TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-380-3p
miRNA Sequence: UAUGUAAUAUGGUCCACAUCUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000052chrX83099 2809 2768 1277 1141 941 537 111 12117 ----
NM_000067chr82565 476 ----1505
NM_000084chrX125456 5159 4803 4374 2634 1387 1344 605 543 214 192 40 14830 1265 15929
NM_000091chr2102836 2821 2813 2686 2542 2470 1824 1783 1091 268 1784 22892 2870 --
NM_000108chr741868 665 344 163 21179 177 --1602
NM_000109chrX62646 2210 2127 521 347 205 2716 573 22103 1007 --
NM_000112chr5115433 4582 4539 4524 3906 3572 2127 2040 1599 1131 370 13599 11402 --
NM_000115chr1382275 2151 2064 1975 754 611 534 37 22377 2164 22084 745 12466
NM_000125chr683955 3815 3557 3352 998 819 545 478 ----11377
NM_000138chr1562609 1940 1767 1733 941 488 12082 22123 574 --
NM_000151chr1721653 1544 ----21797 730
NM_000167chrX71640 1506 1368 1313 1289 703 636 144 11767 --
NM_000168chr752362 1279 449 420 229 --1141 1997
NM_000176chr533610 1528 538 1573 --1811
NM_000216chrX133777 3701 3651 3631 3599 2783 2777 1257 1015 783 457 297 29 --13839 13584
NM_000217chr12104450 4109 4004 3720 3649 1196 982 834 551 152 --21530 478 --
NM_000232chr462940 2557 2006 1107 723 32 1509 1715 --
NM_000245chr761856 1787 1499 771 112 104 --11682 --
NM_000259chr1565989 5387 2135 1854 1715 1262 31730 1528 247 56301 2237 2161 884 743 --
NM_000264chr9103191 3178 2985 2769 2701 2627 2594 2486 2402 1258 1459 ----
NM_000267chr1763227 2558 1078 979 662 465 11175 11189 1863
NM_000297chr431728 1678 81 1153 --21998 1905
NM_000314chr1092609 2414 2346 2244 2161 2066 1293 1206 862 ----22397 2388
NM_000332chr697099 5508 5266 5145 4721 2717 2202 141 90 46009 5391 4976 1812 1900 --
NM_000408chr283480 2894 1063 878 781 715 575 256 22382 918 23467 1070 --
NM_000430chr1741409 1094 540 145 1197 12699 1911
NM_000441chr762212 2043 1595 1559 1542 920 1893 1807 1561
NM_000448chr11113241 3086 3053 2970 2872 2762 2548 2390 607 537 56 2596 476 22767 405 12404
NM_000452chr1381935 1450 1444 1381 1288 625 450 416 2524 217 138 --
NM_000489chrX63232 3222 3128 2165 1132 729 53431 2846 2799 389 374 23442 1252 --
NM_000495chrX41014 839 752 269 1742 --1285
NM_000555chrX116663 6599 6166 6015 5557 5193 5050 2977 1259 1204 307 27183 363 47228 2516 1241 816 --
NM_000618chr12126529 6390 6183 6107 5864 5563 5429 4488 2280 926 856 513 16195 36610 6264 5616 --
NM_000618chr12126529 6390 6183 6107 5864 5563 5429 4488 2280 926 856 513 16195 36610 6264 5616 --
NM_000633chr1895131 4904 3882 3612 3507 3426 2068 493 236 1587 34862 1723 1476 11729
NM_000686chrX61437 1272 1187 526 450 339 --31042 515 394 --
NM_000719chr1286728 5177 5157 2688 2501 1903 1630 1376 36014 4885 1885 26666 1543 --
NM_000782chr2061249 1182 860 286 219 167 1942 11142 --
NM_000793chr1494771 3580 3250 1599 1508 1331 1167 1018 450 143 ----
NM_000809chr4199209 8887 8618 8294 8130 7822 7404 7342 7283 6974 6918 6908 6752 6487 6409 5958 3029 2875 1698 35685 2743 2309 29267 851 17933
NM_000813chr595565 5518 5238 4577 4453 3646 1902 1489 1262 14203 35442 2013 1202 12025
NM_000868chrX52504 1960 747 457 386 1122 11838 12463
NM_000875chr1566256 6195 5605 2642 1615 470 46966 6869 6821 1190 25661 2436 --
NM_000899chr1284096 3611 3165 886 871 336 229 150 14201 14375 --
NM_000902chr3102959 2422 2230 2072 2059 2000 1985 1219 791 753 2728 523 12850 --
NM_000945chr241891 1832 1581 1564 41625 1616 473 335 2806 595 --
NM_000950chrX143570 3538 3370 3288 3240 3014 2923 2776 2722 2348 1091 1062 533 388 1992 13148 --
NM_000963chr172289 2177 1610 859 277 72 31 12195 ----
NM_001001419chr5134818 4326 4289 4257 4236 3908 3811 3798 930 601 343 103 86 15213 2979 26 --
NM_001001420chr5134818 4326 4289 4257 4236 3908 3811 3798 930 601 343 103 86 15213 2979 26 --
NM_001001481chr883456 3268 2460 2450 1018 880 614 510 ----1595
NM_001001484chr1042157 2090 698 164 --1757 1733
NM_001001664chr2124106 4018 3889 3592 3192 3004 2905 1504 1332 1026 301 141 12706 13830 --
NM_001001668chr1973811 3608 3550 3112 3047 1333 1139 ----12801
NM_001001890chr21104287 3542 3490 3346 3195 1329 963 830 530 514 31293 564 554 11170 --
NM_001001974chr1082360 1798 1714 1564 1458 816 521 108 1565 12007 --
NM_001002295chr1041141 740 291 62 --2858 324 1281
NM_001002860chr14124613 4220 4065 3849 3675 1069 711 481 429 390 332 196 --23384 1809 --
NM_001003652chr18148564 8450 7948 7028 6236 6081 5493 3303 2555 1848 1510 1484 806 701 48594 6469 371 354 22724 1128 16102
NM_001003674chr1886972 6753 5903 5410 5286 5212 790 626 36888 1608 754 35882 2016 162 44789 4765 2621 410
NM_001003675chr1886972 6753 5903 5410 5286 5212 790 626 36888 1608 754 35882 2016 162 44789 4765 2621 410
NM_001003679chr152159 2136 703 438 79 --11842 1338
NM_001003712chr12123996 3649 3345 3288 2824 2676 2626 1435 1251 731 683 450 43485 2901 1240 622 13245 --
NM_001004065chr9103875 3004 2981 2419 1581 1516 1502 997 471 291 --13319 --
NM_001004317chr6124450 4218 3975 3641 3076 3068 2752 1547 1541 1507 458 403 33873 322 281 1162 1464
NM_001004441chr541537 1216 1206 39 11107 11231 --
NM_001005473chr566090 5158 1842 1590 609 161 25689 4298 1447 --
NM_001005474chr351380 1116 1082 151 86 21283 199 --1140
NM_001006600chr562377 2280 2261 2173 1744 1532 21868 88 22249 692 --
NM_001006623chr272347 2185 1697 1670 1623 961 94 ----12217
NM_001007023chr1494771 3580 3250 1599 1508 1331 1167 1018 450 143 ----
NM_001007075chr431031 814 715 1762 1799 11051
NM_001008405chr731716 1510 90 1455 1342 21848 613
NM_001008495chr882024 1569 832 785 737 577 130 97 12103 ----
NM_001008564chr13112143 2134 2113 2058 1973 1826 1620 1503 1454 423 323 21957 1678 2245 87 22048 1764
NM_001008738chr562917 2601 2074 1938 869 515 32794 2549 826 ----
NM_001008925chr42591 322 --2705 478 13478
NM_001009554chr494701 4208 3931 3688 3466 3089 1893 1170 878 13129 44256 3135 1670 606 --
NM_001009554chr494701 4208 3931 3688 3466 3089 1893 1170 878 13129 44256 3135 1670 606 --
NM_001009899chr3186553 6545 4951 3964 2247 2146 2112 1775 1599 1095 1044 912 817 770 763 589 239 41 ------
NM_001009909chr11113976 3735 3610 3592 3147 2947 2715 2655 2551 2517 392 13905 12751 --
NM_001010000chr1853526 2859 1320 866 792 23350 588 135 --
NM_001010853chr683234 2702 2030 854 780 645 400 212 33123 2538 1099 --13157
NM_001010861chr162721 2560 977 584 319 84 --1574 1940
NM_001010888chrX93635 3218 3173 743 684 549 449 118 72 11031 53000 1153 972 967 874 13006
NM_001010891chr5146350 5478 5354 5218 4370 2772 2635 2379 2305 1851 1816 1782 1771 1647 26303 619 21863 1841 --
NM_001010935chr171010 678 406 398 282 150 35 1124 ----
NM_001010986chrX32504 2434 1819 21706 802 42409 1899 908 187 --
NM_001011513chr4123465 3414 3398 2966 2794 2698 2636 2545 1498 914 335 88 ------
NM_001011515chr441104 816 441 394 ----1973
NM_001011516chr441104 816 441 394 ----1973
NM_001011537chr372377 2329 2223 1717 891 573 195 --1901 --
NM_001011658chrX71800 1792 1423 846 719 520 142 --11897 12119
NM_001011666chr7106521 6449 5729 5713 5247 4994 4679 4667 1595 524 35461 2035 171 32251 1100 693 --
NM_001012751chr1051873 1816 1394 756 654 --21919 326 --
NM_001012755chrX105053 4793 4205 4170 3771 3672 1903 1457 1320 565 24266 946 34145 673 124 1822
NM_001012756chr1983194 2734 2607 2473 1154 934 158 82 1849 ----
NM_001012968chrX41963 1854 1002 772 1722 22387 860 --
NM_001013620chr12207922 7770 7411 7089 7032 6975 6770 6262 6217 5569 5424 3096 2961 2575 2421 2210 1625 1284 969 701 47562 5856 5832 5494 1122 28351 1274
NM_001013629chr1092140 1852 1787 1642 858 611 470 449 273 21978 1340 11632 --
NM_001014380chr1395878 4490 1739 1628 1250 1040 897 686 240 14034 25416 1331 --
NM_001014797chr10127835 6598 5083 3090 3063 2136 1441 1412 1256 1209 992 205 12124 ----
NM_001015048chr1442752 2205 2147 173 23103 357 1675 --
NM_001015049chr1442752 2205 2147 173 23103 357 1675 --
NM_001015877chrX23034 2379 23096 905 12261 21891 202
NM_001017434chr15738 631 217 211 201 ------
NM_001017923chr1461501 1139 633 274 215 195 31352 396 158 21469 1033 --
NM_001018065chr9115900 5750 5088 4439 4087 3784 2351 1857 1014 942 874 --45339 4488 1832 1216 --
NM_001018066chr9115900 5750 5088 4439 4087 3784 2351 1857 1014 942 874 --45339 4488 1832 1216 --
NM_001018067chr184100 3966 1726 716 704 682 399 60 45258 618 597 448 14619 --
NM_001018068chr184100 3966 1726 716 704 682 399 60 45258 618 597 448 14619 --
NM_001018069chr184100 3966 1726 716 704 682 399 60 45258 618 597 448 14619 --
NM_001018074chr533610 1528 538 1573 --1811
NM_001018075chr533610 1528 538 1573 --1811
NM_001018076chr533610 1528 538 1573 --1811
NM_001018077chr533610 1528 538 1573 --1811
NM_001018090chr1582836 2361 1888 1815 1054 470 114 46 32859 2289 1781 21026 353 12367
NM_001018091chr1582946 2471 1998 1925 1164 580 224 156 32969 2399 1891 21136 463 12477
NM_001018102chr1582836 2361 1888 1815 1054 470 114 46 32859 2289 1781 21026 353 12367
NM_001024094chr533610 1528 538 1573 --1811
NM_001024649chr552259 2140 2127 970 749 12662 31863 1006 481 12736
NM_001024948chr183505 3330 3017 2948 2472 1403 1335 799 23031 823 ----
NM_001024956chr11115456 5275 5186 5151 4591 4095 2357 1283 1142 1052 879 14936 24875 637 --
NM_001025076chr1064372 1224 526 374 302 206 16057 26216 3991 --
NM_001025077chr10115730 5073 5003 4624 2582 1884 1732 1660 1564 1314 630 17415 27574 5349 --
NM_001025079chr354081 3850 1548 1084 146 23746 2728 11409 13965
NM_001025252chr85957 721 711 596 233 21161 118 ----
NM_001025253chr85957 721 711 596 233 21161 118 ----
NM_001025266chr384364 4280 3984 3444 3427 3265 1848 190 1952 14856 --
NM_001025366chr611654 31224 410 364 --1379
NM_001025366chr611654 31224 410 364 --1379
NM_001025367chr611654 31224 410 364 --1379
NM_001025367chr611654 31224 410 364 --1379
NM_001025368chr611654 31224 410 364 --1379
NM_001025368chr611654 31224 410 364 --1379
NM_001025369chr611670 31240 426 380 --1395
NM_001025369chr611670 31240 426 380 --1395
NM_001025370chr611654 31224 410 364 --1379
NM_001025370chr611654 31224 410 364 --1379
NM_001025595chr461631 483 402 373 105 40 11454 ----
NM_001025780chr941318 1180 1050 215 1316 --1568
NM_001029858chr663342 3302 2218 823 664 328 12873 12254 --
NM_001029875chr572850 2527 918 897 542 493 328 12347 1808 --
NM_001030055chr14124212 4014 1649 1605 1575 1399 1317 1089 434 303 262 158 23857 899 1118 --
NM_001031623chr631277 1122 99 1274 --1464
NM_001031695chr2264753 4241 4186 3634 684 60 23859 3392 15041 14690
NM_001031804chr1684226 4112 3793 3379 3230 1420 1251 1162 --1965 --
NM_001031812chr572245 2010 1860 1815 682 156 37 21803 355 21541 938 --
NM_001032380chr1061681 1567 1326 655 587 354 --1647 1475
NM_001033045chr294326 4026 3879 3671 3577 3398 2947 1084 175 2681 332 --1955
NM_001033059chr641490 1327 445 192 2716 596 1170 --
NM_001033756chr611588 31158 344 298 --1313
NM_001033756chr611588 31158 344 298 --1313
NM_001034841chr16154671 4509 4289 4092 4082 3892 3858 2104 1757 1524 1458 1185 753 683 97 43595 3534 2019 1992 1731 --
NM_001034954chr1063200 3139 3073 2958 2828 2440 12345 --13102
NM_001034955chr1063200 3139 3073 2958 2828 2440 12345 --13102
NM_001034956chr1063200 3139 3073 2958 2828 2440 12345 --13102
NM_001034957chr1063200 3139 3073 2958 2828 2440 12345 --13102
NM_001037317chr162721 2560 977 584 319 84 --1574 1940
NM_001037334chr1892273 2074 1828 1712 606 552 391 253 168 ------
NM_001039538chr2133549 3206 2446 2380 2354 1475 836 770 444 261 218 138 79 12306 2551 288 --
NM_001039590chrX63523 3362 2984 2600 1245 343 32459 883 835 ----
NM_001039591chrX63523 3362 2984 2600 1245 343 32459 883 835 ----
NM_001039618chr1175579 5456 5192 4082 3842 2231 260 35830 3977 1030 --35613 3628 1822
NM_001039693chr263835 3735 2604 1375 1031 460 23783 2679 43104 1491 1224 753 --
NM_001039840chrX105886 5419 4992 4793 4176 2188 1643 1634 1355 822 45895 648 607 576 14003 14720
NM_001039937chr1352904 2563 1427 1095 78 1679 23973 671 11546
NM_001040100chr341200 1001 130 40 --1467 133
NM_001040157chr481975 1053 822 390 352 268 185 141 22220 2162 12743 --
NM_001040284chr16105809 5225 5206 4505 4390 4088 3801 2108 1192 1051 75287 4629 3912 1640 1593 568 478 35888 2230 913 --
NM_001040402chr4103097 2704 2603 2188 2172 2005 1064 798 711 384 22392 2292 23102 2246 --
NM_001040441chr1124892 4821 3773 3585 1969 1874 1493 1343 1020 262 135 43 65445 4930 4881 4848 3603 1572 14198 1673
NM_001040450chr1572865 2503 1978 1870 1849 206 149 1665 32156 1854 330 12235
NM_001040453chr1572865 2503 1978 1870 1849 206 149 1665 32156 1854 330 12235
NM_001040665chr7174920 4632 4018 3973 3822 3427 3416 3405 1740 1699 1547 1270 899 686 439 270 76 --54360 1717 1624 609 565 --
NM_001042355chr1693296 1976 1921 1906 1827 1385 871 525 53 13934 45416 5008 4204 4157 --
NM_001042357chr1061412 1169 1097 1083 293 265 1254 11364 --
NM_001042358chr1061412 1169 1097 1083 293 265 1254 11364 --
NM_001042360chr1061412 1169 1097 1083 293 265 1254 11364 --
NM_001042361chr1061443 1200 1128 1114 324 296 1285 11395 --
NM_001042363chr1061412 1169 1097 1083 293 265 1254 11364 --
NM_001042364chr1061443 1200 1128 1114 324 296 1285 11395 --
NM_001042365chr1061443 1200 1128 1114 324 296 1285 11395 --
NM_001042387chr1061443 1200 1128 1114 324 296 1285 11395 --
NM_001042389chr1061412 1169 1097 1083 293 265 1254 11364 --
NM_001042390chr1061412 1169 1097 1083 293 265 1254 11364 --
NM_001042392chr1061412 1169 1097 1083 293 265 1254 11364 --
NM_001042393chr1061443 1200 1128 1114 324 296 1285 11395 --
NM_001042395chr1061412 1169 1097 1083 293 265 1254 11364 --
NM_001042396chr1061443 1200 1128 1114 324 296 1285 11395 --
NM_001042397chr1061443 1200 1128 1114 324 296 1285 11395 --
NM_001042404chr151952 1880 1843 460 277 1573 11784 --
NM_001042412chr1693296 1976 1921 1906 1827 1385 871 525 53 13934 45416 5008 4204 4157 --
NM_001042413chr9114074 4021 3928 2502 1510 1344 1119 619 592 392 182 33910 3531 2624 12829 13008
NM_001042453chrX61699 1536 1097 1077 653 171 11382 21666 1363 --
NM_001042481chr1472541 1695 895 330 268 177 163 22459 74 1725 12343
NM_001042492chr1763227 2558 1078 979 662 465 11175 11189 1863
NM_001042494chr1583552 3137 3092 3061 2787 2643 541 189 13817 ----
NM_001042495chr1583552 3137 3092 3061 2787 2643 541 189 13817 ----
NM_001042496chr1583552 3137 3092 3061 2787 2643 541 189 13817 ----
NM_001042497chr1583552 3137 3092 3061 2787 2643 541 189 13817 ----
NM_001042550chr941839 1438 1387 421 41626 259 131 82 1327 --
NM_001042555chr12114796 4057 3784 3680 3598 3592 3528 3421 1725 969 698 24292 1435 13744 1197
NM_001042599chr2137831 7752 7668 7246 6831 6210 4970 4903 1406 873 731 718 682 25860 1574 12272 12108
NM_001042601chr353216 2865 2774 2128 280 1856 33281 3237 3187 --
NM_001042603chr1264405 2106 1858 169 152 78 14199 34330 4325 1425 --
NM_001042604chr3134760 4723 4691 3674 3638 1709 1286 1269 1211 1081 778 263 221 21811 1169 23412 411 --
NM_001042683chr651624 1471 1402 362 69 --1476 11792
NM_001042749chrX52028 1966 1337 406 352 11793 11342 --
NM_001042750chrX52028 1966 1337 406 352 11793 11342 --
NM_001042751chrX52028 1966 1337 406 352 11793 11342 --
NM_001044385chr253760 2915 1150 615 490 13170 --2567 113
NM_001044722chr572245 2010 1860 1815 682 156 37 21803 355 21541 938 --
NM_001044723chr572245 2010 1860 1815 682 156 37 21803 355 21541 938 --
NM_001046chr592991 2826 2815 2781 2159 2136 1938 811 615 ----12844
NM_001071775chr1391908 1378 783 739 450 435 404 197 133 --160 --
NM_001083620chr482198 2101 1922 1757 860 352 122 51 12337 ----
NM_001106chr3149730 9513 9402 9070 8712 6261 6117 5947 3678 3548 2305 1596 156 147 39391 8850 446 --11494
NM_001121chr1081792 1674 1485 383 252 180 44 28 --11477 --
NM_001160chr1272781 2729 2690 2094 946 841 123 --32734 2698 115 --
NM_001167chrX136557 6537 5876 5741 4998 4783 4261 2160 2126 1989 1836 1653 1531 25143 2271 25495 1744 --
NM_001173chr14124212 4014 1649 1605 1575 1399 1317 1089 434 303 262 158 23857 899 1118 --
NM_001174chrX62235 2057 1950 1819 1718 1468 21838 1633 11999 --
NM_001186chr2193211 3099 3067 2857 2396 2344 1226 1107 824 ----22567 2388
NM_001198chr632260 889 374 22379 302 21947 1471 1231
NM_001204chr2157438 6604 6489 5670 5592 5428 5396 2929 2651 2279 1403 1091 263 236 39 35710 4700 1647 37143 5416 2834 --
NM_001233chr761915 753 504 479 220 56 1432 1680 --
NM_001259chr775897 4920 4381 3873 1634 1070 194 25777 3893 11412 --
NM_001310chr1263060 2882 2811 2173 2079 342 12904 12678 12918
NM_001390chr1873583 3369 3139 3118 2797 2500 523 --13071 1848
NM_001432chr453935 3650 773 604 274 --23725 3128 21558 1330
NM_001438chr193561 3401 3200 3150 2888 1244 974 816 774 12649 ----
NM_001453chr651615 1157 1145 617 499 ----11287
NM_001490chr943307 2959 727 514 12342 22947 459 --
NM_001527chr6184711 4681 4638 4464 4325 3739 3665 3486 3364 3169 3035 1648 1111 966 814 786 586 447 ------
NM_001609chr10134474 4380 4164 3731 3493 3474 2959 1505 1290 1126 663 566 531 24452 711 13131 --
NM_001621chr762502 2485 1913 1198 1015 860 32990 2513 595 --2764 195
NM_001621chr762502 2485 1913 1198 1015 860 32990 2513 595 --2764 195
NM_001634chr641490 1327 445 192 2716 596 1170 --
NM_001663chr1452783 2535 593 528 446 --32596 2085 1083 --
NM_001695chr893844 3254 3146 1330 1267 1058 743 631 565 --23185 1139 --
NM_001709chr1122406 404 22774 2245 3300 223 30 --
NM_001730chr1341366 1082 1042 585 11608 --1513
NM_001730chr1341366 1082 1042 585 11608 --1513
NM_001746chr552259 2140 2127 970 749 12662 31863 1006 481 12736
NM_001754chr21104287 3542 3490 3346 3195 1329 963 830 530 514 31293 564 554 11170 --
NM_001755chr1651873 1694 798 573 220 31734 1652 85 32200 2192 1541 --
NM_001777chr354081 3850 1548 1084 146 23746 2728 11409 13965
NM_001821chr1114246 4060 3583 3186 2986 1736 1573 952 724 571 402 54709 3428 3162 467 103 14442 --
NM_001858chr663902 3885 2012 1607 253 170 --34237 3251 305 --
NM_001918chr1178667 8121 7473 7173 7038 6842 6537 3551 2691 2310 1841 1320 895 837 762 538 91 1702 12293 18783
NM_001942chr1831748 549 204 11404 11583 21698 1436
NM_001968chr42769 228 --1793 1305
NM_001981chr142312 1506 595 162 ----21997 1925
NM_001987chr1223125 1558 22754 2634 14323 1419
NM_002009chr1552586 2347 1707 902 513 1407 --12183
NM_002024chrX42140 1877 558 23 21439 702 1581 --
NM_002025chrX139108 8917 8395 7508 7357 7326 7283 6534 6378 3446 3147 2328 1189 22339 377 37154 5834 3346 --
NM_002035chr1883807 3478 2952 2665 2643 2456 1594 1385 11462 23864 3628 23613 3591
NM_002040chr2163223 2909 2337 901 753 517 53138 3041 1218 557 425 12309 22024 1073
NM_002051chr1041141 740 291 62 --2858 324 1281
NM_002063chrX51247 898 814 168 75 ----1834
NM_002069chr761510 1265 1232 709 553 491 152 31308 1213 510 --
NM_002092chr4104661 4422 4287 4225 3897 3697 3383 3286 2034 276 --24752 3498 --
NM_002126chr1742741 2597 1436 1116 ----21554 1509
NM_002128chr1372256 1699 869 822 711 556 389 1295 ----
NM_002158chr253401 2614 2556 1512 1248 33222 580 258 --13829
NM_002203chr5124135 3438 3423 3405 2581 1649 1280 1123 976 289 277 228 ----13826
NM_002210chr2103097 2902 2623 1350 1157 1001 640 627 451 57 22431 296 3931 664 145 --
NM_002214chr7185479 5252 5174 5064 4554 4474 4359 4147 4031 4014 3892 3816 1595 1434 1299 997 301 63 --54749 4518 4459 3844 3477 --
NM_002223chr1243965 3330 3106 2527 12605 13596 11060
NM_002247chr1032382 1977 921 22001 128 --32042 2020 778
NM_002264chr3114530 4310 4262 4008 3941 3471 3452 1657 1607 534 271 13950 ----
NM_002270chr5225643 5329 5263 5023 4923 4727 4693 3846 3493 2255 2030 1989 1936 1915 1618 935 809 772 602 516 433 249 54666 4636 4570 1687 1241 45003 4092 3569 1283 13674
NM_002290chr6--1445 11166 21338 1327
NM_002310chr5126628 6462 6409 5261 5018 5007 4917 4482 4280 2590 852 136 --45997 5892 5012 4460 --
NM_002336chr1295037 4991 4510 4405 4176 4145 3629 3285 125 54600 1981 1088 903 180 --23663 3646
NM_002374chr2133549 3206 2446 2380 2354 1475 836 770 444 261 218 138 79 12306 2551 288 --
NM_002460chr683379 3315 2382 1383 1285 469 401 182 ----13221
NM_002481chr197487 6400 3067 2793 2715 2544 2367 705 388 17896 --15653
NM_002547chrX103806 3716 3672 3508 3034 1687 1612 706 666 188 13853 11298 --
NM_002577chr3143847 3426 3419 3345 2908 2812 2759 1184 1157 695 568 289 184 160 --12461 --
NM_002581chr9135596 5463 5083 5050 4283 3927 3860 3448 2203 2176 1991 1707 734 14938 21917 751 24920 235
NM_002595chr1251937 1876 784 240 165 11244 2599 391 --
NM_002610chr282738 2176 2155 2138 1121 198 180 79 13108 --22430 1913
NM_002613chr1654869 4828 4539 4235 3742 15084 --25267 585
NM_002623chr202724 166 3525 488 205 2494 215 --
NM_002645chr1162743 2262 2228 1101 631 326 22364 1130 13048 --
NM_002655chr8135323 4243 3891 3828 3701 3619 3562 1767 1480 1375 1118 1029 25 --54970 4810 4430 2069 1464 24362 2109
NM_002709chr273446 3021 2572 2512 2383 1272 248 --1566 --
NM_002731chr132082 1055 671 ----12434
NM_002734chr1792232 1864 1752 1674 1642 1458 727 633 148 31910 1437 127 11779 --
NM_002740chr352549 2487 442 322 92 22648 1902 2345 155 --
NM_002745chr2284524 3962 3788 3711 3427 3224 3116 1388 33151 1803 1590 13704 --
NM_002822chr1261837 1639 1577 576 545 527 11784 21801 1456 --
NM_002835chr72583 235 ----2589 179
NM_002858chr131041 511 42 11225 --3974 496 177
NM_002874chr972517 2318 1527 769 706 345 43 --1800 --
NM_002884chr171010 678 406 398 282 150 35 1124 ----
NM_002886chr3105002 4489 4458 3948 3785 1883 854 683 659 104 ------
NM_002906chr1172361 2239 2113 1659 1644 1484 1470 --12368 11999
NM_002977chr2113422 2882 2567 2541 2346 2184 1359 784 582 298 231 43346 2337 2124 855 33411 1060 566 --
NM_002994chr421251 730 21793 1778 21898 354 31888 1809 1785
NM_003034chr12166725 6627 6493 6089 5989 5737 5358 3229 2930 1939 1895 1586 1565 1522 781 97 35158 2477 617 25429 1270 --
NM_003048chr272702 2458 2011 1961 1051 868 345 22658 1745 ----
NM_003071chr341865 1588 490 120 1207 --11980
NM_003099chr1586514 6321 6083 5976 2316 2162 1891 1854 66452 6440 2539 1625 1534 827 26422 1519 --
NM_003108chr296903 6607 6362 5221 4839 4644 1138 603 387 1306 27297 4946 --
NM_003112chr793046 2500 1133 1109 985 865 606 398 86 21971 882 22902 818 12254
NM_003155chr852837 2577 2519 1882 622 1656 32677 2571 138 1819
NM_003161chr1793483 3370 3031 2777 2685 2329 1148 888 491 1520 --23081 116
NM_003199chr18125324 4617 4367 4055 3776 3486 1955 1947 1427 1289 1108 974 11866 ----
NM_003203chr272005 1787 1720 1574 1558 715 42 21887 1766 ----
NM_003262chr3135238 4765 4749 4681 4545 2031 1188 1169 1009 472 464 290 141 --25273 4166 --
NM_003292chr141954 897 763 633 22018 87 11555 12010
NM_003298chr396148 6121 6084 5590 4063 1980 827 646 386 --35957 4867 1921 --
NM_003304chr341498 1371 638 619 11452 --21199 62
NM_003326chr172754 2516 1853 1721 515 209 81 2524 183 ----
NM_003337chr551578 1261 680 576 532 1381 2393 181 --
NM_003338chr1081794 1527 1313 692 676 573 458 332 --21219 770 --
NM_003376chr611654 31224 410 364 --1379
NM_003376chr611654 31224 410 364 --1379
NM_003387chr292705 2532 2518 2438 2401 652 562 334 285 22678 2194 22349 1796 --
NM_003392chr384282 3345 2927 1479 1366 892 175 113 13448 14264 --
NM_003410chrX72750 2586 2110 645 358 287 272 22598 910 --1863
NM_003411chrY81692 1572 1411 1247 695 608 496 145 1288 1481 --
NM_003412chr3123111 2890 2604 2437 2318 2250 1962 1198 912 602 462 415 ------
NM_003413chrX61727 1552 720 466 129 27 11499 --11950
NM_003423chr19132608 2537 2267 913 809 605 476 392 358 274 158 91 54 --11644 12619
NM_003463chr6103039 2362 2328 2266 1337 1052 705 597 509 175 12069 13238 13371
NM_003468chr284066 3988 3744 2650 1512 751 282 251 --14234 13802
NM_003478chr1152917 2749 798 739 233 21154 879 13110 1105
NM_003566chr12113375 2972 2928 2768 2324 1326 1035 712 531 508 31 32775 2728 957 23479 442 --
NM_003583chr12113852 3607 3214 3084 3013 2940 2518 1266 835 724 362 11526 ----
NM_003590chr2164063 3946 3787 3494 3459 3358 3274 3084 2570 2528 1586 1555 1451 887 317 108 33620 3073 3036 --14049
NM_003607chr174384 4105 3533 3238 1026 368 306 ----13167
NM_003615chr3133908 3837 3502 3430 3263 2829 1538 1239 1212 1182 661 350 22 23774 1335 23145 1012 11080
NM_003617chr153937 3581 1275 1036 585 14465 35019 1838 1458 --
NM_003622chr1272514 2231 1961 1070 970 356 263 1493 31821 394 249 --
NM_003626chr1151026 439 209 139 116 1240 ----
NM_003672chr161559 1444 723 608 324 311 --1305 21330 331
NM_003713chr131524 1495 365 11403 --11416
NM_003722chr342625 2595 927 680 ----11769
NM_003759chr484287 3868 3716 3570 3471 2813 1590 1502 1288 24302 1700 --
NM_003762chr16994 945 937 471 345 305 --2408 353 --
NM_003772chr1171323 1006 866 838 521 449 261 --1224 --
NM_003774chr1263106 2656 2480 2458 778 651 1225 12500 1435
NM_003800chr672354 2136 2063 1960 1494 563 403 1318 2853 627 --
NM_003887chr272048 1997 1540 764 737 319 266 2689 157 21901 584 --
NM_003895chr2172087 1909 1823 1629 871 567 414 21358 516 ----
NM_003909chr893037 2966 2675 2619 2504 2384 2150 229 221 --31089 448 130 --
NM_003913chr6134303 4092 3737 3488 3350 3268 3100 872 685 668 384 237 187 1808 --11167
NM_003966chr5167557 7223 7186 7068 7033 6538 6332 5483 5430 5405 5337 5072 2916 2274 960 599 --17782 --
NM_003994chr1284096 3611 3165 886 871 336 229 150 14201 14375 --
NM_004006chrX62646 2210 2127 521 347 205 2716 573 22103 1007 --
NM_004007chrX62646 2210 2127 521 347 205 2716 573 22103 1007 --
NM_004009chrX62646 2210 2127 521 347 205 2716 573 22103 1007 --
NM_004010chrX62646 2210 2127 521 347 205 2716 573 22103 1007 --
NM_004011chrX62646 2210 2127 521 347 205 2716 573 22103 1007 --
NM_004012chrX62646 2210 2127 521 347 205 2716 573 22103 1007 --
NM_004013chrX62646 2210 2127 521 347 205 2716 573 22103 1007 --
NM_004014chrX62646 2210 2127 521 347 205 2716 573 22103 1007 --
NM_004015chrX62646 2210 2127 521 347 205 2716 573 22103 1007 --
NM_004016chrX62560 2124 2041 435 261 119 2630 487 22017 921 --
NM_004017chrX62646 2210 2127 521 347 205 2716 573 22103 1007 --
NM_004018chrX62560 2124 2041 435 261 119 2630 487 22017 921 --
NM_004020chrX62646 2210 2127 521 347 205 2716 573 22103 1007 --
NM_004021chrX62560 2124 2041 435 261 119 2630 487 22017 921 --
NM_004022chrX62560 2124 2041 435 261 119 2630 487 22017 921 --
NM_004023chrX62560 2124 2041 435 261 119 2630 487 22017 921 --
NM_004109chr1152330 2117 1721 633 188 2246 136 22286 1939 --
NM_004124chr1493311 3097 2225 1387 1312 1104 969 492 203 --23532 2539 --
NM_004133chr822659 437 32524 2436 226 12427 --
NM_004171chr11107121 7021 6959 6877 6840 3027 3012 2211 1376 640 59601 7888 3744 3019 745 36606 2928 1591 --
NM_004172chr552062 1896 432 72 51 31729 1243 318 ----
NM_004232chr1863829 3639 2525 1347 1057 706 1477 13243 --
NM_004272chr551768 1610 1267 728 84 --21703 1343 --
NM_004293chr983880 3724 1404 1354 1232 590 379 133 ----1492
NM_004330chr1591179 1142 888 324 281 238 231 146 106 1266 ----
NM_004331chr862491 1981 1960 1948 870 290 22648 119 ----
NM_004338chr1886972 6753 5903 5410 5286 5212 790 626 36888 1608 754 35882 2016 162 44789 4765 2621 410
NM_004342chr732355 1687 838 --2759 585 21975 1433
NM_004362chr45610 547 524 518 254 --2593 119 1219
NM_004384chr572245 2010 1860 1815 682 156 37 21803 355 21541 938 --
NM_004392chr1392549 2507 2382 2213 1960 1920 1727 1620 521 22005 637 ----
NM_004432chr951800 1572 563 488 437 2319 29 1242 --
NM_004438chr283306 3074 1325 1144 938 867 401 369 12283 12384 --
NM_004458chrX72591 2549 2542 1038 602 551 236 2562 183 1981 12171
NM_004464chr4133884 3849 3496 3432 3185 2850 2611 1729 1493 1403 636 563 521 --43720 3106 2924 1701 13196
NM_004500chr1452008 1742 1540 1308 440 11988 21318 825 --
NM_004501chr163103 2970 934 673 477 178 34059 1378 1110 21520 451 --
NM_004504chr272538 2104 1197 1041 902 622 254 12562 150 --
NM_004529chr941125 890 464 94 ----1396
NM_004586chrX85264 5038 4040 1833 1726 1296 1164 416 45466 5204 5127 887 ----
NM_004612chr9124490 4482 4439 4010 3687 3188 1773 1526 1385 1374 928 359 --34335 1130 614 11868
NM_004657chr251348 1322 1055 587 561 11179 11167 --
NM_004685chr1352885 2235 1206 1067 30 2815 427 22055 179 --
NM_004713chr142682 97 1169 --1526
NM_004726chrX104899 4866 4729 4034 2144 2101 1966 1184 1121 1014 --1589 --
NM_004730chr552116 2065 1875 1532 464 --22022 642 12028
NM_004744chr493942 2738 1310 1085 1077 887 607 366 51 33981 2991 966 ----
NM_004745chr866998 6913 4885 2457 1090 334 12590 --26931 6881
NM_004748chr1583417 2945 1133 560 268 260 157 138 --21595 1117 --
NM_004775chr1862434 1937 1580 475 451 401 12126 1741 22413 2035
NM_004788chr1182543 2512 1685 985 904 505 223 214 --1309 --
NM_004808chr1083256 3030 2895 2353 1356 1200 473 337 23283 2397 12700 --
NM_004815chr174737 3213 3172 1671 1313 695 630 34284 761 568 31196 700 605 1684
NM_004834chr293309 3152 3118 2938 2920 2466 2233 1281 1005 1166 --12954
NM_004842chr641741 1490 719 347 11403 --1657
NM_004850chr261433 1312 645 612 437 168 11465 21103 694 --
NM_004857chr14124818 4262 3239 3140 3023 1831 1750 1436 1376 869 498 219 24627 1844 22997 537 --
NM_004859chr1792974 2614 2542 2330 2320 1229 984 550 520 --11061 --
NM_004866chr5154038 3786 3453 3275 3186 1973 1875 1597 1495 1362 887 614 594 418 372 43954 3439 1815 750 1217 --
NM_004869chr1881541 1501 520 440 425 377 334 146 11569 11446 --
NM_004873chr1442752 2205 2147 173 23103 357 1675 --
NM_004897chr103785 98 84 1274 3798 683 52 --
NM_004904chr7106521 6449 5729 5713 5247 4994 4679 4667 1595 524 35461 2035 171 32251 1100 693 --
NM_004949chr1851472 747 538 471 266 32028 1822 403 ----
NM_004956chr784582 4541 4386 3935 3790 1515 961 144 44447 4258 3815 592 44486 3177 719 560 --
NM_004985chr12164544 4196 4132 3851 3638 3586 3366 1767 1715 1646 774 747 652 632 527 61 11658 22854 595 23421 1366
NM_004992chrX97112 6330 5578 5561 5507 5499 2763 2076 21 15482 38017 6194 5336 18533
NM_004992chrX97112 6330 5578 5561 5507 5499 2763 2076 21 15482 38017 6194 5336 18533
NM_004999chr674152 4072 1211 701 402 295 244 11038 --14167
NM_005056chr1254649 2102 413 396 322 14443 44574 4569 1669 132 --
NM_005065chr14115130 4941 4338 3396 2018 1798 1287 1145 1030 939 64 11582 15213 --
NM_005079chr85957 721 711 596 233 21161 118 ----
NM_005121chr17113231 3112 2837 2601 2558 1023 900 480 404 228 71 22692 809 13165 13202
NM_005126chr372323 2172 1892 1616 648 242 67 12031 --11608
NM_005135chr1583552 3137 3092 3061 2787 2643 541 189 13817 ----
NM_005151chr1892273 2074 1828 1712 606 552 391 253 168 ------
NM_005156chr994935 4724 4649 4233 3880 3615 3544 1310 1185 15090 1482 11335
NM_005160chr22116354 6155 5581 5488 5359 4936 4592 4192 1764 1617 1300 --25415 5394 12727
NM_005180chr1031652 384 67 31526 506 47 1358 --
NM_005188chr11168102 7455 6027 5120 2582 2083 1858 1560 1502 1205 1166 784 558 531 509 409 17118 2263 258 1883
NM_005233chr342590 1876 895 705 32399 801 399 ----
NM_005235chr2137831 7752 7668 7246 6831 6210 4970 4903 1406 873 731 718 682 25860 1574 12272 12108
NM_005259chr291528 1499 1185 1175 1159 1091 530 450 268 2953 412 1248 --
NM_005339chr494043 3820 3794 1454 1413 1201 842 448 390 --13414 11653
NM_005358chr1311679 21631 1527 2706 409 1143
NM_005359chr18105855 5694 4685 2545 2350 2216 1687 1144 1004 571 15455 1701 --
NM_005385chr342623 2253 1697 145 3794 425 317 123 1436
NM_005433chr1871935 901 756 534 463 360 21 22379 2126 12291 --
NM_005497chr17125828 5702 4967 4464 4003 3990 1891 1492 1267 511 383 231 --16017 14622
NM_005502chr993231 3136 2965 2562 2417 2214 2095 724 178 11171 11229 --
NM_005504chr12166485 6234 6200 5797 5094 4474 2499 2467 2178 1391 851 412 340 173 134 69 25520 2644 ----
NM_005509chr571865 1826 1653 1573 1232 245 114 --1188 --
NM_005578chr353560 1902 1724 1036 724 --24914 1582 21164 573
NM_005585chr151168 2325 146 1152 --
NM_005587chr153817 766 97 3904 173 126 1863 --
NM_005596chr9216356 6156 5861 5588 5160 5050 4729 4538 4392 4262 4057 1899 1322 1190 1143 918 896 440 360 250 62 --25351 1484 --
NM_005599chr131136 984 968 31567 1479 1069 21014 553 --
NM_005613chr132141 1931 634 --21681 1529 1467
NM_005665chr194759 3238 3195 3001 1949 1729 1562 1089 768 14474 34523 3935 1398 --
NM_005668chr574319 4240 3170 1541 1299 1137 928 24027 1428 --23962 1305
NM_005746chr792656 2432 2055 1717 996 899 752 354 88 2325 293 22416 486 1688
NM_005840chrX116680 6503 6260 5833 5354 5053 4746 2938 2056 1820 884 35818 5368 2829 11584 12903
NM_005843chr231575 1460 1390 21911 1371 --11792
NM_005859chr541200 565 552 416 --21314 288 1434
NM_005901chr18148564 8450 7948 7028 6236 6081 5493 3303 2555 1848 1510 1484 806 701 48594 6469 371 354 22724 1128 16102
NM_005902chr15104520 4307 4014 3454 2984 1534 1243 954 700 285 11003 ----
NM_005903chr5134818 4326 4289 4257 4236 3908 3811 3798 930 601 343 103 86 15213 2979 26 --
NM_005930chr142114 81 1256 1607 1233
NM_005935chr445147 3879 2025 1101 --44791 4786 4781 4285 24797 4775
NM_005941chr894062 3883 3223 2717 1440 1078 959 919 763 --21470 1360 --
NM_005955chr175340 4569 4068 3999 2114 1980 1580 11066 24316 1300 --
NM_005977chr132764 377 2997 167 --1111
NM_005999chr151243 1119 1026 382 180 41056 216 202 102 --1388
NM_006007chr994486 4085 3917 3243 1570 1424 1303 165 112 34439 2800 1213 11076 --
NM_006047chr2052325 2203 2162 986 194 13166 23137 1349 1111
NM_006080chr742522 2364 2271 146 22305 964 32920 2175 1201 --
NM_006095chr484168 3710 3135 2968 2772 1491 942 155 11764 ----
NM_006106chr1163414 3293 3113 2817 1065 473 33404 2296 927 12288 12194
NM_006154chr1572899 2825 2713 2655 1147 1001 191 ------
NM_006197chr862116 1937 1876 1739 650 579 41821 740 365 38 1332 --
NM_006203chr5155144 4642 4558 4468 4388 3802 3728 3544 2108 2088 1895 1858 993 891 383 45409 4061 4009 806 34185 1785 624 25031 482
NM_006206chr492944 2891 2815 2783 2716 2295 2270 785 73 ------
NM_006241chr342414 525 509 286 ----1120
NM_006251chr5103063 2700 2520 2482 2298 973 763 277 241 95 4989 896 345 314 2351 337 --
NM_006252chr1217487 6678 6468 6291 6187 6054 5700 5396 5080 2629 2520 2336 2099 1844 1792 823 758 728 266 48 29 37391 5643 749 56006 5774 5273 2604 1313 27471 7253
NM_006267chr281632 1250 1153 636 550 173 126 64 ----11436
NM_006282chr2054279 3305 390 299 223 --14378 11833
NM_006283chr8174943 4900 4876 4742 4714 4230 4114 4094 3665 3584 3338 1995 1919 1513 1436 1052 502 21205 194 13720 14241
NM_006287chr262670 2120 2081 1690 771 45 --22661 2571 --
NM_006315chr413840 1502 13980 14044
NM_006364chr1471262 1230 1171 1060 845 317 174 11099 2976 850 1958
NM_006380chr17104176 3932 3770 3577 564 518 462 355 188 97 --11684 13751
NM_006393chr10114516 4327 3814 3545 1789 1626 1619 958 770 726 643 24188 3694 1520 --
NM_006420chr2053209 2743 2554 2148 1390 1197 12519 23388 281
NM_006434chr1063200 3139 3073 2958 2828 2440 12345 --13102
NM_006457chr4123465 3414 3398 2966 2794 2698 2636 2545 1498 914 335 88 ------
NM_006460chr1711697 --11811 21659 66
NM_006469chr141453 1257 544 494 1125 --1132
NM_006482chr12113852 3607 3214 3084 3013 2940 2518 1266 835 724 362 11526 ----
NM_006496chr131435 1412 1365 --1658 11761
NM_006534chr2073314 3058 2973 2829 2473 2462 805 12439 ----
NM_006544chr1485864 4971 4838 4676 3856 3752 2047 822 35985 3938 2429 14213 11233
NM_006561chr1064372 1224 526 374 302 206 16057 26216 3991 --
NM_006599chr16178171 8082 7780 7383 7046 6844 6605 6138 5942 5554 5221 5009 3280 3138 1930 1294 208 35247 2042 852 27626 1814 27429 2797
NM_006603chrX52028 1966 1337 406 352 11793 11342 --
NM_006606chr2073106 2661 2136 2071 349 147 26 ----12212
NM_006609chr232277 517 183 ----12678
NM_006614chr353656 3380 3082 2466 206 53338 1229 876 860 334 23493 2341 --
NM_006620chr6134814 4268 4008 3807 3783 3424 3092 3059 1915 1220 901 857 372 12957 14493 --
NM_006626chr982704 2455 2390 2156 1812 713 110 46 52713 2621 263 216 24 ----
NM_006628chr1574658 3832 3706 3571 1588 842 336 21256 1064 ----
NM_006646chr1353070 2503 2378 2122 2113 ------
NM_006654chr12114796 4057 3784 3680 3598 3592 3528 3421 1725 969 698 24292 1435 13744 1197
NM_006710chr24781 372 350 248 --1711 11088
NM_006717chr993091 3007 2643 2413 2111 1286 1020 820 235 --12689 --
NM_006729chrX115122 4622 4218 4117 1619 1410 1193 781 650 209 160 45441 3918 2089 1559 25010 850 --
NM_006731chr9115430 5254 4903 4415 4317 1661 1430 1329 1009 890 202 --34432 4427 4361 13641
NM_006734chr661556 1247 430 265 138 106 --21634 1591 1124
NM_006750chr1698037 7577 6556 6091 5978 2855 2512 2219 1756 26713 2731 --18068
NM_006754chr731186 483 334 1144 --1444
NM_006775chr673123 3013 2802 2768 2238 2185 580 23005 2814 12920 --
NM_006813chr65877 263 221 159 108 --1152 1133
NM_006827chr1463103 2756 2422 1025 948 527 31327 994 495 22075 1038 12410
NM_006873chr243236 3080 2794 2404 13374 21400 1395 13175
NM_006895chr242178 1730 1425 728 12091 31470 627 34 --
NM_006914chr951339 1217 1160 608 336 ----1503
NM_006915chrX72532 2513 2477 2441 1982 674 503 22091 485 52458 2367 1697 508 148 --
NM_006918chr11115456 5275 5186 5151 4591 4095 2357 1283 1142 1052 879 14936 24875 637 --
NM_006920chr241723 1317 563 360 11901 42074 1912 1617 439 --
NM_006922chr262467 2388 2128 1773 450 324 11724 12011 22614 2415
NM_006924chr1774399 4268 3718 3252 1357 1054 765 14281 2662 122 21120 567
NM_006948chr2142436 2403 895 545 21749 143 3773 688 318 1533
NM_006956chr762366 1563 894 564 554 169 1272 12269 --
NM_006981chr982652 2546 2275 2256 1827 848 366 214 11967 23012 861 --
NM_006988chr213335 287 278 --21216 1093 --
NM_007007chr12134697 4043 3506 3223 3010 1864 1278 1124 1040 862 551 396 362 33532 1232 270 23070 657 13853
NM_007038chr21105612 5498 5446 4064 3704 2126 1674 1611 890 420 35755 5521 3920 34618 4338 1722 15632
NM_007049chr641014 987 951 249 ----1957
NM_007054chr5113880 3869 3862 3671 2911 2777 2572 2502 2490 524 282 1431 --13288
NM_007106chr1332773 1898 362 2984 434 12224 22294 2160
NM_007111chr131888 1810 1578 1798
NM_007114chr382820 2623 2297 2235 2193 2018 956 926 32393 2378 371 ----
NM_007124chr631914 403 395 51998 1575 774 606 372 11629 --
NM_007125chrY51029 1019 990 904 560 --2893 498 11186
NM_007137chrX65339 5027 1707 369 290 70 24930 626 35518 4321 498 --
NM_007159chr331608 1425 1163 1480 11644 1151
NM_007173chr1172164 2039 914 553 391 354 154 2707 238 ----
NM_007195chr1873224 2955 2360 1436 1302 515 226 23367 305 23559 476 22468 969
NM_007203chr9103875 3004 2981 2419 1581 1516 1502 997 471 291 --13319 --
NM_007218chr81724 1920 1955 1339
NM_007231chrX82393 2074 1890 927 801 579 349 338 1962 2263 194 --
NM_007249chr13178929 8632 6833 6389 6085 5738 3772 3728 3370 3150 2452 1857 1787 1764 870 819 439 18995 48200 8030 7988 7723 --
NM_007287chr3102959 2422 2230 2072 2059 2000 1985 1219 791 753 2728 523 12850 --
NM_007288chr3102959 2422 2230 2072 2059 2000 1985 1219 791 753 2728 523 12850 --
NM_007289chr3102959 2422 2230 2072 2059 2000 1985 1219 791 753 2728 523 12850 --
NM_007315chr21442 31467 1250 518 31393 590 527 --
NM_007331chr442445 2436 2240 1904 11818 12394 12042
NM_007332chr841555 1436 1351 1332 11394 --1372
NM_007347chr15113017 2500 2399 2363 2198 2066 1179 607 594 126 112 3721 261 47 ----
NM_007351chr461091 838 479 320 306 288 ------
NM_007373chr1021837 579 1189 1116 21473 1266
NM_012081chr573705 3470 3103 3080 2558 1031 627 23205 1062 12961 12444
NM_012096chr373405 3188 2814 1042 313 171 109 11376 22819 265 --
NM_012120chr662618 2555 1167 577 542 225 22761 162 12985 --
NM_012124chr113649 602 282 --2931 28 1818
NM_012141chr1352904 2563 1427 1095 78 1679 23973 671 11546
NM_012156chr2032138 1016 429 ----2952 325
NM_012158chr1381589 1202 1176 590 512 399 344 46 ----11770
NM_012164chr9187483 7213 6905 6811 5733 5260 5204 5104 4798 2614 2478 2377 2343 1676 1473 962 604 436 --1990 --
NM_012193chr11104706 4576 4248 4195 1525 1328 1111 1036 996 483 --2939 897 --
NM_012214chr2105315 2257 2235 1794 950 624 578 375 294 263 1327 23994 852 1408
NM_012234chr3153782 3611 3423 3327 2978 2787 2594 1083 879 873 637 579 315 217 76 1904 --1499
NM_012249chr253117 2235 972 773 210 22808 1058 11126 11398
NM_012262chr195194 4969 3794 3441 3416 1717 1411 1171 998 --34974 2105 935 1970
NM_012281chr71735 --11934 22105 422
NM_012287chr3134552 4198 3930 3891 3284 2915 1775 1669 1505 1166 1111 895 277 24272 4027 44332 1755 1596 1082 14082
NM_012294chr753984 3741 2984 2758 849 44023 3616 2907 2697 --12666
NM_012297chr442451 2301 1020 54 12259 12539 11887
NM_012309chr1184609 3455 3432 1960 1904 1840 1579 620 13076 ----
NM_012316chr143420 1727 1694 1172 15580 24353 4018 24508 1776
NM_012329chr1771210 1151 1051 602 277 114 77 --11458 --
NM_012382chr5103915 3152 2772 1776 1747 1467 967 710 510 196 --23803 988 12813
NM_012388chr1573114 2292 2145 919 554 190 172 --12967 1837
NM_012395chr783295 2480 2180 2103 993 961 833 754 33343 2908 632 ----
NM_012420chr1052290 788 447 153 95 --21998 389 1319
NM_012431chr773294 2880 2248 1365 1144 86 39 22240 179 1787 --
NM_013229chr1272781 2729 2690 2094 946 841 123 --32734 2698 115 --
NM_013231chr1474039 3504 3369 3106 1770 200 101 --33648 894 86 11265
NM_013255chr7197960 7688 6982 6631 6592 6293 5468 3461 3426 3277 3048 2905 2734 2420 2310 1261 727 586 62 48895 5924 2463 1727 26423 3299 --
NM_013374chr353002 2615 840 299 174 1432 33084 2952 235 --
NM_013381chr1241772 480 424 314 --12327 1463
NM_013386chr141437 375 355 224 1396 3584 461 164 --
NM_013989chr1494771 3580 3250 1599 1508 1331 1167 1018 450 143 ----
NM_013995chrX82352 1917 1907 1866 994 723 245 28 12367 12271 --
NM_014011chr252491 2270 1797 1044 536 --12100 11659
NM_014028chr693247 3225 2691 2612 750 652 544 445 385 1461 53282 2776 762 710 586 --
NM_014048chr1665296 5209 4229 2131 628 90 11237 --11255
NM_014089chr13112143 2134 2113 2058 1973 1826 1620 1503 1454 423 323 21957 1678 2245 87 22048 1764
NM_014106chr15112720 2639 2446 2370 2012 1176 839 706 556 434 418 12503 22451 479 --
NM_014109chr851192 1152 817 808 30 1783 ----
NM_014112chr8145525 5488 4467 3714 2202 2024 1992 1670 1624 1407 1351 1063 888 373 1365 21511 1356 --
NM_014141chr774104 3959 3518 1732 1402 807 465 34352 851 487 35329 1445 1332 --
NM_014155chr1197311 7196 6120 6005 2434 2354 2068 1620 1384 47087 1601 1158 1102 27446 5044 16845
NM_014181chr242900 1059 814 182 2889 420 --1640
NM_014243chr4102047 1781 1721 1501 704 649 629 492 340 231 --21646 548 11370
NM_014296chr361179 1121 523 238 209 125 ----11052
NM_014309chr2264743 4231 4176 3624 674 50 23849 3382 15031 14680
NM_014331chr4257751 7743 7716 7322 6042 5692 5636 5602 5226 5206 4932 4752 3018 2860 2667 2490 2366 1898 1579 1363 1133 1056 550 483 90 67858 5093 2845 2729 2715 1732 46664 3085 886 494 11641
NM_014372chr172048 1970 1874 1750 1714 1473 1394 --11546 --
NM_014388chr1106096 5144 3901 2187 2086 1257 1076 761 323 302 --13906 --
NM_014393chr8112373 2320 2252 2164 2157 2141 1789 1667 1584 440 110 31822 1760 383 21725 1543 --
NM_014395chr431916 1790 450 --11345 11404
NM_014415chr371456 1127 1069 605 365 355 335 1100 1504 11449
NM_014423chr555301 5212 1169 758 745 45024 3526 3440 423 15436 35398 5270 3837
NM_014445chr362439 1862 781 649 631 389 21802 415 11815 --
NM_014447chr461630 483 402 373 105 40 11453 ----
NM_014563chrX71800 1792 1423 846 719 520 142 --11897 12119
NM_014572chr1351614 1416 678 304 281 1579 11482 --
NM_014584chr1421449 522 31572 1509 107 1135 --
NM_014616chr373498 2861 1304 982 966 833 457 23142 2391 1308 --
NM_014674chr362793 1570 1120 841 728 491 13763 2596 392 --
NM_014682chr862293 1930 1861 1830 527 125 22069 1977 ----
NM_014701chr1572843 2623 2383 2181 876 829 626 23267 2424 ----
NM_014702chr6103417 3372 3366 2825 2242 1093 804 456 390 27 21191 732 ----
NM_014707chr782198 1813 1564 1452 859 780 603 55 ------
NM_014711chr165779 769 413 337 248 12009 2739 206 --
NM_014721chr6117169 6855 6762 6126 5854 5591 5309 1415 1311 723 77 --37433 2264 1966 --
NM_014733chr532245 757 561 --12229 41573 615 600 24
NM_014739chr684195 3569 3149 2839 1661 1436 261 21 43187 3172 934 213 23456 1610 --
NM_014743chr4123006 2928 2744 2539 2503 1258 1249 823 754 358 334 295 --12252 --
NM_014746chr283751 3569 3384 3249 3016 1710 1388 710 14348 11685 --
NM_014755chr2144281 4173 4164 3953 3750 2772 1162 1144 938 713 553 515 509 371 --21425 333 --
NM_014787chr172196 2096 2036 1972 1718 1134 389 ------
NM_014810chr183428 3312 3253 3211 3150 2669 427 168 ------
NM_014812chr151952 1880 1843 460 277 1573 11784 --
NM_014819chr551711 790 580 363 342 --11748 2917 81
NM_014826chr174384 4105 3533 3238 1026 368 306 ----13167
NM_014836chr1061681 1567 1326 655 587 354 --1647 1475
NM_014839chr142221 2204 1027 467 22043 810 --1412
NM_014864chr183775 3129 1455 1347 1313 818 489 441 ----13535
NM_014873chr1154589 4474 4330 4029 3917 3837 3247 3133 3094 2978 1963 1473 902 361 72 1650 11113 --
NM_014875chr131091 896 759 ----1790
NM_014877chr17197464 7224 7205 6921 6819 6174 5326 2944 2771 2659 2257 2251 1850 1353 1010 993 376 266 185 66360 4981 4870 2792 2304 257 17643 25126 2567
NM_014897chr17102859 2732 2599 2438 2274 1010 755 502 325 236 32352 2262 2104 21298 955 --
NM_014898chr1962068 1934 1774 1693 1575 226 12436 3770 649 475 --
NM_014900chr25958 837 725 441 359 ----1917
NM_014901chr51767 11941 --22161 1957
NM_014904chr1083282 2999 2599 1270 1203 957 948 450 54037 2730 1442 1062 458 11468 1109
NM_014906chr1773673 3124 2984 2868 1212 1155 208 --1432 --
NM_014912chr10103042 3025 2772 2717 2546 1316 1290 1091 905 200 43211 1345 1196 1175 ----
NM_014920chr693648 3371 2662 2321 2314 917 856 734 400 23463 2939 2748 607 1613
NM_014923chr1352051 1862 1670 599 146 11815 132 22347 902
NM_014932chr361646 1519 1412 760 632 40 2443 272 ----
NM_014934chr1373397 1602 1366 1115 1000 947 419 22895 768 ----
NM_014936chr652704 2628 2563 2135 472 22057 390 32762 2237 1987 --
NM_014946chr242939 2039 1198 977 23095 120 --12901
NM_014950chr1481646 1637 1293 1201 644 437 308 283 1398 11739 --
NM_014951chr1062507 2142 1876 1634 219 191 11893 22124 1924 --
NM_014953chr1384135 3411 2932 2798 1512 1313 980 766 24004 3705 ----
NM_014961chr43880 648 415 21454 513 --11727
NM_014962chr2072684 2354 1995 1904 1844 526 244 --12084 --
NM_014982chr14105278 4701 4659 4446 4194 3871 3818 1700 1687 242 1614 35387 4274 1102 14736
NM_014988chr4102619 2294 2274 2263 2057 2015 1931 617 601 205 --12047 --
NM_014991chr483242 3111 2948 1211 941 871 553 315 1969 ----
NM_014999chr1241169 632 504 106 2668 569 31549 1501 131 --
NM_015000chr1242522 1972 689 601 1995 1228 32404 2094 761
NM_015025chr262460 1797 1067 935 785 647 ----12385
NM_015026chr12124518 3679 1630 1581 1557 1518 1329 1122 935 897 617 160 24086 3943 23475 3136 --
NM_015032chr13102707 2640 2388 2273 2134 2127 2049 1084 929 590 ------
NM_015055chr1142930 2481 2054 1079 12430 12607 12767
NM_015056chr2141956 990 236 58 11679 --12222
NM_015071chr5116481 6158 5831 5480 3976 2462 1730 1495 772 517 34 1551 --1974
NM_015076chr6114526 4325 4148 3782 3480 3290 3008 1766 1324 1223 758 34204 1012 134 44515 4510 1544 547 14045
NM_015087chr1382416 2106 1958 1681 888 325 211 185 21910 1034 1645 12140
NM_015092chr1674646 4366 3519 3500 1351 1092 737 13733 11392 --
NM_015097chr352285 1822 791 767 610 --11561 12371
NM_015110chr9112540 2267 2170 1787 883 808 801 423 350 327 278 11711 21698 794 12216
NM_015115chr4103097 2704 2603 2188 2172 2005 1064 798 711 384 22392 2292 23102 2246 --
NM_015137chr882591 2326 2068 1988 1904 911 775 734 --21969 1017 --
NM_015156chr1483918 3550 3288 3258 2469 1452 1133 651 --12909 22722 2602
NM_015192chr2072768 2668 2366 2308 2151 2081 66 --51909 1188 1172 492 30 --
NM_015206chr1573441 3119 3096 2858 2411 1373 203 33777 1416 22 ----
NM_015208chr1872702 2625 1525 1089 218 120 54 13319 2774 239 --
NM_015225chr952644 2022 1069 858 712 23024 2265 32463 627 392 --
NM_015235chr1041820 1592 564 265 22039 1548 1246 --
NM_015247chr1693296 1976 1921 1906 1827 1385 871 525 53 13934 45416 5008 4204 4157 --
NM_015271chr474332 3939 1460 1056 797 742 237 1408 11696 11156
NM_015275chr1281817 1534 1520 1509 1496 872 631 123 1339 11544 --
NM_015310chr8118097 7814 7730 7715 7624 7573 5738 5520 5132 1323 439 12383 28324 6494 --
NM_015317chr241081 850 440 192 1700 1200 1978
NM_015323chr631576 1158 1092 21130 400 --31658 1332 282
NM_015336chr1232553 2009 687 22657 1702 32171 741 418 --
NM_015355chr1761977 1508 691 574 560 331 --4492 487 181 42 1580
NM_015385chr1063200 3139 3073 2958 2828 2440 12345 --13102
NM_015387chr241637 823 798 92 12120 1843 11723
NM_015393chr433836 1249 763 --23843 401 23827 3130
NM_015431chr1103168 2573 2396 2359 1252 1166 662 587 301 181 1168 --1278
NM_015436chr42410 141 --2524 297 13297
NM_015455chr544038 4012 1178 1009 33699 3406 687 33692 3474 1427 --
NM_015458chr8104938 4221 3900 3608 1149 915 904 839 647 251 ------
NM_015532chr1582836 2361 1888 1815 1054 470 114 46 32859 2289 1781 21026 353 12367
NM_015535chr2104188 3925 3033 2692 2616 1148 1047 1013 678 356 21442 1365 23020 1227 12756
NM_015553chr6124913 4290 4189 3511 3322 3235 3164 1938 981 837 71 29 --11653 11078
NM_015554chr1562406 1998 880 686 543 392 42838 2722 1826 638 22262 163 --
NM_015555chr631277 1122 99 1274 --1464
NM_015564chr5103510 3031 2826 2190 1403 1382 1129 844 718 693 150 --21168 269
NM_015565chr2152017 1933 422 329 303 11848 11973 1225
NM_015569chr174864 4543 3619 930 814 793 216 11660 ----
NM_015571chr681973 1775 1756 971 772 491 420 273 21001 666 12512 --
NM_015575chr263625 3572 3217 3081 617 539 23610 3538 21457 565 --
NM_015602chr171763 1398 1344 1288 681 596 284 1127 1238 11674
NM_015605chr1061443 1200 1128 1114 324 296 1285 11395 --
NM_015640chr184100 3966 1726 716 704 682 399 60 45258 618 597 448 14619 --
NM_015879chr1888163 6740 5226 2756 1847 1836 589 229 21768 446 28002 7135 --
NM_015886chr8135415 4923 4664 4327 4206 3915 3700 1673 1634 956 747 277 89 35544 651 380 34906 1959 293 1479
NM_015888chr182675 2549 2269 1287 1179 420 274 179 22415 627 ----
NM_015891chr651968 1451 738 586 56 --2687 682 --
NM_015906chr173925 3362 1731 1463 1368 1257 516 44059 3940 3859 3445 ----
NM_015990chr431031 814 715 1762 1799 11051
NM_016009chr184315 3989 3894 3590 3330 864 171 153 148 ----
NM_016018chr862312 2065 2003 661 308 230 21910 783 ----
NM_016023chr8102176 1831 1807 1716 1507 1392 827 475 417 108 12025 11536 --
NM_016072chr1242093 1778 1584 659 11753 32385 748 86 --
NM_016076chr183200 3140 3058 2200 2051 1127 692 310 11155 21268 142 --
NM_016087chr791470 1268 1157 1121 627 486 369 225 53 --21363 1279 11546
NM_016132chr1533117 2866 2192 --32706 2580 1085 --
NM_016206chr3259025 8875 8805 7962 7656 7310 6934 6865 6717 6583 6566 6505 6214 5999 5692 5479 3573 3466 3403 2725 2514 1939 1774 1093 662 37288 1337 917 57913 7697 5802 716 561 36636 6224 5941
NM_016255chr663253 2861 2086 977 148 74 43054 985 947 859 22835 2310 --
NM_016260chr2126747 6402 5955 5920 5605 4923 4915 2828 2692 1499 1225 174 26652 2785 17491 --
NM_016277chr651441 1055 332 219 78 1629 132 11112
NM_016289chr252163 2116 2033 1884 738 12204 --11580
NM_016377chr641741 1490 719 347 11403 --1657
NM_016396chr15112935 2870 2719 2042 1043 1008 696 584 486 152 94 12010 ----
NM_016422chr1163144 3071 3049 2009 827 250 12037 --12026
NM_016441chr252029 1952 1863 878 667 ----1970
NM_016472chr1451226 1083 1074 525 287 2321 71 --1563
NM_016485chr682261 2040 1869 1643 1607 1573 1397 393 1323 22301 444 --
NM_016513chr693648 3371 2662 2321 2314 917 856 734 400 23463 2939 2748 607 1613
NM_016531chr453305 3047 2986 134 88 12559 13449 23750 2761
NM_016542chrX61699 1536 1097 1077 653 171 11382 21666 1363 --
NM_016599chr441041 325 314 84 11396 31389 1247 618 --
NM_016626chr1871740 1634 1471 1273 1124 505 399 1248 --11719
NM_016824chr1081792 1674 1485 383 252 180 44 28 --11477 --
NM_017420chr14153859 3553 3376 3216 3173 3142 3052 2724 2549 2413 1333 1228 1189 674 188 22796 2376 --13585
NM_017423chr471830 1730 1495 819 448 324 229 12188 ----
NM_017437chr1492262 2128 1742 1641 1583 662 376 350 122 11798 ----
NM_017447chr2194331 3682 3501 3197 1239 495 418 268 163 34360 3047 2881 13792 --
NM_017594chr973371 3265 3243 3214 1240 1137 1126 13322 33284 2883 112 12667
NM_017610chr1571689 1639 1571 1521 1475 1390 244 21624 357 2710 261 --
NM_017628chr485182 5127 3851 1171 597 482 106 53 1655 ----
NM_017633chr673596 2670 1374 1271 1188 1072 801 22789 1060 31425 1032 793 --
NM_017637chr9139465 9071 8159 7476 7418 7145 6947 5860 2781 2691 1938 1808 608 49367 8372 5812 1167 38409 6561 1139 12884
NM_017644chr3125116 4742 4343 4330 4122 3922 3611 3465 1930 1550 686 612 25143 4417 24676 392 --
NM_017650chr7105836 5600 5155 4298 4165 3699 2393 2364 640 405 15018 22245 2240 15109
NM_017651chr651122 1093 1036 1000 248 --51049 1044 389 274 263 --
NM_017658chr14144371 4197 4156 3895 3288 3140 2870 1857 1674 1481 1150 1067 1018 182 23023 864 21621 1187 --
NM_017666chrX62166 2000 1790 1659 1579 361 --21891 289 --
NM_017694chr251666 615 478 319 214 1591 12097 11319
NM_017737chr1102214 2039 1726 1657 645 534 454 320 112 44 11740 ----
NM_017745chrX2610 555 1122 --199
NM_017752chrX72104 2014 1886 1718 1685 1672 274 22075 381 ----
NM_017762chr1541957 676 215 99 ----1730
NM_017769chr1493201 2861 2395 2328 2281 1035 742 558 149 42915 2067 1074 458 22890 2758 2609 355
NM_017770chr633018 2046 79 --22906 398 12670
NM_017813chr8105479 4312 3996 3799 2077 1826 1509 903 757 626 24639 4046 35501 4842 927 --
NM_017824chr1051693 1680 1073 884 807 21660 648 12598 1437
NM_017831chr18134634 3529 3026 2892 1488 1374 1284 1231 1164 758 248 189 39 23259 862 ----
NM_017848chrX113817 3750 3657 3565 3425 3253 3079 2909 1800 1310 402 21000 963 ----
NM_017919chr9145301 5050 4947 4905 4625 4446 4400 2328 2139 1997 1978 1813 1692 512 12159 25807 3884 --
NM_017938chrX71928 1780 1726 767 760 647 266 --11919 --
NM_017944chr1182910 2169 2132 2121 1158 1055 775 680 --13087 --
NM_017945chr341086 413 385 258 1121 --11343
NM_017987chr1062173 2041 1359 828 508 151 2676 160 21697 1436 --
NM_018017chr1052568 2260 928 736 286 12590 12407 1704
NM_018027chr1093280 3064 2538 2495 2379 2371 2267 2148 473 13038 12900 --
NM_018084chr242759 2661 1143 437 --22212 1005 --
NM_018105chr861216 1009 797 400 192 158 21115 103 1981 --
NM_018120chr841516 317 305 115 ----11204
NM_018121chr1082773 2656 2293 2128 817 583 314 80 --11998 --
NM_018126chr451425 1227 542 358 87 2119 110 1979 --
NM_018155chr363379 2969 2836 1014 146 48 2834 336 22196 937 --
NM_018178chr141974 1547 1515 172 --1374 1531
NM_018184chr342023 1717 388 349 11623 1550 1313
NM_018211chr161856 880 813 764 523 494 --1423 11691
NM_018247chr662722 2547 2166 1172 729 394 11023 1343 --
NM_018254chr162051 967 626 535 334 47 42272 2140 1843 772 1908 22433 639
NM_018257chr2021781 826 1196 21877 1749 1220
NM_018290chr461190 1134 1087 1045 436 28 31037 1028 305 ----
NM_018293chr372887 2826 2620 1120 839 282 195 22186 2120 12229 12601
NM_018299chr883456 3268 2460 2450 1018 880 614 510 ----1595
NM_018313chr382607 2347 1821 1690 1648 908 472 182 4373 222 142 26 1110 --
NM_018318chr123194 73 46 ----1322
NM_018339chr961810 1800 1789 1703 1231 627 181 1260 --
NM_018351chr12154283 4215 3963 3860 3662 3561 3137 3063 960 920 896 843 636 444 345 11890 1621 13819
NM_018361chr8123902 3696 3336 3280 3146 3056 2951 1574 1174 711 595 376 12695 23376 2727 13404
NM_018362chr11113766 3585 3032 2877 2795 2561 2545 1279 779 492 322 --32628 1553 746 --
NM_018364chr193389 3178 3109 2506 1640 1339 1283 1270 1188 33877 1612 1475 13353 --
NM_018367chr1152322 957 881 365 355 22439 994 22488 1796 --
NM_018373chr1496128 5974 5553 4987 4721 2171 2115 936 532 35726 4203 236 --26228 4258
NM_018374chr7105050 4874 4104 4044 3852 1797 1242 876 798 464 35001 4578 3740 24531 3750 14819
NM_018403chr344097 3958 3122 550 --14060 23173 1482
NM_018429chr572933 2559 642 567 513 337 264 12897 160 --
NM_018439chr18102529 2395 2314 2252 2196 2084 2064 926 658 152 --12382 22463 43
NM_018440chr8118731 8604 7477 6535 6490 3021 2956 2119 1964 1444 1381 --48647 5243 3356 1487 --
NM_018482chr881913 1670 1587 901 795 525 250 94 --22040 1008 12281
NM_018566chr1104405 3981 3760 3531 3355 1427 626 605 402 295 --14555 --
NM_018590chr1051605 1560 1530 1405 1365 21522 1129 41185 667 321 305 --
NM_018638chr12105663 5412 4837 4226 3944 3527 3507 1089 979 298 33981 1626 1106 --24608 4169
NM_018695chr562377 2280 2261 2173 1744 1532 21868 88 22249 692 --
NM_018698chrX41534 1503 290 197 2490 207 --1517
NM_018710chr87932 863 479 387 381 234 158 --31365 274 169 --
NM_018841chr133718 3293 2683 23043 2797 1398 1292
NM_018844chr741958 1752 332 180 2697 238 1584 12090
NM_018898chr552314 2271 2245 2195 670 --32101 1956 1542 --
NM_018899chr552314 2271 2245 2195 670 --32101 1956 1542 --
NM_018900chr552314 2271 2245 2195 670 --32101 1956 1542 --
NM_018901chr552314 2271 2245 2195 670 --32101 1956 1542 --
NM_018902chr552314 2271 2245 2195 670 --32101 1956 1542 --
NM_018903chr552314 2271 2245 2195 670 --32101 1956 1542 --
NM_018904chr552314 2271 2245 2195 670 --32101 1956 1542 --
NM_018905chr552314 2271 2245 2195 670 --32101 1956 1542 --
NM_018906chr552314 2271 2245 2195 670 --32101 1956 1542 --
NM_018907chr552314 2271 2245 2195 670 --32101 1956 1542 --
NM_018908chr552314 2271 2245 2195 670 --32101 1956 1542 --
NM_018909chr552314 2271 2245 2195 670 --32101 1956 1542 --
NM_018910chr552314 2271 2245 2195 670 --32101 1956 1542 --
NM_018911chr552314 2271 2245 2195 670 --32101 1956 1542 --
NM_018945chr662500 2433 1279 774 533 504 ----12441
NM_018948chr121431 96 2263 33 11326 1278
NM_018999chr10134971 4504 4474 4274 3797 3598 3352 1954 1651 1397 889 664 321 23918 1386 --23132 1371
NM_019001chr3134760 4723 4691 3674 3638 1709 1286 1269 1211 1081 778 263 221 21811 1169 23412 411 --
NM_019035chr482000 1909 1875 1869 1619 406 214 101 ------
NM_019050chr482243 2180 2125 1620 876 776 669 452 130 ----
NM_019067chrX134653 4409 4122 4080 3605 3594 3418 1807 1720 1585 1323 1085 435 24464 3326 14477 11922
NM_019083chr131631 438 65 --31104 222 57 --
NM_019087chr541713 1437 611 431 --1631 11189
NM_019094chr1283431 2865 2819 2379 1504 1372 480 133 --13485 --
NM_019117chrX73488 3202 2161 1154 1021 521 144 12616 --1192
NM_019556chrX91006 922 593 451 431 345 244 149 122 ------
NM_019593chr20103156 3109 2495 1200 1107 930 806 636 502 400 ----1711
NM_019903chr1081792 1674 1485 383 252 180 44 28 --11477 --
NM_020122chr2114142 3820 3736 2370 1896 1694 1022 931 593 496 115 --11996 15944
NM_020159chr461668 1481 1264 1198 387 66 --1123 1482
NM_020177chr5112983 2805 2607 2539 2200 2088 1198 1033 691 627 135 --12099 12045
NM_020198chr1731443 455 294 --11478 11437
NM_020346chr1161300 1213 395 385 217 57 1376 11090 1539
NM_020357chr321473 241 1182 41486 1295 1019 545 1285
NM_020390chr3154865 4786 4527 4394 4332 3104 3076 3063 1582 1372 1192 833 676 597 405 13673 --1434
NM_020432chr76754 509 195 177 148 122 --1400 1550
NM_020452chr132098 2073 1351 12010 12134 21988 406
NM_020466chr694678 4548 3452 3340 3173 1513 678 98 51 23157 840 13982 --
NM_020654chr341646 1362 1220 324 --11144 21417 1081
NM_020673chr20137387 7336 6840 6709 6236 6100 5810 5396 5308 2333 1648 922 390 --24784 2140 --
NM_020699chr132133 513 506 --14044 12106
NM_020718chr16146625 6526 6518 6128 6075 6037 5525 5374 4794 4598 2193 1860 960 165 11106 11261 16564
NM_020734chr1283392 2417 1065 710 663 636 452 435 32843 2316 1058 12062 --
NM_020739chr1583417 2945 1133 560 268 260 157 138 --21595 1117 --
NM_020766chrX74498 4060 3689 3024 855 600 320 21179 299 34354 3548 353 --
NM_020771chr661439 1186 972 510 426 408 1602 21270 377 --
NM_020772chr17138582 8523 7100 6590 6452 6437 6356 5809 5728 5637 3253 3090 591 37298 1487 748 58139 7105 2667 1279 1164 15370
NM_020774chr1895706 4726 2120 2103 1180 1045 781 610 467 11379 32326 1365 295 14837
NM_020782chr1244563 1823 1053 653 2711 611 14170 11868
NM_020794chr151442 1384 1339 1004 622 31425 1409 387 1573 --
NM_020801chr552146 1727 973 791 343 --12512 12205
NM_020803chr441997 1912 1869 534 1726 22023 827 --
NM_020819chr66966 821 412 323 132 116 --2338 66 --
NM_020830chr252539 2498 2492 2107 2063 --12623 --
NM_020841chr12123996 3649 3345 3288 2824 2676 2626 1435 1251 731 683 450 43485 2901 1240 622 13245 --
NM_020844chr8217611 7367 6967 6673 6611 6479 6160 6112 5965 5719 5265 4860 4653 2275 1405 1369 1014 585 458 324 80 14896 36473 5023 897 15586
NM_020854chr1871560 1032 587 350 335 186 108 21579 268 11345 11096
NM_020871chrX92334 1772 986 903 759 575 530 510 338 1609 1136 --
NM_020872chr351430 1278 380 336 122 1216 11443 1223
NM_020917chr1973420 3182 2788 580 331 103 34 23145 2678 1401 --
NM_020918chr1063635 3121 2667 2356 1165 375 11387 13430 --
NM_020935chr2113443 3139 2874 1813 1615 1463 1065 887 726 682 561 1752 23801 1437 --
NM_020940chr10102948 2774 2645 2104 1967 1047 964 532 337 224 --22810 2717 --
NM_020948chr1103683 3213 2910 2360 1351 1273 1115 1013 1000 911 21437 549 12448 13046
NM_020964chr1894535 4482 3642 1843 1792 590 232 85 46 14784 ----
NM_021033chr1372493 2146 1321 1130 1067 898 518 --12526 22865 1187
NM_021072chr532138 949 228 32314 2180 2043 --22349 2108
NM_021083chrX63100 2644 2623 2311 1402 997 --12782 --
NM_021111chr971405 1253 1194 559 550 408 260 11055 21217 876 --
NM_021116chr789042 8832 8550 6897 6486 6478 911 365 28192 5699 25647 3433 --
NM_021120chrX43119 2640 1031 553 2519 494 --1542
NM_021140chrX1299 1931 1771 1920
NM_021148chr7122491 2408 1905 1684 1678 970 743 711 618 496 415 106 42030 1966 1598 562 12389 --
NM_021252chr1051731 1555 1301 261 114 21393 27 11442 --
NM_021255chr1494031 3771 3485 3003 2617 1429 1381 815 183 --13226 --
NM_021622chr1082360 1798 1714 1564 1458 816 521 108 1565 12007 --
NM_021629chr3134782 4650 4594 4513 4280 3779 3602 1683 942 690 327 304 86 24394 1020 23719 2017 --
NM_021647chr494701 4208 3931 3688 3466 3089 1893 1170 878 13129 44256 3135 1670 606 --
NM_021814chr621526 247 11608 --1172
NM_021815chr272710 2544 2221 1073 407 298 142 1954 23121 2417 --
NM_021818chr1461385 1379 1290 129 112 65 21514 493 ----
NM_021911chr595565 5518 5238 4577 4453 3646 1902 1489 1262 14203 35442 2013 1202 12025
NM_021954chr1383502 3488 3418 2844 2801 2762 992 196 12723 43673 3256 2716 563 11010
NM_021961chr1197222 7212 6314 6168 4524 1375 911 904 717 --26206 1794 --
NM_021964chr3196642 6139 6104 5505 5031 4689 4593 4407 4384 2310 2009 1519 1501 1479 1292 1206 559 392 193 34529 2429 900 31825 828 564 22003 1165
NM_021977chr693689 3670 3547 3254 1456 1125 1118 966 864 33710 3650 157 2994 462 --
NM_022048chr1594985 4087 4021 2290 2268 1820 1337 814 606 --25675 5658 --
NM_022058chr221563 623 1120 --11952
NM_022118chr133566 456 185 176 --2466 250
NM_022133chr861832 1705 693 506 498 411 31675 1215 134 3378 354 208 --
NM_022351chr8113429 3342 3231 3213 3189 3171 3148 2619 1184 820 519 11551 ----
NM_022459chr13146268 5679 5409 5035 4967 4941 4442 4435 3922 2160 1882 1674 1390 1176 --44848 4689 1613 1541 24337 1521
NM_022473chr15124394 3906 3861 3679 3085 3032 2695 1656 1490 783 752 170 ------
NM_022474chr1451886 934 846 818 582 --12845 11095
NM_022483chr561562 1396 602 167 115 100 --21373 399 11461
NM_022716chr142483 1049 1004 103 3975 967 946 23133 720 --
NM_022763chr342403 1957 360 344 22833 102 32525 865 839 --
NM_022781chr973172 2455 2164 1300 950 653 301 42885 2243 2146 375 ----
NM_022828chr531334 309 186 --21525 200 11410
NM_022841chr15122804 2504 2185 2173 1987 1927 1835 1111 671 657 467 271 22496 2455 ----
NM_022845chr1651827 1648 752 527 174 31688 1606 39 32154 2146 1495 --
NM_022893chr273062 2784 2479 2293 2047 940 333 --1290 12160
NM_022894chr241509 1389 258 249 21763 641 --1674
NM_022918chr1172165 1905 1821 1343 871 841 775 11731 --2282 245
NM_022977chrX72591 2549 2542 1038 602 551 236 2562 183 1981 12171
NM_023074chr193961 842 134 --21351 1023 2937 848
NM_023929chr852816 2784 2094 319 169 --1213 22219 2072
NM_024345chr9155632 5536 5511 5487 4830 4812 4519 1965 1775 1492 1363 1312 813 624 274 15872 35525 4387 3921 --
NM_024408chr153671 3208 2435 2321 1373 12899 23079 2862 --
NM_024423chr1874275 3890 3712 3612 3012 946 351 --2188 25 --
NM_024512chr373549 3110 3002 1233 800 691 294 43375 3209 769 232 ----
NM_024524chr393099 3074 2783 2666 2659 2038 1129 622 290 1406 --22238 242
NM_024548chr341516 576 223 138 1115 1262 1403
NM_024582chr451056 893 391 377 319 --1384 --
NM_024583chr281105 1045 961 830 385 349 341 247 1932 --3859 303 88
NM_024584chr231180 1071 987 --1956 1969
NM_024590chr481768 1732 1696 1294 450 414 372 318 1558 ----
NM_024607chr894396 4070 3748 3544 3481 3371 758 582 182 11310 ----
NM_024613chr841840 1368 736 512 1722 1708 --
NM_024641chr6102999 2654 2269 2229 2174 2049 1112 347 151 111 32373 1185 1157 32488 341 236 1619
NM_024665chr3124673 4565 4227 4075 4028 3044 1613 1535 1298 539 297 161 13684 31519 1186 384 --
NM_024740chr1184161 4148 3690 3478 3199 3063 1582 645 ----14154
NM_024744chr2102383 2121 1939 1838 1775 1027 936 587 538 336 12662 --12469
NM_024761chr985330 4658 4585 3419 3410 2145 2134 1950 25192 4221 ----
NM_024770chr276006 5513 5497 4826 4463 1694 416 36566 5681 2329 1235 12307
NM_024817chr1555298 4089 3761 951 938 15198 15428 15770
NM_024828chr971256 1250 979 610 438 177 88 21148 1008 ----
NM_024884chr1493747 3477 1550 1513 1407 1349 1195 1059 276 13847 31794 1396 65 --
NM_024913chr741647 1389 1367 1168 21416 1356 21409 1132 --
NM_024921chrX81555 1456 1335 639 540 406 271 24 --21750 390 --
NM_024930chr572810 2705 2634 1965 1930 1805 880 12220 32830 2714 2324 12595
NM_024947chr3269580 9571 9470 9245 9112 8323 7727 7693 7572 7437 7103 6826 6087 3843 3703 3479 2963 2825 1969 1883 1542 1313 1170 354 244 220 11958 22262 2229 19094
NM_024949chr464493 4301 3456 803 591 191 23402 1628 14306 11527
NM_024989chr2207985 7409 7369 6653 6605 6393 6187 6029 5655 5402 2836 2696 2448 1965 1465 1377 1167 982 824 558 47194 6598 6252 5943 48007 2660 1973 1450 11830
NM_024991chr1063200 3139 3073 2958 2828 2440 12345 --13102
NM_025040chr1992406 2335 2261 2011 1864 1806 1575 999 989 12249 12055 --
NM_025054chr863673 3214 1664 1603 1130 775 22985 1683 1119 --
NM_025134chr1692361 2126 2033 1825 1627 616 243 228 156 --1475 32299 1797 1646
NM_025146chr352737 2456 2441 1839 1091 --1575 12107
NM_025160chr164248 3761 3668 3028 1127 844 13072 1603 --
NM_025191chr163518 2959 2903 2347 2278 862 12620 1843 --
NM_025208chr1131974 771 22 3521 334 239 22280 213 --
NM_025235chr10132200 2099 1842 1836 1764 1711 1510 1372 552 527 441 284 257 ------
NM_030621chr14133811 3711 3573 3171 3148 3014 2902 2634 1649 1383 1144 805 727 23982 646 33646 3632 3176 --
NM_030627chr5113930 3747 3691 3457 3092 2872 1374 1300 1054 614 221 24018 930 33104 2946 2930 12741
NM_030639chrX91776 1680 1625 1477 630 324 157 74 60 ------
NM_030647chr7126141 6130 5312 5007 2146 2115 2045 1702 953 873 699 480 1615 14815 15632
NM_030648chr4125439 5301 5075 4162 3853 2185 2030 1961 1727 799 723 623 1410 13536 --
NM_030650chr253281 3231 701 491 190 1158 23332 3256 --
NM_030664chr1042157 2090 698 164 --1757 1733
NM_030674chr1295104 4939 4901 4696 1096 1075 1035 937 352 --21978 1843 --
NM_030755chr14132728 2576 2288 2123 1120 994 956 845 683 559 547 304 100 --1320 12713
NM_030791chr1451363 1339 1221 377 158 1276 --2329 311
NM_030806chr1129423 8822 8772 8664 8495 8467 8442 6054 3578 846 146 51 11783 --19385
NM_030816chr183319 3259 3201 1048 1025 612 219 108 --1606 --
NM_030918chr185195 4408 4065 3325 2100 931 644 438 ----11210
NM_030920chr141989 1809 1360 368 ----11794
NM_030945chr562670 2318 1715 764 742 92 12523 21902 1873 --
NM_031268chr1654869 4828 4539 4235 3742 15084 --25267 585
NM_031291chr43565 521 230 173 --158
NM_031314chr1452008 1742 1540 1308 440 11988 21318 825 --
NM_031362chr292762 2747 2739 2612 2468 2396 1750 1017 194 1710 22818 2796 --
NM_031365chr2102898 2883 2875 2748 2604 2532 1886 1845 1153 330 1846 22954 2932 --
NM_031366chr2102898 2883 2875 2748 2604 2532 1886 1845 1153 330 1846 22954 2932 --
NM_031411chr552314 2271 2245 2195 670 --32101 1956 1542 --
NM_031418chr1152451 2437 873 579 222 32529 2146 792 22513 680 --
NM_031419chr351380 1116 1082 151 86 21283 199 --1140
NM_031427chr14105786 5512 3638 2239 1766 1252 1122 819 645 586 51440 1350 258 197 66 25631 4790 11398
NM_031435chr12113013 2713 2384 2239 1144 957 773 438 208 198 139 --33410 2512 357 13482
NM_031445chr253373 2977 1350 1105 506 12649 --13126
NM_031461chr831609 1509 545 21688 561 2831 302 1270
NM_031469chr6103820 2965 2727 2617 1578 1465 1417 500 393 264 --22732 168 --
NM_031483chr2083499 3247 2689 2242 1260 1021 962 571 12461 ----
NM_031844chr163103 2970 934 673 477 178 34059 1378 1110 21520 451 --
NM_031845chr2133549 3206 2446 2380 2354 1475 836 770 444 261 218 138 79 12306 2551 288 --
NM_031847chr2133549 3206 2446 2380 2354 1475 836 770 444 261 218 138 79 12306 2551 288 --
NM_031849chr552314 2271 2245 2195 670 --32101 1956 1542 --
NM_031857chr552314 2271 2245 2195 670 --32101 1956 1542 --
NM_031860chr552314 2271 2245 2195 670 --32101 1956 1542 --
NM_032012chr9165278 4952 4259 3858 3613 3386 3210 1968 1834 1086 1076 1009 960 675 591 523 25104 138 24627 4183 1325
NM_032047chr382319 1726 1623 923 682 619 546 225 1874 ----
NM_032116chr1395878 4490 1739 1628 1250 1040 897 686 240 14034 25416 1331 --
NM_032145chr661791 1366 1198 688 457 89 1528 --1765
NM_032160chr18124166 4153 3880 3747 2906 1475 1280 1218 1199 1128 1024 271 24077 3235 11701 --
NM_032199chr1053721 3445 2774 2734 1163 1586 13822 13684
NM_032228chr1173326 3283 3081 2786 2726 2422 495 11122 12247 --
NM_032268chr16--1894 --22824 320
NM_032288chr372377 2329 2223 1717 891 573 195 --1901 --
NM_032321chr272759 2428 2337 1048 940 592 133 12227 22342 679 13015
NM_032373chr10104909 4825 4125 1909 1745 1446 637 334 153 65 33813 2256 2171 31287 852 434 25943 4434
NM_032424chr1141467 1093 644 131 ----1234
NM_032439chr1041202 613 501 422 1304 --11259
NM_032440chr1092738 2188 2154 1030 944 590 346 220 122 1168 22880 2875 1851
NM_032446chr5113857 3710 3432 3326 3134 2666 2526 1089 923 675 373 12935 33564 3014 1195 11149
NM_032457chr473116 3108 1256 1058 641 209 33 13863 21263 742 22508 781
NM_032458chrX43364 2709 2095 308 33426 1235 156 22591 274 22221 532
NM_032505chr392775 2762 2445 2322 2028 1862 928 476 135 12045 --12241
NM_032521chr2073153 3096 3075 2421 2199 1134 231 1327 12280 --
NM_032679chr194974 962 856 796 --158 11102
NM_032828chr19134656 4436 4376 4268 3966 3385 3252 3119 1910 1787 1270 1196 404 24836 4448 ----
NM_032838chr196931 913 799 430 405 372 --11047 11289
NM_032859chr13143924 3603 3141 2973 2942 2809 1164 1037 981 916 541 492 305 160 23016 2935 23297 24 --
NM_032873chr11164516 4139 4072 3708 3698 3195 3159 3025 1791 1715 1602 1440 1221 1058 905 519 --13041 --
NM_032968chrX103611 3580 3569 3274 3051 2915 2727 1172 227 172 13137 14247 11668
NM_032969chrX103611 3580 3569 3274 3051 2915 2727 1172 227 172 13137 14247 11668
NM_032973chrY103603 3576 3565 3269 3046 2910 2722 1172 227 172 13132 14239 11662
NM_032975chr1873583 3369 3139 3118 2797 2500 523 --13071 1848
NM_032980chr1873583 3369 3139 3118 2797 2500 523 --13071 1848
NM_033020chr173925 3362 1731 1463 1368 1257 516 44059 3940 3859 3445 ----
NM_033107chr762147 1786 1658 1586 1576 432 11870 1475 11839
NM_033132chr1331981 1802 252 --21843 1655 11822
NM_033135chr1131974 771 22 3521 334 239 22280 213 --
NM_033138chr732355 1687 838 --2759 585 21975 1433
NM_033139chr732355 1687 838 --2759 585 21975 1433
NM_033140chr732355 1687 838 --2759 585 21975 1433
NM_033143chr4124215 4180 3827 3763 3516 3181 2942 1824 1734 967 894 852 --34051 3437 3255 13527
NM_033157chr732355 1687 838 --2759 585 21975 1433
NM_033224chr7187105 6866 6730 6362 6194 6072 6014 5752 5401 5317 4915 2954 2817 2516 1015 815 666 386 --16467 11747
NM_033285chr8114467 3773 3600 3331 2903 1795 919 676 250 160 46 13041 21660 739 13214
NM_033290chrX62971 2414 1316 1160 747 264 --13480 12707
NM_033360chr12154665 4317 4253 3972 3759 3707 3487 1836 1767 895 868 773 753 648 182 11779 22975 716 23542 1487
NM_033380chrX41014 839 752 269 1742 --1285
NM_033381chrX41014 839 752 269 1742 --1285
NM_033394chr261309 1239 1139 1074 1039 437 21359 467 1215 --
NM_033430chr423814 3632 ----2977 179
NM_033437chr423814 3632 ----2977 179
NM_033505chr266558 5231 5011 4411 4139 1407 12577 --11876
NM_033656chr2195521 5259 4068 3699 1343 1000 549 401 108 34995 2177 1318 14700 --
NM_052832chr843021 2951 1985 797 12351 22571 2499 --
NM_052879chr1263910 3533 2859 2528 1395 493 12492 --11554
NM_052885chr1274498 4224 3868 3608 826 697 490 34914 4698 950 23735 1370 1370
NM_052886chr841954 366 208 52 1669 --11765
NM_052907chr1273947 3287 3178 1669 1536 1302 1057 23408 481 --13867
NM_052913chr62405 264 ----2832 790
NM_052927chr531999 1548 255 1284 21577 723 21625 1607
NM_052937chr862284 726 713 390 379 108 2362 334 12749 12074
NM_053016chr9117239 5632 5362 2920 1821 1632 1061 1050 856 564 443 74909 2885 2654 2379 2123 723 549 46238 2516 1782 1713 12093
NM_053056chr1182656 2524 2507 2121 1215 673 409 325 22486 246 1612 --
NM_053064chr1482614 2330 2312 2240 2195 2047 1925 792 --1772 --
NM_057168chr791470 1268 1157 1121 627 486 369 225 53 --21363 1279 11546
NM_078476chr631822 1795 1759 ----11765
NM_080618chr203447 269 120 11352 11214 1453
NM_080743chr662274 1956 869 576 492 240 1309 1621 1401
NM_080759chr1392549 2507 2382 2213 1960 1920 1727 1620 521 22005 637 ----
NM_080760chr1392549 2507 2382 2213 1960 1920 1727 1620 521 22005 637 ----
NM_080867chr14104689 4133 3984 3832 3308 3086 1969 1627 335 251 --24761 4582 1442
NM_080872chr893824 3445 3130 2885 2724 2653 2641 1532 1280 2196 153 1843 --
NM_080874chr471624 1536 1434 763 687 625 195 --21896 333 --
NM_080927chr3102728 2566 2549 2512 2348 1230 1125 1074 936 516 12217 --193
NM_130438chr2193178 3046 3008 2601 2321 2222 2098 2086 736 22961 952 31257 480 82 --
NM_130809chr533092 2964 1016 32863 1195 1106 11088 --
NM_133334chr464486 4144 2458 1485 1467 775 36286 4545 2346 14356 --
NM_133372chr562917 2601 2074 1938 869 515 32794 2549 826 ----
NM_133473chr1951703 1291 756 671 494 --11257 11917
NM_133477chr4143066 3045 2982 2967 2257 2062 1268 1262 936 803 670 451 287 267 --23273 2290 --
NM_133496chr194204 3606 3584 3356 3038 1627 1236 945 846 24252 1608 24458 3228 --
NM_133638chr561282 1064 570 274 212 166 --142 199
NM_133646chr2125369 5286 5183 4833 4364 4219 4021 1350 1138 373 242 132 14492 14476 11369
NM_133647chr1583552 3137 3092 3061 2787 2643 541 189 13817 ----
NM_138270chrX63232 3222 3128 2165 1132 729 53431 2846 2799 389 374 23442 1252 --
NM_138286chr19163821 3781 3753 3686 2821 2754 2703 1651 1379 1245 1065 725 649 448 249 133 33418 2999 2724 ----
NM_138400chr783469 3268 3092 2797 2765 2720 2465 977 --1127 --
NM_138444chr1394772 4411 3826 1933 1672 1307 627 504 62 23218 1241 14569 --
NM_138459chr673681 3640 3475 1318 1193 933 877 --13525 --
NM_138468chr286345 4980 4669 2420 2102 1309 838 383 2969 959 11330 --
NM_138473chr1254517 2006 1542 1201 523 23721 3524 11885 1420
NM_138633chr641741 1490 719 347 11403 --1657
NM_138635chr762964 2511 1068 869 667 219 --11161 13080
NM_138713chr16178171 8082 7780 7383 7046 6844 6605 6138 5942 5554 5221 5009 3280 3138 1930 1294 208 35247 2042 852 27626 1814 27429 2797
NM_138714chr16178171 8082 7780 7383 7046 6844 6605 6138 5942 5554 5221 5009 3280 3138 1930 1294 208 35247 2042 852 27626 1814 27429 2797
NM_138731chr1474281 3320 2808 1004 310 266 242 33527 3418 3235 21528 607 13967
NM_138771chr741371 1342 1192 611 11067 31480 999 45 11005
NM_138782chr582117 2092 1881 1856 1770 741 593 36 52394 2216 1740 1601 1587 --1752
NM_138811chr781120 1075 1049 786 400 321 269 128 ------
NM_138959chr186632 6312 6197 4987 2549 2522 2252 260 12188 --16129
NM_139057chr1532887 2796 2409 ----22902 2802
NM_139136chr1241009 938 722 713 1832 1810 --
NM_139169chr1072180 1862 1619 1599 841 173 112 12272 22126 1979 --
NM_139242chr1571459 1166 1072 515 419 356 223 ----133
NM_144571chr496677 6068 5443 4244 1862 1419 904 879 249 36221 2006 692 11787 --
NM_144599chr15115423 4868 4813 4372 4266 1463 1117 1060 769 454 349 --14347 --
NM_144600chr1651640 1522 1365 531 491 --11408 11346
NM_144632chr272392 2352 2228 2000 1679 1501 933 22203 651 1839 --
NM_144718chr392585 2526 2293 931 590 582 554 387 79 ------
NM_144721chr472778 2747 2664 1780 835 374 131 ------
NM_144949chr252491 2270 1797 1044 536 --12100 11659
NM_144963chr892656 2415 2208 717 681 371 333 318 171 ----1864
NM_144973chr1285102 4506 4402 4213 3822 1115 713 540 34617 3689 554 35170 3601 250 --
NM_145176chr663042 2913 2801 2190 571 549 13399 11405 --
NM_145259chr2127023 6502 6471 6423 5795 5765 2822 2777 2593 2583 2154 268 --16490 12688
NM_145307chr10164464 4439 4030 3576 3533 3505 3469 3342 3239 3044 1339 1236 1040 716 438 66 24085 3567 13812 186
NM_145686chr293309 3152 3118 2938 2920 2466 2233 1281 1005 1166 --12954
NM_145687chr293309 3152 3118 2938 2920 2466 2233 1281 1005 1166 --12954
NM_145808chr742905 2894 2460 2029 21982 768 --11166
NM_145893chr1641504 1206 188 76 --21162 263 1453
NM_147150chr9103875 3004 2981 2419 1581 1516 1502 997 471 291 --13319 --
NM_147189chr872029 1716 1476 534 316 264 131 --32164 2064 1633 --
NM_148955chr1586514 6321 6083 5976 2316 2162 1891 1854 66452 6440 2539 1625 1534 827 26422 1519 --
NM_148957chr1392593 2212 1910 1879 931 899 826 793 93 12625 ----
NM_152261chr121226 12038 11612 21726 394
NM_152330chr1472541 1695 895 330 268 177 163 22459 74 1725 12343
NM_152332chr1482759 2600 2139 1792 1056 943 917 268 12708 ----
NM_152388chr253760 2915 1150 615 490 13170 --2567 113
NM_152389chr251311 1171 639 587 527 41393 1329 1064 146 ----
NM_152400chr422106 1529 31539 800 63 --11952
NM_152409chr573505 3431 3307 829 610 514 338 13262 43203 2756 1284 753 --
NM_152424chrX73492 3485 3476 3416 2872 1640 1571 14088 1641 1326
NM_152529chr294326 4026 3879 3671 3577 3398 2947 1084 175 2681 332 --1955
NM_152551chr672982 2949 2657 2575 932 920 214 2616 82 --1627
NM_152556chr762260 2145 1994 583 490 385 32080 173 102 1949 --
NM_152594chr1592239 1704 1698 874 720 710 510 429 200 31907 1591 846 --1542
NM_152624chr5166836 6539 6379 4987 2716 2568 2555 2045 1975 1051 918 880 679 460 365 356 11073 11659 --
NM_152629chr9114074 4021 3928 2502 1510 1344 1119 619 592 392 182 33910 3531 2624 12829 13008
NM_152630chrX51579 1402 433 412 122 ----11511
NM_152680chr421835 1623 --12340 21919 1681
NM_152682chr481793 1608 1577 1558 1307 1290 1168 128 --11135 --
NM_152754chr753883 3850 2824 2461 1007 13337 11198 --
NM_152756chr5144178 4141 3931 3770 3682 3534 3238 3219 3104 1652 1394 1388 1064 680 23125 632 ----
NM_152758chr852919 2513 2035 1982 1949 12841 32938 2254 583 11149
NM_152774chr792581 2116 1879 1043 770 623 596 93 87 --21983 325 --
NM_152826chr1586514 6321 6083 5976 2316 2162 1891 1854 66452 6440 2539 1625 1534 827 26422 1519 --
NM_152836chr861832 1705 693 506 498 411 31675 1215 134 3378 354 208 --
NM_152837chr861832 1705 693 506 498 411 31675 1215 134 3378 354 208 --
NM_152838chr2052325 2203 2162 986 194 13166 23137 1349 1111
NM_152890chr181249 1212 995 983 825 497 398 291 --21017 217 --
NM_152902chr141856 1621 209 146 ----1630
NM_152999chr7174920 4632 4018 3973 3822 3427 3416 3405 1740 1699 1547 1270 899 686 439 270 76 --54360 1717 1624 609 565 --
NM_153013chr592514 2068 1924 1792 965 686 599 233 134 --12546 --
NM_153184chr351630 1333 679 650 581 --21575 298 --
NM_153188chr5225643 5329 5263 5023 4923 4727 4693 3846 3493 2255 2030 1989 1936 1915 1618 935 809 772 602 516 433 249 54666 4636 4570 1687 1241 45003 4092 3569 1283 13674
NM_153207chr12104023 3851 3414 3105 2580 1456 1122 386 366 302 23435 1065 ----
NM_153235chr672296 2261 1864 1672 566 427 266 32436 522 43 1477 --
NM_153262chr172823 2784 2436 2387 1045 863 331 13169 12572 --
NM_153332chr873268 3217 3039 1181 584 481 123 2954 223 33024 2401 880 --
NM_153354chr53869 208 186 ----1842
NM_153371chr1382104 1834 1532 951 737 226 177 29 12090 ----
NM_153456chr1366137 5809 4371 4177 4115 2288 14774 26063 4143 --
NM_153607chr593185 2841 2681 2546 2479 974 263 118 79 12629 22674 177 --
NM_153686chr461974 707 175 166 153 112 1467 31554 607 144 --
NM_153687chr1251652 1586 1405 654 37 --1306 11288
NM_153748chr1241009 938 722 713 1832 1810 --
NM_170710chr4103224 3180 2935 2718 2701 2411 719 471 252 110 22156 653 22893 2529 13135
NM_170725chr15738 631 217 211 201 ------
NM_170731chr1122406 404 22774 2245 3300 223 30 --
NM_170732chr1122406 404 22774 2245 3300 223 30 --
NM_170733chr1122406 404 22774 2245 3300 223 30 --
NM_170734chr1122406 404 22774 2245 3300 223 30 --
NM_170735chr1122406 404 22774 2245 3300 223 30 --
NM_172070chr272212 1745 1663 1424 1387 869 391 11532 121 --
NM_172071chr1127485 7274 6739 6052 5264 5098 5023 4821 4682 2056 1425 749 34562 1760 1646 --31771 394 328
NM_172193chr1481371 1294 1193 1061 976 481 184 74 ----1293
NM_173082chr681361 1208 1139 590 548 523 491 99 --1213 11529
NM_173083chr151256 1133 1033 429 239 2230 64 1181 --
NM_173198chr982652 2546 2275 2256 1827 848 366 214 11967 23012 861 --
NM_173200chr982652 2546 2275 2256 1827 848 366 214 11967 23012 861 --
NM_173214chr16178171 8082 7780 7383 7046 6844 6605 6138 5942 5554 5221 5009 3280 3138 1930 1294 208 35247 2042 852 27626 1814 27429 2797
NM_173463chr473791 3584 3434 2983 1012 967 160 23200 3121 ----
NM_173468chr496100 5864 3739 2275 2263 1674 1224 615 70 1780 2724 634 --
NM_173469chr1571556 1515 1152 360 171 161 89 --11324 --
NM_173470chrX42819 406 184 97 1148 --1740
NM_173496chr1092969 2943 2327 2272 1947 1220 1091 764 58 2901 521 12997 21159 693
NM_173500chr15------2453 370
NM_173536chr4155060 5005 4731 4449 4142 3734 3625 1572 1315 1117 1107 650 271 262 184 11052 13168 14699
NM_173545chr251915 1874 1698 748 33 21407 314 --1464
NM_173552chr3132324 2228 2076 2070 1988 1969 1768 1756 912 702 382 351 99 --32309 671 624 --
NM_173576chr10102108 1981 1822 1696 925 842 776 569 247 168 ------
NM_173582chr11126234 4906 4336 2239 2089 1671 1454 945 561 313 251 237 23880 395 34249 1174 1009 15809
NM_173607chr1431793 1489 100 1437 --11776
NM_173642chr188734 8338 6965 3200 2091 1337 1105 260 12004 26814 1776 --
NM_173654chr382383 2042 1922 1683 1608 715 582 416 12217 ----
NM_173694chrX52570 2500 1885 1575 61 21772 868 42475 1965 974 253 --
NM_173698chrX81751 1594 1551 1502 1352 1323 734 466 11332 21680 743 --
NM_173797chr53986 907 212 11364 2867 233 1147
NM_173808chr183813 3042 2972 1348 1216 1045 353 112 21190 1138 12709 13074
NM_173826chr391669 1502 1459 1427 611 488 375 277 172 31745 1635 95 ----
NM_173829chr5145847 5765 5665 5605 5383 5199 4346 4134 4063 2054 1608 1354 1179 1143 15416 ----
NM_173851chr843765 2739 1176 222 22499 646 --21284 196
NM_174916chr1572355 1982 1757 1479 452 325 130 11625 12174 --
NM_174978chr142120 62 --1133 1768
NM_175056chr342089 2052 1476 358 --31807 1502 169 --
NM_175607chr371444 1262 1175 443 384 265 150 1254 --1284
NM_175612chr371444 1262 1175 443 384 265 150 1254 --1284
NM_175861chr12115801 5194 4813 4338 4224 2080 1995 1747 1156 722 611 25989 1849 14659 --
NM_175876chr152323 2213 570 65 59 149 ----
NM_175910chr1982323 2266 1987 1964 1648 1531 1514 453 22479 2370 ----
NM_175921chr564179 3886 3583 3212 3008 106 43836 3415 3032 1728 24191 916 1170
NM_176814chr761153 1147 547 508 386 302 11189 1227 --
NM_176824chr441069 1032 323 110 21076 384 21346 1190 11305
NM_177414chr131524 1495 365 11403 --11416
NM_177438chr14133811 3711 3573 3171 3148 3014 2902 2634 1649 1383 1144 805 727 23982 646 33646 3632 3176 --
NM_177996chr2032138 1016 429 ----2952 325
NM_178011chr1062882 2721 2093 1294 948 727 12954 1374 1647
NM_178127chr113600 414 372 ----1381
NM_178151chrX116663 6599 6166 6015 5557 5193 5050 2977 1259 1204 307 27183 363 47228 2516 1241 816 --
NM_178152chrX116663 6599 6166 6015 5557 5193 5050 2977 1259 1204 307 27183 363 47228 2516 1241 816 --
NM_178153chrX116663 6599 6166 6015 5557 5193 5050 2977 1259 1204 307 27183 363 47228 2516 1241 816 --
NM_178505chr10123611 3532 3328 3222 3205 3040 2460 2334 1244 1091 994 288 32299 1141 683 13653 --
NM_178539chr1241943 1816 510 190 ----22007 747
NM_178558chr76504 423 293 177 113 86 --1807 --
NM_178585chr483242 3111 2948 1211 941 871 553 315 1969 ----
NM_180991chr551136 1002 727 403 371 42441 2340 922 848 --1774
NM_181265chr4103224 3180 2935 2718 2701 2411 719 471 252 110 22156 653 22893 2529 13135
NM_181354chr861548 1490 1363 695 267 135 11410 ----
NM_181358chr174258 3901 1635 1470 1347 1174 594 43792 1254 1152 634 63862 3851 2700 1477 905 883 --
NM_181443chr2072684 2354 1995 1904 1844 526 244 --12084 --
NM_181481chr1886972 6753 5903 5410 5286 5212 790 626 36888 1608 754 35882 2016 162 44789 4765 2621 410
NM_181482chr1886972 6753 5903 5410 5286 5212 790 626 36888 1608 754 35882 2016 162 44789 4765 2621 410
NM_181483chr1886972 6753 5903 5410 5286 5212 790 626 36888 1608 754 35882 2016 162 44789 4765 2621 410
NM_181659chr2073314 3058 2973 2829 2473 2462 805 12439 ----
NM_181659chr2073314 3058 2973 2829 2473 2462 805 12439 ----
NM_181670chr1261407 1323 1254 1146 1017 577 ----11233
NM_181705chr595492 4756 4482 4057 3667 2083 1063 614 119 35222 5191 2222 1380 --
NM_181706chr1171975 1912 1814 1486 895 760 194 --22400 228 --
NM_181723chr892317 2309 2291 2284 2051 1967 1474 571 512 1204 ----
NM_181782chr651899 1823 817 633 150 32155 1781 624 ----
NM_181783chr1231288 257 225 11969 --21492 1434
NM_181787chr8113889 3838 3724 3623 2614 2479 1217 962 303 270 243 11344 11277 1526
NM_181836chr572664 2033 1712 856 766 706 264 --1780 --
NM_181861chr1272781 2729 2690 2094 946 841 123 --32734 2698 115 --
NM_181868chr1272781 2729 2690 2094 946 841 123 --32734 2698 115 --
NM_181869chr1272866 2814 2775 2179 1031 926 208 165 32819 2783 200 --
NM_182485chr4123709 3494 3443 3081 2845 1438 919 880 852 804 673 264 22804 1328 --23016 2325
NM_182503chr6115183 5147 4381 3587 1429 1297 1267 1132 771 738 609 195 43682 1566 1227 519 13835
NM_182515chr19205640 5500 5405 5365 5352 5299 4787 4242 2573 2338 1984 1851 1577 1247 1130 1028 746 666 634 484 12238 24889 1543 --
NM_182646chr4123709 3494 3443 3081 2845 1438 919 880 852 804 673 264 22804 1328 --23016 2325
NM_182715chr731186 483 334 1144 --1444
NM_182734chr2083015 2915 2613 2555 2398 2328 2037 313 --32156 739 277 --
NM_182757chr632850 1233 39 21378 1099 --11106
NM_182758chr1583476 3399 3331 3269 3214 2784 899 174 23539 3427 22476 1504 1359
NM_182762chr7176210 5379 5261 4568 4486 4473 4096 4066 4024 4011 3981 3968 3906 3833 3798 2301 2292 25065 4330 35787 398 175 11160
NM_182765chr10102368 2299 2204 2094 2010 930 872 718 470 31 22145 253 ----
NM_182767chr1251941 1636 1387 202 183 ----11776
NM_182830chr1472299 1677 1396 710 704 668 266 --11608 --
NM_182896chr351857 1796 435 341 296 11689 2555 375 11492
NM_182898chr7106521 6449 5729 5713 5247 4994 4679 4667 1595 524 35461 2035 171 32251 1100 693 --
NM_182899chr7106521 6449 5729 5713 5247 4994 4679 4667 1595 524 35461 2035 171 32251 1100 693 --
NM_182907chr632260 889 374 22379 302 21947 1471 1231
NM_182948chr132082 1055 671 ----12434
NM_182972chr171990 1896 1802 1784 1767 932 730 1755 12756 --
NM_183043chr132764 377 2997 167 --1111
NM_183044chr132764 377 2997 167 --1111
NM_183050chr692228 1650 936 817 718 510 477 342 193 --12415 --
NM_183227chr651441 1055 332 219 78 1629 132 11112
NM_194282chr4103030 2832 2397 2287 2260 2163 1985 1926 1213 128 21949 427 --1230
NM_194291chr842678 960 375 261 --42983 1161 1061 737 --
NM_194314chr1185279 5218 5185 5091 4622 3750 2065 1921 1815 1800 1231 1207 1187 1070 746 726 431 39 64120 4068 3516 2041 1980 1059 35011 4986 463 14965
NM_194328chr973172 2455 2164 1300 950 653 301 42885 2243 2146 375 ----
NM_194329chr973172 2455 2164 1300 950 653 301 42885 2243 2146 375 ----
NM_194330chr973172 2455 2164 1300 950 653 301 42885 2243 2146 375 ----
NM_194332chr973172 2455 2164 1300 950 653 301 42885 2243 2146 375 ----
NM_198189chr24781 372 350 248 --1711 11088
NM_198225chr1061681 1567 1326 655 587 354 --1647 1475
NM_198268chr174258 3901 1635 1470 1347 1174 594 43792 1254 1152 634 63862 3851 2700 1477 905 883 --
NM_198269chr174258 3901 1635 1470 1347 1174 594 43792 1254 1152 634 63862 3851 2700 1477 905 883 --
NM_198270chrX83355 3264 3197 2756 2687 992 757 404 ----12821
NM_198273chr582983 2928 2859 2606 2381 2281 1088 65 52172 2149 969 857 831 32459 879 735 12116
NM_198279chrX4815 395 330 182 1351 1994 1875
NM_198281chr462510 1274 663 477 448 319 23221 724 12917 --
NM_198400chr1572899 2825 2713 2655 1147 1001 191 ------
NM_198468chr6124010 3804 3207 3166 2974 1484 1357 1311 639 592 507 133 44578 4248 4070 1062 14530 14618
NM_198503chr162398 2300 2050 1920 1640 1578 11927 32097 624 407 --
NM_198513chr861870 1847 1810 1755 625 380 --11607 --
NM_198549chr193295 2803 2777 2662 2254 1318 456 211 77 22334 2273 22450 1204 --
NM_198581chr2216944 6769 6545 6220 6105 5738 5637 5602 5110 4579 2412 2167 1908 1151 894 790 738 694 498 342 102 27494 172 ----
NM_198584chr892574 2466 2459 1851 1717 979 688 603 243 11969 3828 810 776 --
NM_198715chr1106170 5523 4989 1919 1873 1114 696 476 456 21 1938 36273 3908 3841 --
NM_198719chr14361 331 176 30 155 1882 186
NM_198793chr354077 3846 1544 1080 142 23742 2724 11405 13961
NM_198904chr542065 777 678 487 --11524 12046
NM_198968chr1373397 1602 1366 1115 1000 947 419 22895 768 ----
NM_199003chr861500 1293 1081 957 476 442 21399 387 11265 --
NM_199039chr431031 814 715 1762 1799 11051
NM_199040chr1283431 2865 2819 2379 1504 1372 480 133 --13485 --
NM_199072chr773090 2844 2716 2380 2035 1006 227 22269 2212 ----
NM_199188chr1263910 3533 2859 2528 1395 493 12492 --11554
NM_199190chr1263910 3533 2859 2528 1395 493 12492 --11554
NM_199320chr462812 2466 1986 1069 496 468 11919 22817 2678 --
NM_199320chr462812 2466 1986 1069 496 468 11919 22817 2678 --
NM_199324chr493596 3435 2319 1402 1288 1196 1147 1006 303 --13426 23744 703
NM_199421chr14104689 4133 3984 3832 3308 3086 1969 1627 335 251 --24761 4582 1442
NM_199436chr242939 2039 1198 977 23095 120 --12901
NM_199482chr241637 823 798 92 12120 1843 11723
NM_203301chr1451558 1490 1459 1196 402 2620 34 1686 2526 127
NM_203354chr142114 81 1256 1607 1233
NM_203355chr142114 81 1256 1607 1233
NM_203356chr142114 81 1256 1607 1233
NM_203390chr871587 1166 669 617 502 339 211 21711 1640 --11744
NM_203391chrX71640 1506 1368 1313 1289 703 636 144 11767 --
NM_203406chr572906 2863 2735 2062 974 610 553 --21913 811 2111 36
NM_203459chr1112422 2194 1855 1795 1703 1646 1616 1034 934 575 337 --2963 939 --
NM_203463chr2104040 3715 3603 3511 3376 1949 1408 1177 479 233 --11678 13162
NM_203504chr442451 2301 1020 54 12259 12539 11887
NM_203505chr442451 2301 1020 54 12259 12539 11887
NM_206594chr193561 3401 3200 3150 2888 1244 974 816 774 12649 ----
NM_206595chr193561 3401 3200 3150 2888 1244 974 816 774 12649 ----
NM_206853chr693954 3553 3384 2906 1441 1189 739 269 177 43060 2998 2831 1408 ----
NM_206854chr6115215 4814 4645 4167 3728 3694 2000 1530 1438 421 408 34321 4259 4092 ----
NM_206855chr6156180 5779 5610 5132 4693 4659 2495 2403 1386 1373 868 620 243 154 83 35286 5224 5057 ----
NM_206866chr2193211 3099 3067 2857 2396 2344 1226 1107 824 ----22567 2388
NM_206876chr273446 3021 2572 2512 2383 1272 248 --1566 --
NM_206907chr5103063 2700 2520 2482 2298 973 763 277 241 95 4989 896 345 314 2351 337 --
NM_206909chr8118097 7814 7730 7715 7624 7573 5738 5520 5132 1323 439 12383 28324 6494 --
NM_207015chr352298 2254 1919 1606 191 --22174 131 --
NM_207303chr10123711 3582 3514 1667 1642 1503 1301 1239 960 439 324 235 11650 ----
NM_207361chr13136030 5887 5752 5478 5323 5175 4202 4080 2431 1826 931 758 173 22244 655 35982 5232 4211 14247
NM_207366chr752365 1580 919 894 670 --22315 1834 12153
NM_207506chr851361 979 525 400 179 --11239 11275
NM_207647chr942580 2525 767 693 21954 905 12548 1315
NM_212471chr1792232 1864 1752 1674 1642 1458 727 633 148 31910 1437 127 11779 --
NM_212472chr1792232 1864 1752 1674 1642 1458 727 633 148 31910 1437 127 11779 --
NM_212558chr963988 3722 3701 3500 2795 963 2855 441 33533 1129 720 11295
NM_213589chr295562 5267 5202 5045 4772 4165 3931 3891 3735 11741 35575 5053 1348 2992 433
NM_213651chr141437 375 355 224 1396 3584 461 164 --