TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-380-5p
miRNA Sequence: UGGUUGACCAUAGAACAUGCGC

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000084chrX106706 6091 5766 5246 4881 2650 2527 2514 1725 864 26428 4895 --1141
NM_000090chr22833 599 ----176
NM_000108chr721220 512 11466 1258 11353
NM_000112chr575396 4984 4968 2019 2013 1255 894 1106 ----
NM_000125chr644276 3601 859 576 23187 2912 ----
NM_000138chr1542460 1693 872 861 32583 2109 523 11704 --
NM_000216chrX23926 3057 1449 --1151
NM_000217chr1294757 4038 3545 1597 1259 740 691 536 140 --1915 14565
NM_000259chr1595658 4874 3920 2403 2268 2024 1942 995 699 56144 4491 2218 718 224 ----
NM_000267chr1773512 3205 2809 2269 510 153 31 --11217 13016
NM_000314chr1053241 3100 3033 2120 977 21008 816 11172 --
NM_000332chr646530 6023 4776 2171 --16553 1587
NM_000337chr575950 5678 5464 5458 4465 1417 905 35031 2476 892 1574 1925
NM_000351chrX63885 3859 3753 3361 389 168 --23917 2933 --
NM_000390chrX33003 2853 647 --33193 3123 996 --
NM_000408chr242868 1346 1053 517 12638 12904 --
NM_000489chrX2916 86 --23213 1364 --
NM_000492chr721534 1471 11306 --1328
NM_000555chrX97176 7072 6939 5795 5461 2669 2654 865 561 27118 5745 1706 --
NM_000611chr1186935 6923 6805 6553 5828 5474 4483 1706 37046 2840 1682 26251 2097 --
NM_000617chr1222288 117 32010 493 325 ----
NM_000618chr1286484 5752 5542 5408 2448 2084 1551 749 15656 ----
NM_000618chr1286484 5752 5542 5408 2448 2084 1551 749 15656 ----
NM_000793chr1424651 3335 21372 836 13661 13376
NM_000813chr585350 4371 4098 3656 2183 1067 733 87 35155 4648 616 ----
NM_000875chr1576541 6135 5544 4908 2362 1093 1021 12486 11799 --
NM_000902chr3----13267 23049 211
NM_000959chr143240 3160 2846 2444 11211 ----
NM_001001323chr1252556 2395 2373 2167 305 22779 1170 ----
NM_001001419chr543780 1165 1150 1025 21747 783 --13176
NM_001001420chr543780 1165 1150 1025 21747 783 --13176
NM_001002026chr332464 347 235 ----12158
NM_001003652chr18118658 8585 8078 7691 7173 5958 5532 5449 3180 2660 2231 28123 7478 ----
NM_001003712chr1253012 816 636 383 354 ------
NM_001004065chr923226 234 11050 13258 13908
NM_001004317chr684484 3882 3248 2889 1184 923 422 220 14119 ----
NM_001005386chr242387 478 197 76 1789 1633 --
NM_001005502chr1274929 4055 3202 1762 1627 933 21 14687 ----
NM_001005845chr82397 94 21720 1248 ----
NM_001007023chr1424651 3335 21372 836 13661 13376
NM_001007257chr13956 352 57 11345 11204 --
NM_001008392chr333302 2386 309 11302 --13551
NM_001008408chr786273 5759 5681 5640 4726 4400 1376 472 25917 445 32513 1714 629 --
NM_001008925chr432824 2397 1283 13130 12617 --
NM_001009899chr394191 2327 2091 1837 1444 830 542 440 201 ------
NM_001010000chr1873188 2745 2243 2204 763 294 181 12774 ----
NM_001010867chr195473 5401 5254 5222 2261 2097 1533 1455 1385 26695 1608 15786 --
NM_001010888chrX74230 4154 3936 3869 894 810 528 --13565 24466 1610
NM_001010908chr102561 548 --2769 519 --
NM_001010934chr7168 3942 372 84 ----
NM_001011666chr746244 4890 2395 803 36505 5508 1110 ----
NM_001012393chr11115079 3702 3677 3332 1934 1354 1274 1105 1074 918 755 14649 25000 4020 --
NM_001014380chr1345654 5393 876 367 21468 953 --15158
NM_001014797chr10108041 7994 7625 7463 5665 5560 2005 1517 1502 1485 25956 72 22166 1023 --
NM_001017395chr343559 3408 1314 594 11420 ----
NM_001017405chr41249 ----1220
NM_001017440chr778192 8038 7527 7489 1877 413 402 47949 2016 1794 275 27729 438 11362
NM_001017523chr1211786 1578 1227 1417
NM_001018065chr975770 5418 3686 1736 802 674 533 55763 5287 4290 317 252 ----
NM_001018066chr975770 5418 3686 1736 802 674 533 55763 5287 4290 317 252 ----
NM_001018067chr185297 4079 3765 3754 3285 1496 1019 668 11009 1465 --
NM_001018068chr185297 4079 3765 3754 3285 1496 1019 668 11009 1465 --
NM_001018069chr185297 4079 3765 3754 3285 1496 1019 668 11009 1465 --
NM_001018072chr1211786 1578 1227 1417
NM_001024647chr1297541 7402 6985 5792 5739 5475 3036 1830 833 22550 1416 11393 --
NM_001025076chr1044440 1436 1236 242 34491 1930 1342 ----
NM_001025077chr1065798 2794 2594 1600 921 490 25849 2700 ----
NM_001025108chr253814 3275 2834 1648 779 2667 401 --2929 424
NM_001025252chr842390 1038 726 68 1886 ----
NM_001025253chr842390 1038 726 68 1886 ----
NM_001025266chr394880 4220 3829 3152 1696 1380 782 671 574 ------
NM_001025580chrX13517 ----23114 147
NM_001030007chr1634042 3144 1602 23240 39 ----
NM_001030055chr1444467 1718 1351 378 --13024 --
NM_001031684chr211010 1101 1313 1999
NM_001031732chr433324 1165 1134 ----13270
NM_001031804chr1653981 1260 1201 798 585 ------
NM_001031812chr562283 2268 2198 1749 1718 190 ----1347
NM_001033045chr264170 4058 3827 3417 1466 85 --1919 --
NM_001034841chr1664767 3675 3540 1868 849 609 33999 3371 2043 ----
NM_001037553chr2194235 3366 1358 1338 1021 958 366 182 51 14998 1924 --
NM_001039538chr263473 2807 2499 2313 2261 2238 23650 3131 --13455
NM_001039580chr445026 3991 3841 1632 14113 ----
NM_001039585chr153497 3417 3103 2701 141 11468 ----
NM_001039590chrX42885 855 499 161 13683 --1458
NM_001039591chrX42885 855 499 161 13683 --1458
NM_001039618chr1155656 5559 5009 2235 43 11232 ----
NM_001039840chrX65961 5793 5027 2219 1370 97 12314 ----
NM_001040151chr1194592 4252 3483 3433 1686 1249 898 259 72 --11378 --
NM_001040152chr744941 4182 3625 3475 22053 1211 --13326
NM_001040202chr472453 2211 2150 2123 2012 840 426 ------
NM_001040284chr1655858 4555 4425 3877 1397 35111 4243 1371 ----
NM_001040665chr774784 4076 3942 1397 414 203 128 21131 870 ----
NM_001042492chr1773512 3205 2809 2269 510 153 31 --11217 13016
NM_001042494chr1563038 2622 2343 1225 647 324 23749 93 12851 --
NM_001042495chr1563038 2622 2343 1225 647 324 23749 93 12851 --
NM_001042496chr1563038 2622 2343 1225 647 324 23749 93 12851 --
NM_001042497chr1563038 2622 2343 1225 647 324 23749 93 12851 --
NM_001042537chrX--1330 --11954
NM_001042601chr333171 618 577 22083 1310 ----
NM_001042604chr333512 1714 217 34571 4054 4041 --13984
NM_001042749chrX21281 704 11774 --1509
NM_001042750chrX21281 704 11774 --1509
NM_001042751chrX21281 704 11774 --1509
NM_001044722chr562283 2268 2198 1749 1718 190 ----1347
NM_001044723chr562283 2268 2198 1749 1718 190 ----1347
NM_001046chr572979 1917 671 408 286 202 188 1349 ----
NM_001099678chr386041 6010 5732 4820 4230 921 658 480 ------
NM_001106chr378728 8576 6650 6152 3309 1658 243 47897 6664 2842 303 ----
NM_001117chr1852000 1623 687 593 577 12440 12233 --
NM_001128chr1634042 3144 1602 23240 39 ----
NM_001167chrX66564 4644 4340 2405 1277 1253 25013 4883 11005 --
NM_001173chr1444467 1718 1351 378 --13024 --
NM_001201chr443660 3046 2921 454 31390 1030 37 ----
NM_001204chr247404 2007 774 100 36538 5516 2693 ----
NM_001206chr951057 677 555 198 133 12660 ----
NM_001419chr19134857 4573 4400 4289 4117 3599 3485 3189 1698 1537 1075 437 311 11043 ----
NM_001438chr132532 2400 91 43165 2716 2274 1080 ----
NM_001491chr642489 2458 2021 1021 21029 437 192 11766
NM_001616chr243297 2665 2432 573 23269 2690 ----
NM_001650chr1862888 1431 1405 874 376 283 ------
NM_001682chr1242270 2109 2087 1881 22493 884 ----
NM_001695chr8104195 3725 3284 3125 2991 2840 2780 2747 1531 499 1484 ----
NM_001742chr74630 458 369 326 11145 ----
NM_001806chr1931099 1042 75 11015 ----
NM_001874chr1274929 4055 3202 1762 1627 933 21 14687 ----
NM_001918chr188925 7885 7018 6259 5836 3439 2316 260 47341 2916 2492 1481 --26816 2150
NM_001969chr1473738 3651 3540 3402 2934 1057 485 2593 61 13970 --
NM_002006chr485612 5529 5313 5284 4230 1098 539 366 ------
NM_002025chrX65757 3714 2850 2166 739 486 39023 7299 6513 ----
NM_002128chr1362088 1865 735 367 149 48 ------
NM_002241chr151911 1080 974 954 127 1286 12050 --
NM_002264chr333584 1178 626 24105 1819 11932 13289
NM_002270chr545290 4629 4454 563 13558 11652 --
NM_002285chr253814 3275 2834 1648 779 2667 401 --2929 424
NM_002310chr596531 5321 4124 2579 2099 2082 1958 1926 203 ----129
NM_002336chr1243719 1494 628 460 11015 24939 4857 --
NM_002356chr6--22369 931 1355 1214
NM_002374chr263473 2807 2499 2313 2261 2238 23650 3131 --13455
NM_002387chr551594 1224 695 528 151 --13494 11667
NM_002480chr1221184 378 41439 1423 1066 341 ----
NM_002481chr1117856 7031 6019 5498 2885 1316 886 619 589 393 300 36997 6757 5347 ----
NM_002545chr11115079 3702 3677 3332 1934 1354 1274 1105 1074 918 755 14649 25000 4020 --
NM_002581chr964636 4124 3461 756 423 74 11570 11519 --
NM_002655chr854092 1597 1566 1434 975 --24272 3599 --
NM_002706chr2146 ----1691
NM_002709chr221341 208 23525 2555 --11089
NM_002711chr7143 ----1780
NM_002731chr152908 2563 2422 2291 422 22357 2222 12843 --
NM_002737chr17116538 6314 5551 5371 5228 5040 4794 1791 1041 155 70 26267 5309 1265 15181
NM_002886chr363464 1993 1211 705 447 333 --13322 --
NM_002890chr54948 809 380 226 1777 ----
NM_002956chr1251313 1287 969 117 109 11144 ----
NM_003099chr1565235 2403 2203 1489 590 109 ------
NM_003161chr1741305 955 254 105 1166 --1676
NM_003189chr163221 2435 2166 2160 827 354 126 13081 12610
NM_003199chr1865288 5062 4953 1689 480 95 11412 14947 15204
NM_003217chr1272035 1724 1675 1339 493 480 474 --3651 268 231 --
NM_003319chr24916 344 152 116 1706 ----
NM_003430chr1951273 1038 330 246 235 21206 404 ----
NM_003463chr643331 2800 2781 218 31149 550 450 1182 --
NM_003478chr1152582 2525 621 492 256 --12780 --
NM_003483chr1232313 2107 300 12020 1839 1371
NM_003489chr2132337 2093 771 --1378 13158
NM_003574chr1864816 4058 3629 1922 1500 599 24271 984 --11162
NM_003583chr1273619 3122 2809 1174 1145 1064 1048 ------
NM_003590chr243173 3120 2500 898 14032 13014 --
NM_003659chr251094 795 269 53 32 1939 ----
NM_003679chr182790 2741 2305 2113 1337 877 768 401 --12338 --
NM_003713chr131510 1444 1378 21570 1336 ----
NM_003716chr31750 ----195
NM_003759chr463514 3335 3227 1238 870 769 ----22916 2680
NM_003861chr1462893 2283 2043 1011 959 539 1808 ----
NM_003872chr272892 2767 2423 1888 1220 674 473 22926 1955 12873 --
NM_003895chr2141586 1403 370 193 ------
NM_003913chr654098 3083 2899 1494 790 12950 12719 --
NM_004028chr1862888 1431 1405 874 376 283 ------
NM_004087chr3--1468 --11879
NM_004098chr1031291 1280 1274 11010 --1380
NM_004136chr1521164 954 31070 887 844 ----
NM_004162chr31829 2515 76 --1314
NM_004171chr1199220 2923 2916 2549 2511 2057 951 899 788 29433 802 28589 3543 --
NM_004172chr551883 1760 1488 419 363 ------
NM_004229chrX51821 1473 724 602 64 21502 1419 11706 --
NM_004232chr1842641 924 358 160 ----1954
NM_004274chr1453105 3052 2755 2054 439 ------
NM_004370chr651591 432 356 140 127 --11805 --
NM_004384chr562283 2268 2198 1749 1718 190 ----1347
NM_004423chr352696 2416 2053 948 428 ------
NM_004464chr453300 1288 707 404 328 11690 13684 --
NM_004501chr183935 3835 3514 2533 1364 1320 887 57 ------
NM_004586chrX44353 4025 3875 3467 14141 14321 13372
NM_004612chr984629 3846 3676 3615 3443 1884 137 70 12978 13378 --
NM_004726chrX115431 5269 5221 4921 2183 1945 1758 1441 1300 1005 191 15567 1716 --
NM_004734chr1342637 2220 140 42 --1431 --
NM_004744chr453926 3509 3446 1406 959 23910 68 ----
NM_004745chr885271 5192 4830 4605 4547 2442 2397 2289 26475 2738 ----
NM_004857chr14104398 4205 3367 2988 1912 1792 1595 1453 1220 209 1959 14019 --
NM_004859chr1733034 2303 287 11168 --12554
NM_004904chr746244 4890 2395 803 36505 5508 1110 ----
NM_004956chr723099 1180 24230 3512 13803 --
NM_004993chr1431282 512 434 1426 ----
NM_004999chr664425 4327 4261 3563 1095 839 22940 76 --12948
NM_005065chr1425374 1203 ----1362
NM_005079chr842390 1038 726 68 1886 ----
NM_005121chr1743603 3596 489 251 13209 --12930
NM_005135chr1563038 2622 2343 1225 647 324 23749 93 12851 --
NM_005156chr953604 1959 1726 444 337 1710 14442 --
NM_005188chr1188297 7111 6778 5566 5179 2029 624 418 12817 13324 --
NM_005197chr14116037 5251 5035 4976 4771 3954 2408 1695 1579 355 349 11217 14938 --
NM_005207chr2283409 3322 3016 2534 2422 1327 824 689 12327 --12977
NM_005241chr32520 480 1238 --1849
NM_005271chr1031224 1155 850 --2146 136 --
NM_005277chr431766 625 559 1315 ----
NM_005339chr464137 3833 3316 1498 949 578 23746 3462 ----
NM_005359chr1865840 5134 4281 2195 2177 27 15483 ----
NM_005370chr1941041 185 74 33 --11184 21110 301
NM_005402chr721205 205 21699 447 ----
NM_005475chr1222968 119 2648 619 --12817
NM_005493chr65745 697 615 202 46 1839 ----
NM_005497chr1796155 4811 4763 4472 1928 1870 1727 1290 989 ----25977 1020
NM_005596chr986396 6200 5152 4754 2175 1780 930 667 35056 4762 1741 ----
NM_005668chr583460 3380 3258 1532 877 773 404 292 13131 ----
NM_005722chr242387 478 197 76 1789 1633 --
NM_005746chr752689 2668 2384 2279 246 1183 ----
NM_005748chr1243444 2974 2420 1208 11262 12098 --
NM_005808chr333302 2386 309 11302 --13551
NM_005840chrX54933 1264 933 438 230 15028 17071 17282
NM_005843chr231902 1731 97 --1203 --
NM_005868chr742393 1736 981 448 ----1404
NM_005882chr41249 ----1220
NM_005901chr18118658 8585 8078 7691 7173 5958 5532 5449 3180 2660 2231 28123 7478 ----
NM_005902chr1553759 1400 968 121 82 ------
NM_005903chr543780 1165 1150 1025 21747 783 --13176
NM_005909chr542792 2621 856 84 33734 3238 1722 ----
NM_005927chr541294 903 417 361 --11021 --
NM_005937chr1784042 3869 3707 3660 1631 965 618 603 13029 ----
NM_005955chr164725 4336 3857 3606 1959 343 24418 3794 ----
NM_005966chr222268 904 --1874 11515
NM_006038chr203787 748 40 21773 182 1638 --
NM_006095chr433582 3047 1622 ----11542
NM_006203chr535575 4607 1396 44651 3480 2159 1410 11945 --
NM_006224chr1752518 1896 1676 402 43 21813 612 22020 763 --
NM_006359chrX--1330 --11954
NM_006482chr1273619 3122 2809 1174 1145 1064 1048 ------
NM_006526chr2031705 548 187 11897 --1652
NM_006538chr242951 2770 2679 1040 24211 361 13587 --
NM_006544chr14116009 5348 4805 4735 4461 4103 3777 1988 1740 1392 522 24272 2418 14615 --
NM_006548chr321432 701 31108 502 258 --1197
NM_006561chr1044440 1436 1236 242 34491 1930 1342 ----
NM_006591chr1141849 1279 745 720 1162 --11923
NM_006599chr16107957 6885 6452 6201 5239 3169 1906 1459 821 191 58037 7516 5273 2636 2302 ----
NM_006603chrX21281 704 11774 --1509
NM_006614chr393670 2914 2750 2726 2576 2512 1469 721 124 33453 561 269 ----
NM_006624chr1042136 1678 436 295 ------
NM_006628chr1554346 3550 1404 1298 912 24437 3270 ----
NM_006629chr1842017 923 285 34 ------
NM_006699chr152386 945 160 144 105 ------
NM_006729chrX64369 4253 4061 1024 692 411 --11933 --
NM_006751chr22970 915 2783 44 ----
NM_006766chr832090 888 862 1920 --1434
NM_006775chr663116 3048 2481 2032 1987 72 12333 ----
NM_006777chrX21998 1987 12906 --12814
NM_006827chr1473060 2735 2600 2294 634 291 178 21116 40 ----
NM_006828chr62622 102 1116 --1170
NM_006851chr1242299 1902 1073 930 22599 64 12544 --
NM_006852chr1722522 240 1837 12096 11074
NM_006885chr1653307 3082 2832 2714 609 --1511 --
NM_006920chr251907 1386 367 164 92 --11895 --
NM_006924chr1744132 3895 1591 225 1427 ----
NM_006930chr551886 1385 810 568 527 --1425 --
NM_006981chr932685 2175 890 --12951 12038
NM_007007chr1233405 780 577 23761 3497 11304 --
NM_007050chr2087954 7893 7863 7695 5481 1774 1284 224 15406 27560 5525 --
NM_007146chr1752911 2850 1133 775 408 12582 ----
NM_007153chr1943033 1602 289 109 44163 696 364 26 ----
NM_007203chr923226 234 11050 13258 13908
NM_007249chr13129285 8497 6963 3273 3177 2656 2639 1797 1517 597 414 88 39446 5874 2147 ----
NM_007287chr3----13267 23049 211
NM_007288chr3----13267 23049 211
NM_007289chr3----13267 23049 211
NM_012081chr543766 3017 2877 959 11188 1617 --
NM_012090chr11857 11223 11007 1963
NM_012104chr1153840 3535 3109 2850 286 12735 ----
NM_012104chr1153840 3535 3109 2850 286 12735 ----
NM_012120chr642945 1036 819 676 ------
NM_012193chr1164174 3781 1106 1078 1032 396 24712 1741 21100 134 14305
NM_012219chr352982 1183 587 557 268 22233 1086 11155 --
NM_012238chr1041712 1493 1233 586 1241 ----
NM_012252chr733733 404 27 24588 4146 ----
NM_012420chr1052253 1891 1671 632 485 ------
NM_013231chr1431477 1072 955 1336 24223 596 --
NM_013255chr788102 7427 6748 6268 2600 1593 1424 172 22642 131 ----
NM_013261chr473762 3301 1382 943 661 623 256 23453 1429 ----
NM_013372chr1553198 2973 2181 1058 448 1565 ----
NM_013381chr124856 320 112 31 ------
NM_013989chr1424651 3335 21372 836 13661 13376
NM_013995chrX41593 757 711 481 1155 22118 74 --
NM_014011chr222595 27 11938 --12580
NM_014028chr612856 11067 13110 --
NM_014035chr52381 77 1446 --11370
NM_014048chr1654722 4016 3788 3427 3350 23795 3494 --11818
NM_014112chr823546 195 25035 2128 14058 --
NM_014155chr1196991 4839 2406 2223 1641 1548 1410 1363 119 14852 ----
NM_014421chr421751 583 21901 549 ----
NM_014445chr362329 2276 1608 1503 960 271 --22462 357 --
NM_014548chr151637 1275 --1112
NM_014679chr111954 2915 51 1933 11360
NM_014701chr1533167 3036 3013 13284 ----
NM_014721chr697186 6243 6112 5792 1904 1591 1572 1242 520 ------
NM_014755chr253801 3570 1460 1197 749 ----13522
NM_014765chr162691 2408 1969 1076 821 531 ------
NM_014776chr1241097 940 240 178 1171 ----
NM_014802chr1241119 978 735 45 128 ----
NM_014810chr163660 3452 3370 3274 2781 876 23544 456 ----
NM_014822chr41459 ----1663
NM_014838chr2231921 665 498 ----1233
NM_014877chr1777678 6997 6827 6298 6019 3044 2784 25452 5233 15732 --
NM_014899chr533071 2974 2791 12087 ----
NM_014906chr1773230 3186 3180 2760 2709 1378 170 --1768 11284
NM_014920chr643635 978 836 145 --23795 299 1847
NM_014934chr1333780 3316 3086 1312 11091 13239
NM_014950chr143673 129 39 --1469 --
NM_015008chr343559 3408 1314 594 11420 ----
NM_015026chr1243485 3152 1093 476 ------
NM_015071chr556039 5748 4951 2411 127 1180 --25683 215
NM_015144chr1693813 3583 3083 3001 1476 1261 603 436 329 --11085 --
NM_015271chr463265 3210 906 783 613 420 --11514 1980
NM_015310chr857354 7281 2831 1227 332 48440 5986 5565 671 17632 --
NM_015317chr252779 2289 1886 494 206 284 35 ----
NM_015345chr652498 2340 2217 2177 571 --12021 --
NM_015347chr1232127 415 74 22409 1100 ----
NM_015355chr171542 ----1440
NM_015365chrX13517 ----23114 147
NM_015436chr432643 2216 1102 12949 12436 --
NM_015460chr351978 1436 817 794 368 2574 547 ----
NM_015483chr741109 919 760 439 ----1831
NM_015559chr183952 779 435 ----1923
NM_015569chr154361 1767 1675 1476 698 11549 ----
NM_015571chr622461 1883 1993 --11845
NM_015578chr1931581 705 508 ----1550
NM_015640chr185297 4079 3765 3754 3285 1496 1019 668 11009 1465 --
NM_015852chr7123508 3251 2956 2503 1182 922 838 765 418 345 177 93 3587 335 167 2597 513 --
NM_015866chr13956 352 57 11345 11204 --
NM_015878chr842112 1888 839 56 11743 ----
NM_015906chr164558 4295 1680 1575 660 425 ----1934
NM_016083chr653902 3356 2711 2635 546 ------
NM_016132chr1552892 2402 2220 1224 562 --23099 320 --
NM_016206chr378923 8871 7502 6308 6140 5972 2565 2947 839 ----
NM_016260chr275617 5128 2624 2293 1474 979 826 --15701 22074 973
NM_016275chr321891 791 ----12531
NM_016399chr121731 --1752 166
NM_016441chr242049 1691 728 344 32146 1895 706 ----
NM_016513chr643635 978 836 145 --23795 299 1847
NM_016652chr2051791 1454 1204 1181 1172 ------
NM_016831chr142317 2099 877 475 11686 ----
NM_016929chr684361 3748 3694 2958 1447 1302 1141 169 144 ----
NM_017447chr2123821 763 13988 13342 --
NM_025076chr21657 ----1674
NM_030621chr1443564 3111 2775 340 13925 ----
NM_030625chr1052428 2397 746 386 263 1412 ----
NM_030627chr553675 3541 3384 550 75 --1974 --
NM_030648chr495329 5097 4947 4531 4323 2035 1435 566 480 11204 15315 14858
NM_030650chr253201 1475 1468 1012 25 --1628 --
NM_030660chr1431282 512 434 1426 ----
NM_030674chr1275870 3765 2241 2175 1338 893 500 --1804 --
NM_030791chr1431269 1182 270 ------
NM_030806chr188677 7268 7222 6843 3205 2819 2416 1546 18514 13103 --
NM_031427chr14105442 4063 3795 3748 3721 3617 1878 1502 1111 26 --1623 --
NM_031468chr778192 8038 7527 7489 1877 413 402 47949 2016 1794 275 27729 438 11362
NM_031483chr2033298 697 594 13116 1731 --
NM_031844chr183935 3835 3514 2533 1364 1320 887 57 ------
NM_031845chr263473 2807 2499 2313 2261 2238 23650 3131 --13455
NM_031847chr263473 2807 2499 2313 2261 2238 23650 3131 --13455
NM_032105chr1127989 7164 6152 5631 3018 1449 1019 752 722 526 433 54 37130 6890 5480 ----
NM_032116chr1345654 5393 876 367 21468 953 --15158
NM_032199chr1033179 2483 1229 21487 445 --13359
NM_032373chr1095291 5213 4183 3983 3685 2353 1931 73 57 ------
NM_032446chr583372 3296 3091 1055 684 496 471 101 1733 ----
NM_032539chrX3876 673 659 ----1798
NM_032682chr352343 1398 279 273 147 ------
NM_032837chr1762078 1988 828 785 142 62 ----1330
NM_032873chr1122824 888 64171 3365 3168 1811 807 761 --11027
NM_032961chr431387 74 66 --11350 151
NM_032968chrX53409 1560 1247 1106 153 12935 --1162
NM_032969chrX53409 1560 1247 1106 153 12935 --1162
NM_032973chrY43405 1559 1106 153 12930 --1162
NM_033020chr164558 4295 1680 1575 660 425 ----1934
NM_033044chr11857 11223 11007 1963
NM_033121chr1221211 617 11171 11799 167
NM_033143chr463631 2875 1619 1038 735 659 --14015 --
NM_033181chr653902 3356 2711 2635 546 ------
NM_033224chr767426 6709 6028 2293 1782 282 22886 1655 15159 --
NM_033285chr884477 4415 4250 3698 1397 1041 404 296 33544 2834 1145 13648 --
NM_033389chr1774069 3980 1872 1120 927 491 298 21588 1510 13768 1470
NM_033430chr453547 2574 1402 947 510 --11117 --
NM_033437chr453547 2574 1402 947 510 --11117 --
NM_033505chr236649 2165 1085 26291 1702 16134 --
NM_052855chr171601 ----1625
NM_052885chr1234906 4354 1769 11795 13626 13008
NM_052905chr261436 1231 550 429 174 165 1271 ----
NM_053016chr955446 2337 1118 706 614 1293 ----
NM_053042chr473118 2717 2569 2376 2346 2339 614 11238 ----
NM_053043chr786273 5759 5681 5640 4726 4400 1376 472 25917 445 32513 1714 629 --
NM_057169chr1241097 940 240 178 1171 ----
NM_057170chr1241097 940 240 178 1171 ----
NM_080645chr651591 432 356 140 127 --11805 --
NM_080669chr1784895 4120 3895 3555 3282 1957 1815 1055 34191 4165 429 --11351
NM_080867chr1443811 1571 750 653 21901 207 23599 3194 --
NM_130809chr552907 2599 2132 1022 630 ------
NM_133170chr2087954 7893 7863 7695 5481 1774 1284 224 15406 27560 5525 --
NM_133264chr1773950 3923 3677 3340 996 930 924 ------
NM_133334chr476277 5205 4225 3987 706 616 242 ----11536
NM_133370chr433324 1165 1134 ----13270
NM_133378chr24916 344 152 116 1706 ----
NM_133432chr24916 344 152 116 1706 ----
NM_133437chr24916 344 152 116 1706 ----
NM_133445chr922827 1277 11033 21085 285 11397
NM_133493chr673436 3300 2965 1277 1254 1100 751 --14443 --
NM_133647chr1563038 2622 2343 1225 647 324 23749 93 12851 --
NM_138270chrX2916 86 --23213 1364 --
NM_138333chr952501 2219 1701 733 78 --11938 --
NM_138448chr2--1171 --1331
NM_138468chr265829 5669 5123 2150 1003 317 11234 --1129
NM_138473chr1274371 3207 1635 1259 794 716 46 11274 ----
NM_138621chr242951 2770 2679 1040 24211 361 13587 --
NM_138638chr1441625 575 562 298 11949 1376 --
NM_138713chr16107957 6885 6452 6201 5239 3169 1906 1459 821 191 58037 7516 5273 2636 2302 ----
NM_138714chr16107957 6885 6452 6201 5239 3169 1906 1459 821 191 58037 7516 5273 2636 2302 ----
NM_138782chr52681 467 22249 208 ----
NM_138969chr81940 1149 --11409
NM_138971chr1153840 3535 3109 2850 286 12735 ----
NM_138971chr1153840 3535 3109 2850 286 12735 ----
NM_138972chr1153840 3535 3109 2850 286 12735 ----
NM_138972chr1153840 3535 3109 2850 286 12735 ----
NM_138973chr1153840 3535 3109 2850 286 12735 ----
NM_138973chr1153840 3535 3109 2850 286 12735 ----
NM_144571chr446444 5561 4882 843 36577 6093 4793 ----
NM_144578chr1433813 3475 1688 ----11908
NM_144775chr1794778 4273 3945 3754 3565 3326 3178 1450 1066 13809 14396 14770
NM_144949chr222595 27 11938 --12580
NM_144963chr822683 592 11726 --173
NM_144973chr1245026 4725 4018 3351 --11490 15064
NM_145206chr1063000 2691 2246 2117 616 512 1273 ----
NM_145259chr286608 5976 4978 4932 4562 2488 1154 233 ------
NM_145649chr642489 2458 2021 1021 21029 437 192 11766
NM_145655chr642489 2458 2021 1021 21029 437 192 11766
NM_145913chr121739 ----11030
NM_147150chr923226 234 11050 13258 13908
NM_148174chr842112 1888 839 56 11743 ----
NM_148955chr1565235 2403 2203 1489 590 109 ------
NM_152261chr1232051 809 767 11758 184 1552
NM_152275chr232398 1991 1939 22044 419 ----
NM_152433chr1131132 446 204 ----151
NM_152529chr264170 4058 3827 3417 1466 85 --1919 --
NM_152594chr1541985 415 401 259 22300 919 ----
NM_152622chr543094 2898 894 171 23070 598 12221 --
NM_152624chr567236 7108 6814 6717 5778 454 ------
NM_152641chr121732 12928 --2241 42
NM_152688chr63905 701 347 1366 ----
NM_152699chr353743 3191 3157 785 697 13356 ----
NM_152758chr832417 2109 390 ----1348
NM_152774chr721750 487 12268 ----
NM_152826chr1565235 2403 2203 1489 590 109 ------
NM_152903chr1322768 198 --1437 12860
NM_152999chr774784 4076 3942 1397 414 203 128 21131 870 ----
NM_153020chr641236 559 219 81 11246 ----
NM_153188chr545290 4629 4454 563 13558 11652 --
NM_153207chr1233015 816 761 1623 196 --
NM_153332chr863146 2292 2030 926 859 555 12010 ----
NM_153619chr1532993 2214 821 23396 2628 ----
NM_170665chr1254502 3477 3144 696 328 21611 1319 --14148
NM_170710chr442096 824 814 455 --23055 2434 12751
NM_172037chr83536 152 124 ------
NM_172071chr177477 7334 2310 1513 1451 691 482 36066 5480 952 ----
NM_173198chr932685 2175 890 --12951 12038
NM_173200chr932685 2175 890 --12951 12038
NM_173214chr16107957 6885 6452 6201 5239 3169 1906 1459 821 191 58037 7516 5273 2636 2302 ----
NM_173359chr341903 1697 313 105 21545 769 ----
NM_173463chr462962 2824 1522 1377 554 405 11143 --173
NM_173468chr455108 3793 1986 1057 748 ------
NM_173475chr1631535 1198 548 ----1557
NM_173495chrX--12107 22549 396 22430 2327
NM_173552chr361809 1702 1653 952 872 142 ------
NM_173582chr1176192 4854 4164 2527 1983 772 275 --1147 --
NM_173602chr1251441 880 834 434 196 1585 1465 --
NM_173642chr189167 7839 7527 7111 6819 5875 1648 699 65944 2420 2112 1274 691 493 ----
NM_173808chr112958 --24327 419 13353
NM_173829chr575090 4808 4318 2125 1635 1455 715 11326 ----
NM_175056chr371828 1669 1507 1414 739 588 140 ------
NM_175623chr1297541 7402 6985 5792 5739 5475 3036 1830 833 22550 1416 11393 --
NM_175624chr1297636 7497 7080 5887 5834 5570 3131 1925 928 22645 1511 11488 --
NM_175625chr1297636 7497 7080 5887 5834 5570 3131 1925 928 22645 1511 11488 --
NM_175736chr1266962 6248 4867 2482 390 250 25840 109 ----
NM_175854chr1322685 2191 2723 45 12202 12269
NM_176823chr163488 3413 3091 2670 2428 126 11150 11349 --
NM_177414chr131510 1444 1378 21570 1336 ----
NM_177438chr1443564 3111 2775 340 13925 ----
NM_177969chr2146 ----1691
NM_178140chr552629 1993 1779 811 666 22207 433 ----
NM_178151chrX97176 7072 6939 5795 5461 2669 2654 865 561 27118 5745 1706 --
NM_178152chrX97176 7072 6939 5795 5461 2669 2654 865 561 27118 5745 1706 --
NM_178153chrX97176 7072 6939 5795 5461 2669 2654 865 561 27118 5745 1706 --
NM_178498chr1173944 3507 3184 2540 972 953 544 1354 ----
NM_181265chr442096 824 814 455 --23055 2434 12751
NM_181489chr375176 4581 4505 2138 1471 915 504 26357 4210 16322 11227
NM_181672chrX145 1712 --11566
NM_181673chrX145 1712 --11566
NM_181705chr543534 2168 1287 279 25044 3511 ----
NM_181784chr242291 771 560 521 22370 1898 --12313
NM_181836chr522328 2058 1310 ----
NM_182898chr746244 4890 2395 803 36505 5508 1110 ----
NM_182899chr746244 4890 2395 803 36505 5508 1110 ----
NM_182948chr152908 2563 2422 2291 422 22357 2222 12843 --
NM_182972chr142659 2324 1889 216 11793 12719 --
NM_183004chr1473738 3651 3540 3402 2934 1057 485 2593 61 13970 --
NM_183376chr1532571 2524 1927 ------
NM_183393chr31750 ----195
NM_183394chr31750 ----195
NM_194247chr253248 2859 525 470 248 ------
NM_194285chr1152684 2109 1258 1183 234 ----22932 304
NM_194314chr154885 4410 3655 1274 1124 13490 --11656
NM_194317chr242704 794 734 674 32396 950 857 --12567
NM_194328chr933146 2769 114 2914 149 ----
NM_194329chr933146 2769 114 2914 149 ----
NM_194330chr933146 2769 114 2914 149 ----
NM_194332chr933146 2769 114 2914 149 ----
NM_194434chr1864816 4058 3629 1922 1500 599 24271 984 --11162
NM_197941chr522075 1897 --1134 1415
NM_198066chr1462656 2532 2371 2242 2210 765 33086 2803 225 1550 --
NM_198240chr1251313 1287 969 117 109 11144 ----
NM_198320chr1274929 4055 3202 1762 1627 933 21 14687 ----
NM_198439chr1131132 446 204 ----151
NM_198485chr361880 1700 847 604 364 277 22505 791 ----
NM_198581chr2136524 6334 5717 5581 5133 5089 4628 2352 1975 1739 972 761 422 ------
NM_198900chr1266962 6248 4867 2482 390 250 25840 109 ----
NM_198935chr2052343 2167 2138 1222 378 --1433 --
NM_198968chr1333780 3316 3086 1312 11091 13239
NM_199072chr731971 310 114 42884 2397 1196 157 ----
NM_199421chr1443811 1571 750 653 21901 207 23599 3194 --
NM_201266chr272892 2767 2423 1888 1220 674 473 22926 1955 12873 --
NM_201279chr272892 2767 2423 1888 1220 674 473 22926 1955 12873 --
NM_201435chr122795 98 ----1208
NM_201591chr431766 625 559 1315 ----
NM_201592chr431766 625 559 1315 ----
NM_203329chr1186935 6923 6805 6553 5828 5474 4483 1706 37046 2840 1682 26251 2097 --
NM_203330chr1186935 6923 6805 6553 5828 5474 4483 1706 37046 2840 1682 26251 2097 --
NM_203331chr1186935 6923 6805 6553 5828 5474 4483 1706 37046 2840 1682 26251 2097 --
NM_203394chr1232006 1819 127 1146 ----
NM_203406chr522791 1975 22097 1883 ----
NM_203446chr2152396 2213 1180 1003 584 1612 1242 --
NM_203458chr163132 2596 1357 807 482 73 ------
NM_203487chr1321294 484 ----1513
NM_206594chr132532 2400 91 43165 2716 2274 1080 ----
NM_206595chr132532 2400 91 43165 2716 2274 1080 ----
NM_206876chr221341 208 23525 2555 --11089
NM_206909chr857354 7281 2831 1227 332 48440 5986 5565 671 17632 --
NM_207015chr312204 31926 1740 64 ----
NM_207292chr323096 1215 1124 --1153
NM_207293chr323096 1215 1124 --1153
NM_207294chr323096 1215 1124 --1153
NM_207295chr323096 1215 1124 --1153
NM_207296chr323096 1215 1124 --1153
NM_207297chr323121 1240 1149 --1178
NM_207303chr1063379 3077 2687 1154 609 316 13883 --13289
NM_207361chr13106248 5731 5151 4102 3912 2127 2089 545 533 22 22064 1637 ----
NM_212554chr1011583 21542 285 1151 11102