TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-382-3p
miRNA Sequence: AAUCAUUCACGGACAACACUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000337chr5135642 5391 5142 4358 2362 1897 1575 1550 1491 914 653 640 296 12194 1436 14717
NM_000618chr12104496 2147 1851 1818 1139 904 771 198 28 21 26588 4966 1178 --
NM_000618chr12104496 2147 1851 1818 1139 904 771 198 28 21 26588 4966 1178 --
NM_000809chr4138996 8327 7589 6481 6039 3218 2557 2346 2288 1713 1558 165 33 46285 2468 2456 1664 12670 12733
NM_000813chr5105342 4987 4790 4547 4424 4209 1733 1245 456 220 35316 3800 481 --11973
NM_000912chr873234 3140 2515 2309 1178 449 54 23508 856 13367 12558
NM_001001419chr5104880 4868 4811 4583 4526 4263 3395 1832 1640 525 1574 13695 --
NM_001001420chr5104880 4868 4811 4583 4526 4263 3395 1832 1640 525 1574 13695 --
NM_001001556chr1571233 1180 481 460 451 172 145 11060 --1289
NM_001001664chr233768 3012 793 34061 3120 2512 23696 2691 21260 875
NM_001003407chr10134411 4204 3192 1918 1833 1404 1305 705 572 535 500 476 449 34186 3727 3224 ----
NM_001003408chr10134411 4204 3192 1918 1833 1404 1305 705 572 535 500 476 449 34186 3727 3224 ----
NM_001003652chr18118108 7814 7745 7242 7115 5860 2967 2761 2478 1185 243 37314 6685 2855 22949 2144 --
NM_001004065chr993657 3452 2710 1415 1351 1117 507 358 149 1960 33945 1029 707 11180
NM_001004419chr12124203 3991 1697 1523 1380 1177 1079 1061 781 748 690 669 --33643 3378 2958 --
NM_001005473chr5104669 4645 2381 2216 1370 1311 857 713 598 157 44865 4347 4341 794 ----
NM_001007094chr1093803 3767 3725 3389 2822 1653 1572 1190 224 161 33044 2773 1057 --
NM_001009554chr493777 3546 3116 3040 3004 1562 1013 787 160 11334 23334 121 14313
NM_001009554chr493777 3546 3116 3040 3004 1562 1013 787 160 11334 23334 121 14313
NM_001009899chr3126484 5722 5639 4737 4574 4491 4225 4074 2517 1429 1143 34 --14932 14780
NM_001012423chr1562827 2756 2263 1078 1068 835 ----11936
NM_001013620chr1277674 6172 5987 2507 2375 636 474 27249 568 38154 7619 1345 --
NM_001014797chr10138135 7590 6759 5914 3112 2953 2129 1999 1859 1566 600 323 183 18170 46198 5420 2247 531 --
NM_001018067chr165268 4765 3646 3547 3392 1644 23359 993 23844 1330 --
NM_001018068chr165268 4765 3646 3547 3392 1644 23359 993 23844 1330 --
NM_001018069chr165268 4765 3646 3547 3392 1644 23359 993 23844 1330 --
NM_001024647chr12117628 7530 7002 6323 6299 5401 2266 1875 758 442 92 27613 7251 15845 1764
NM_001025233chr1272204 1876 814 669 401 381 368 12568 1747 1466
NM_001039618chr11105699 3645 2133 2117 1712 1068 952 923 646 569 35493 3953 181 35750 4022 1742 --
NM_001039840chrX135940 5908 5082 4912 4785 4026 3964 2144 1301 1176 665 434 70 24933 114 24127 3842 --
NM_001040152chr794944 4931 4901 3361 3122 1379 1036 76 50 24980 629 --14549
NM_001040284chr16135803 5788 5738 5098 5092 4571 1238 776 663 444 384 148 39 13593 24966 3871 --
NM_001040441chr1105437 5363 4267 3764 3555 3538 3392 1236 236 119 15339 11104 --
NM_001042355chr16105360 4839 1675 1659 1496 1199 777 669 597 117 11131 33309 1720 638 1811
NM_001042412chr16105360 4839 1675 1659 1496 1199 777 669 597 117 11131 33309 1720 638 1811
NM_001042473chr109728 685 676 641 437 289 97 54 43 12159 21618 519 --
NM_001099678chr365415 4490 4373 1691 169 49 26340 901 --3283 215 128
NM_001106chr3119059 8344 6570 3574 3126 2367 2084 1959 1908 883 611 28618 6205 47554 6627 6029 618 --
NM_001304chr1773344 3171 2805 2520 1368 1337 729 13611 11104 11237
NM_001412chrX83646 3009 2805 2756 2466 1500 1350 1029 --33723 3240 1124 --
NM_002025chrX138821 8416 7648 7513 3708 3325 3155 2843 2606 2509 2292 322 272 79228 7722 6348 3683 2007 1036 674 16594 16843
NM_002044chr1571233 1180 481 460 451 172 145 11060 --1289
NM_002182chr362607 2483 1968 947 814 103 ----21765 542
NM_002270chr5104826 4193 1789 1554 1356 1252 947 805 425 365 ----12019
NM_002310chr596389 5971 5387 5137 4263 2162 1695 1591 610 16334 24664 1305 --
NM_002313chr10134411 4204 3192 1918 1833 1404 1305 705 572 535 500 476 449 34186 3727 3224 ----
NM_002356chr662617 1797 1788 1053 706 484 1418 21802 952 --
NM_002481chr177447 6062 5707 2240 1303 1053 929 42631 1896 1788 737 37870 5180 505 16540
NM_002886chr3104577 4260 4216 4019 1972 1948 1629 1524 391 364 --13976 1815
NM_003034chr12118153 5895 5819 5529 5197 2065 1976 1413 1365 1003 823 16747 25829 74 --
NM_003108chr2106974 6027 5512 5350 4695 4579 1682 1479 1239 77 2159 87 14613 --
NM_003392chr3114251 4090 4046 3984 3023 2844 1488 1395 797 275 63 1558 24155 3949 --
NM_003421chr1093803 3767 3725 3389 2822 1653 1572 1190 224 161 33044 2773 1057 --
NM_003566chr1253356 3024 1184 826 612 11096 22894 2120 22959 395
NM_003615chr362700 2512 1489 1470 1385 801 53843 2748 576 458 338 12727 12817
NM_004136chr1562858 2850 2844 2086 1277 131 --1191 13037
NM_004171chr11138481 8310 8277 8110 7518 7224 6464 6167 1781 1406 678 239 160 21232 63 28918 7326 --
NM_004232chr1883775 3577 3280 2978 838 416 391 376 12395 ----
NM_004392chr1361938 1797 986 460 452 335 12494 1510 --
NM_004586chrX105060 4754 4420 4262 4093 3556 2014 1749 1445 172 --11258 14172
NM_004612chr9104687 4388 4313 3590 3434 2985 1853 1766 391 281 33995 3416 3114 14276 14154
NM_004999chr6103755 3538 3447 1453 1432 1287 1223 855 558 432 22969 2772 --11650
NM_005160chr22146392 6374 6362 6288 5402 5327 2626 1737 1051 987 706 623 318 71 45468 4900 2165 511 12476 11057
NM_005359chr18156266 6102 5979 5884 4962 4236 4041 2314 2039 2003 1990 1699 1382 1179 721 35800 1674 1563 ----
NM_005504chr12106263 5161 4741 4544 4534 4015 1486 730 274 186 25269 4906 1142 25311 1890
NM_005840chrX97468 6676 6654 6146 5319 2871 2239 2205 142 12225 16307 190
NM_005901chr18118108 7814 7745 7242 7115 5860 2967 2761 2478 1185 243 37314 6685 2855 22949 2144 --
NM_005903chr5104880 4868 4811 4583 4526 4263 3395 1832 1640 525 1574 13695 --
NM_005909chr573768 3216 3127 1642 394 353 343 43633 1584 1548 1457 24106 3402 --
NM_006252chr1106742 6456 6277 5694 4634 2937 2599 2214 2033 1936 37414 1811 839 17032 --
NM_006720chr10134411 4204 3192 1918 1833 1404 1305 705 572 535 500 476 449 34186 3727 3224 ----
NM_006729chrX155621 5494 2248 2212 2179 2064 1572 1548 1378 1210 830 713 276 132 48 --11918 --
NM_006731chr985561 3702 1538 1514 1119 505 491 224 45683 4181 1633 523 15829 11342
NM_006750chr16127564 7416 7256 7125 7117 5222 3014 2828 2299 2183 2061 291 77702 7464 6746 5681 5055 2893 1394 25371 2395 --
NM_007038chr2195064 4770 4559 4120 3959 3868 2249 2226 1336 45816 2398 1453 337 11323 --
NM_007050chr20167332 6890 6828 6400 6277 5520 5255 5037 4943 3224 3105 2905 1973 1751 1278 68 46190 5788 5294 3015 ----
NM_007203chr993657 3452 2710 1415 1351 1117 507 358 149 1960 33945 1029 707 11180
NM_007249chr13129361 9240 9121 8863 7700 7047 5799 3514 2510 2000 1492 388 47824 7110 6778 2107 19185 13718
NM_012214chr296058 4697 3909 1908 1665 1451 1247 1219 1090 11173 26238 4814 --
NM_012262chr195007 4630 3469 3391 3284 3241 1910 1180 580 25274 1735 13961 --
NM_013255chr7168240 7800 7722 6545 3438 3062 3007 2306 1762 1599 1457 1357 1212 1044 477 94 1706 38801 3218 1114 --
NM_013269chr12124130 3918 1624 1450 1307 1104 1006 988 708 675 617 596 --33570 3305 2885 --
NM_014043chr381498 1394 1240 479 428 179 172 122 --1228 --
NM_014112chr873560 2152 1524 788 447 207 191 34871 1886 1754 15281 --
NM_014155chr11127027 5987 5923 4949 4805 2752 2073 1485 1267 954 932 604 26435 2932 12635 --
NM_014157chr1693786 3538 3088 3081 2986 2601 806 494 223 --33851 3385 3093 --
NM_014331chr4167419 7156 6725 6690 6673 6657 5890 5372 3122 2565 2482 2078 1960 1825 1782 1015 --27198 3000 16819
NM_014363chr1321125 329 11091 21006 239 1249
NM_014423chr5135381 4362 3912 3890 3427 3411 2143 2071 2041 1718 1191 1124 100 14604 24983 924 --
NM_014787chr192771 2748 1011 979 659 652 616 597 403 21890 1844 --1584
NM_014838chr2292805 2715 2606 2511 2434 1112 1041 1021 314 12870 --11819
NM_014873chr194704 4414 3988 3483 3417 3139 2983 1051 992 13328 24788 1931 --
NM_014877chr17126702 6004 5320 5217 2318 2059 2003 1809 1653 1446 1427 1240 27493 2849 --13068
NM_014906chr17113970 3961 3683 3409 3315 2555 1618 1042 980 968 844 23700 2523 14057 --
NM_014912chr1063566 3524 2284 1206 1080 1059 22225 707 --1215
NM_015026chr12124305 4225 4031 3907 3720 3645 3397 1893 1395 1003 323 191 24064 514 ----
NM_015035chr20146440 6225 5822 4790 4660 2595 2582 2546 2540 1916 1549 1326 877 596 26694 1373 25243 1924 14896
NM_015192chr2072141 2107 1904 875 818 800 602 22388 991 12044 --
NM_015247chr16105360 4839 1675 1659 1496 1199 777 669 597 117 11131 33309 1720 638 1811
NM_015310chr898333 7347 7291 5610 1385 1285 1120 257 193 --15853 12202
NM_015560chr362805 2656 2526 2070 805 178 22213 1829 12742 12453
NM_015640chr165268 4765 3646 3547 3392 1644 23359 993 23844 1330 --
NM_015886chr8125636 5317 5242 4706 3898 3553 1818 1150 969 831 242 31 41773 556 531 422 ----
NM_015906chr1124243 4176 3979 3564 3304 3227 1073 668 598 308 274 245 22976 688 11332 --
NM_016260chr275160 4733 2959 2407 2222 1957 1296 31902 518 415 16193 11604
NM_017644chr394633 4449 4288 4182 3188 3143 1448 715 214 22032 1813 31684 1582 320 --
NM_017650chr775611 4944 4657 4251 3830 80 22 198 34159 2135 1114 24559 1967
NM_017658chr14144071 3522 3486 3275 1873 1361 1135 1099 1063 925 705 575 419 386 13308 --14330
NM_017769chr1473041 2920 2871 2491 2271 1109 269 12087 1947 11063
NM_017919chr985529 4261 4158 3707 3658 1876 1190 553 25584 3675 25248 1229 --
NM_018293chr392775 2705 1199 1091 917 613 587 249 154 1863 --12725
NM_018362chr1183985 3606 2619 2552 1489 1470 1337 85 --23693 3382 --
NM_018440chr8138367 8194 6806 6658 5971 5512 5377 5350 2661 1970 1861 1506 1155 48495 8245 1396 1283 36524 5851 2164 --
NM_020133chr6126360 6276 6226 6164 5969 5421 5259 4352 2058 1361 843 245 --16059 16366
NM_020337chr461985 1161 1074 1061 1049 581 12604 --12332
NM_020466chr6103218 3179 1938 1671 1388 979 908 715 622 564 24449 1719 14430 11712
NM_020699chr195133 3964 1998 1966 1620 1401 704 367 288 1495 15444 24183 1346
NM_020766chrX104515 4410 4252 3960 3064 785 721 473 440 83 24474 2974 12880 --
NM_020772chr17148529 8323 8258 6633 6322 6016 5799 5648 5529 5439 3317 3217 1590 311 1440 1467 --
NM_020774chr18115938 5404 4877 4609 1791 1199 1125 1030 956 591 167 25297 4113 1516 --
NM_020844chr8147663 7416 7319 6412 5858 2427 2388 1894 1758 1734 1643 1155 1127 539 26508 3015 11941 --
NM_021163chr793302 3250 3197 2944 1498 1431 1184 568 231 31285 670 541 ----
NM_021645chr1382350 2124 1655 1620 791 258 235 145 1545 --12064
NM_021647chr493777 3546 3116 3040 3004 1562 1013 787 160 11334 23334 121 14313
NM_021911chr5105342 4987 4790 4547 4424 4209 1733 1245 456 220 35316 3800 481 --11973
NM_021964chr356461 5679 4830 4043 432 22392 2280 46584 6574 1434 1273 26031 529
NM_022456chr12117628 7530 7002 6323 6299 5401 2266 1875 758 442 92 27613 7251 15845 1764
NM_022459chr13126347 6341 5974 5968 5933 5616 5556 4920 4631 4514 4017 623 25790 1855 25653 236 --
NM_022716chr173183 3085 2463 2106 2026 1082 883 12637 42266 1972 801 395 --
NM_024524chr363240 2070 1029 876 565 86 33085 2413 280 --13131
NM_024947chr3209029 9016 8809 8287 8009 7876 7536 7032 6716 6381 6372 6139 5914 3749 3193 2257 1513 1341 942 348 38641 5841 3209 13719 1903
NM_024989chr2107878 6644 5772 5280 3275 3259 2608 2278 1365 1332 36789 1705 52 --1584
NM_030648chr495472 4408 4112 2002 1799 1545 1309 507 304 34995 4940 4376 12128 12147
NM_030816chr183584 3539 3226 2714 2542 2359 808 577 33298 1141 588 ----
NM_032160chr1893711 3267 3168 1560 1231 1086 1036 594 533 33465 2985 517 --11413
NM_032859chr1343078 2870 1182 101 13855 22555 2488 150
NM_033020chr1124243 4176 3979 3564 3304 3227 1073 668 598 308 274 245 22976 688 11332 --
NM_033224chr7158114 7318 6830 6639 5983 5504 5267 3075 1598 1517 1345 1296 1290 961 659 17599 23161 1301 --
NM_033505chr2106371 6129 5270 1857 1658 1283 1266 662 477 256 25481 549 35597 4630 2113 1132
NM_052879chr1283824 3641 3184 3064 2967 1649 582 381 33021 2768 2746 --1151
NM_053016chr9137181 5457 5330 2948 2716 2503 2458 2409 2285 2172 975 276 247 32765 2292 299 17783 15999
NM_080743chr632441 2311 1696 --1682 22097 769
NM_080759chr1361938 1797 986 460 452 335 12494 1510 --
NM_080760chr1361938 1797 986 460 452 335 12494 1510 --
NM_130831chr362805 2656 2526 2070 805 178 22213 1829 12742 12453
NM_130832chr362805 2656 2526 2070 805 178 22213 1829 12742 12453
NM_130833chr362805 2656 2526 2070 805 178 22213 1829 12742 12453
NM_130834chr362805 2656 2526 2070 805 178 22213 1829 12742 12453
NM_130835chr362805 2656 2526 2070 805 178 22213 1829 12742 12453
NM_130836chr362805 2656 2526 2070 805 178 22213 1829 12742 12453
NM_130837chr362805 2656 2526 2070 805 178 22213 1829 12742 12453
NM_133170chr20167332 6890 6828 6400 6277 5520 5255 5037 4943 3224 3105 2905 1973 1751 1278 68 46190 5788 5294 3015 ----
NM_133646chr2104693 4574 4287 4052 4044 1957 1695 1606 734 475 13490 34684 3646 1928 14750
NM_144571chr486278 5761 5578 2731 1651 1503 819 76 25179 1837 31763 418 347 14627
NM_145259chr2136123 5107 4769 4700 4555 4495 2203 1996 1749 1505 1427 1221 345 46893 4502 2636 1470 35811 4603 2720 26778 2341
NM_145698chr109728 685 676 641 437 289 97 54 43 12159 21618 519 --
NM_147150chr993657 3452 2710 1415 1351 1117 507 358 149 1960 33945 1029 707 11180
NM_152446chr14--1625 1202 2249 169
NM_152624chr5126808 5786 5522 5383 5026 4966 4715 2843 2645 2002 1782 361 22778 2407 34635 2757 987 --
NM_152835chr172907 2802 2049 1945 692 226 54 22336 2182 --131
NM_152903chr13102880 2404 2363 2342 2160 2132 790 782 432 363 11942 11883 --
NM_152996chr141308 110 83 68 32027 1780 93 31721 740 440 --
NM_153188chr5104826 4193 1789 1554 1356 1252 947 805 425 365 ----12019
NM_153456chr1375342 5112 4469 4096 2255 1413 818 16278 15149 1824
NM_153619chr1563145 2870 2760 974 679 659 33511 3243 2770 21296 173 12551
NM_173582chr1196122 5867 5361 4732 4414 1716 1708 201 186 24940 447 ----
NM_173642chr198876 7850 7561 6479 3357 2281 2118 143 61 12638 48249 7351 6286 3548 15801
NM_173808chr1114062 3477 3364 3015 2922 2875 2827 2807 1392 1005 549 13561 2706 121 --
NM_173829chr585117 4376 2184 2159 739 598 553 394 34410 1992 818 46230 4778 2081 581 --
NM_175623chr12117628 7530 7002 6323 6299 5401 2266 1875 758 442 92 27613 7251 15845 1764
NM_175624chr12117723 7625 7097 6418 6394 5496 2361 1970 853 537 187 27708 7346 15940 1859
NM_175625chr12117723 7625 7097 6418 6394 5496 2361 1970 853 537 187 27708 7346 15940 1859
NM_175861chr12125932 5795 5646 4573 4180 4081 2139 2076 1743 494 402 235 25549 4704 157 --
NM_177538chr2128878 7292 6492 3461 3363 3284 3197 3082 2955 1780 1428 756 12335 13540 12501
NM_181077chr1572212 2141 1614 1572 1489 838 712 ----21955 607
NM_182734chr2072388 2354 2151 1122 1065 1047 849 22635 1238 12291 --
NM_194318chr1382424 1928 1902 986 649 484 245 39 22291 310 11819 1456
NM_198581chr2116646 5702 5374 4940 4895 2804 2553 1352 887 806 327 26755 6338 26209 2689 16874
NM_199188chr1283824 3641 3184 3064 2967 1649 582 381 33021 2768 2746 --1151
NM_199190chr1283824 3641 3184 3064 2967 1649 582 381 33021 2768 2746 --1151
NM_206855chr655764 5205 4289 977 48 45536 4157 2414 579 --25866 3907
NM_206909chr898333 7347 7291 5610 1385 1285 1120 257 193 --15853 12202
NM_207303chr10113990 3688 3469 3103 2658 2596 899 875 796 601 429 12816 21622 366 --