781chr131726 568 485 ------
NM_004788chr1121676 949 --12529 --
NM_004796chr1431885 1581 46 22315 861 ----
NM_004805chr221440 413 ------
NM_004808chr1033180 2869 2326 33022 829 643 ----
NM_004815chr184905 4241 3849 3785 3226 3021 935 565 34748 1881 1204 ----
NM_004831chr191206 ------
NM_004834chr233134 1148 909 31185 901 250 13374 --
NM_004836chr21614 ------
NM_004841chr171085 915 814 723 423 83 65 ------
NM_004842chr621703 1295 ------
NM_004849chr62542 531 31322 1135 1051 ----
NM_004850chr211318 21625 372 ----
NM_004857chr1464085 3949 3652 1589 1030 749 1172 14041 13718
NM_004859chr1742737 2485 756 55 --12244 --
NM_004863chr1445273 3966 1198 277 44773 3716 1631 657 11191 --
NM_004866chr531716 1595 169 24211 1283 ----
NM_004869chr1831514 1453 61 1101 ----
NM_004874chr81507 ------
NM_004887chr5--1171 ----
NM_004898chr432511 2011 703 ------
NM_004904chr766338 6027 5485 4441 4122 1737 1205 ----
NM_004925chr92825 125 ------
NM_004929chr821051 213 --1565 1547
NM_004948chr1811018 11308 ----
NM_004956chr743770 3063 1686 489 44143 3447 3130 1649 --23897 161
NM_004969chr101447 ------
NM_004976chr1154932 3304 1410 1240 1104 1639 11098 --
NM_004985chr121132 --14253 --
NM_004992chrX107080 6614 5657 5384 2059 1570 1363 1236 639 421 --18058 --
NM_004992chrX107080 6614 5657 5384 2059 1570 1363 1236 639 421 --18058 --
NM_005010chr731669 1369 678 11392 ----
NM_005017chr31236 ------
NM_005022chr17--1244 ----
NM_005023chr521120 350 ------
NM_005028chr1052092 2069 1954 599 122 11458 ----
NM_005044chrX63734 3649 3013 1824 1580 46 --1615 --
NM_005045chr71678 ------
NM_005056chr1295611 3747 3689 3631 3573 1235 1010 802 495 21051 423 ----
NM_005057chr131770 1570 768 ------
NM_005065chr1423314 1558 21982 1468 1293 12150
NM_005076chr153614 2822 2688 1474 169 11551 11397 --
NM_005079chr883191 2730 2563 2102 2087 2055 1052 474 192 ----
NM_005087chr32591 22 ------
NM_005095chr111586 1328 --11755
NM_005097chr101343 ------
NM_005109chr321859 978 1423 ----
NM_005110chr52223 147 ------
NM_005112chr42853 663 ------
NM_005116chr2064135 3961 3482 3365 884 852 --14029 --
NM_005126chr331836 599 514 2483 285 11542 --
NM_005135chr1573814 3363 3346 2703 2590 1470 578 33305 2869 1168 ----
NM_005139chr41285 ------
NM_005151chr1821776 355 --12369 --
NM_005156chr924788 882 33849 2022 207 11684 1911
NM_005164chr1222172 815 22568 1682 ----
NM_005168chr211277 11544 ----
NM_005171chr123834 377 344 1423 ----
NM_005175chr17--180 ----
NM_005181chr82694 93 ------
NM_005188chr11117862 7266 6793 6654 5896 5322 5203 3058 3026 1005 498 23121 2424 1381 --
NM_005189chr17----12263 22498 2333
NM_005197chr1455811 5381 5185 4912 3873 12378 --1995
NM_005203chr101174 ------
NM_005219chr521674 574 1708 ----
NM_005230chr12----168 --
NM_005233chr312493 ------
NM_005235chr297820 7603 6903 6135 4751 2697 1757 729 86 15521 11056 11976
NM_005238chr1133080 500 117 ------
NM_005244chr201703 ------
NM_005249chr141880 --1286 --
NM_005254chr1511079 ------
NM_005259chr221250 339 ------
NM_005261chr821017 991 ------
NM_005271chr1021254 68 ------
NM_005308chr102362 350 ------
NM_005316chr111306 ------
NM_005327chr41141 1707 ----
NM_005334chrX41643 1521 1420 574 1183 ----
NM_005339chr474123 4022 3846 3549 3309 1160 983 --14034 13070
NM_005342chrX1168 --12292 --
NM_005358chr1341859 511 478 227 1587 ----
NM_005359chr1882393 2163 1713 1628 1577 1457 1274 886 55193 2499 1838 1398 489 ----
NM_005375chr611190 ------
NM_005378chr2193 ------
NM_005382chr8----1356 --
NM_005385chr362469 2383 2335 739 310 299 --1974 --
NM_005388chr921093 228 1340 ----
NM_005398chr1011414 ------
NM_005399chr123705 269 33483 2841 387 ----
NM_005402chr71391 ------
NM_005410chr51127 ------
NM_005433chr1832123 1983 1740 22154 35 ----
NM_005436chr1053984 3703 3650 728 180 11262 155 1437
NM_005439chr121512 ----1204
NM_005455chr151733 1341 714 609 38 --11608 --
NM_005460chr51523 ------
NM_005471chr521308 1051 ----1244
NM_005475chr12122877 2642 1263 1194 902 864 576 506 463 440 216 190 --1733 --
NM_005493chr62750 142 ------
NM_005497chr1765872 4830 1695 1576 929 454 55582 5242 4338 1129 1095 ----
NM_005502chr943308 918 752 247 32910 2456 1069 --1580
NM_005504chr1245869 5739 5118 845 14136 ----
NM_005513chr341550 619 334 90 ------
NM_005520chr5------1524
NM_005522chr721090 457 1996 ----
NM_005523chr721179 357 ------
NM_005542chr741260 783 588 241 11869 ----
NM_005544chr23344 259 160 ------
NM_005552chr14--1539 ----
NM_005573chr5148 ------
NM_005578chr343930 1498 1274 1081 14515 --1377
NM_005595chr11344 ------
NM_005596chr974883 4727 4582 2563 2155 1242 480 22517 1599 --15658
NM_005603chr1821765 43 31628 616 323 ----
NM_005604chr652287 2191 2165 1593 547 --1847 --
NM_005610chr11711 ------
NM_005625chr831076 259 123 ------
NM_005638chrX31727 1408 1228 3338 174 101 ----
NM_005647chrX53122 2824 2328 584 147 ------
NM_005664chr155434 286 126 48 30 ------
NM_005665chr1104915 4777 4700 4401 4207 1612 1348 474 441 163 34298 200 189 ----
NM_005668chr574448 4201 4107 3498 3054 3033 260 ------
NM_005669chr542292 882 385 168 ----1592
NM_005686chr121554 325 1497 21414 303 1433
NM_005711chr51702 ------
NM_005715chr662328 2194 1973 1788 693 673 11107 ----
NM_005737chr242866 2694 2161 208 ------
NM_005738chr721251 73 21892 526 41916 604 325 94 --
NM_005744chr15--139 ----
NM_005746chr722718 2566 ------
NM_005751chr71392 ------
NM_005756chrX2467 58 --11280 --
NM_005760chr2134 ------
NM_005765chrX1819 ----1849
NM_005779chr551261 1209 395 184 94 ------
NM_005785chr121222 ----1583
NM_005789chr1742143 2048 1832 765 11618 1169 --
NM_005796chr161279 ------
NM_005807chr13698 687 185 ------
NM_005810chr122912 454 11139 ----
NM_005813chr262672 2370 2093 1882 896 581 12548 11708 --
NM_005828chr1795062 4364 3876 1792 1295 1039 342 333 54 34436 1731 496 1785 13841
NM_005832chr321266 393 1509 ----
NM_005838chr11121 --1335 --
NM_005840chrX177657 6868 6862 6815 6455 3011 2457 2397 2382 2356 1629 1589 666 636 624 551 192 25782 2665 17091 --
NM_005857chr131077 1038 951 2549 243 ----
NM_005859chr511085 21430 1357 ----
NM_005862chr321063 1013 2890 826 ----
NM_005880chr1631509 1423 118 31250 595 445 ----
NM_005885chr511120 ------
NM_005895chr1253229 994 939 789 359 11373 ----
NM_005896chr23145 58 50 ------
NM_005898chr1122303 1963 22268 825 ----
NM_005900chr441196 971 312 211 ------
NM_005901chr18138634 8520 6215 5943 3488 2811 2782 2705 2446 2193 1876 551 86 45468 5378 2982 559 18031 18727
NM_005906chr64540 92 85 75 11378 ----
NM_005909chr564167 4122 3138 1287 549 516 12819 ----
NM_005911chr221504 1372 ------
NM_005924chr72159 73 ------
NM_005933chr1172473 2400 2198 2074 1957 1927 246 32718 2081 1206 ----
NM_005938chrX31224 68 61 ------
NM_005941chr814042 ----13080
NM_005944chr31346 1386 31111 199 41 --
NM_005955chr1105024 4858 4687 4159 1953 1681 1471 1167 1047 104 --21313 881 --
NM_005966chr231536 645 451 --1408 --
NM_005977chr131896 11032 ----
NM_006015chr12313 267 --1107 --
NM_006016chr642204 2021 1879 695 12188 11710 --
NM_006033chr182623 341 --12318 --
NM_006037chr284509 4396 4293 3050 3039 1679 556 154 --13228 --
NM_006047chr2032907 1135 153 1758 ----
NM_006060chr754237 3875 1090 460 375 --23818 3676 --
NM_006080chr722379 110 21191 595 1456 --
NM_006089chrX21874 304 1534 1217 --
NM_006091chr15148 11522 11285 --
NM_006095chr443779 1761 597 70 24533 3795 ----
NM_006106chr1142853 2510 2162 1101 1887 11330 --
NM_006107chr171425 ------
NM_006113chr131552 848 552 1467 ----
NM_006136chr711055 11101 1458 --
NM_006143chr121136 ------
NM_006147chr11412 ------
NM_006148chr1762644 2261 1072 524 497 465 22370 163 ----
NM_006154chr1562593 1122 966 948 626 330 22541 349 ----
NM_006156chr14126 ------
NM_006158chr851821 1399 1251 675 287 ------
NM_006166chr122891 647 --1614 --
NM_006187chr1273056 1028 884 671 634 349 283 12079 --2755 577
NM_006206chr411885 ----22874 2569
NM_006237chr1342139 2102 2085 681 12162 11933 --
NM_006241chr342412 857 659 574 1208 ----
NM_006244chr112403 52 --1585 --
NM_006251chr523022 2953 22875 1241 ----
NM_006252chr186296 6264 5628 2969 2188 1413 786 380 36026 4977 1506 11569 --
NM_006255chr143795 733 430 ----1726
NM_006256chr152339 2064 1915 901 288 21022 873 ----
NM_006258chr10125 ----11292
NM_006264chr44466 444 123 68 ------
NM_006267chr211443 1702 ----
NM_006277chr2----1483 --
NM_006282chr2044169 2966 1530 676 34436 1430 824 ----
NM_006283chr864425 1984 1897 998 897 815 11667 1872 14999
NM_006287chr232596 2482 242 42096 1873 669 33 12314 1952
NM_006310chr171310 ------
NM_006312chr121671 --1231 --
NM_006315chr453838 3432 1747 776 178 13754 11783 --
NM_006317chr53758 85 73 1278 ----
NM_006321chr362119 1413 897 857 412 82 22167 186 1736 --
NM_006330chr831537 1043 404 31663 1119 219 ----
NM_006338chr1--151 ----
NM_006348chr71143 192 ----
NM_006353chr6142 ------
NM_006357chr24474 439 432 113 ------
NM_006359chrX42476 1962 1900 1547 ------
NM_006364chr1441058 1039 1027 884 --1283 --
NM_006366chr61396 144 ----
NM_006367chr121035 86 1314 ----
NM_006378chr951464 1414 1395 1074 147 ------
NM_006379chr7--188 ----
NM_006380chr1754021 3708 2757 942 527 ----11565
NM_006393chr1084323 2983 1678 1613 1498 1433 761 662 1556 ----
NM_006408chr72983 903 ----1297
NM_006415chr91987 ------
NM_006420chr2043241 1339 720 227 23154 240 ----
NM_006449chr22682 140 11630 ----
NM_006451chr541014 895 319 231 1157 ----
NM_006459chr1021686 349 ------
NM_006465chr1542346 2305 2284 71 1395 ----
NM_006467chr531810 454 155 22056 217 ----
NM_006482chr1233141 1473 107 ------
NM_006489chr1431844 582 43 2277 167 ----
NM_006496chr111631 ------
NM_006516chr12564 438 21537 1106 ----
NM_006520chrX31674 551 81 1513 ----
NM_006532chr1951980 1932 1693 1361 375 ------
NM_006534chr2043312 2548 2481 325 11288 12600 --
NM_006538chr253802 3141 2716 837 294 13731 23831 2612 --
NM_006544chr1476025 5383 4910 4026 1668 1039 690 24261 1398 14553 25955 3910
NM_006546chr1735572 4668 913 46483 6201 4243 1339 25886 212 --
NM_006547chr72484 111 ------
NM_006548chr341712 1323 148 126 11240 ----
NM_006549chr1232797 2446 1993 12851 ----
NM_006561chr10115074 4839 4806 4683 4472 2424 2327 1540 1445 864 638 --14293 --
NM_006565chr1621267 227 1113 ----
NM_006572chr1762781 960 620 489 305 82 --1699 12822
NM_006575chr1411396 --1179 --
NM_006595chr113454 269 53 21798 112 ----
NM_006599chr16117834 7660 7193 6603 6106 5708 5514 2817 1659 1610 367 57989 7459 6777 2118 683 15499 --
NM_006601chr121852 1933 ----
NM_006603chrX21353 404 ------
NM_006609chr242664 2316 2059 29 21991 346 --1550
NM_006614chr393690 3335 3126 2978 2550 1226 1198 841 807 --12570 --
NM_006618chr131305 438 329 1347 ----
NM_006620chr664842 4521 4127 3486 1513 322 21277 694 ----
NM_006621chr111621 1272 ----
NM_006626chr942710 2115 775 751 32245 758 474 ----
NM_006628chr1594687 4608 4016 3518 1719 1237 868 397 67 21159 917 ----
NM_006636chr2193 ------
NM_006654chr1274138 3931 3511 3490 1263 1064 732 11606 ----
NM_006667chrX41207 1152 446 249 ------
NM_006699chr152086 1716 1077 619 42 1892 ----
NM_006704chr131118 ------
NM_006713chr52744 638 --2711 208 --
NM_006716chr72936 104 193 ----
NM_006717chr963378 2541 551 400 331 219 1124 ----
NM_006726chr43976 249 27 171 ----
NM_006727chr52498 44 ------
NM_006729chrX115341 5204 4922 4916 4574 4081 3880 1444 1301 1129 762 14545 ----
NM_006734chr611245 ------
NM_006738chr1563917 3498 3080 1240 479 440 --24289 812 --
NM_006745chr421007 165 ------
NM_006746chrX41528 1278 264 79 --1164 --
NM_006754chr72290 218 1906 ----
NM_006766chr8--1904 12481 --
NM_006775chr622791 2673 ------
NM_006777chrX42894 2039 1935 1080 1103 ----
NM_006805chr531098 447 395 ------
NM_006807chr172991 68 ------
NM_006815chr122473 398 ----145
NM_006827chr1452725 1318 492 474 235 22815 390 12396 --
NM_006832chr14--2860 176 ----
NM_006837chr8124 ------
NM_006838chr1211855 ------
NM_006839chr21111 1283 ----
NM_006851chr1252701 2054 1949 864 397 42245 1973 1020 162 ----
NM_006857chr22635 357 ------
NM_006884chr321741 1416 ------
NM_006885chr1643859 3351 2811 2734 ------
NM_006888chr1453171 2495 826 629 444 1699 23064 475 --
NM_006892chr203951 559 454 --11423 1317
NM_006892chr203951 559 454 --11423 1317
NM_006902chr143144 836 561 127 140 ----
NM_006910chr161266 ------
NM_006912chr12746 200 1233 12487 --
NM_006914chr941511 1352 1332 595 ------
NM_006915chrX32243 1000 400 21019 609 ----
NM_006920chr2140 ------
NM_006922chr252126 890 631 448 38 31652 1599 354 ----
NM_006924chr1723688 3572 34294 3479 2852 22898 265 --
NM_006943chr20145 ------
NM_006951chr102638 107 ------
NM_006965chr1831045 464 448 11215 ----
NM_006981chr932443 2222 2148 1887 ----
NM_006982chr12------1199
NM_006996chr12453 357 1522 --11210
NM_007002chr20195 ------
NM_007005chr921060 341 --1215 --
NM_007007chr1284717 4365 4320 1562 1140 702 468 178 24451 4023 ----
NM_007008chr22584 252 ------
NM_007010chr1741735 1390 1321 731 ----1593
NM_007011chr15106908 6758 6319 6250 6108 4360 2293 1955 1610 1063 36831 5497 1876 ----
NM_007013chr83730 362 171 1886 ----
NM_007033chr162117 2080 1395 883 859 548 1847 ----
NM_007034chr1165 ------
NM_007039chr1462352 2184 1752 614 362 43 ------
NM_007054chr554000 3669 2724 742 163 --13692 --
NM_007064chr31584 1671 ----
NM_007076chr121111 ------
NM_007078chr1043055 2410 2078 1124 22642 1074 ----
NM_007106chr1322553 1717 32675 2436 540 1101 --
NM_007107chr342317 2136 461 35 11610 ----
NM_007111chr131807 ----1825
NM_007114chr322830 2596 11317 --12810
NM_007124chr661837 1809 1659 1604 1532 137 1465 ----
NM_007129chr131743 1135 ----
NM_007146chr1742843 2420 2119 525 145 ----
NM_007157chrX22249 894 --22830 2167 --
NM_007159chr33200 167 93 ------
NM_007166chr1111300 ------
NM_007173chr1142351 903 687 137 12268 ----
NM_007175chr873673 3559 3356 3315 2223 521 395 22707 2439 ----
NM_007200chr1563917 3498 3080 1240 479 440 --24289 812 --
NM_007202chr172715 241 ------
NM_007203chr963798 3467 3325 3010 942 730 --12949 --
NM_007212chr11134 11495 12230 --
NM_007214chr621306 304 1841 ----
NM_007217chr31392 ------
NM_007222chr81676 ------
NM_007236chr1562089 1828 1558 793 592 514 22004 67 --1390
NM_007242chr161238 ------
NM_007249chr1389198 8692 8184 3552 3378 3259 737 201 2610 271 16616 22136 2050
NM_007276chr721090 980 ------
NM_007287chr332327 1252 694 22766 2540 12664 2287 202
NM_007288chr332327 1252 694 22766 2540 12664 2287 202
NM_007289chr332327 1252 694 22766 2540 12664 2287 202
NM_007308chr4--1495 ----
NM_007347chr1562558 2469 2310 2055 326 44 32933 2923 64 11962 --
NM_007361chr142497 33 ------
NM_007373chr1021845 481 11751 ----
NM_007375chr132699 621 374 1605 12237 --
NM_012081chr552535 2390 2315 1403 265 32860 2815 902 ----
NM_012082chr81922 1210 ----
NM_012084chrX168 ------
NM_012089chr131399 422 213 ----1389
NM_012095chr1053408 2838 1233 1038 466 13113 ----
NM_012096chr343331 2571 2307 1238 --11110 --
NM_012097chr232143 1827 54 ------
NM_012120chr652848 2733 2044 1072 563 ------
NM_012129chr732428 554 488 21973 947 ----
NM_012137chr161168 991 942 591 120 91 52031 1985 1820 608 501 --1576
NM_012141chr1364065 3129 2756 2608 1581 748 ------
NM_012158chr1341443 1246 1135 273 21720 87 ----
NM_012161chr431150 923 763 1153 126 --
NM_012164chr977476 7466 6024 5225 4824 2586 2070 36699 2354 385 15717 --
NM_012193chr1165365 4246 4164 4010 1645 539 2404 70 25032 1185 --
NM_012199chr144124 3307 1622 655 --13029 --
NM_012210chr921405 1167 21016 537 ----
NM_012214chr246104 2434 1583 82 11373 1109 --
NM_012219chr333078 919 724 ------
NM_012224chr421010 489 ------
NM_012234chr363731 2735 1150 1019 965 264 --13127 --
NM_012238chr1021763 73 ------
NM_012249chr273170 3141 2433 2185 1388 1376 348 ----13247
NM_012250chr112240 68 ------
NM_012255chr201138 ------
NM_012257chr7128 ----1251
NM_012259chr611298 ------
NM_012262chr153754 1474 884 423 391 14414 24100 3803 --
NM_012287chr344281 4024 1576 91 --13605 --
NM_012288chr695532 5253 5146 4779 4734 4097 3946 3801 2148 24082 1474 ----
NM_012290chr2--1598 ----
NM_012294chr743909 3622 896 57 11223 13783 --
NM_012296chr1153931 3108 2414 196 105 2318 111 ----
NM_012297chr462640 2434 2299 1687 759 356 22469 2384 ----
NM_012300chr5--21679 645 ----
NM_012301chr722193 2066 ------
NM_012307chr181767 ------
NM_012309chr1174589 4073 3936 3614 3546 1912 911 1213 14274 21752 871
NM_012319chr182840 184 ------
NM_012325chr2021638 190 11068 ----
NM_012327chr181107 --1620 --
NM_012329chr1731039 260 169 2678 440 11636 --
NM_012333chr1--11546 ----
NM_012383chr91331 ------
NM_012399chr2241953 1739 1687 42 ------
NM_012406chr121907 169 ----
NM_012412chr73870 792 639 ------
NM_012417chr171627 ------
NM_012429chr2221383 55 11352 --1180
NM_012444chr201324 ------
NM_012463chr1211614 21235 1177 --1180
NM_012465chr1093445 2856 2825 2445 1322 1171 737 214 84 1483 ----
NM_012471chrX1682 11366 ----
NM_012475chr1180 --166 --
NM_012479chr72590 415 12393 11736 --
NM_012481chr172680 628 ------
NM_013233chr231412 379 78 ------
NM_013238chr1331280 622 424 11450 ----
NM_013248chr201241 ------
NM_013255chr758778 8452 7578 3098 146 28318 7908 1314 16100
NM_013257chr83324 311 41 1712 ----
NM_013261chr422593 183 ------
NM_013262chr621346 550 1107 ----
NM_013267chr121440 ------
NM_013279chr11----2701 269 --
NM_013281chr202304 78 ------
NM_013282chr19--11132 ----
NM_013286chr383023 2982 2841 2663 627 479 244 74 13467 ----
NM_013293chr71282 ------
NM_013302chr1664526 4491 4081 2909 1064 903 23514 1662 ----
NM_013309chr1521981 225 ------
NM_013346chrX128 ------
NM_013357chr82716 710 ------
NM_013381chr1252445 2338 895 877 202 ----11954
NM_013386chr141496 353 260 86 21807 615 ----
NM_013396chr21--21441 974 11476 --
NM_013400chr721054 1005 ------
NM_013436chr2276 52 ------
NM_013437chr83493 325 181 ------
NM_013444chrX1976 ------
NM_013446chr751335 880 424 131 30 ------
NM_013448chr141235 ------
NM_013450chr211111 1848 ----
NM_014000chr1051944 1783 1292 329 244 2699 39 ----
NM_014021chr153186 2590 2482 1313 601 11011 ----
NM_014034chr61384 ------
NM_014039chr111216 1478 11308 --
NM_014043chr321600 1516 11093 --11536
NM_014048chr1654291 4242 4156 1626 1040 34589 1369 1172 --23768 1857
NM_014089chr132321 57 ------
NM_014106chr1542624 1945 1071 1013 11006 ----
NM_014110chr111040 ------
NM_014112chr885423 4658 4009 1918 1622 1611 632 362 35516 4256 3968 ----
NM_014117chr1632195 1830 1738 1994 12730 22114 909
NM_014154chr321536 1343 ------
NM_014155chr11106870 6746 6102 5256 5034 4614 2879 2253 2230 1564 16213 22191 1022 --
NM_014181chr222583 2556 --12121 --
NM_014184chr1--1147 ----
NM_014212chr123895 700 174 ------
NM_014213chr21201 ------
NM_014216chr1471560 1354 1315 1174 449 256 231 ------
NM_014217chr12568 455 1142 1370 --
NM_014220chr31820 --1116 --
NM_014231chr1221898 55 12183 ----
NM_014243chr431963 538 372 22077 196 ----
NM_014245chr31312 1739 --11058
NM_014253chrX22234 334 --11770 1624
NM_014263chr1011362 2604 316 168 --
NM_014268chr1831377 571 110 ------
NM_014271chrX1617 2201 189 ----
NM_014278chr41302 ------
NM_014289chrX21208 975 11388 ----
NM_014294chr8--151 ----
NM_014309chr2244237 1394 1237 192 1310 ----
NM_014315chr141165 ------
NM_014317chr101265 ------
NM_014329chr162285 89 1220 ----
NM_014331chr447855 5124 401 31 11461 1853 --
NM_014333chr1121981 366 ------
NM_014372chr111842 ------
NM_014374chr721054 1005 ------
NM_014379chr81658 1146 ----
NM_014381chr1463181 3126 2471 2004 1145 258 1535 21318 418 --
NM_014382chr331520 1124 328 11606 ----
NM_014391chr102577 533 ------
NM_014393chr872072 1708 497 415 331 296 189 ------
NM_014399chr72671 282 ------
NM_014415chr341392 97 86 66 ------
NM_014423chr575579 4963 4674 3882 1461 1158 363 ------
NM_014445chr321702 823 1614 ----
NM_014447chr41371 11289 ----
NM_014458chr121374 1314 11436 ----
NM_014469chr111110 ------
NM_014488chr111565 ------
NM_014491chr71766 --1791 --
NM_014494chr1671558 863 792 752 461 264 199 1497 ----
NM_014515chr12------1316
NM_014547chr151193 ------
NM_014547chr151193 ------
NM_014548chr1541498 628 439 394 ------
NM_014552chr241563 533 344 108 ------
NM_014554chr1231689 158 57 21514 273 ----
NM_014572chr1331801 1641 1612 ------
NM_014584chr1421595 177 ----11307
NM_014606chr411184 ------
NM_014607chr252034 1462 813 106 67 1248 ----
NM_014616chr352902 2867 2301 880 734 22453 1168 ----
NM_014633chr111459 2636 126 ----
NM_014636chr954369 3543 3006 2656 328 ------
NM_014647chr161659 2265 138 12219 --
NM_014670chr22271 255 ------
NM_014676chr1----11453 --
NM_014677chr821342 1026 ------
NM_014683chr1751881 1758 1478 1388 184 ------
NM_014686chr1932079 2067 1951 ------
NM_014689chr2--1395 1121 --
NM_014701chr1541206 668 378 24 12222 ----
NM_014702chr643298 2441 1293 72 12904 ----
NM_014705chr74747 668 600 43 11613 ----
NM_014707chr742186 1562 773 93 --1468 1688
NM_014709chr21425 --122 --
NM_014711chr162262 72 ------
NM_014721chr666232 4624 2034 1887 1309 685 --25246 2401 --
NM_014735chrX1685 12131 ----
NM_014736chr151386 2847 233 141 --
NM_014739chr684088 1568 1262 1202 823 286 122 56 13919 1887 --
NM_014747chr134052 1946 209 34835 843 495 --11180
NM_014755chr243692 3263 1489 349 13464 ----
NM_014756chr11140 ------
NM_014757chr542319 2120 920 273 --1939 --
NM_014760chr311832 ------
NM_014765chr13749 157 134 22526 120 ----
NM_014767chr1043627 1030 457 435 --1482 1570
NM_014774chr163144 2629 2526 1178 1044 47 ------
NM_014779chr35788 333 262 254 45 ------
NM_014781chr82232 141 ------
NM_014783chr1561637 1540 1106 555 535 258 ------
NM_014790chr5153 ------
NM_014795chr21311 ------
NM_014803chr1021961 88 ----1942
NM_014810chr1113501 3259 2906 2827 2557 1265 965 747 736 399 56 22843 783 --1490
NM_014812chr141861 1833 1342 607 ------
NM_014820chr341897 1619 1543 356 --142 --
NM_014822chr43641 469 275 ------
NM_014826chr153512 3419 3117 898 270 13434 13072 --
NM_014827chr121519 75 11432 ----
NM_014829chr55104 69 62 37 24 ------
NM_014830chr1293796 3519 2822 2657 2647 1085 548 326 203 ------
NM_014832chr132541 529 --21705 715 --
NM_014839chr142219 2068 1623 56 ----1108
NM_014850chr384807 4674 4624 4591 3806 3322 1474 517 24419 1096 23166 703 --
NM_014857chr1184 ------
NM_014864chr11978 44277 2886 1567 429 ----
NM_014872chr942213 2076 875 541 22335 2322 --1475
NM_014873chr194646 4487 3226 1700 1584 1442 1285 647 385 2235 163 ----
NM_014877chr1767688 6143 5609 4944 1702 991 36445 6322 1219 11272 --
NM_014883chr462344 1771 1765 606 119 47 12084 ----
NM_014888chr711079 ------
NM_014903chr1222193 338 1673 ----
NM_014904chr1023330 139 1286 ----
NM_014905chr242028 822 708 79 ------
NM_014906chr1743338 3071 2753 1234 ------
NM_014907chr9198 ------
NM_014909chr1472790 2624 977 749 580 473 362 --33621 3507 729 11449
NM_014912chr1053481 3082 2399 871 248 ------
NM_014913chr1841506 1485 1290 984 ------
NM_014917chr12912 691 ------
NM_014920chr631498 1168 73 ----12403
NM_014923chr1352005 1668 677 650 469 ------
NM_014924chr1422747 233 31220 476 283 ----
NM_014932chr3------11351
NM_014934chr1383898 3774 3698 3590 3256 2695 2423 92 13666 ----
NM_014938chr1272401 1857 1615 804 434 256 120 --1463 --
NM_014946chr241132 620 435 97 1282 ----
NM_014950chr1421761 1358 ------
NM_014952chr1522005 421 ------
NM_014978chr1021805 96 1259 11311 1108
NM_014982chr1485035 4858 4509 4334 3619 1443 863 411 25236 4637 ----
NM_014988chr441922 500 388 103 ------
NM_014989chr641859 1678 1657 37 21938 192 ----
NM_014990chr142431 45 ----1256
NM_014991chr462582 2568 1311 1181 1145 94 53315 2540 1247 1129 1013 12169 --
NM_014994chr1542164 892 456 63 11502 --11696
NM_014999chr12--195 ----
NM_015000chr1232080 2071 304 1932 12317 --
NM_015001chr11197 ------
NM_015005chr1431358 1290 48 11782 ----
NM_015008chr353018 2957 2483 1016 121 12416 11405 --
NM_015020chr1683355 3273 2780 2588 2374 412 358 72 ------
NM_015024chr821495 1340 --11098 --
NM_015026chr1244579 4516 942 133 24672 3934 ----
NM_015032chr132825 542 12861 --1585
NM_015033chr973077 3002 2825 2707 2523 486 53 ------
NM_015035chr20116452 6241 5093 4867 4537 4273 4093 1769 1707 1274 252 36419 5382 715 ----
NM_015039chr163999 3695 3105 2644 1517 971 24226 3983 ----
NM_015040chr263439 3326 2904 2735 997 389 11186 ----
NM_015042chr1584291 4256 3973 3780 1154 1124 673 356 --13117 1989
NM_015045chr1041853 1512 805 567 ------
NM_015052chr72501 345 1359 ----
NM_015071chr546020 4493 462 443 44883 4867 4509 680 1865 --
NM_015074chr144556 4178 3621 1346 23957 1188 ----
NM_015076chr673587 3121 1809 1725 1581 992 60 11205 1787 --
NM_015087chr1342431 2035 1907 841 ------
NM_015090chr145714 5465 4982 617 --31417 1234 739 22321 130
NM_015091chr14140 ------
NM_015092chr1644430 3274 1051 684 2867 270 ----
NM_015094chr2244327 4301 3158 1074 24140 30 23630 215 --
NM_015097chr362142 1550 1528 725 645 174 ------
NM_015100chr121990 370 --11818 --
NM_015107chrX71673 1561 1512 524 266 86 33 --12018 --
NM_015124chr2212351 22259 2023 ----
NM_015130chr4--2910 222 ----
NM_015137chr82754 74 12513 12425 --
NM_015138chr1552703 1846 676 498 174 --12768 --
NM_015149chr122021 640 1651 12177 --
NM_015156chr1463619 2838 721 396 224 154 13492 ----
NM_015161chr1671539 1494 1430 1107 419 406 119 ----1464
NM_015163chr1421937 159 21698 556 ----
NM_015170chr811442 ------
NM_015172chr121499 1279 ------
NM_015173chr411737 ------
NM_015176chr111622 1233 ----
NM_015185chrX62393 2341 1885 1025 1005 302 1833 ----
NM_015187chr41249 ------
NM_015199chr332586 2439 2116 22363 2280 12557 --
NM_015200chr442246 2024 548 126 --1462 --
NM_015206chr1593286 2780 2704 2640 950 868 843 575 177 23372 988 21181 1161 --
NM_015208chr181994 13917 ----
NM_015215chr112848 ------
NM_015225chr941274 1190 154 62 13043 --2544 312
NM_015233chr132521 497 1218 12416 --
NM_015236chr421153 1063 ------
NM_015239chr9--1536 ----
NM_015247chr1655244 5188 4053 3931 531 --1455 --
NM_015250chr931697 1511 418 ------
NM_015252chr23696 130 124 1136 ----
NM_015265chr252416 2230 1770 1028 309 ------
NM_015266chr2061658 1081 926 772 656 579 --1602 --
NM_015267chr121133 ------
NM_015268chr31270 1550 ----
NM_015271chr454240 1577 1555 890 210 24308 1588 ----
NM_015272chr1632139 1589 283 1591 ----
NM_015275chr122629 178 ------
NM_015277chr1841705 1252 535 364 11163 ----
NM_015278chr633434 1255 295 ------
NM_015285chr1852099 1842 863 712 513 --12489 1495
NM_015291chr152604 2555 819 755 527 ------
NM_015294chr1731124 728 375 ----1291
NM_015308chr111753 ------
NM_015310chr8138095 7775 7369 7184 6068 2144 2025 1989 1841 1706 866 811 302 --11276 --
NM_015313chr1134717 226 111 14460 ----
NM_015315chr522507 2306 2698 576 ----
NM_015317chr242605 1045 395 314 12240 --12578
NM_015323chr621712 1199 11771 11193 --
NM_015326chr122780 975 ------
NM_015328chr752674 2291 2257 2068 732 ------
NM_015336chr121521 1594 ----
NM_015338chr20------11807
NM_015346chr1441620 306 243 109 --11639 11909
NM_015347chr1282402 2222 2105 1978 987 528 385 317 --1928 --
NM_015349chr612401 12358 ----
NM_015355chr172354 157 ------
NM_015358chr2111095 ------
NM_015359chr852779 994 946 782 345 11821 ----
NM_015361chr21970 ------
NM_015365chrX44314 3791 2955 1060 ------
NM_015367chr2221589 453 ------
NM_015375chr193176 2009 1772 1434 1121 1047 1038 595 505 1806 11145 --
NM_015381chr2241757 1634 496 104 11905 ----
NM_015435chr811238 ------
NM_015447chr93706 639 496 --1567 --
NM_015453chr33834 737 93 31740 1540 290 --1828
NM_015455chr543719 1509 1439 268 22818 763 --13507
NM_015457chr111431 ------
NM_015461chr181719 ----1783
NM_015463chr2147 ------
NM_015464chr71348 ------
NM_015465chr51494 ------
NM_015474chr202248 22 ------
NM_015477chr151698 1939 1714 --
NM_015509chr1231161 625 487 ------
NM_015542chr101876 21137 171 ----
NM_015550chr763566 3012 2886 1056 1006 142 ------
NM_015553chr684269 4259 4118 3644 3396 1281 1108 729 1348 1791 14214
NM_015554chr1552753 2320 2177 2157 1814 1118 ----
NM_015557chr173150 3038 2618 2490 1143 534 418 32377 902 725 ----
NM_015564chr53842 564 322 32776 2220 82 ----
NM_015569chr154586 4475 1503 840 594 33368 1221 327 --1440
NM_015570chr711344 --11400 --
NM_015575chr21303 21122 899 139 --
NM_015576chr372654 2341 2161 1066 812 614 199 ------
NM_015626chr17----21010 958 --
NM_015630chr21365 1847 ----
NM_015640chr134770 4073 1450 11370 14278 --
NM_015660chr71295 ------
NM_015676chr141296 ------
NM_015691chrX12348 32653 1854 527 ----
NM_015713chr852441 2301 1033 277 54 --11364 --
NM_015833chr21102103 1982 1968 1704 1692 1531 784 311 290 238 --11551 --
NM_015878chr832231 1453 322 ------
NM_015886chr865036 3559 1883 1278 1242 879 35216 4145 2238 11805 --
NM_015888chr182790 2643 2163 2146 1031 978 819 536 ------
NM_015906chr164318 3937 1130 1095 611 493 24349 1357 23771 673 --
NM_015915chr141255 1303 ----
NM_015920chr151558 186 ----
NM_015955chr2--172 ----
NM_015975chrX2273 90 31666 431 281 ----
NM_015984chr11418 ------
NM_015995chr1555567 4508 3776 1752 529 ------
NM_015999chr13526 291 244 ------
NM_016009chr164250 3760 3470 3264 293 257 1141 43655 3348 3059 518 --
NM_016023chr862115 1813 1519 887 847 339 160 1398 --
NM_016038chr72421 112 ----179
NM_016039chr14--1134 ----
NM_016061chr251240 269 243 233 59 ------
NM_016070chr17140 ------
NM_016072chr1262142 2047 1823 968 734 184 11900 1715 --
NM_016073chr1511031 ------
NM_016076chr141289 1217 299 277 --21228 966 --
NM_016078chr171398 21136 750 ----
NM_016083chr653935 3391 942 197 69 43199 2832 1168 102 13070 --
NM_016094chr31582 1274 ----
NM_016096chr821585 43 ------
NM_016097chr182836 327 --1716 --
NM_016106chr14130 ------
NM_016107chr52449 77 ------
NM_016121chr1------1465
NM_016131chr222360 1846 ------
NM_016132chr1542342 2250 763 513 ------
NM_016133chr221651 1640 ------
NM_016152chr331054 870 305 --21268 451 1925
NM_016166chr15182 ------
NM_016179chr13------125
NM_016185chr17------1332
NM_016206chr388578 7774 7625 6558 6429 3052 1650 556 47812 6738 5498 1885 18816 16973
NM_016213chr15161 ------
NM_016223chr11----131 --
NM_016230chr61397 ------
NM_016231chr1721120 215 --11151 --
NM_016252chr22304 162 ------
NM_016255chr642798 2773 1173 422 ------
NM_016257chr163075 3058 2581 2498 451 129 21350 955 ----
NM_016258chr11678 1782 ----
NM_016260chr287212 5653 2394 1366 1359 849 559 166 47637 7263 1980 272 15664 --
NM_016269chr41150 --1215 --
NM_016271chr1811665 ------
NM_016272chr2232444 2194 1763 ------
NM_016274chr1179 ------
NM_016275chr31520 22357 887 ----
NM_016289chr221704 131 11739 ----
NM_016303chrX189 ------
NM_016315chr231186 1179 232 11740 ----
NM_016316chr22648 265 ------
NM_016319chr121820 ------
NM_016320chr112849 112 ----1219
NM_016322chr962720 2282 2220 1167 1085 317 12386 ----
NM_016337chr141490 ------
NM_016339chr1731855 1342 139 --1597 --
NM_016340chr531237 907 132 ----1404
NM_016351chr7287 39 ------
NM_016374chr11592 ------
NM_016374chr11592 ------
NM_016377chr621703 1295 ------
NM_016396chr1562962 2494 718 663 653 171 1291 1617 --
NM_016399chr121843 1908 ----
NM_016424chr1721930 731 ------
NM_016436chr2022628 758 22264 384 ----
NM_016448chr131902 1524 452 31600 383 178 11770 --
NM_016462chr62452 111 ------
NM_016472chr1411522 ------
NM_016485chr642259 2008 653 62 ------
NM_016499chr111521 ------
NM_016505chr13690 654 579 1535 ----
NM_016507chr1763135 2691 1128 742 654 235 ------
NM_016513chr631498 1168 73 ----12403
NM_016530chr1563764 3205 2900 2790 984 671 ------
NM_016531chr443638 1348 1018 417 ------
NM_016544chr223824 3058 23901 1206 ----
NM_016562chrX31587 1030 348 ----135
NM_016575chr1264105 3835 1694 1491 1335 252 24580 942 ----
NM_016578chr111570 ------
NM_016587chr721090 980 ------
NM_016613chr442784 2762 2445 589 22002 845 ----
NM_016620chr131038 531 171 ------
NM_016623chr81261 ------
NM_016626chr1831291 565 192 11143 ----
NM_016631chr212226 190 ------
NM_016641chr1641343 1218 1127 140 --11306 --
NM_016644chr5175 ------
NM_016651chr1411178 ------
NM_016654chr1511079 ------
NM_016830chr12--1545 ----
NM_016950chr431513 567 546 ------
NM_017409chr121527 ------
NM_017412chr831079 999 425 1204 ----
NM_017416chrX1149 ------
NM_017420chr1432986 993 403 43472 2935 1061 839 ----
NM_017423chr442013 227 206 191 ------
NM_017426chr41134 ------
NM_017440chr123200 137 104 ------
NM_017447chr2123067 3056 23622 2860 1891 24404 3909
NM_017491chr42853 663 ------
NM_017520chr13--1601 ----
NM_017522chr121441 1136 11249 ----
NM_017544chrX1280 ------
NM_017545chr201378 ------
NM_017548chr31438 ------
NM_017549chr741328 1311 1131 176 ------
NM_017569chr131107 ------
NM_017580chr1051930 1881 1818 439 271 1914 ----
NM_017594chr963272 2872 2777 2284 1308 1069 21343 199 ----
NM_017599chr1241803 1469 770 92 --11500 --
NM_017610chr1521569 1301 ----11830
NM_017612chr121115 1391 ----
NM_017613chr211349 ------
NM_017617chr911525 ------
NM_017628chr464904 4188 3763 1896 1200 1081 14438 ----
NM_017629chr151835 1553 1534 431 243 1111 ----
NM_017632chr4------1347
NM_017633chr643911 3706 3110 236 23306 2576 --12543
NM_017634chr821303 584 11576 1268 --
NM_017637chr978762 8354 7994 7787 7276 1780 1690 17057 ----
NM_017643chr1751256 985 855 746 88 33036 2054 843 ----
NM_017644chr3115227 4858 4736 4120 3772 3632 3418 1858 1152 294 270 14163 ----
NM_017650chr764536 4163 2154 1686 1001 414 14988 ----
NM_017658chr1484558 4508 4154 4105 3930 2868 1344 1314 ------
NM_017672chr1511382 ------
NM_017686chr1--1964 --1849
NM_017694chr231775 1460 800 1289 ----
NM_017697chr81113 ----1379
NM_017709chr143399 2807 640 165 13980 23855 1689 --
NM_017714chr201339 ------
NM_017730chr3--1573 ----
NM_017742chr182312 94 ----11884
NM_017747chr51318 1404 ----
NM_017752chrX21990 34 12174 ----
NM_017754chr684298 4067 3620 3607 3458 3077 1419 568 13799 ----
NM_017769chr1412482 12570 ----
NM_017770chr642763 1166 824 379 ----1568
NM_017780chr82818 61 ------
NM_017786chr81599 ------
NM_017787chr1031940 965 957 12390 22030 1834 1508
NM_017811chr953109 2926 2089 2052 228 ----13122
NM_017813chr875801 5440 5327 5124 4891 447 289 45025 4486 4415 714 ----
NM_017819chr31222 ------
NM_017824chr10------12592
NM_017902chr1075689 4701 3771 1992 1886 1644 234 11319 1522 --
NM_017913chr91317 ------
NM_017919chr975656 5299 2156 2045 1528 787 620 21470 1003 21293 39 --
NM_017938chrX21640 1440 1750 ----
NM_017943chr14----11024 --
NM_017958chr242504 1895 1155 607 1862 11126 --
NM_017966chr1121481 317 11425 ----
NM_017969chr2130 ------
NM_017990chr1654046 3771 3173 1505 558 --21600 1567 --
NM_017994chr73940 774 419 --11906 --
NM_018003chr1512164 11649 ----
NM_018018chr122474 226 11606 --1127
NM_018023chr332019 1770 1350 11489 ----
NM_018028chr191126 ------
NM_018030chr1831098 694 84 ------
NM_018048chr1232050 1911 1836 11850 1581 --
NM_018061chr12664 453 --1520 --
NM_018062chr21362 ------
NM_018063chr101434 ----1454
NM_018070chr11608 ------
NM_018072chr1128 ------
NM_018078chr41932 ------
NM_018084chr21276 12347 --13071
NM_018086chr221406 616 --1740 11573
NM_018092chr163613 166 120 1453 ----
NM_018098chr3----1166 --
NM_018103chr11305 ------
NM_018107chr142824 59 1805 ----
NM_018112chr92212 49 ------
NM_018121chr1022611 826 12530 ----
NM_018126chr411303 1425 1986 --
NM_018128chr1721498 397 --1596 --
NM_018133chr311795 12206 ----
NM_018155chr363146 2980 2967 1038 921 870 1263 ----
NM_018157chr1233112 2767 123 1962 ----
NM_018178chr121662 1281 21654 397 ----
NM_018184chr352113 1990 1840 631 573 1673 1371 --
NM_018195chr111516 ------
NM_018206chr161137 ------
NM_018211chr11762 ----2722 617
NM_018223chr122422 160 ------
NM_018227chr421252 543 22574 2025 ----
NM_018243chr454094 3860 3750 537 108 32978 1373 64 ----
NM_018254chr122254 1996 ------
NM_018257chr2052528 1024 857 310 193 12326 12026 --
NM_018263chr252575 2243 2152 646 546 21729 333 ----
NM_018287chr1011203 ------
NM_018293chr322068 388 ------
NM_018312chr1152159 2107 874 848 622 ------
NM_018313chr342605 677 470 423 ------
NM_018314chr113764 214 187 ------
NM_018332chr16--21335 1085 ----
NM_018340chr1645063 3167 1212 1033 23793 1646 1340 --
NM_018351chr1254235 3747 1635 536 210 21016 759 ----
NM_018362chr1133956 3566 2966 23785 2924 ----
NM_018364chr123151 221 1954 ----
NM_018373chr1426134 5500 21196 71 35229 4658 1392 --
NM_018374chr774166 1952 1834 1503 1176 401 111 ------
NM_018383chr232024 2011 1428 1468 ----
NM_018388chrX2421 409 187 ----
NM_018393chr112213 101 ------
NM_018403chr3--32864 1113 1028 11600 --
NM_018416chr1212660 1601 1383 --
NM_018429chr542553 2180 1081 262 ----12779
NM_018433chr21154 ------
NM_018437chr91505 1162 ----
NM_018440chr888602 7888 7190 5731 3430 3029 560 419 48539 7974 7692 6253 13188 --
NM_018444chr851966 1947 686 454 111 1272 ----
NM_018445chr151205 ----1551
NM_018448chr122954 308 ------
NM_018462chr34586 322 252 225 2839 155 ----
NM_018469chr1751342 1045 355 133 126 --1294 --
NM_018476chrX2189 91 ------
NM_018482chr862573 2055 1861 826 493 170 ------
NM_018490chr111422 ------
NM_018534chr21593 ------
NM_018553chr172247 184 21655 1182 ----
NM_018566chr174679 3529 3235 1567 1388 193 179 1493 14564 --
NM_018584chr11449 11109 ----
NM_018590chr1031637 270 66 ------
NM_018638chr1274928 4802 1998 1935 1686 1334 957 25621 689 ----
NM_018640chr1221038 952 1434 --2609 522
NM_018652chr151211 147 ----
NM_018682chr7--1469 ----
NM_018686chr121138 ------
NM_018693chr2190 ------
NM_018695chr542240 2150 2095 797 12363 ----
NM_018703chr161266 ------
NM_018704chr152035 1999 1805 1723 768 11892 ----
NM_018712chr1111574 21429 602 ----
NM_018717chr431096 823 292 ----22252 874
NM_018718chr752256 1521 549 382 245 ------
NM_018834chr51926 ------
NM_018836chr1121 ------
NM_018841chr152877 2480 1022 865 72 ------
NM_018844chr741788 1750 664 553 12001 --1274
NM_018898chr52925 317 11807 12042 --
NM_018899chr52925 317 11807 12042 --
NM_018900chr52925 317 11807 12042 --
NM_018901chr52925 317 11807 12042 --
NM_018902chr52925 317 11807 12042 --
NM_018903chr52925 317 11807 12042 --
NM_018904chr52925 317 11807 12042 --
NM_018905chr52925 317 11807 12042 --
NM_018906chr52925 317 11807 12042 --
NM_018907chr52925 317 11807 12042 --
NM_018908chr52925 317 11807 12042 --
NM_018909chr52925 317 11807 12042 --
NM_018910chr52925 317 11807 12042 --
NM_018911chr52925 317 11807 12042 --
NM_018945chr632498 2304 1393 12889 ----
NM_018948chr121279 212 1572 ----
NM_018962chr2121433 245 2896 434 ----
NM_018970chr733131 1140 594 1647 ----
NM_018976chr1221137 626 --12190 --
NM_018979chr1232007 1878 474 1930 ----
NM_018999chr1074755 3461 3412 3261 1987 1276 1224 1867 ----
NM_019001chr323005 45 11320 --14700
NM_019004chr732316 1529 590 1536 ----
NM_019008chr2293348 2839 2789 1449 1028 796 435 331 218 23282 1372 23513 340 11111
NM_019022chr18103188 3155 3121 2807 2203 1004 919 276 227 53 ------
NM_019035chr441945 1343 750 508 1516 ----
NM_019042chr711245 11063 11075 --
NM_019045chrX1769 ------
NM_019049chr12719 188 ------
NM_019058chr101747 ------
NM_019063chr231721 1428 395 ----1611
NM_019074chr15165 --1627 --
NM_019084chr1012567 12467 ----
NM_019087chr511640 ----1230
NM_019091chr2--1426 ----
NM_019098chr821867 742 ------
NM_019106chr2242503 2096 1365 833 12421 1874 --
NM_019114chr922105 1008 ------
NM_019116chr1673697 3535 3101 3072 2764 2314 837 23518 317 ----
NM_019556chrX21375 1095 2491 446 ----
NM_019590chr104213 206 187 58 ------
NM_019592chr92558 67 1638 ----
NM_019593chr2063182 2734 2627 2465 2113 790 22314 2152 11277 --
NM_019595chr2----1483 --
NM_019605chr1--1208 ----
NM_019610chr142024 1548 1360 387 2852 70 ----
NM_019857chrX11627 --11744 --
NM_019887chr122489 265 --1569 --
NM_019895chr321040 186 ------
NM_020039chr1251301 1200 174 168 83 --21373 304 1317
NM_020066chr11372 ------
NM_020116chr411666 ------
NM_020120chr22483 79 11330 1394 --
NM_020122chr235431 5158 4069 45402 5245 4812 2187 2526 359 --
NM_020130chr82537 484 ------
NM_020144chr721909 1447 21966 267 ----
NM_020148chr1831025 704 433 12208 ----
NM_020152chr214905 707 139 128 ------
NM_020159chr451569 1180 1169 1126 334 11476 ----
NM_020177chr51412 22381 440 12783 22955 248
NM_020193chr1121028 345 ------
NM_020198chr172491 139 ------
NM_020204chr12211 175 ------
NM_020225chr43115 71 50 ------
NM_020235chr3258 34 1336 ----
NM_020239chr151645 725 528 168 126 41974 1871 832 25 --1628
NM_020245chr674470 3640 1272 965 956 763 301 44595 4138 3668 1134 1329 --
NM_020310chr1722548 2345 1660 ----
NM_020311chr2132 1576 ----
NM_020336chr2073221 3029 2633 2554 1417 486 376 --13310 --
NM_020337chr422566 1180 --1883 --
NM_020341chr2021611 527 ----11987
NM_020346chr1141613 1507 1222 676 ------
NM_020357chr31339 --1649 --
NM_020390chr334705 3670 1002 34500 4250 566 ----
NM_020403chr132641 198 ------
NM_020416chr41323 22128 334 ----
NM_020432chr72864 120 ------
NM_020438chr911398 ------
NM_020440chr142726 2712 634 465 ----1177
NM_020443chr155345 4561 2726 1642 776 26366 2524 11857 --
NM_020444chr52579 59 1219 11063 --
NM_020456chr1332231 491 69 12291 ----
NM_020466chr644923 4895 1798 789 21864 413 14581 --
NM_020473chrX21891 385 ----1641
NM_020474chr1831790 1693 234 167 ----
NM_020482chr63788 681 608 ------
NM_020532chr22584 252 ------
NM_020640chr34834 782 755 691 11684 ----
NM_020644chr113703 285 259 ------
NM_020647chr821815 1451 2686 427 --12187
NM_020651chr21358 ------
NM_020673chr2087797 6531 4771 1983 1231 1108 1096 893 37083 2070 535 ----
NM_020696chr3----127 --
NM_020697chr821001 343 ------
NM_020699chr161819 981 891 755 268 218 ------
NM_020704chr742521 1803 1602 61 1686 ----
NM_020713chr2053005 2591 2383 1202 602 12395 12461 1994
NM_020717chrX114526 4152 3708 3234 3101 1898 604 403 390 199 120 54797 4231 3583 1230 789 ----
NM_020718chr1636143 5898 2411 55733 4083 1058 530 195 ----
NM_020727chr2124000 3956 12839 ----
NM_020728chr732455 559 49 22931 2030 ----
NM_020737chr6197 ------
NM_020739chr1543080 2893 653 611 --14006 13450
NM_020748chr1731420 728 201 ------
NM_020752chr101428 1663 1278 --
NM_020760chr221801 1639 ------
NM_020761chr17--11948 ----
NM_020766chrX44459 3446 1573 1484 24526 3856 24278 832 --
NM_020768chr573012 2790 921 811 354 240 150 12283 ----
NM_020769chrX2928 838 ------
NM_020771chr621462 466 ------
NM_020772chr17107618 7589 6966 6073 5990 5557 5445 1935 1716 1565 27269 5939 25545 1960 --
NM_020774chr18115733 5715 4651 4560 4316 3958 3800 1977 1376 1224 241 ----11389
NM_020776chr1872968 2640 2470 1144 1030 879 801 1732 ----
NM_020778chr1564456 1821 1787 1242 414 289 --24625 1067 --
NM_020786chr1661816 1631 784 735 491 242 21917 1505 ----
NM_020791chr1721161 161 11235 --142
NM_020792chr342777 2431 962 107 1653 ----
NM_020796chr532140 2044 556 22051 957 ----
NM_020801chr521733 530 1786 --1561
NM_020841chr1263435 3358 3343 2951 619 250 ------
NM_020850chr1632440 854 167 21302 847 12359 --
NM_020854chr1821448 238 ------
NM_020858chr1522200 669 ------
NM_020859chr443874 3327 1180 416 1666 ----
NM_020860chr44887 257 244 169 --1163 1379
NM_020868chr221978 462 1371 1173 --
NM_020870chr431980 903 296 ------
NM_020871chrX1573 22512 1011 ----
NM_020872chr321294 114 ------
NM_020873chr3--1355 ----
NM_020888chr152011 1768 1633 540 463 1704 ----
NM_020892chr71355 ------
NM_020897chr131229 1187 451 11216 21076 894 --
NM_020899chr1751937 909 825 694 310 ------
NM_020909chr22794 632 14082 14026 --
NM_020917chr1943363 1521 770 704 12401 --12459
NM_020918chr1032368 2362 1329 ------
NM_020919chr221206 477 2270 35 ----
NM_020922chrX31715 235 115 11642 21877 519 11737
NM_020925chr1--1548 ----
NM_020927chr1642372 1491 586 119 12134 12248 --
NM_020935chr2103830 3779 3428 3137 3063 1871 1224 680 645 94 1859 14254 --
NM_020940chr1022946 962 ------
NM_020946chr931145 525 89 --11306 --
NM_020947chr1652105 1916 1749 1503 895 1304 ----
NM_020948chr153416 3400 948 246 153 12944 --12729
NM_020951chr193927 540 262 ------
NM_020964chr1873899 3477 3098 1439 1269 1023 44 34297 4142 1190 13879 --
NM_020975chr1021891 1852 --165 --
NM_020977chr4----11655 --
NM_020988chr1631071 1027 395 --11314 --
NM_021003chr14----128 --
NM_021005chr1521032 402 ------
NM_021007chr272299 2249 1938 616 445 93 41 12282 ----
NM_021012chr1762829 2811 2245 721 436 273 --43089 2712 1169 1140 22032 524
NM_021033chr1311162 ------
NM_021035chr2021008 468 1219 ----
NM_021045chr1022021 923 12639 ----
NM_021069chr431974 1740 499 ------
NM_021072chr522136 75 1689 12007 --
NM_021096chr2242925 2869 2776 54 ----12699
NM_021097chr223061 1939 ------
NM_021111chr91421 ------
NM_021115chr221138 ------
NM_021116chr769053 8892 7002 6865 6668 3565 26354 5912 22445 1845 --
NM_021120chrX2945 682 --13188 12046
NM_021132chr102532 300 1986 ----
NM_021140chrX2718 115 --11050 --
NM_021145chr71157 1100 ----
NM_021158chr201326 --1839 --
NM_021183chrX2571 528 ----1217
NM_021190chr111068 ------
NM_021220chr203422 369 47 ------
NM_021229chr1221021 36 ------
NM_021239chr1421156 1056 ------
NM_021249chr1431628 1294 334 11235 ----
NM_021252chr1051435 1413 319 294 197 ------
NM_021255chr1442732 716 216 73 13971 ----
NM_021574chr2252191 1972 1735 816 337 1126 --12027
NM_021619chr911164 11076 1987 --
NM_021626chr17--1432 ----
NM_021627chr31996 ------
NM_021629chr344882 4742 1510 80 13303 ----
NM_021647chr4114028 3978 3925 3811 3553 3475 3161 1817 909 388 236 24073 269 1772 --
NM_021722chr7139 ------
NM_021723chr7287 39 ------
NM_021813chr645701 5455 3648 1788 35052 4686 1583 ----
NM_021814chr621531 1524 ----11427
NM_021911chr544341 4334 1402 833 34357 3610 1638 ----
NM_021912chr1563991 3846 3232 1683 1157 59 31523 1041 282 ----
NM_021914chr1422443 1571 ----1704
NM_021943chr651899 1550 1473 841 603 --11742 21754 771
NM_021947chr171919 ------
NM_021949chrX42785 2577 674 206 ------
NM_021951chr91907 1717 ----
NM_021958chr11342 ------
NM_021960chr132161 1992 718 ----12291
NM_021961chr1195875 5440 4907 2786 2526 2484 2371 2238 1965 26555 1723 26440 5105 15181
NM_021962chr1732460 1721 826 --22344 776 1797
NM_021964chr335408 2558 1230 66345 2489 2363 1959 1535 674 --16539
NM_021998chrX21233 1062 11403 ----
NM_022037chr2167 ----1198
NM_022041chr1652213 1924 994 891 793 12677 ----
NM_022048chr1575280 1373 833 411 358 344 283 --1643 --
NM_022058chr22400 91 ------
NM_022062chr111346 ------
NM_022066chr171984 ------
NM_022085chr641589 1419 1178 1013 11242 1391 --
NM_022103chr19168 2812 346 ----
NM_022114chr153526 3500 1400 658 470 14191 1595 11641
NM_022118chr132258 39 1527 ----
NM_022121chr61254 21135 948 ----
NM_022129chr10--1251 1102 --
NM_022140chr531964 1497 549 11555 ----
NM_022166chr16105627 5027 4965 4643 4587 4385 2348 2335 1407 351 --54864 4794 4656 2547 1755 14619
NM_022167chr171854 ------
NM_022173chr2167 ----1198
NM_022351chr863617 2972 2529 991 581 95 11323 1474 --
NM_022374chr23330 85 27 1436 ----
NM_022454chr8----1789 1160
NM_022458chr753114 3098 2131 1238 803 2984 25 --12891
NM_022459chr1386060 5102 4653 4262 4160 1511 1108 1085 24420 1979 --14936
NM_022474chr1431909 1884 686 ----12198
NM_022482chr2072213 1800 1604 999 415 393 33 32441 2132 2086 ----
NM_022484chr761312 943 893 415 390 298 ------
NM_022497chr353704 2670 1417 763 388 11505 --23900 3857
NM_022650chr51706 ------
NM_022658chr12180 ------
NM_022726chr61407 ------
NM_022728chr73228 107 95 ------
NM_022735chr11418 --1101 --
NM_022763chr362998 2842 1955 1244 898 286 1697 ----
NM_022768chr11129 ------
NM_022771chr12--21002 186 ----
NM_022776chr3--1197 147 --
NM_022781chr932955 1018 368 22690 103 ----
NM_022802chr1041489 1233 419 174 ------
NM_022831chr131374 374 266 2280 40 ----
NM_022832chr442399 1012 432 323 1734 ----
NM_022841chr1522377 1833 ------
NM_022844chr162945 713 1642 ----
NM_022845chr1661747 880 808 590 496 114 ----1569
NM_022893chr233148 1163 766 22660 705 ----
NM_022898chr1444549 1577 514 152 13173 --14780
NM_022901chr931584 1210 218 11396 ----
NM_022902chr51304 1313 ----
NM_022909chr51116 1522 ----
NM_022912chr252583 2441 2014 696 109 ------
NM_022918chr1142123 1884 1660 435 ------
NM_023000chr141668 ------
NM_023001chr141668 ------
NM_023039chr55423 308 84 69 36 --125 --
NM_023074chr1931274 400 103 ------
NM_023079chr1741425 1166 633 452 ------
NM_023927chr511042 21287 963 ----
NM_023929chr852534 2506 1987 1968 1040 ------
NM_024007chr542047 969 910 719 23016 1067 ----
NM_024016chr173842 806 705 ------
NM_024034chr202728 274 1205 ----
NM_024045chr102166 45 122 ----
NM_024061chr72557 182 ------
NM_024089chr131138 ------
NM_024095chr1221477 1329 1523 ----
NM_024295chr841819 1646 449 312 11941 ----
NM_024311chr172254 164 1739 ----
NM_024326chr101140 ------
NM_024345chr985103 4203 4070 2080 1853 1536 1197 985 32382 1656 905 --15364
NM_024424chr1161272 1098 960 416 280 185 1378 ----
NM_024425chr1161272 1098 960 416 280 185 1378 ----
NM_024426chr1161272 1098 960 416 280 185 1378 ----
NM_024496chr141666 ------
NM_024524chr332190 1110 952 --1354 --
NM_024529chr111066 ------
NM_024561chr1331193 525 149 ------
NM_024563chr521835 583 21888 1630 ----
NM_024582chr411123 2314 274 ----
NM_024602chr1--2666 591 2864 725 --
NM_024607chr863714 3632 3119 3050 851 810 31385 1064 440 --13135
NM_024612chr172995 58 ------
NM_024631chr11148 ------
NM_024632chr51281 160 ----
NM_024639chr612825 21940 317 ----
NM_024645chr831146 404 49 --11347 21410 556
NM_024663chr20139 ------
NM_024666chr153678 537 61 ------
NM_024670chr1061630 1461 1287 509 276 99 ------
NM_024674chr162964 2325 2171 1035 970 833 22545 943 ----
NM_024692chr221805 72 11308 ----
NM_024700chr12963 909 ------
NM_024702chr173598 558 205 ------
NM_024713chr1521038 658 ------
NM_024721chr852370 980 753 739 608 --1646 --
NM_024740chr1164146 3639 3401 3372 1081 151 34020 3125 814 11432 --
NM_024744chr252659 833 505 297 166 ------
NM_024749chr14852 760 285 56 11512 ----
NM_024753chr22492 204 ------
NM_024755chr15--1369 ----
NM_024757chr91816 1740 ----
NM_024761chr955214 3965 1121 669 308 11089 13268 --
NM_024770chr2115601 5326 4589 4561 4157 4068 1379 1284 1243 500 65 12027 ----
NM_024772chr12545 440 ------
NM_024786chr52255 42 --186 --
NM_024811chr112524 148 --11789 --
NM_024824chr1421535 139 --11334 --
NM_024852chr12593 166 ------
NM_024863chrX--122 ----
NM_024881chr1953376 2617 2539 668 349 23817 1165 ----
NM_024887chr162120 1757 563 425 376 39 11593 ----
NM_024899chr181264 ------
NM_024900chr432139 1618 338 ------
NM_024900chr432139 1618 338 ------
NM_024909chr611115 ------
NM_024915chr851100 694 672 630 412 --1623 --
NM_024930chr531752 1103 66 ------
NM_024944chr212404 159 ------
NM_024947chr357257 5809 1950 1872 396 11302 ----
NM_024948chr101198 ------
NM_024949chr443355 3098 1876 1070 23562 1283 13222 13677
NM_024953chr1262793 2408 1994 1764 1098 317 --11870 --
NM_024979chr1341193 565 504 294 11128 ----
NM_024989chr278077 7549 6391 6227 2426 728 113 11444 1424 --
NM_024993chr2129 ----1407
NM_025040chr1931538 491 222 22373 2157 ----
NM_025076chr2----1537 --
NM_025134chr1621943 614 22454 1572 11891 --
NM_025135chr18----1437 --
NM_025146chr322689 2563 ------
NM_025179chr184969 4655 3678 1889 1374 1362 1170 293 1773 13070 13430
NM_025191chr112628 --22727 2541 --
NM_025208chr1122035 274 ------
NM_025211chr9------1214
NM_025221chr4--150 --1998
NM_025222chr352970 2570 914 847 370 12369 ----
NM_025235chr1031932 1924 483 ------
NM_025246chr3----165 --
NM_025268chr141390 ------
NM_030579chr1633180 1484 980 21436 1038 13639 --
NM_030621chr1454185 2921 1479 1095 872 14105 ----
NM_030623chr221663 568 11372 ----
NM_030625chr1062539 2100 2084 679 308 85 12525 --12365
NM_030627chr564005 3483 3005 2857 2725 2611 23550 2822 1423 --
NM_030640chr121714 --2864 582 --
NM_030647chr775881 5557 4640 4067 1902 1876 1309 --14933 --
NM_030648chr465437 5067 4649 4635 4192 3858 ------
NM_030650chr242893 2603 489 477 14124 ----
NM_030664chr1061821 1719 1538 858 597 267 1308 ----
NM_030674chr1274565 4322 4311 2161 273 90 36 ------
NM_030755chr1463003 2549 2117 1000 776 138 12208 ----
NM_030759chr101641 ------
NM_030786chr141650 692 539 442 --21417 504 --
NM_030791chr1411620 11578 11332 --
NM_030799chr51189 1508 11968 --
NM_030802chr17--127 ----
NM_030806chr1108616 8335 6210 3621 3542 3053 2995 2112 2067 1588 47193 6049 3628 900 18318 --
NM_030810chr641589 1419 1178 1013 11242 1391 --
NM_030816chr143495 2753 2569 710 ------
NM_030821chr4--1332 ----
NM_030885chr321971 917 11935 ----
NM_030914chr91998 ------
NM_030915chr242307 2009 687 589 --11717 --
NM_030949chr61150 ----11489
NM_030954chr82606 24 1767 ----
NM_030962chr113462 431 155 21398 536 ----
NM_030964chr552468 1249 806 643 30 --22298 117 13673
NM_030969chr62452 111 ------
NM_031216chr1842184 1976 1622 492 ------
NM_031217chr11----1120 --
NM_031268chr1644974 3668 3649 1964 14215 ----
NM_031296chr41151 ------
NM_031314chr1431264 714 44 --11899 --
NM_031371chr11592 ------
NM_031371chr11592 ------
NM_031372chr411416 1493 ----
NM_031407chrX--137 ----
NM_031411chr52925 317 11807 12042 --
NM_031418chr1152115 2021 704 504 284 --12591 --
NM_031422chr18--2454 135 ----
NM_031427chr1474590 4045 1903 1330 868 580 75 54492 3814 1639 1278 278 --14248
NM_031435chr1242800 2539 2523 2316 23172 523 22447 2271 --
NM_031442chrX43056 2314 275 58 22382 976 --12472
NM_031443chr72377 150 ------
NM_031461chr822037 153 --11985 --
NM_031468chr747966 7349 2346 2074 28241 8176 ----
NM_031483chr2042212 189 164 62 23168 2500 ----
NM_031492chr111522 ------
NM_031844chr123919 3506 ------
NM_031845chr243467 2923 1120 295 12702 ----
NM_031847chr243467 2923 1120 295 12702 ----
NM_031849chr52925 317 11807 12042 --
NM_031857chr52925 317 11807 12042 --
NM_031860chr52925 317 11807 12042 --
NM_031890chr2282348 2137 2047 917 782 592 91 61 ------
NM_031892chrX3358 253 60 2731 655 ----
NM_031942chr231249 429 31 1998 ----
NM_031953chr4--1452 ----
NM_032012chr964385 4058 3817 1346 502 76 23734 854 --13880
NM_032025chr31166 21447 139 ----
NM_032042chr532792 2275 720 ------
NM_032047chr362302 1936 1621 1576 175 76 ------
NM_032102chr1142423 469 129 67 12132 ----
NM_032105chr177371 7062 5755 5590 1105 829 493 56665 3212 2295 1688 257 23134 1657 --
NM_032116chr1344889 4607 2330 844 15077 15147 1259
NM_032138chr13132 1180 ----
NM_032147chr121383 1292 2789 217 --
NM_032182chr103537 339 168 1583 ----
NM_032186chr131038 531 171 ------
NM_032189chr1375074 4697 4586 4535 3269 1495 892 ------
NM_032195chr211526 ------
NM_032208chr242611 1205 650 395 33072 2875 236 ----
NM_032217chr461132 555 455 397 200 93 ------
NM_032221chr2021744 729 1358 1199 --
NM_032231chr151305 ------
NM_032233chr141646 ------
NM_032246chr15------11107
NM_032256chr12190 ------
NM_032268chr1682676 2628 2588 2479 2182 510 366 304 ------
NM_032291chr11542 31678 1635 295 ----
NM_032320chr11----1662 1226
NM_032321chr252817 2785 780 490 115 12599 ----
NM_032352chr1451237 1206 1178 540 29 ------
NM_032373chr1085664 4894 4723 4634 1674 1651 1253 49 14006 1134 1631
NM_032435chr152427 2397 2384 177 65 11933 ----
NM_032439chr1021278 374 ------
NM_032445chr1551030 786 698 622 35 12174 ----
NM_032446chr543754 3657 3457 387 ----1407
NM_032451chr162651 125 ------
NM_032452chr141260 ------
NM_032457chr443647 3200 176 134 ------
NM_032491chr1211253 1432 ----
NM_032505chr352782 1764 982 858 823 ------
NM_032509chr842122 1853 1705 385 22525 2087 11694 --
NM_032538chr672771 2710 2493 2108 2034 1852 409 --32159 617 224 --
NM_032550chr1031061 816 223 11168 ----
NM_032557chr43658 191 83 --1313 --
NM_032622chr411421 ----21602 345
NM_032632chr1441783 1617 1327 1243 31452 458 35 ----
NM_032682chr31197 21086 625 ----
NM_032717chr43731 217 128 ------
NM_032727chr1031598 1365 659 ------
NM_032737chr1941777 1086 835 34 --2937 908 --
NM_032765chr51851 ------
NM_032777chr821437 421 ------
NM_032778chr363144 2815 2671 2386 986 611 1111 ----
NM_032804chr103658 94 69 1675 ----
NM_032810chr1021120 466 ------
NM_032812chr10136 ------
NM_032828chr19113065 1857 1744 1463 1388 1301 1106 964 832 806 118 44279 3741 1079 329 ----
NM_032840chr122992 123 1751 189 --
NM_032846chr1461514 1219 549 499 455 409 1529 11236 --
NM_032859chr1333563 2436 824 ------
NM_032867chr11--1585 ----
NM_032873chr1133662 3143 599 ------
NM_032900chr1033369 3359 2919 23562 1575 11331 --
NM_032905chr101808 ------
NM_032906chr41165 ------
NM_032932chr1796393 6034 5867 4871 2526 2428 1920 348 279 25068 2005 25247 936 --
NM_032961chr43561 271 258 ------
NM_032968chrX53533 3287 3087 691 591 1818 2409 398 --
NM_032969chrX53533 3287 3087 691 591 1818 2409 398 --
NM_032973chrY53529 3282 3082 691 591 --2409 398 --
NM_032975chr1853618 3162 2907 1380 444 13022 ----
NM_032978chr1811097 ------
NM_032979chr1811097 ------
NM_032980chr1853618 3162 2907 1380 444 13022 ----
NM_032981chr1811097 ------
NM_032998chr13288 217 81 ------
NM_032999chr721106 125 --1145 --
NM_033000chr721106 125 --1145 --
NM_033001chr721106 125 --1145 --
NM_033017chr771441 684 646 557 142 91 76 --11679 --
NM_033020chr164318 3937 1130 1095 611 493 24349 1357 23771 673 --
NM_033023chr711155 --11219 --
NM_033036chr1121234 446 11654 ----
NM_033055chr111029 129 ----
NM_033081chr2011375 ------
NM_033083chr343367 2100 2087 2080 --12784 --
NM_033087chr921189 300 --1972 --
NM_033089chr2021197 151 1475 1486 --
NM_033125chr6142 ------
NM_033135chr1122035 274 ------
NM_033136chr531809 545 355 --11377 --
NM_033137chr531809 545 355 --11377 --
NM_033138chr742351 2112 1817 257 12187 11696 --
NM_033139chr742351 2112 1817 257 12187 11696 --
NM_033140chr742351 2112 1817 257 12187 11696 --
NM_033143chr474101 3678 3208 3199 3044 2910 163 1175 --14596
NM_033157chr742351 2112 1817 257 12187 11696 --
NM_033181chr653935 3391 942 197 69 43199 2832 1168 102 13070 --
NM_033211chr511780 ------
NM_033224chr778060 6835 5018 2201 2181 1987 1156 37951 7239 5190 1451 --
NM_033227chr52523 137 ------
NM_033228chr52563 177 ------
NM_033255chr131100 ------
NM_033272chr2181 ------
NM_033285chr883578 3518 3038 1610 1530 1284 1191 893 11325 ----
NM_033290chrX41451 1225 847 632 --13138 --
NM_033300chr121441 1136 11249 ----
NM_033360chr121253 --14374 --
NM_033389chr1713658 ------
NM_033419chr1731528 282 235 11418 2368 21 --
NM_033425chr1143357 3274 3098 255 --21256 970 --
NM_033429chr1542281 2191 862 716 23109 423 --12689
NM_033430chr443480 3160 1409 31 43726 3687 3503 1449 --1796
NM_033437chr443480 3160 1409 31 43726 3687 3503 1449 --1796
NM_033495chrX3925 256 35 ------
NM_033505chr286363 6109 4278 2030 1829 1436 1113 275 ----12255
NM_033535chr431150 923 763 1153 126 --
NM_033551chr522507 2306 2698 576 ----
NM_033631chr143853 3580 878 486 21022 471 125 --
NM_033644chr5--21679 645 ----
NM_033645chr5--21679 645 ----
NM_033656chr21105948 5136 4531 4275 4195 4120 1654 1315 1060 424 24259 4137 15750 11968
NM_048368chr18----1313 --
NM_052834chr1852099 1842 863 712 513 --12489 1495
NM_052840chr1511117 ------
NM_052864chr441902 602 574 482 11857 ----
NM_052875chr1132081 1965 1944 152 ----
NM_052877chr1287 53 1130 ----
NM_052879chr1221393 1204 12776 ----
NM_052885chr1234267 3960 1347 43891 3601 3171 1222 ----
NM_052886chr821824 1428 --146 --
NM_052900chr821570 1482 1476 --1179
NM_052903chr151530 ----1240
NM_052905chr221812 489 1577 ----
NM_052911chr182943 257 --1924 --
NM_052913chr61980 --11046 --
NM_052917chr283057 3002 2929 2867 2829 2261 452 33 1828 ----
NM_052918chr1033700 3175 3147 ------
NM_052937chr852266 1031 692 638 451 ------
NM_052944chr16----189 --
NM_052953chr3169 ------
NM_052954chr2142249 479 161 63 ------
NM_053016chr997423 7244 6540 5707 5433 5419 2224 1835 1134 47196 6706 4869 3102 --15716
NM_053023chr111411 22392 218 ----
NM_053024chr351554 1101 421 342 169 ------
NM_053046chr19----1557 --
NM_053064chr1432597 2540 497 ----1555
NM_053281chrX1111 1368 ----
NM_054016chr131854 1831 60 1602 ----
NM_054016chr131854 1831 60 1602 ----
NM_054016chr131854 1831 60 1602 ----
NM_054027chr51535 12124 11625 --
NM_054110chr31702 1979 ----
NM_054111chr64893 808 335 113 1733 ----
NM_057175chr432611 2222 2022 21949 861 ----
NM_057178chr1762497 2291 2167 2108 2043 742 ----1535
NM_057182chr191500 ------
NM_057749chr83482 270 219 ------
NM_058172chr431854 1144 145 2544 190 ----
NM_058241chr231610 811 459 ------
NM_058241chr231610 811 459 ------
NM_078471chr1731156 474 258 --11216 --
NM_078483chr563545 3462 3367 1228 825 127 --13172 --
NM_078625chr64545 460 157 91 11030 ----
NM_080422chr181133 ------
NM_080491chr1153931 3108 2414 196 105 2318 111 ----
NM_080546chr912136 --1649 --
NM_080597chr1831098 694 84 ------
NM_080599chr101876 21137 171 ----
NM_080650chr152810 436 21179 1006 ----
NM_080654chr117946 413 213 99 85 78 51 11150 ----
NM_080683chr44466 444 123 68 ------
NM_080684chr44466 444 123 68 ------
NM_080685chr44466 444 123 68 ------
NM_080732chr19----1557 --
NM_080759chr1322626 2458 ------
NM_080760chr1322626 2458 ------
NM_080798chr101174 ------
NM_080799chr101174 ------
NM_080800chr101174 ------
NM_080801chr101174 ------
NM_080802chr101174 ------
NM_080803chr101174 ------
NM_080804chr101174 ------
NM_080805chr101174 ------
NM_080806chr101174 ------
NM_080807chr101174 ------
NM_080808chr101174 ------
NM_080809chr101174 ------
NM_080810chr101174 ------
NM_080811chr101174 ------
NM_080812chr101174 ------
NM_080813chr101174 ------
NM_080814chr101174 ------
NM_080815chr101174 ------
NM_080867chr1495096 4357 4107 3646 1816 1464 905 230 120 --14221 --
NM_080872chr894026 3651 3563 3540 3128 2848 983 672 78 43192 1152 419 212 ----
NM_080874chr421741 347 ------
NM_130386chr182623 543 1151 ----
NM_130391chr963316 3151 2827 1377 1147 926 12761 ----
NM_130392chr963316 3151 2827 1377 1147 926 12761 ----
NM_130393chr963316 3151 2827 1377 1147 926 12761 ----
NM_130436chr2142203 1915 1909 1865 ------
NM_130438chr2172780 2492 2486 2442 301 211 184 --1401 --
NM_130440chr111537 11315 ----
NM_130469chr141645 ------
NM_130797chr711804 ------
NM_130808chr3--171 ----
NM_130838chr1511255 ------
NM_130839chr1511255 ------
NM_133264chr1763823 3427 3315 2787 541 284 11152 33649 2691 941 --
NM_133265chrX32719 2237 176 23020 3010 11342 --
NM_133330chr44974 911 704 187 21161 835 ----
NM_133331chr44974 911 704 187 21161 835 ----
NM_133334chr476219 4852 4744 4300 3981 1421 525 170 ----
NM_133335chr44974 911 704 187 21161 835 ----
NM_133367chr663463 3452 3158 2851 1147 589 1831 --13368
NM_133370chr421109 69 23566 2380 21026 99 --
NM_133443chr1631826 296 87 ------
NM_133445chr963507 2812 2419 2397 1047 134 ------
NM_133473chr1931541 1515 207 21881 154 ----
NM_133478chr222438 1854 1843 1315 --
NM_133486chrX2450 438 1116 ----
NM_133496chr133645 3493 1656 --12832 --
NM_133499chrX1317 ------
NM_133503chr123766 650 112 ------
NM_133504chr123766 650 112 ------
NM_133505chr123766 650 112 ------
NM_133506chr123766 650 112 ------
NM_133507chr125944 828 290 142 38 1155 ----
NM_133642chr2231236 1199 187 ------
NM_133647chr1573814 3363 3346 2703 2590 1470 578 33305 2869 1168 ----
NM_134265chr17----21010 958 --
NM_134268chr172992 247 2397 338 ----
NM_134442chr21284 11627 ----
NM_138270chrX43363 3342 3317 1117 23197 709 ----
NM_138288chr1462135 1923 1495 424 408 219 11802 ----
NM_138316chr1031314 403 349 ------
NM_138319chr1531044 915 308 11000 1461 --
NM_138344chr14----1336 --
NM_138357chr102649 108 11207 ----
NM_138395chr211048 ------
NM_138396chr121289 --1774 --
NM_138423chr1552236 1768 772 732 56 11787 ----
NM_138426chr721882 396 ------
NM_138444chr1354212 3503 3417 1192 278 ------
NM_138455chr81120 ------
NM_138457chr643339 3080 2077 1145 ------
NM_138459chr653579 3067 1463 1176 68 12945 --13269
NM_138468chr265990 5867 4270 1072 919 729 32301 2074 1472 ----
NM_138473chr1254363 3994 2030 1950 1865 13331 24554 4067 --
NM_138494chr722247 633 22567 1791 ----
NM_138558chr111040 ------
NM_138569chr62248 204 ------
NM_138576chr1444549 1577 514 152 13173 --14780
NM_138621chr253802 3141 2716 837 294 13731 23831 2612 --
NM_138633chr621703 1295 ------
NM_138638chr1422443 1571 ----1704
NM_138694chr633566 2253 1344 23351 257 ----
NM_138701chr72225 81 ------
NM_138713chr16117834 7660 7193 6603 6106 5708 5514 2817 1659 1610 367 57989 7459 6777 2118 683 15499 --
NM_138714chr16117834 7660 7193 6603 6106 5708 5514 2817 1659 1610 367 57989 7459 6777 2118 683 15499 --
NM_138730chr62464 456 2130 93 ----
NM_138731chr1443569 2977 1201 747 21244 221 ----
NM_138798chr2--1111 132 --
NM_138799chr211944 ------
NM_138811chr731073 319 126 --1896 --
NM_138927chr21----1346 --
NM_138929chr122489 265 --1569 --
NM_138930chr122489 265 --1569 --
NM_138970chr1431885 1581 46 22315 861 ----
NM_139015chr1221424 1413 --11245 --
NM_139045chr92117 61 --1598 --
NM_139062chr172439 131 ------
NM_139068chr51672 ------
NM_139069chr51672 ------
NM_139070chr51541 ------
NM_139132chr112849 112 ----1219
NM_139135chr12313 267 --1107 --
NM_139164chr541432 1424 585 299 ------
NM_139246chr93431 353 138 1425 12226 1176
NM_139266chr2127 ------
NM_139312chr1011362 2604 316 168 --
NM_139321chr2043332 1700 717 371 11444 13693 --
NM_144568chr141599 ------
NM_144571chr436617 6133 934 36594 5687 4568 ----
NM_144574chr141176 ------
NM_144578chr1495264 4657 4487 4307 4257 3769 1857 1814 650 14091 11140 15323
NM_144590chr1082379 2266 2166 813 707 509 172 54 1683 --1787
NM_144609chr1731279 943 120 ------
NM_144610chr171455 --1391 --
NM_144628chr2033057 2228 868 1254 ----
NM_144664chr11--12389 ----
NM_144723chr53325 208 156 --1758 --
NM_144767chr1563917 3498 3080 1240 479 440 --24289 812 --
NM_144778chr133480 364 274 12634 ----
NM_144963chr832712 222 35 22540 2251 ----
NM_144967chrX2747 263 ------
NM_144973chr1264971 4557 4445 1996 528 500 24140 1746 1896 --
NM_144979chr41270 ----1527
NM_145012chr1021026 1005 ------
NM_145025chr62286 21 1262 155 --
NM_145036chr171380 1322 ----
NM_145055chr1853053 1013 561 407 295 11471 ----
NM_145112chr1421004 447 ------
NM_145117chr1132919 2620 858 ------
NM_145176chr642154 498 417 275 13328 ----
NM_145206chr1022106 251 ------
NM_145235chr101151 ------
NM_145259chr277011 5580 1790 1419 1266 1205 94 36923 4531 2409 15182 --
NM_145268chr7--21027 110 ----
NM_145296chr191616 187 ----
NM_145303chr6----1474 --
NM_145307chr1074082 3574 3564 3090 3061 2980 930 ------
NM_145313chr1031561 597 298 ------
NM_145320chr763566 3012 2886 1056 1006 142 ------
NM_145321chr763566 3012 2886 1056 1006 142 ------
NM_145322chr763566 3012 2886 1056 1006 142 ------
NM_145331chr61633 ------
NM_145332chr62781 76 ------
NM_145333chr62781 76 ------
NM_145649chr632579 1048 869 12252 ----
NM_145655chr632579 1048 869 12252 ----
NM_145686chr233134 1148 909 31185 901 250 13374 --
NM_145687chr233134 1148 909 31185 901 250 13374 --
NM_145698chr1042007 1455 806 251 21752 223 1309 --
NM_145716chr11608 ------
NM_145735chr1312376 ----12156
NM_145808chr732067 481 463 186 12528 --
NM_145810chr231249 429 31 1998 ----
NM_145859chr31392 ------
NM_145860chr31392 ------
NM_145891chr1611427 ------
NM_145892chr1611427 ------
NM_145893chr1611549 ------
NM_147150chr963798 3467 3325 3010 942 730 --12949 --
NM_147171chr71392 ------
NM_147175chrX32042 667 660 ------
NM_147181chr4--150 --1998
NM_147182chr4--150 --1998
NM_147183chr4--150 --1998
NM_147185chr71392 ------
NM_147189chr852252 2021 1953 532 262 1208 ----
NM_147202chr931104 1049 731 --187 1740
NM_148174chr832231 1453 322 ------
NM_148894chr41220 1843 21269 911 --
NM_148898chr71766 --1791 --
NM_148899chr71766 --1791 --
NM_148923chr181210 ------
NM_148957chr1342491 2178 839 598 1265 ----
NM_148977chr1031314 403 349 ------
NM_148978chr1031314 403 349 ------
NM_152233chr1431628 1294 334 11235 ----
NM_152253chr2253613 3394 2703 1432 38 1921 1898 12656
NM_152261chr1222301 2024 ------
NM_152263chr165910 5794 2219 579 334 33 54947 4123 1952 1075 374 ----
NM_152265chr111244 1483 ----
NM_152271chr83745 440 65 ------
NM_152280chr153481 1244 1005 885 309 --12834 --
NM_152282chr341229 918 908 385 ------
NM_152300chr1741735 1390 1321 731 ----1593
NM_152305chr31260 --22060 2052 --
NM_152317chr121226 ------
NM_152330chr1442465 2184 928 755 1395 ----
NM_152332chr1452406 2207 1139 871 557 1406 1456 --
NM_152387chr22980 216 ------
NM_152388chr243870 3736 3352 583 ------
NM_152409chr543511 3155 2512 2496 32336 1319 1012 12815 --
NM_152411chr7--2924 620 ----
NM_152414chr811390 ------
NM_152420chr93682 165 148 ------
NM_152422chr91287 21662 380 ----
NM_152424chrX44359 3554 528 202 24064 169 13400 --
NM_152442chr1221168 1081 ------
NM_152450chr1541947 780 489 336 22137 203 21440 151 --
NM_152451chr151807 1865 ----
NM_152470chr1853785 2887 743 717 635 ------
NM_152487chr121357 496 21403 266 ----
NM_152519chr242022 1724 1615 763 22076 853 ----
NM_152522chr2----2250 79 --
NM_152527chr242151 1845 851 299 21865 492 ----
NM_152529chr241778 1563 980 624 23172 463 ----
NM_152538chr311753 1518 11182 --
NM_152545chr41643 ------
NM_152556chr752030 1024 738 145 122 22484 1853 ----
NM_152594chr151600 ------
NM_152605chr1931110 977 895 ------
NM_152608chr162036 1916 707 563 292 279 21932 1864 12381 142
NM_152609chr11362 ------
NM_152622chr563168 2266 945 913 614 458 12376 ----
NM_152624chr576901 6854 5684 2714 2444 349 203 12282 11019 --
NM_152629chr941625 1219 747 356 13895 22850 919 --
NM_152630chrX--31332 1143 999 ----
NM_152636chr1131087 1037 83 12425 ----
NM_152641chr1222705 1161 1597 ----
NM_152667chr2021312 1009 ----11391
NM_152699chr353506 3403 2934 2338 1515 1492 --1913
NM_152704chr132880 263 ------
NM_152716chr1151476 633 607 220 137 --11486 --
NM_152737chr642121 1956 524 183 ------
NM_152744chr763326 996 681 418 136 54 ------
NM_152748chr71351 1505 ----
NM_152754chr732812 2697 244 1376 12746 --
NM_152758chr832361 2075 169 1241 ----
NM_152774chr752735 2724 2304 2252 840 1911 ----
NM_152780chrX21295 413 ------
NM_152787chrX33422 1511 1007 21399 712 ----
NM_152789chr721307 469 --11293 --
NM_152793chr73792 701 416 ------
NM_152838chr2032907 1135 153 1758 ----
NM_152860chr12187 ------
NM_152890chr1--11092 ----
NM_152896chr9--1710 ----
NM_152924chr15106908 6758 6319 6250 6108 4360 2293 1955 1610 1063 36831 5497 1876 ----
NM_152991chr113716 682 673 ------
NM_152999chr7104953 4658 4334 3952 3702 3365 3184 2015 1555 39 24937 845 ----
NM_153015chr84804 383 297 263 --130 --
NM_153026chr122184 140 ------
NM_153029chr1684169 3674 3643 3546 480 287 243 233 23954 3448 ----
NM_153035chr131152 477 57 --12102 --
NM_153042chr6--1443 ----
NM_153182chr363144 2815 2671 2386 986 611 1111 ----
NM_153184chr331348 462 92 31402 717 84 ----
NM_153188chr564060 2181 1613 1089 965 695 14941 33970 3748 301 1997
NM_153207chr1253902 2856 2589 741 505 --1637 --
NM_153208chr163987 822 812 ------
NM_153230chr17------1214
NM_153252chrX147 162 ----
NM_153257chr1921271 411 ------
NM_153261chr1631325 1194 140 --11032 --
NM_153262chr132811 2731 2221 3473 121 70 ----
NM_153321chr171353 1695 ----
NM_153322chr171353 1695 ----
NM_153331chr31269 ----1684
NM_153343chr442087 1927 513 489 12277 ----
NM_153354chr51294 ------
NM_153358chr19--2459 231 ----
NM_153367chr1043613 2991 2497 767 --12470 11565
NM_153371chr1331518 836 706 ------
NM_153456chr1395348 4866 4424 2396 2363 1549 1209 1150 395 1792 14550 --
NM_153487chr684307 4104 3777 3721 1422 982 389 262 14830 ----
NM_153498chr102327 156 ----1683
NM_153605chr311440 11621 ----
NM_153616chr1522200 669 ------
NM_153617chr1522200 669 ------
NM_153618chr1522200 669 ------
NM_153619chr1523438 346 --12512 --
NM_153620chr731481 1149 364 11387 ----
NM_153634chr1221356 382 ------
NM_153686chr442339 2143 1928 613 ------
NM_153687chr1221644 229 1356 ----
NM_153690chr31615 ------
NM_153712chr221366 620 33425 3189 452 1657 --
NM_153810chr1053980 3723 1385 1329 593 21417 1302 ----
NM_153812chr132259 1799 509 1452 ----
NM_153828chr22584 252 ------
NM_170607chr1761410 1209 1009 984 275 121 --11180 --
NM_170662chr31254 1478 ----
NM_170665chr1233244 632 72 13912 13556 13202
NM_170674chr1511199 --11234 --
NM_170675chr151875 --1910 --
NM_170676chr151875 --1910 --
NM_170677chr1511199 --11234 --
NM_170692chr171085 915 814 723 423 83 65 ------
NM_170706chr163999 3695 3105 2644 1517 971 24226 3983 ----
NM_170709chr83324 311 41 1712 ----
NM_170721chr17------11348
NM_170731chr1142476 1867 402 216 21911 935 ----
NM_170732chr1142476 1867 402 216 21911 935 ----
NM_170733chr1142476 1867 402 216 21911 935 ----
NM_170734chr1142476 1867 402 216 21911 935 ----
NM_170735chr1142476 1867 402 216 21911 935 ----
NM_170750chrX2755 360 ------
NM_170768chr1131111 269 35 ------
NM_172020chr742062 1799 244 230 1664 21852 816 --
NM_172037chr831349 995 365 132 ----
NM_172058chr861236 610 475 433 172 144 ----1260
NM_172059chr861236 610 475 433 172 144 ----1260
NM_172060chr861236 610 475 433 172 144 ----1260
NM_172110chr201703 ------
NM_172111chr201703 ------
NM_172112chr201703 ------
NM_172113chr201703 ------
NM_172127chr421832 220 12033 --12056
NM_172128chr421788 176 11989 --12012
NM_172159chr331527 716 146 22375 2068 ----
NM_172160chr331527 716 146 22375 2068 ----
NM_172216chr1232797 2446 1993 12851 ----
NM_172315chr1511199 --11234 --
NM_172316chr1511199 --11234 --
NM_173054chr71678 ------
NM_173075chr451420 1251 617 120 31 ------
NM_173156chr111872 ----11972
NM_173172chr241593 1045 301 237 ------
NM_173198chr932443 2222 2148 1887 ----
NM_173200chr932443 2222 2148 1887 ----
NM_173214chr16117834 7660 7193 6603 6106 5708 5514 2817 1659 1610 367 57989 7459 6777 2118 683 15499 --
NM_173354chr211346 12118 ----
NM_173454chr152801 340 --1958 --
NM_173468chr434635 870 854 24501 1731 1517 --
NM_173470chrX12817 1576 12351 --
NM_173475chr1651342 1271 482 121 104 21122 36 ----
NM_173478chr17165 ------
NM_173491chr511107 ------
NM_173496chr1063005 2648 2325 1917 586 262 --11184 --
NM_173508chr151079 1063 1023 990 43 ----11011
NM_173510chr2251920 1058 706 434 244 ------
NM_173511chr273698 3202 2410 1214 978 248 165 22782 962 ----
NM_173515chr61139 ------
NM_173517chr71422 ------
NM_173552chr322027 581 ------
NM_173560chr64470 452 411 48 ------
NM_173563chr6139 ------
NM_173582chr1155873 4310 4080 643 96 21351 755 ----
NM_173602chr1293651 3631 3444 3300 2768 1483 1031 642 404 12716 ----
NM_173631chr1941323 1282 920 234 1869 ----
NM_173642chr178721 7325 1558 1026 976 913 239 68414 5612 2032 1740 1580 871 28903 2591 18790
NM_173683chr821792 369 1668 ----
NM_173694chrX22312 2201 1205 1577 --
NM_173797chr51210 --174 --
NM_173808chr144000 337 315 166 11451 ----
NM_173824chr31226 --147 --
NM_173829chr585976 4392 3856 2470 1476 730 587 347 14211 ----
NM_173851chr832785 808 519 22619 401 ----
NM_173854chr152311 2027 1812 1561 1551 11741 ----
NM_174916chr1542006 1970 1696 1467 1596 ----
NM_175052chr531025 151 113 ------
NM_175061chr721780 704 ----11377
NM_175573chr20195 ------
NM_175607chr321183 251 11677 ----
NM_175610chr1511008 170 ----
NM_175612chr321183 251 11677 ----
NM_175634chr81954 1349 ----
NM_175635chr81954 1349 ----
NM_175636chr81954 1349 ----
NM_175709chr2272588 2214 1098 972 604 555 417 ----1177
NM_175736chr12187600 7425 6741 6578 6099 6086 5907 5720 5275 2997 2889 2636 2299 1859 1362 772 553 145 46637 6078 5359 1296 47115 5680 5618 2332 15301
NM_175748chr1431945 848 489 ------
NM_175767chr521867 1210 --11276 --
NM_175848chr203951 559 454 --11423 1317
NM_175848chr203951 559 454 --11423 1317
NM_175849chr203951 559 454 --11423 1317
NM_175849chr203951 559 454 --11423 1317
NM_175850chr203951 559 454 --11423 1317
NM_175850chr203951 559 454 --11423 1317
NM_175856chr53663 214 187 --143 --
NM_175859chrX11627 --11744 --
NM_175884chr72343 90 ------
NM_175921chr584042 2855 2610 1660 1453 1272 899 585 24088 1528 23371 835 2699 340
NM_176787chr181107 --1620 --
NM_176812chr202782 172 ----1548
NM_176814chr721310 1059 ------
NM_176823chr132707 875 226 23874 1367 2913 251 --
NM_176863chr1742143 2048 1832 765 11618 1169 --
NM_177398chr121789 431 --1356 --
NM_177399chr121789 431 --1356 --
NM_177422chr12593 166 ------
NM_177424chr16757 628 576 493 359 273 ------
NM_177438chr1454185 2921 1479 1095 872 14105 ----
NM_177952chr14----128 --
NM_177968chr22656 538 12012 ----
NM_177972chr1164356 3667 3456 3356 2706 1669 ------
NM_177974chr1552236 1768 772 732 56 11787 ----
NM_177985chr232143 1827 54 ------
NM_177989chr32352 23 ------
NM_177990chr2021611 527 ----11987
NM_177995chr91287 21662 380 ----
NM_178011chr1053265 2835 2803 575 180 12295 11037 --
NM_178013chr1452912 2269 1000 684 346 ------
NM_178042chr32352 23 ------
NM_178123chr21260 ------
NM_178140chr531844 709 264 ------
NM_178151chrX96795 5497 5162 3123 3028 3020 2602 839 360 26161 1055 ----
NM_178152chrX96795 5497 5162 3123 3028 3020 2602 839 360 26161 1055 ----
NM_178153chrX96795 5497 5162 3123 3028 3020 2602 839 360 26161 1055 ----
NM_178154chr141263 ------
NM_178155chr141263 ------
NM_178156chr141263 ------
NM_178157chr141263 ------
NM_178234chr8------136
NM_178423chr741059 938 456 86 2946 906 ----
NM_178425chr741059 938 456 86 2946 906 ----
NM_178426chr11734 ------
NM_178427chr11634 ------
NM_178454chr12511 313 ----1639
NM_178509chr1743116 2950 1542 1078 13869 11226 --
NM_178539chr1241737 1572 822 124 ------
NM_178566chr91210 --11416 --
NM_178585chr462582 2568 1311 1181 1145 94 53315 2540 1247 1129 1013 12169 --
NM_178586chr14--11715 1746 --
NM_178812chr841575 1385 568 293 11235 ----
NM_178815chr1062691 1991 1857 862 669 510 --11901 --
NM_181077chr1511442 12221 ----
NM_181291chr141611 ------
NM_181302chr141176 ------
NM_181308chr141176 ------
NM_181351chr1152632 2624 2397 880 727 32923 2373 706 ----
NM_181354chr821580 371 11701 ----
NM_181358chr163764 3157 3110 1662 922 88 ------
NM_181361chr321266 393 1509 ----
NM_181457chr231034 917 253 ------
NM_181458chr231167 1050 386 ------
NM_181459chr23933 816 152 ------
NM_181460chr23980 863 199 ------
NM_181481chr1866930 6921 5464 5178 4490 2518 56766 6119 1726 1420 745 ----
NM_181482chr1866930 6921 5464 5178 4490 2518 56766 6119 1726 1420 745 ----
NM_181483chr1866930 6921 5464 5178 4490 2518 56766 6119 1726 1420 745 ----
NM_181504chr522666 1390 1363 ----
NM_181523chr522666 1390 1363 ----
NM_181524chr522666 1390 1363 ----
NM_181598chr141255 1303 ----
NM_181659chr2043312 2548 2481 325 11288 12600 --
NM_181659chr2043312 2548 2481 325 11288 12600 --
NM_181671chr173938 265 86 --1212 --
NM_181702chr821017 991 ------
NM_181723chr842341 1644 1638 569 ------
NM_181741chr241258 453 291 132 ------
NM_181742chr241258 453 291 132 ------
NM_181784chr252514 2462 658 634 363 ----11637
NM_181809chr173716 3495 3229 1559 629 387 199 1970 ----
NM_181836chr542050 370 269 244 1490 ----
NM_181838chr521326 517 --1128 --
NM_181876chr41323 22128 334 ----
NM_181886chr4----1131 --
NM_181887chr4----1131 --
NM_181888chr4----1131 --
NM_181889chr4----1131 --
NM_181890chr4----1131 --
NM_181891chr4----1131 --
NM_181892chr4----1178 --
NM_181893chr4----1131 --
NM_182485chr462459 1343 744 433 381 317 1395 ----
NM_182503chr655479 4801 4750 4209 1059 11491 --23705 1966
NM_182540chrX2897 579 ------
NM_182551chr243110 2615 2546 1035 1951 ----
NM_182557chr112483 283 11648 ----
NM_182646chr462459 1343 744 433 381 317 1395 ----
NM_182648chr141235 ------
NM_182678chr24474 439 432 113 ------
NM_182691chr71211 ------
NM_182692chr71211 ------
NM_182715chr72290 218 1906 ----
NM_182717chr1021042 26 11216 ----
NM_182720chr1021042 26 11216 ----
NM_182721chr1021042 26 11216 ----
NM_182722chr1021042 26 11216 ----
NM_182723chr1021042 26 11216 ----
NM_182763chr132150 1981 707 ----12280
NM_182765chr1052048 1848 1521 741 482 12184 ----
NM_182789chr541014 895 319 231 1157 ----
NM_182797chr203675 473 445 1542 ----
NM_182811chr201423 ------
NM_182830chr1432080 1959 518 ------
NM_182835chr14130 ------
NM_182853chr1021042 26 11216 ----
NM_182898chr766338 6027 5485 4441 4122 1737 1205 ----
NM_182899chr766338 6027 5485 4441 4122 1737 1205 ----
NM_182907chr6102448 2388 2376 2308 2252 1878 1593 767 413 254 1793 ----
NM_182920chr321235 354 ----1926
NM_182931chr7--1469 ----
NM_182948chr122172 1053 ------
NM_182964chr1132919 2620 858 ------
NM_182972chr122597 997 11754 22110 527 --
NM_183011chr1021042 26 11216 ----
NM_183012chr1021042 26 11216 ----
NM_183013chr1021042 26 11216 ----
NM_183043chr131896 11032 ----
NM_183044chr131896 11032 ----
NM_183050chr632156 1560 630 1922 ----
NM_183075chr442200 846 818 361 32418 754 460 12971 11874
NM_183078chr683653 2840 2615 1471 1237 412 308 154 13374 23260 619 --
NM_183228chr172680 628 ------
NM_183229chr172680 628 ------
NM_183230chr172680 628 ------
NM_183231chr172680 628 ------
NM_183232chr172680 628 ------
NM_183234chr1521903 1679 ------
NM_183235chr1521903 1679 ------
NM_183236chr1521903 1679 ------
NM_183237chr31374 2801 28 --11120
NM_183238chr1243305 2903 904 547 ------
NM_183323chr541014 895 319 231 1157 ----
NM_183397chr2085100 4942 4384 4072 3547 3160 660 200 11825 ----
NM_183419chr811238 ------
NM_194071chr795235 3667 3519 1964 1038 700 625 509 40 14736 1959 --
NM_194247chr254425 3671 2800 896 845 24538 120 11462 --
NM_194259chr16158 ------
NM_194260chr16158 ------
NM_194261chr16158 ------
NM_194282chr432906 2090 1026 22727 2515 ----
NM_194283chr531643 686 194 21677 1176 --1621
NM_194285chr1132325 2290 1143 12821 ----
NM_194291chr81439 12723 22221 1149 --
NM_194298chr1051926 1647 601 329 188 ------
NM_194301chr141259 ----184
NM_194314chr154872 4237 2211 1419 155 13652 ----
NM_194328chr932955 1018 368 22690 103 ----
NM_194329chr932955 1018 368 22690 103 ----
NM_194330chr932955 1018 368 22690 103 ----
NM_194332chr932955 1018 368 22690 103 ----
NM_194356chr1222307 1840 32417 686 37 ----
NM_194358chr121222 ----1583
NM_194359chr121222 ----1583
NM_194434chr1854911 3880 1374 911 481 14968 166 --
NM_194449chr18--1204 ----
NM_197941chr542238 955 925 720 12683 1311 --
NM_197956chr921572 373 128 ----
NM_197964chr72206 116 156 ----
NM_197968chr13188 ------
NM_197978chr91505 1162 ----
NM_198057chrX146 1793 ----
NM_198089chr19--1104 ----
NM_198098chr751813 1699 1363 376 165 2223 126 ----
NM_198120chr81524 ------
NM_198123chr821570 1482 1476 --1179
NM_198124chr821570 1482 1476 --1179
NM_198128chr1811665 ------
NM_198181chr1532604 2111 1790 11171 ----
NM_198182chr241563 533 344 108 ------
NM_198195chr31576 ------
NM_198196chr342123 1788 867 850 21913 377 12427 1272
NM_198204chr1761410 1209 1009 984 275 121 --11180 --
NM_198205chr1761410 1209 1009 984 275 121 --11180 --
NM_198215chr1041351 1315 1246 523 164 ----
NM_198243chr152683 329 ------
NM_198268chr163764 3157 3110 1662 922 88 ------
NM_198269chr163764 3157 3110 1662 922 88 ------
NM_198270chrX53353 3020 2651 1350 524 ------
NM_198273chr552778 2702 2468 2403 370 ------
NM_198279chrX1847 ------
NM_198336chr731172 500 153 11781 --1697
NM_198353chr4145 ------
NM_198391chr202304 78 ------
NM_198396chr171372 ------
NM_198399chr331856 1712 374 --1589 --
NM_198400chr1562593 1122 966 948 626 330 22541 349 ----
NM_198404chr132345 157 ------
NM_198468chr6104282 4118 3889 3843 3516 3068 2794 1377 226 26 23404 934 ----
NM_198484chr395527 5074 5023 4404 2273 2123 2001 1632 461 45261 4975 4144 1475 ----
NM_198503chr121710 565 1879 ----
NM_198504chr33923 846 777 ------
NM_198511chrX3567 190 41 ------
NM_198560chr363696 3180 2791 1167 967 57 23846 508 --23161 1002
NM_198581chr2147361 7236 6518 6495 5834 5707 5550 4923 4772 2544 1906 1599 1534 280 --174 --
NM_198686chr1452658 2489 1655 1015 879 11647 ----
NM_198715chr1125406 4654 4579 4228 4070 1643 1037 999 977 599 577 293 24011 1488 --21369 229
NM_198721chr41104 ------
NM_198793chr343437 3210 3086 1248 ----1492
NM_198794chr1411396 --1179 --
NM_198859chr365045 3860 3293 883 721 230 55072 3888 3153 1669 1010 ----
NM_198880chr3--1573 ----
NM_198889chr461132 555 455 397 200 93 ------
NM_198900chr12187600 7425 6741 6578 6099 6086 5907 5720 5275 2997 2889 2636 2299 1859 1362 772 553 145 46637 6078 5359 1296 47115 5680 5618 2332 15301
NM_198904chr522082 1580 ------
NM_198968chr1383898 3774 3698 3590 3256 2695 2423 92 13666 ----
NM_198990chr742788 1032 498 97 2355 216 ----
NM_198995chr181528 ----1473
NM_199000chr7--2626 552 11891 --
NM_199051chr11234 ------
NM_199129chr201231 3433 250 63 2887 278 --
NM_199138chr132880 263 ------
NM_199188chr1221393 1204 12776 ----
NM_199189chr51926 ------
NM_199190chr1221393 1204 12776 ----
NM_199245chr1232304 1688 461 12589 1395 --
NM_199320chr412843 1769 ----
NM_199320chr412843 1769 ----
NM_199324chr453154 3044 2751 1014 383 ------
NM_199355chr1611324 11585 ----
NM_199421chr1495096 4357 4107 3646 1816 1464 905 230 120 --14221 --
NM_199436chr241132 620 435 97 1282 ----
NM_199440chr22173 21 ------
NM_199454chr153526 3500 1400 658 470 14191 1595 11641
NM_199462chr193176 2009 1772 1434 1121 1047 1038 595 505 1806 11145 --
NM_199511chr31762 ------
NM_199512chr31762 ------
NM_201263chr131637 1571 822 32138 1565 42 ----
NM_201267chr21593 ------
NM_201269chr131038 531 171 ------
NM_201280chr61145 11196 ----
NM_201436chr73870 792 639 ------
NM_201516chr73926 848 695 ------
NM_201517chr73870 792 639 ------
NM_201532chr111568 ------
NM_201533chr111568 ------
NM_201567chr3153 ------
NM_201568chr111872 ----11972
NM_201569chr111872 ----11972
NM_201570chr1021335 86 11975 11430 --
NM_201571chr1021335 86 11975 11430 --
NM_201572chr1021335 86 11975 11430 --
NM_201590chr1021335 86 11975 11430 --
NM_201593chr1021335 86 11975 11430 --
NM_201596chr1021335 86 11975 11430 --
NM_201597chr1021335 86 11975 11430 --
NM_201630chr1--151 ----
NM_203301chr1431328 300 140 21482 1131 ----
NM_203304chr192665 148 ------
NM_203305chr962305 2233 1830 965 898 396 --12339 12369
NM_203318chr1731156 474 258 --11216 --
NM_203327chr2064135 3961 3482 3365 884 852 --14029 --
NM_203341chr11828 ------
NM_203350chr141628 1236 609 504 --11503 --
NM_203365chr2130 ------
NM_203394chr1272461 2449 2278 1891 1667 1052 519 11850 ----
NM_203446chr2122135 503 11205 ----
NM_203459chr152142 2035 1712 1608 820 11734 ----
NM_203487chr132641 198 ------
NM_203504chr462640 2434 2299 1687 759 356 22469 2384 ----
NM_203505chr462640 2434 2299 1687 759 356 22469 2384 ----
NM_205833chrX4803 794 768 615 ------
NM_205842chr2276 52 ------
NM_205861chr162120 1757 563 425 376 39 11593 ----
NM_206594chr143449 1330 350 189 22428 1069 33310 1211 328 --
NM_206595chr143449 1330 350 189 22428 1069 33310 1211 328 --
NM_206853chr643952 3462 1154 853 13498 ----
NM_206854chr665213 4723 3507 3366 2114 763 24759 93 ----
NM_206855chr666178 5688 4472 4331 1728 587 25724 1058 ----
NM_206866chr2112165 2958 730 --1120
NM_206876chr223586 520 ------
NM_206907chr523022 2953 22875 1241 ----
NM_206909chr8138095 7775 7369 7184 6068 2144 2025 1989 1841 1706 866 811 302 --11276 --
NM_206914chr1242028 1834 742 221 ------
NM_206933chr162657 2201 2166 1910 758 44 32539 539 419 ----
NM_206943chr21825 1781 ----
NM_207012chr1053408 2838 1233 1038 466 13113 ----
NM_207015chr322225 33 --11589 --
NM_207171chr121990 370 --11818 --
NM_207303chr1023630 1480 33226 2639 216 ----
NM_207304chr133367 251 161 12521 ----
NM_207317chr52364 298 161 ----
NM_207325chr193484 136 24 --1200 --
NM_207348chr121981 772 1383 ----
NM_207371chr1021414 218 ------
NM_207372chr1042366 2358 1593 660 11924 11769 --
NM_207377chr141115 ------
NM_207404chr372227 1730 1691 1490 529 435 398 1138 ----
NM_207406chr485534 5178 2542 1069 654 526 360 109 32343 1255 101 ----
NM_207422chrX41425 1308 1026 961 1126 ----
NM_207442chr1411024 ------
NM_207469chr2021315 185 1142 ----
NM_207517chr151722 11531 ----
NM_207520chr22584 252 ------
NM_207521chr22584 252 ------
NM_207660chr1421535 139 --11334 --
NM_207661chr1421535 139 --11334 --
NM_207662chr1421535 139 --11334 --
NM_212460chr721251 73 21892 526 41916 604 325 94 --
NM_212464chr1541991 1885 1715 1642 ------
NM_212471chr1762018 1974 846 757 618 504 ------
NM_212472chr1762018 1974 846 757 618 504 ------
NM_212543chr32749 741 ----1778
NM_213594chr1211253 1432 ----
NM_213606chr1042603 2483 888 624 22589 1886 --12435
NM_213609chr31141 ------
NM_213651chr141496 353 260 86 21807 615 ----
NM_213654chr321536 1343 ------