TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-382-5p
miRNA Sequence: GAAGUUGUUCGUGGUGGAUUCG

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr541333 551 278 46 11997 11867 --
NM_000046chr5103115 2783 2528 2308 2138 1928 315 273 260 63 --13095 --
NM_000052chrX62969 2402 677 670 272 31 --12223 13217
NM_000067chr81186 ----1656
NM_000081chr131877 1691 1303 --11245 --
NM_000084chrX95894 4994 4883 4269 2534 1553 1326 1074 823 1293 ----
NM_000088chr1721194 43 --31263 261 115 --
NM_000090chr23899 228 189 ------
NM_000091chr292584 2523 2428 2371 2213 2178 814 230 133 32738 2707 2659 21160 808 12500
NM_000092chr2104511 4283 3985 3941 3695 3420 3277 2985 1266 365 21719 1366 24239 1011 11206
NM_000109chrX31063 900 99 --31992 927 332 --
NM_000112chr554749 4510 4041 899 478 54986 4947 4655 3823 1434 21278 956 --
NM_000115chr1382666 2561 2429 2278 2203 2148 1873 151 1435 3867 462 273 --
NM_000125chr6144181 3766 2946 2590 1583 1500 1293 1279 1266 861 649 317 284 228 --14268 --
NM_000129chr631432 1385 1010 11477 ----
NM_000138chr1542670 2547 2383 1980 --12243 1474
NM_000139chr1162809 2700 2627 2022 870 290 12436 22206 486 12483
NM_000153chr1431698 1333 361 --11665 --
NM_000163chr52739 637 21928 850 ----
NM_000176chr573822 2825 2632 1392 1066 915 600 --33527 1025 529 --
NM_000192chr1221032 451 --1184 --
NM_000208chr1974648 4622 4607 3283 3081 1774 91 23424 172 24499 1861 --
NM_000210chr22420 250 ------
NM_000216chrX53567 3339 1642 1400 369 11466 23402 463 --
NM_000217chr1255313 3380 1705 1261 355 --24104 1078 1886
NM_000232chr493211 3181 2615 2137 665 646 640 594 89 ------
NM_000237chr841918 1185 554 70 21615 197 ----
NM_000240chrX61772 903 828 745 624 154 --1302 --
NM_000248chr363048 2356 2088 1021 618 192 --22409 1099 166
NM_000259chr15106189 5251 4410 4404 2538 2451 2432 2288 1454 712 25505 5103 36066 1799 363 --
NM_000264chr942561 2405 873 498 --12974 --
NM_000266chrX4395 288 108 37 --1218 --
NM_000267chr1763207 2811 2739 1317 250 197 21389 33 13024 13280
NM_000268chr22------13761
NM_000280chr113936 655 128 ------
NM_000282chr13168 134 ----
NM_000286chr171106 ------
NM_000297chr411747 ------
NM_000301chr62222 79 ------
NM_000304chr173810 726 369 --1750 --
NM_000314chr1062809 2192 2121 2036 1105 121 12606 22165 910 1983
NM_000318chr872624 885 852 771 438 392 225 --1251 --
NM_000321chr1331774 1253 465 21348 1328 174 --
NM_000328chrX1130 --2390 315 167
NM_000329chr14232 109 80 51 --1126 --
NM_000332chr6135946 5929 5884 5853 5511 4641 2556 2081 1839 1031 709 635 539 --36099 4938 1553 --
NM_000337chr596163 5705 5459 5231 4705 2519 770 686 530 15681 ----
NM_000340chr361301 1294 1050 487 464 336 ------
NM_000346chr1741791 692 536 170 11835 ----
NM_000351chrX84246 2934 2881 1221 1186 494 160 89 ------
NM_000361chr2071637 1533 1408 436 231 93 60 --12036 --
NM_000368chr994556 3206 1772 1115 1095 889 391 141 27 1964 ----
NM_000378chr1121155 122 1943 ----
NM_000390chrX52559 2255 997 803 30 13006 1327 --
NM_000393chr231467 673 509 1312 22104 1503 --
NM_000405chr541785 1433 1180 487 --11715 --
NM_000408chr293483 3463 3084 2658 2203 1055 838 534 163 12643 33277 2881 2286 --
NM_000421chr17125 --1306 --
NM_000428chr1452392 1973 1785 398 24 21677 147 ----
NM_000430chr1743205 2381 682 499 --13656 --
NM_000439chr531637 628 183 --1864 --
NM_000450chr141632 1358 407 73 11482 --31786 592 489
NM_000459chr92315 299 ------
NM_000480chr1161525 1262 1240 434 41 28 ------
NM_000484chr2131073 952 133 --1781 --
NM_000489chrX62924 2390 2368 1022 404 279 --22667 1312 --
NM_000493chr611081 --2721 455 --
NM_000495chrX4921 885 771 87 ------
NM_000503chr851698 1595 187 102 30 --31746 518 344 --
NM_000516chr20141 ------
NM_000518chr11124 ------
NM_000522chr74883 277 176 29 ------
NM_000533chrX41928 1516 1279 773 ------
NM_000549chr1121 ------
NM_000555chrX157177 7053 6837 6637 6603 4903 3100 2841 2613 2598 2545 1762 1463 1276 724 ----1585
NM_000575chr221122 978 --1244 --
NM_000589chr5160 ------
NM_000596chr71398 --2214 136 --
NM_000599chr2114333 4303 4047 3252 1790 1189 1048 887 590 405 171 14571 ----
NM_000601chr72106 38 ----1403
NM_000609chr1033068 2137 679 1230 23087 1153 --
NM_000610chr1132152 1859 176 --12384 --
NM_000612chr1133383 1485 471 ------
NM_000615chr1172759 2347 884 710 646 626 51 --1860 --
NM_000617chr1252265 2118 1598 809 636 ------
NM_000618chr1261599 1546 1517 800 695 440 26180 5061 ----
NM_000618chr1261599 1546 1517 800 695 440 26180 5061 ----
NM_000663chr1643079 1912 916 319 --11014 --
NM_000673chr43817 726 330 --1582 --
NM_000681chr101316 --11081 11294
NM_000719chr1244573 4397 1915 1434 24587 4059 16476 --
NM_000724chr1061894 1818 1734 1395 1263 51 11838 21380 1342 --
NM_000726chr251157 899 497 273 76 1359 138 --
NM_000789chr171235 ------
NM_000793chr1494863 4209 3974 3336 3166 1957 1734 535 146 13247 35121 3729 1091 --
NM_000794chr52720 138 1962 1317 --
NM_000807chr42640 80 ----1714
NM_000810chr151168 --1213 --
NM_000813chr5104240 3993 3881 2246 2233 1945 1871 1504 1173 1081 14486 13942 14437
NM_000814chr1563695 3585 3136 2984 1166 790 11452 --1279
NM_000816chr51448 ----1558
NM_000817chr251174 1053 1039 370 359 ------
NM_000824chr43929 911 270 ------
NM_000826chr452523 2397 2309 632 380 --12495 --
NM_000827chr552325 1779 1706 685 374 ------
NM_000828chrX21985 1636 11729 1724 --
NM_000829chr1142232 2059 624 220 ------
NM_000833chr1641261 955 540 245 ------
NM_000838chr672716 848 659 342 288 270 72 --21809 1075 12473
NM_000845chr72471 377 ------
NM_000860chr431332 1294 1195 --11542 --
NM_000868chrX--1214 ----
NM_000875chr1556813 6542 6228 1871 201 --32818 1221 148 --
NM_000876chr631418 519 402 --11446 --
NM_000879chr52363 111 2276 249 ----
NM_000880chr81773 --2752 657 --
NM_000882chr3--1366 1336 1310
NM_000891chr1733343 2744 929 12373 1807 --
NM_000899chr12103977 3924 3753 3108 1618 1317 945 564 438 78 33658 3587 1444 1459 --
NM_000901chr452316 2269 2188 2042 280 22504 2086 ----
NM_000902chr373112 2299 2153 1162 1153 683 671 22165 822 ----
NM_000917chr103151 89 73 ------
NM_000926chr11199358 9112 8490 8182 7939 7906 7691 6735 6217 5994 5715 3022 2790 1919 1771 1599 1217 586 311 22971 336 22311 489 --
NM_000933chr2041802 1440 384 310 --21168 159 1256
NM_000935chr321064 472 --1119 1278
NM_000945chr241698 673 621 185 11594 1495 --
NM_000949chr52811 584 ------
NM_000950chrX53506 3487 2711 495 343 --1605 --
NM_000959chr1113597 2990 2847 2745 1328 1123 1093 787 688 252 173 23242 3162 ----
NM_000963chr122261 680 22466 274 12284 12113
NM_000965chr331027 470 200 1174 ----
NM_000983chr131228 505 158 ------
NM_001001323chr1232031 1087 795 --154 1898
NM_001001330chr1061206 1143 895 826 163 51 ------
NM_001001344chrX42088 1986 1625 118 12575 ----
NM_001001389chr1132152 1859 176 --12384 --
NM_001001390chr1132152 1859 176 --12384 --
NM_001001391chr1132152 1859 176 --12384 --
NM_001001392chr1132198 1905 222 --12430 --
NM_001001395chr1282554 2467 2241 2105 1951 900 656 458 --2988 735 --
NM_001001396chr163954 3693 3050 1502 762 254 34251 1648 466 21552 54 --
NM_001001419chr5105190 4558 4444 4393 4318 4041 3819 2027 696 463 53641 1153 1061 969 445 1298 1108
NM_001001420chr5105190 4558 4444 4393 4318 4041 3819 2027 696 463 53641 1153 1061 969 445 1298 1108
NM_001001433chr2021264 1234 23157 554 1661 --
NM_001001481chr853128 1362 1283 892 189 --13414 --
NM_001001484chr1051961 1945 1732 524 167 21905 217 --1782
NM_001001549chr732339 1949 356 --12034 --
NM_001001550chr732339 1949 356 --12034 --
NM_001001555chr732339 1949 356 --12034 --
NM_001001556chr153509 503 349 ----1249
NM_001001664chr2103601 3100 1570 1124 962 933 858 668 332 176 33918 3535 3144 ----
NM_001001665chr253253 3063 1187 428 232 1435 ----
NM_001001872chr141244 --1420 --
NM_001001890chr21123724 3705 3577 2656 1654 1573 1373 1106 711 649 458 388 23187 1337 23566 718 --
NM_001001974chr1042030 1763 830 645 --21996 353 1325
NM_001001994chrX190 --1480 --
NM_001001995chrX91316 1238 756 730 691 626 480 59 38 ------
NM_001001996chrX190 --1480 --
NM_001002233chr862102 2068 749 641 536 174 ------
NM_001002255chr6182 ------
NM_001002257chr243508 3155 2919 2701 --2236 169 --
NM_001002295chr102834 58 ----1288
NM_001002759chr10------143
NM_001002860chr1443755 3185 221 100 11150 --169
NM_001002909chr1772211 2139 1965 1894 1734 568 213 --11413 --
NM_001003652chr18158587 8453 8261 7059 6472 6183 5962 5534 5415 5270 3198 2511 1815 596 44 25756 5524 ----
NM_001003665chr152612 1111 910 553 60 22187 1057 ----
NM_001003674chr18106779 5440 5085 4844 4273 2813 2479 1541 1441 990 26111 750 25339 1626 11157
NM_001003675chr18106779 5440 5085 4844 4273 2813 2479 1541 1441 990 26111 750 25339 1626 11157
NM_001003681chr2241726 487 348 297 ------
NM_001003694chr3--1663 ----
NM_001003712chr12114051 3999 3353 3303 3096 2761 2712 1267 1156 1133 285 ------
NM_001003792chr32990 856 --11121 1205
NM_001003793chr32990 856 --11121 1205
NM_001003800chr943616 2575 1306 644 --13446 --
NM_001003805chr14185 ------
NM_001003810chr43555 237 55 ------
NM_001003894chrY----198 --
NM_001003895chrY137 ------
NM_001003940chr1543383 1229 1181 517 --23874 1359 --
NM_001003942chr1543383 1229 1181 517 --23874 1359 --
NM_001003943chr1543387 1233 1185 521 --23878 1363 --
NM_001004019chr3--1108 194 --
NM_001004051chrX1119 194 ----
NM_001004065chr9113776 3131 2905 2671 2556 1513 984 819 601 588 65 --1880 --
NM_001004317chr6124179 4074 3093 2769 1747 1741 1258 905 848 701 651 481 12891 13429 --
NM_001004329chr1231022 420 244 --1105 --
NM_001004342chr1135946 5786 5494 5144 4414 2222 2125 2013 1544 1357 1245 945 192 --15067 --
NM_001004346chr471282 1264 971 887 309 231 207 ----11062
NM_001004360chr221670 1384 31723 1363 102 --11546
NM_001004419chr1264522 3322 1839 815 202 126 --23461 1450 13923
NM_001005366chr123922 641 382 ------
NM_001005369chr2125 ------
NM_001005375chrY21138 732 --2446 208 --
NM_001005386chr242389 1660 980 493 ------
NM_001005404chr1721814 1114 14046 13973 23490 473
NM_001005463chr1082430 1940 1753 1682 767 636 584 203 1614 --12215
NM_001005473chr5155799 5398 5174 4768 4601 2624 2105 1725 1614 1503 1114 834 697 420 255 --11460 14276
NM_001005609chrX63136 2971 2423 1037 752 634 12772 --12397
NM_001005611chrX3495 395 386 157 1423 --
NM_001005746chr251157 899 497 273 76 1359 138 --
NM_001005747chr251157 899 497 273 76 1359 138 --
NM_001005785chrY21138 732 --2446 208 --
NM_001005786chrY21138 732 --2446 208 --
NM_001005849chr17179 --2471 463 --
NM_001005861chr31811 ------
NM_001006600chr532230 1819 1563 --11975 --
NM_001006605chr1----31111 818 55 --
NM_001006605chr1----31111 818 55 --
NM_001006618chr91251 ------
NM_001006623chr242102 2066 964 45 11959 11576 --
NM_001006635chr22268 31 ------
NM_001006657chr262887 2388 1011 436 177 24 ----1687
NM_001006945chr11572 --1134 --
NM_001007023chr1494863 4209 3974 3336 3166 1957 1734 535 146 13247 35121 3729 1091 --
NM_001007097chr954161 972 832 822 780 24282 1518 13964 --
NM_001007099chr11212 1728 1898 --
NM_001007100chr11212 1728 1898 --
NM_001007102chr621085 78 1422 1527 --
NM_001007257chr121492 957 21109 59 11309 --
NM_001007277chr1111099 --11084 --
NM_001007466chr654538 4527 4426 4291 3873 --1375 --
NM_001007559chr1832026 1937 258 --1319 --
NM_001007794chr13683 638 629 --1117 --
NM_001008239chr18123659 3443 3103 2827 2640 2625 2536 2500 2380 954 681 89 23109 2969 1256 --
NM_001008388chr42728 83 198 ----
NM_001008392chr333348 3015 169 --1512 --
NM_001008393chr442416 446 395 254 --11101 --
NM_001008405chr731300 468 223 --11266 11241
NM_001008408chr766287 5823 5270 4559 4402 1865 11961 ----
NM_001008491chr252035 1964 1872 1629 340 --21772 647 --
NM_001008492chr252035 1964 1872 1629 340 --21772 647 --
NM_001008540chr2----140 --
NM_001008541chr1042330 1935 910 633 --1241 11541
NM_001008541chr1042330 1935 910 633 --1241 11541
NM_001008564chr1342055 1624 1436 394 --1832 --
NM_001008657chr52857 805 ------
NM_001008660chr1151571 1354 564 485 474 ------
NM_001008701chr1972997 2914 2473 2249 1115 716 385 ------
NM_001008738chr542969 1016 464 332 11002 ----
NM_001008801chr1931824 566 37 ------
NM_001008925chr483158 3044 2545 2353 1413 1310 974 689 12463 22841 2711 --
NM_001009552chr81397 1444 1182 --
NM_001009554chr464773 4245 3737 3372 2941 1750 --13084 --
NM_001009554chr464773 4245 3737 3372 2941 1750 --13084 --
NM_001009567chr101643 ------
NM_001009569chr103628 369 129 --1300 --
NM_001009894chr1261711 1485 1415 1166 461 258 1327 --1285
NM_001009899chr3105756 5684 5591 5362 4192 2433 1931 1860 697 396 --24770 454 1353
NM_001009909chr11133652 3512 3240 3207 3002 2897 2827 2458 653 557 529 121 99 11482 1111 --
NM_001009931chr1--239 23 1237 --
NM_001009955chr11165 ------
NM_001009955chr11165 ------
NM_001009959chr21932 21764 1684 41756 1676 833 822 12607
NM_001009993chr273537 3322 1137 629 227 130 59 --1397 --
NM_001010000chr1893496 2850 2356 2205 2197 1359 1188 875 295 1905 12266 --
NM_001010853chr642964 2589 2566 1289 --12034 --
NM_001010854chr141636 --1495 --
NM_001010861chr132533 722 658 ----12605
NM_001010888chrX63591 3467 3117 2972 1821 1199 1768 12941 --
NM_001010891chr5126732 6125 6021 5752 5674 4294 4200 2047 1374 1063 520 326 35207 384 376 26336 5770 11881
NM_001010895chr941952 289 250 71 ------
NM_001010927chr61503 ------
NM_001010932chr72106 38 ----1403
NM_001010942chr1241211 1158 532 76 --1439 11222
NM_001010971chr11734 ------
NM_001010980chr183405 2452 2191 1320 865 541 463 81 --1501 --
NM_001010984chr131608 728 212 ------
NM_001010986chrX92488 2384 2286 1811 991 950 463 242 24 1588 12046 --
NM_001011513chr463670 3568 3379 2910 251 135 ------
NM_001011515chr431129 1112 65 11045 2742 134 --
NM_001011516chr431129 1112 65 11045 2742 134 --
NM_001011537chr332065 894 114 12208 1579 --
NM_001011663chr10----1159 1115
NM_001011666chr7116174 5594 5513 5244 4867 4463 2380 2331 2038 788 209 25645 4634 44431 4406 1661 352 12063
NM_001011708chr2--22927 2594 32627 205 33 --
NM_001011713chr143557 63 23 ----11643
NM_001011885chr1541791 1739 1214 669 11408 2447 401 --
NM_001012267chr961968 1949 1934 1921 172 55 1567 ----
NM_001012270chr1741949 1433 1242 546 --1233 --
NM_001012271chr1742052 1536 1345 649 --1336 --
NM_001012279chr61149 --1246 --
NM_001012337chr3298 86 ------
NM_001012393chr1194926 3679 3626 3466 1630 1580 1075 168 82 14439 1396 --
NM_001012398chr1621109 922 1943 ----
NM_001012419chr921298 246 1276 ----
NM_001012420chr1572672 2378 2371 2086 232 219 78 12841 --12284
NM_001012423chr1572672 2378 2371 2086 232 219 78 12841 --12284
NM_001012751chr1031703 250 213 1192 ----
NM_001012755chrX84222 4096 3786 3694 3382 1976 397 26 --24872 919 24180 3987
NM_001013031chr1043057 1299 1000 693 13140 11286 --
NM_001013399chr631157 709 437 ----11071
NM_001013406chr731617 1401 1253 --1654 --
NM_001013415chr451370 1237 388 255 193 ----11594
NM_001013438chr31875 ------
NM_001013439chr31721 ------
NM_001013620chr12158087 7778 7700 6978 6762 6601 6441 6044 5525 2661 2238 2126 1968 424 65 28437 7182 46790 5217 1728 801 17125
NM_001013635chr122851 105 ----1397
NM_001013690chr1231688 1632 828 ------
NM_001013699chr121363 1452 ----
NM_001013746chr73474 265 96 12211 21920 163 11701
NM_001013843chr153210 183 149 ------
NM_001014797chr10108173 5971 5564 3058 1503 1467 1024 836 547 93 25961 1487 38207 2097 584 11264
NM_001014812chr151406 2451 85 ----
NM_001014831chr191806 ------
NM_001014832chr191806 ------
NM_001014834chr191806 ------
NM_001014835chr191806 ------
NM_001015877chrX52694 1089 596 98 50 --11193 --
NM_001015880chr1021697 432 --11409 --
NM_001015882chr93718 195 55 ------
NM_001017371chr23502 442 120 ------
NM_001017395chr343302 3286 2965 434 170 ----
NM_001017424chr121865 357 --1413 11355
NM_001017425chr121865 357 --1413 11355
NM_001017440chr7147867 7580 6168 5747 5210 5163 5154 1623 1189 1147 741 287 173 155 38107 8095 5068 37045 6806 2057 --
NM_001017923chr142548 297 11076 --1497
NM_001017926chr831718 1459 1421 1243 2561 227 --
NM_001017962chr103151 89 73 ------
NM_001017977chr1189 ------
NM_001017992chr531176 569 317 1258 11525 --
NM_001017995chr594768 3691 3459 3165 3156 1212 769 435 94 13353 13200 --
NM_001018004chr151653 182 ----
NM_001018006chr151653 182 ----
NM_001018007chr151653 182 ----
NM_001018020chr151653 182 ----
NM_001018054chr131349 1029 1020 ------
NM_001018064chr952047 1735 1297 747 414 ------
NM_001018067chr195299 4941 4123 3449 3336 2127 2104 707 81 1535 21935 1113 --
NM_001018068chr195299 4941 4123 3449 3336 2127 2104 707 81 1535 21935 1113 --
NM_001018069chr195299 4941 4123 3449 3336 2127 2104 707 81 1535 21935 1113 --
NM_001018074chr573822 2825 2632 1392 1066 915 600 --33527 1025 529 --
NM_001018075chr573822 2825 2632 1392 1066 915 600 --33527 1025 529 --
NM_001018076chr573822 2825 2632 1392 1066 915 600 --33527 1025 529 --
NM_001018077chr573822 2825 2632 1392 1066 915 600 --33527 1025 529 --
NM_001018090chr1542661 2503 2090 309 11051 11129 12617
NM_001018091chr1542771 2613 2200 419 11161 --12727
NM_001018102chr1542661 2503 2090 309 11051 11129 12617
NM_001018115chr32643 455 ------
NM_001020825chr531297 300 107 --11002 --
NM_001023560chr67916 863 767 751 400 258 165 --11022 --
NM_001023567chr1522484 78 --11610 --
NM_001023587chr311057 ----1767
NM_001024094chr573822 2825 2632 1392 1066 915 600 --33527 1025 529 --
NM_001024218chr143793 339 77 ------
NM_001024455chrX----32092 830 640 --
NM_001024647chr12157351 6200 6054 5817 5754 5600 4752 3041 2808 2500 2392 2307 1311 966 39 --21881 1539 --
NM_001024649chr562235 2102 944 908 264 153 --1701 --
NM_001024660chr31616 ----1439
NM_001024668chr123607 329 183 ----1925
NM_001024808chr1272845 2452 2055 1828 1135 246 67 --11751 --
NM_001024934chr62657 259 1650 1134 --
NM_001024935chr62657 259 1650 1134 --
NM_001024936chr62657 259 1650 1134 --
NM_001024948chr132953 2903 532 --12848 --
NM_001025068chr341733 1229 251 202 ------
NM_001025069chr341733 1229 251 202 ------
NM_001025076chr1044559 1607 1517 1238 35830 4442 2487 11856 12078
NM_001025077chr1095917 4788 2965 2875 2596 1376 1089 492 106 37188 5800 924 ----
NM_001025079chr353819 3485 3401 452 362 33866 3032 2591 23937 286 --
NM_001025105chr531142 434 325 1997 11015 --
NM_001025108chr243815 3735 1427 210 --12676 --
NM_001025266chr364913 4881 4875 4582 3447 170 14697 13406 --
NM_001025389chr1161525 1262 1240 434 41 28 ------
NM_001025390chr1161525 1262 1240 434 41 28 ------
NM_001025580chrX64105 3519 3013 2912 2752 759 1925 --21643 1411
NM_001025595chr42353 158 --1127 --
NM_001025616chr431728 1255 208 1327 21900 1867 --
NM_001025780chr91383 1422 11312 --
NM_001029858chr673169 3104 2904 2760 604 335 233 12869 12103 --
NM_001029863chr642792 850 695 557 23164 2336 31973 631 340 --
NM_001029875chr562243 2172 776 724 688 71 11913 22157 1101 --
NM_001029989chr15--1166 1701 --
NM_001030007chr1653848 3542 3410 3145 2509 --43457 2686 2592 928 --
NM_001030055chr14104705 4699 4356 3966 2944 1520 1514 1171 457 289 2975 426 24340 903 24408 1377
NM_001030287chr11783 --11138 --
NM_001031679chr1243347 2875 1169 485 --1221 146
NM_001031695chr2231756 1657 663 14612 12085 1847
NM_001031709chr102282 152 --152 --
NM_001031712chr61273 ------
NM_001031804chr1644014 3669 3382 931 11692 1300 --
NM_001031812chr51761 --1378 --
NM_001032282chr82349 32 --21288 880 --
NM_001032293chr17151 1207 ----
NM_001032296chr1331994 386 344 --22862 553 --
NM_001032394chr642678 1833 1039 199 12411 181 --
NM_001032730chr1--2513 115 1152 1677
NM_001032999chr2065096 4510 4333 4184 4170 1251 --11153 15296
NM_001033002chr172226 43 ----192
NM_001033044chr121448 444 --11410 --
NM_001033047chr452652 2480 2472 726 603 --1953 --
NM_001033056chr121448 444 --11410 --
NM_001033059chr63501 310 304 ----12057
NM_001033087chr2053254 2548 2526 1117 794 --2572 278 --
NM_001033112chr51608 --2762 38 --
NM_001033503chr5--1141 2472 74 --
NM_001033506chr111113 ------
NM_001033564chr631944 1233 221 ------
NM_001033576chr1722491 581 ------
NM_001033578chr851742 935 553 354 92 11713 1563 1233
NM_001033910chr122113 2039 --11685 --
NM_001033925chr1052120 2113 2032 805 255 ------
NM_001033953chr11167 ------
NM_001034194chr4131 ------
NM_001034841chr1655389 1917 1790 491 427 15410 45192 5015 3867 2049 --
NM_001034845chr431399 1276 272 ------
NM_001034853chrX4782 299 240 131 --1943 143
NM_001035chr121222 61 ------
NM_001035003chr451273 1110 1072 504 95 ------
NM_001035004chr451273 1110 1072 504 95 ------
NM_001035511chr172057 2030 1789 1604 709 339 204 --1134 --
NM_001035512chr172164 2137 1896 1711 816 446 311 --1241 --
NM_001035513chr172164 2137 1896 1711 816 446 311 --1241 --
NM_001037126chr71101 ------
NM_001037131chr231209 885 367 --11332 --
NM_001037132chr71151 --11484 --
NM_001037133chr71151 --11484 --
NM_001037164chr731701 1599 1371 11347 1735 --
NM_001037174chr232309 911 818 ------
NM_001037317chr132533 722 658 ----12605
NM_001037331chr182352 155 1781 ----
NM_001037334chr1841933 1863 1623 657 --21908 837 --
NM_001037339chr131394 708 467 --1354 --
NM_001037340chr131394 708 467 --1354 --
NM_001037341chr131394 708 467 --1354 --
NM_001037341chr131394 708 467 --1354 --
NM_001037494chr121179 ------
NM_001037495chr121179 ------
NM_001037535chrX41403 373 345 35 11021 11244 --
NM_001037536chrX41403 373 345 35 11021 11244 --
NM_001037540chrX41403 373 345 35 11021 11244 --
NM_001037553chr2154045 1381 1339 1022 87 14554 13747 --
NM_001037631chr23903 99 74 ----1203
NM_001037872chr2----1740 --
NM_001037954chr1163111 2310 735 671 492 454 --13040 --
NM_001039091chrX1544 31270 1251 1075 1313 --
NM_001039348chr22896 134 ------
NM_001039349chr22896 134 ------
NM_001039395chr942358 2203 1993 57 ------
NM_001039538chr283474 2790 2611 2483 2242 990 887 236 21211 409 1142 --
NM_001039570chr2254518 4454 4191 3665 567 24147 2853 1956 14588
NM_001039571chr2254518 4454 4191 3665 567 24147 2853 1956 14588
NM_001039577chr153758 1681 1314 1054 394 13602 ----
NM_001039580chr4124789 4397 3842 3566 3485 3383 1971 1707 1677 1544 1395 879 11221 34770 3456 1151 --
NM_001039585chr1123854 3247 3104 3002 2654 1585 1380 1350 1044 945 509 430 33499 3419 167 ----
NM_001039590chrX43804 1320 732 501 23444 3296 43091 2513 1249 1131 13308
NM_001039591chrX43804 1320 732 501 23444 3296 43091 2513 1249 1131 13308
NM_001039618chr1185940 5801 5175 5010 4398 1599 1364 697 ----13847
NM_001039693chr233036 1303 816 2567 220 ----
NM_001039709chr2065096 4510 4333 4184 4170 1251 --11153 15296
NM_001039762chr103478 355 349 --1511 --
NM_001039840chrX145972 5794 5569 5472 4921 3812 3742 3705 2333 2133 1319 1293 978 208 25134 99 35824 5312 642 --
NM_001039884chr1921093 437 --11033 --
NM_001039888chr13670 634 621 ------
NM_001039937chr1384178 4000 3756 3725 3169 3040 958 284 --21431 821 13008
NM_001040057chr71220 --21395 1383 --
NM_001040100chr321196 894 --1291 155
NM_001040110chr751449 1304 1202 217 95 --11681 --
NM_001040142chr242397 2353 2004 538 1284 ----
NM_001040143chr242397 2353 2004 538 1284 ----
NM_001040152chr775062 3681 3629 3179 1780 1203 150 24819 4185 23288 829 --
NM_001040153chr133792 407 332 1342 --1946
NM_001040157chr462548 2504 2440 2335 2077 157 --42324 1796 111 77 --
NM_001040159chr431389 523 319 ------
NM_001040181chr321114 25 ------
NM_001040182chr321114 25 ------
NM_001040183chr321114 25 ------
NM_001040199chr321114 25 ------
NM_001040200chr321114 25 ------
NM_001040202chr442470 1858 784 169 22437 312 ----
NM_001040214chr652208 2079 1792 1463 91 ------
NM_001040284chr16155035 4703 4565 4171 3619 2033 1993 1695 1399 1143 871 865 682 167 119 25220 4656 21758 1154 --
NM_001040402chr453166 3067 904 763 484 13138 1510 --
NM_001040429chr1363461 3388 3343 2889 2240 882 23537 2648 --12400
NM_001040432chr31127 ----1337
NM_001040441chr143712 1972 411 242 140 34015 386 131 --
NM_001040446chr542396 438 79 50 11017 12362 12764
NM_001040450chr151305 --21876 550 --
NM_001040453chr151305 --21876 550 --
NM_001040665chr7104996 4280 4233 4101 3469 1850 1713 1669 247 21 1416 1330 13505
NM_001040666chr71698 ------
NM_001040712chr973459 3347 2542 2522 614 111 98 --13431 --
NM_001042355chr1611023 14986 44944 3622 875 307 --
NM_001042361chr1051148 1039 624 568 300 --21563 253 --
NM_001042364chr1051148 1039 624 568 300 --21563 253 --
NM_001042365chr1051148 1039 624 568 300 --21563 253 --
NM_001042387chr1051148 1039 624 568 300 --21563 253 --
NM_001042388chr183935 757 730 ------
NM_001042393chr1051148 1039 624 568 300 --21563 253 --
NM_001042396chr1051148 1039 624 568 300 --21563 253 --
NM_001042397chr1051148 1039 624 568 300 --21563 253 --
NM_001042399chr121329 ----1437
NM_001042403chr122966 928 --1132 --
NM_001042404chr131989 1360 770 --2577 92 --
NM_001042406chr63145 79 40 --1271 --
NM_001042412chr1611023 14986 44944 3622 875 307 --
NM_001042413chr963971 3143 2817 1528 997 736 13236 11538 --
NM_001042424chr452518 2481 2364 2334 1995 22662 2176 1802 1999
NM_001042453chrX61662 1578 1533 1460 679 373 --1202 --
NM_001042473chr1062139 1981 1880 1810 568 462 --22163 1699 11654
NM_001042492chr1763207 2811 2739 1317 250 197 21389 33 13024 13280
NM_001042493chr641968 718 166 140 11636 ----
NM_001042494chr1563725 3676 2433 1266 555 414 11227 1425 --
NM_001042495chr1563725 3676 2433 1266 555 414 11227 1425 --
NM_001042496chr1563725 3676 2433 1266 555 414 11227 1425 --
NM_001042497chr1563725 3676 2433 1266 555 414 11227 1425 --
NM_001042517chr131843 --2867 808 --
NM_001042555chr1254416 4183 3827 1615 1489 1905 14218 --
NM_001042599chr2187538 7037 6871 6700 6271 6022 5668 5495 5392 5339 4746 2305 2031 615 581 254 160 46 15909 17805 13050
NM_001042601chr363309 3251 3173 2586 2244 1055 --12933 --
NM_001042603chr1244416 4251 1932 499 14868 1960 34214 1774 377
NM_001042604chr364069 3580 3496 3375 1279 629 23024 527 23505 703 1444
NM_001042646chr31552 11747 11990 --
NM_001042669chr431728 1255 208 1327 21900 1867 --
NM_001042681chr121894 138 ------
NM_001042682chr121894 138 ------
NM_001042682chr121894 138 ------
NM_001042683chr621773 541 --21758 511 --
NM_001042749chrX21877 1540 11334 31762 577 196 --
NM_001042750chrX21877 1540 11334 31762 577 196 --
NM_001042751chrX21877 1540 11334 31762 577 196 --
NM_001043318chr1443702 3419 3240 155 14117 13749 --
NM_001043351chr131648 720 602 --32192 2054 1964 --
NM_001044305chr641342 265 210 161 21331 1089 11605 --
NM_001044722chr51761 --1378 --
NM_001044723chr51761 --1378 --
NM_001046chr532547 2139 288 --12064 --
NM_001048183chr153333 3326 3278 3257 3248 13647 ----
NM_001049chr1432452 377 321 --12216 --
NM_001050chr1731148 234 160 --11011 --
NM_001071775chr1331905 438 225 ------
NM_001083620chr452521 2395 2307 631 379 --12493 --
NM_001099678chr3115435 5047 2489 2345 2182 2084 2037 1399 1353 1092 805 16000 36377 4728 328 --
NM_001100108chr147489 6798 5810 2674 32776 2722 407 ----
NM_001105518chr1------1875
NM_001106chr3109000 8298 7242 6218 6154 3469 2571 1984 1886 864 28934 8709 18684 --
NM_001113490chrX43341 3188 3089 765 23164 897 21033 868 --
NM_001116chr162582 135 --12699 --
NM_001117chr1862485 2470 2418 2139 2057 719 ------
NM_001121chr1031434 579 269 --11720 --
NM_001124chr111490 ------
NM_001126chr14969 383 189 167 ------
NM_001128chr1653848 3542 3410 3145 2509 --43457 2686 2592 928 --
NM_001146chr811486 12227 1492 --
NM_001149chr102953 409 1200 ----
NM_001151chr42266 244 ------
NM_001153chr24851 729 120 55 1623 ----
NM_001167chrX105985 5134 4936 4746 2650 2282 1969 1793 969 260 11280 24906 1335 --
NM_001173chr14104705 4699 4356 3966 2944 1520 1514 1171 457 289 2975 426 24340 903 24408 1377
NM_001174chrX42204 2157 1561 130 --12046 --
NM_001177chr1252284 2079 1848 550 342 11756 ----
NM_001186chr2162423 1238 1182 1052 275 263 1335 22884 342 --
NM_001198chr632046 1888 1807 --32062 763 655 2691 381
NM_001201chr443668 3620 3007 2678 21026 201 21239 396 23099 264
NM_001202chr141249 ------
NM_001204chr277105 5866 5752 5609 2390 2210 1802 --66772 6205 6086 5855 2176 1095 26728 6601
NM_001206chr9103017 2893 2578 2318 2180 2171 1028 591 557 226 12613 --12342
NM_001219chr751799 767 681 561 194 --149 1460
NM_001222chr101115 ------
NM_001241chr261900 1657 877 553 346 120 --21872 663 --
NM_001241chr261900 1657 877 553 346 120 --21872 663 --
NM_001256chr17126 12425 11938 1225
NM_001257chr163333 108 92 --21256 148 --
NM_001259chr7155983 5770 5751 5226 5191 5111 4927 4747 4679 4547 2441 1163 507 345 198 35941 1885 1248 11594 15727
NM_001278chr103362 355 258 --11090 --
NM_001289chrX21647 1199 ------
NM_001290chr441043 933 709 54 ------
NM_001304chr1773774 3638 3583 3185 2793 1158 696 ------
NM_001310chr1242580 2323 179 132 --23025 673 12178
NM_001315chr631592 697 550 11459 11642 --
NM_001326chr111378 ------
NM_001329chr1041465 1326 1273 222 ------
NM_001331chr1131950 1018 166 ------
NM_001332chr531414 600 185 ------
NM_001343chr551664 1536 614 529 110 --21219 536 --
NM_001351chr321489 661 21625 1394 ----
NM_001356chrX32057 1669 321 160 42025 1555 839 331 1447
NM_001364chr1194409 4308 4236 4215 4015 1480 1406 1158 434 --11133 24567 4267
NM_001365chr17--1769 ----
NM_001380chr101967 ------
NM_001386chr812203 --11961 --
NM_001387chr563214 2942 2895 2790 2332 555 11129 --1879
NM_001389chr214531 469 46 37 ------
NM_001390chr1853419 2752 2533 1083 223 1299 ----
NM_001391chr184996 882 495 160 ------
NM_001396chr2161995 1809 1091 548 251 147 ------
NM_001399chrX63136 2971 2423 1037 752 634 12772 --12397
NM_001400chr121354 862 ------
NM_001402chr621989 1961 --1241 --
NM_001412chrX103673 3210 3021 2741 1186 1042 997 920 709 105 12548 43777 865 435 52 --
NM_001415chrX22011 1597 --11811 --
NM_001419chr1994793 4684 4336 4233 1722 1484 1096 93 77 ----11518
NM_001423chr1222049 787 ------
NM_001427chr722044 402 --1360 --
NM_001429chr22----2105 73 --
NM_001430chr281985 1968 1512 702 324 203 77 51 ------
NM_001432chr4113806 3785 3732 3308 3063 2457 1579 1038 1028 810 642 23743 3031 1706 --
NM_001438chr182608 1344 1188 1064 971 951 884 149 21154 1105 22853 2537 1761
NM_001447chr541367 394 361 268 ------
NM_001453chr611379 ------
NM_001455chr694873 4531 3954 1759 1726 1263 1089 654 433 ----1120
NM_001463chr23769 664 129 ------
NM_001480chr182201 91 1378 11175 --
NM_001483chr72979 937 ------
NM_001491chr631864 477 217 12491 21727 457 --
NM_001494chr101161 1215 1281 --
NM_001497chr942130 1880 611 178 ----1822
NM_001498chr631324 1203 1141 ------
NM_001527chr693813 3502 1589 1580 1247 871 852 462 21 11266 24567 451 1591
NM_001530chr143461 202 129 ------
NM_001546chr641451 380 346 244 11340 1176 --
NM_001557chr231202 438 300 11228 ----
NM_001560chrX42632 937 915 549 --1304 --
NM_001565chr42810 215 ------
NM_001584chr112817 386 1482 ----
NM_001604chr113936 655 128 ------
NM_001609chr1043392 3115 2738 722 1185 11082 --
NM_001616chr282994 2728 2666 2528 2264 1391 1149 424 12614 1487 11308
NM_001621chr722668 128 12383 22270 1968 --
NM_001621chr722668 128 12383 22270 1968 --
NM_001634chr63501 310 304 ----12057
NM_001642chr1131354 1070 163 ------
NM_001649chrX52248 1817 989 556 225 --1145 --
NM_001650chr1883896 3343 3316 1500 1433 938 593 278 44000 3877 1408 343 ----
NM_001656chr541703 1556 610 46 ------
NM_001663chr1442274 2226 1943 1073 1567 --1782
NM_001664chr33340 309 272 ------
NM_001668chr121685 771 ----11631
NM_001674chr11783 --11138 --
NM_001677chr1----1925 --
NM_001681chr121554 2670 581 --1216
NM_001682chr122801 509 ----1612
NM_001684chr153671 3410 2767 1219 479 33968 1365 183 11269 --
NM_001690chr331633 430 107 1458 21946 398 --
NM_001695chr883884 3426 3262 3039 2842 1211 824 401 1557 --13665
NM_001701chr991529 1277 1140 1079 604 590 457 443 63 11620 ----
NM_001706chr31983 ----1719
NM_001709chr1152348 2338 2169 730 464 ----1206
NM_001718chr621081 1040 1902 11098 --
NM_001730chr1331566 570 109 --31621 1355 1346 11028
NM_001730chr1331566 570 109 --31621 1355 1346 11028
NM_001743chr2--171 1550 1607
NM_001744chr51150 --1432 --
NM_001746chr562235 2102 944 908 264 153 --1701 --
NM_001752chr111582 --2471 155 --
NM_001753chr731617 708 64 --11831 197
NM_001754chr21123724 3705 3577 2656 1654 1573 1373 1106 711 649 458 388 23187 1337 23566 718 --
NM_001755chr1652154 1782 1737 1558 142 --1474 --
NM_001759chr1233975 2014 1487 14434 11465 --
NM_001769chr121371 1389 1404 --
NM_001777chr353819 3485 3401 452 362 33866 3032 2591 23937 286 --
NM_001786chr10------1144
NM_001792chr183885 143 86 --21106 42 --
NM_001797chr163601 509 223 --1665 --
NM_001798chr121922 ------
NM_001806chr1932884 2712 2356 32321 1919 1802 22983 835 --
NM_001830chrX33911 3863 1198 1364 ----
NM_001842chr91559 --2449 129 --
NM_001843chr12281 70 ------
NM_001854chr1------11270
NM_001855chr92777 35 --1742 --
NM_001858chr6154954 4685 4503 3939 3737 3691 3517 3481 1827 1439 1411 1155 1120 451 225 --24855 3420 43824 1958 581 507
NM_001859chr963905 2921 1029 968 816 422 ------
NM_001882chr5178 --1501 --
NM_001884chr5----1387 --
NM_001892chr531142 434 325 1997 11015 --
NM_001895chr202213 66 ----1894
NM_001903chr54913 715 677 356 ------
NM_001904chr34817 732 319 223 1254 1244 --
NM_001918chr1139286 8469 8281 8093 7780 7556 7450 7393 6677 2805 2324 1316 1091 17905 18408 188
NM_001920chr12--2764 683 1577 --
NM_001931chr1121282 884 ------
NM_001935chr25919 870 848 804 777 ------
NM_001938chr131470 1435 219 --1299 21784 1175
NM_001939chrX83800 3360 2614 2366 1309 1036 865 454 ------
NM_001942chr1811769 --21704 93 --
NM_001945chr51563 --11392 --
NM_001949chr632919 2701 2137 1867 ----
NM_001954chr61812 ------
NM_001955chr6------1973
NM_001957chr442258 2225 2076 65 ------
NM_001977chr441771 1349 1131 697 11609 1325 11573
NM_001981chr142295 1874 1564 1511 --11776 11861
NM_001987chr1264140 4051 3394 1705 1630 962 --11540 13600
NM_001992chr522059 603 --1119 12041
NM_001995chr431370 964 457 ------
NM_001998chr3--1108 194 --
NM_001999chr521409 103 --1231 --
NM_002006chr494793 3932 3532 1890 1852 1532 1110 585 541 13978 35320 4754 122 14404
NM_002015chr1342946 2258 848 656 12903 --11097
NM_002017chr1141359 1213 475 162 ------
NM_002024chrX32081 2058 1939 --1173 --
NM_002025chrX138985 8225 7303 7142 6440 3688 3000 2971 2858 1280 1192 1175 959 12484 27204 6564 1175
NM_002031chr61330 ------
NM_002035chr1873889 3838 3744 2890 1004 931 71 11018 32691 422 49 --
NM_002039chr41184 1150 ----
NM_002040chr2163095 2583 2157 1166 654 387 22931 898 ----
NM_002044chr153509 503 349 ----1249
NM_002047chr71149 ------
NM_002048chr951306 476 384 170 143 ------
NM_002051chr102834 58 ----1288
NM_002056chr21718 --1679 --
NM_002065chr121448 444 --11410 --
NM_002074chr141630 1277 175 48 ------
NM_002114chr62475 189 ------
NM_002126chr1743875 1029 348 118 11371 --23052 507
NM_002128chr1362439 2325 1993 1971 660 63 22176 341 1453 --
NM_002130chr511595 --11708 --
NM_002133chr222574 379 ------
NM_002137chr722188 2088 --174 1675
NM_002138chr43555 237 55 ------
NM_002139chrX3646 254 70 ------
NM_002140chr921119 985 --1790 --
NM_002146chr1751462 1435 1284 985 508 ------
NM_002158chr283659 2905 2690 2455 1356 1065 342 161 23096 2536 23850 626 23730 3160
NM_002166chr21705 ------
NM_002182chr342805 2048 1783 901 12601 ----
NM_002193chr211387 21346 317 21860 162 --
NM_002203chr594138 3829 3641 3583 2578 1151 1068 661 406 23400 511 1328 --
NM_002210chr293575 3519 3394 2545 1122 1084 673 490 49 --11220 --
NM_002211chr104982 935 880 47 ------
NM_002214chr7185582 5564 5059 4712 4694 4271 4256 4159 4097 4007 3878 3740 3613 2228 1858 1763 1739 488 35488 4391 4065 25049 4616 1255
NM_002222chr31466 ------
NM_002223chr1283672 3412 3095 3062 2556 580 543 471 --32977 1432 706 1157
NM_002227chr12817 314 1213 ----
NM_002234chr122701 691 ------
NM_002235chr1231581 427 247 11482 11568 --
NM_002241chr162529 2292 1912 1897 742 203 ------
NM_002242chr23543 324 227 --1422 --
NM_002247chr1092288 2159 2063 2051 2029 1988 1677 1569 77 ------
NM_002264chr3104433 3585 3375 3319 1945 1415 1060 898 419 89 11740 23475 1437 --
NM_002265chr171953 ------
NM_002267chr1342240 1782 961 282 1547 ----
NM_002268chr311774 ------
NM_002269chr61380 ------
NM_002270chr595457 5338 4732 4332 4236 1337 565 392 252 24504 4244 14283 25360 607
NM_002271chr1372412 2321 2315 2077 911 874 579 --1332 --
NM_002285chr243815 3735 1427 210 --12676 --
NM_002293chr142387 1764 1014 751 12057 1874 --
NM_002296chr131693 1147 585 21434 188 ----
NM_002310chr596337 6320 5790 5223 5216 4061 2424 2143 329 --46584 5400 5296 847 --
NM_002317chr52159 71 ------
NM_002334chr113727 171 125 ------
NM_002336chr1241496 885 754 303 --13220 --
NM_002356chr682744 2524 2454 2120 1967 1134 1111 859 ------
NM_002372chr5--1689 ----
NM_002374chr283474 2790 2611 2483 2242 990 887 236 21211 409 1142 --
NM_002381chr231031 904 849 --137 --
NM_002397chr552185 2167 1376 896 254 ------
NM_002398chr231267 504 484 ------
NM_002399chr1551115 1070 568 521 426 ------
NM_002411chr111118 ------
NM_002438chr101643 ------
NM_002445chr841465 540 392 82 21288 348 ----
NM_002449chr531315 982 796 --11228 --
NM_002451chr94486 417 99 70 --43875 2978 1089 184 --
NM_002453chr2125 ------
NM_002467chr81447 --1293 --
NM_002481chr1208007 7839 7739 7026 6423 6317 6307 6051 6020 5976 5922 5361 5276 4812 3032 1564 1481 1376 381 301 --11415 --
NM_002486chr942355 2314 2169 383 12528 1374 --
NM_002487chr154663 633 538 110 ------
NM_002489chr73364 342 171 --2290 66 --
NM_002499chr1552310 2149 1616 951 212 --1381 12222
NM_002500chr23519 510 345 --1900 11281
NM_002505chr61154 --11142 --
NM_002515chr1441485 1451 1250 817 11696 ----
NM_002519chr1151547 1502 1351 996 261 --1158 --
NM_002522chr1753652 3592 2842 438 247 ------
NM_002526chr61481 --1276 2397 327
NM_002544chr17--1269 ----
NM_002545chr1194926 3679 3626 3466 1630 1580 1075 168 82 14439 1396 --
NM_002546chr82778 34 ------
NM_002547chrX64089 3592 3094 2826 1193 1021 --1758 --
NM_002556chr1142097 1396 691 560 11405 ----
NM_002563chr341041 929 365 83 --1878 --
NM_002577chr363171 3076 2984 945 915 732 ------
NM_002581chr965473 5305 4846 4125 1391 554 24677 4117 11897 --
NM_002582chr161675 188 ----
NM_002585chr11336 ------
NM_002594chr202794 380 12181 2978 305 --
NM_002595chr1251391 356 329 268 243 --1188 11266
NM_002600chr131394 708 467 --1354 --
NM_002601chr21449 ------
NM_002605chr154945 829 408 351 ------
NM_002610chr241221 437 248 232 12849 22391 2159 --
NM_002613chr1664831 4638 3617 1244 612 495 --15246 --
NM_002628chr341214 888 875 28 ------
NM_002645chr1133127 626 188 1711 ----
NM_002651chr11678 ------
NM_002655chr885248 4674 4465 4454 3817 3316 1449 425 1881 ----
NM_002661chr16--1205 1195 --
NM_002664chr231250 1143 1038 11601 ----
NM_002667chr651134 1098 244 219 31 145 ----
NM_002687chr1451276 1110 995 843 448 1861 ----
NM_002703chr471584 1422 1347 677 657 617 173 11821 21806 1779 --
NM_002706chr2177 --2637 606 --
NM_002709chr243376 3245 875 667 2737 121 43421 2994 2317 267 12435
NM_002710chr122304 87 11023 2836 238 --
NM_002713chr121076 149 ------
NM_002715chr52927 846 --2988 879 1332
NM_002716chr1142968 1374 689 599 12635 13013 2445 127
NM_002718chr392642 2090 1807 1018 961 804 744 624 187 2537 170 ----
NM_002721chr92195 53 ------
NM_002731chr1103160 3136 2627 2293 1215 1151 609 555 287 116 --12072 22364 2087
NM_002737chr17156459 6161 6135 5943 5693 5492 5410 5186 4645 4213 4206 4192 1348 1184 681 11014 1311 --
NM_002745chr2274413 4047 3144 1034 830 657 498 --21392 1097 13716
NM_002747chr1851893 1867 1704 378 171 ------
NM_002755chr151312 ------
NM_002765chrX1544 31270 1251 1075 1313 --
NM_002767chr174546 476 190 149 ------
NM_002788chr142111 87 ------
NM_002790chr1----136 --
NM_002812chr19----1425 --
NM_002816chr17------1242
NM_002825chr71255 ------
NM_002834chr1264025 3927 3706 3323 3291 3273 --23547 2922 --
NM_002836chr20198 ------
NM_002839chr973459 3347 2542 2522 614 111 98 --13431 --
NM_002841chr32694 211 --1708 --
NM_002844chr631325 1311 500 --2999 929 --
NM_002847chr751221 541 516 234 93 ------
NM_002851chr73693 669 116 1289 ----
NM_002858chr121319 1228 --11033 --
NM_002869chr1131618 1368 449 11879 32220 1423 244 --
NM_002874chr952143 280 240 200 50 ------
NM_002886chr364888 4190 3764 1644 593 306 --34964 3451 3296 15043
NM_002890chr54796 625 408 163 1894 --1647
NM_002894chr18--1197 1235 --
NM_002906chr1142364 2353 1578 598 ----22244 687
NM_002912chr62866 80 ------
NM_002922chr11624 1521 182 --
NM_002930chr18153 ------
NM_002938chr431657 1394 342 --11782 --
NM_002941chr31564 ------
NM_002942chr33444 417 402 11035 11185 192
NM_002948chr341158 1108 1070 342 ----142
NM_002956chr123932 912 330 ------
NM_002958chr31811 ------
NM_002959chr1124397 4165 3475 2940 1608 1551 721 658 449 238 198 73 1664 23777 1356 --
NM_002968chr1631041 230 160 1345 ----
NM_002971chr351210 1127 1113 1038 918 --11155 --
NM_002977chr253236 2222 2104 1177 809 32584 1197 579 22243 1040 --
NM_002979chr11212 1728 1898 --
NM_002998chr862111 1792 1370 819 541 473 ----21810 1413
NM_003001chr172164 2137 1896 1711 816 446 311 --1241 --
NM_003010chr1752325 2077 1956 970 811 --1914 --
NM_003011chr911076 1158 ----
NM_003016chr1731936 1762 1564 ----1686
NM_003022chrX31057 906 812 1330 ----
NM_003034chr12118098 7251 7007 6838 5403 3242 2933 1669 1181 751 228 13262 11529 27400 2901
NM_003038chr242667 758 236 95 ----1651
NM_003042chr362213 1955 1926 1762 871 780 ------
NM_003071chr36836 746 684 556 307 256 --42041 1992 1749 148 --
NM_003074chr341641 307 113 77 ------
NM_003081chr2021001 147 ----1300
NM_003088chr721166 1114 ------
NM_003106chr32832 162 11061 --1758
NM_003107chr632080 1644 329 --12618 --
NM_003108chr2127198 6477 6395 5541 5190 4958 4647 1189 847 833 606 511 --25957 1565 --
NM_003111chr23502 442 120 ------
NM_003112chr743035 3028 2162 1142 ------
NM_003113chr2160 1787 ----
NM_003128chr262704 2050 1871 1056 674 278 ------
NM_003137chr651981 1876 1482 856 530 ------
NM_003144chr641825 491 103 21 --32199 1853 424 --
NM_003150chr1782392 1753 1632 938 534 332 103 35 ------
NM_003155chr84926 874 695 255 1840 21826 810 --
NM_003157chr31735 1319 ----
NM_003161chr1772785 2334 2303 1384 681 402 79 --1624 --
NM_003162chr211075 1772 ----
NM_003164chr111414 ------
NM_003178chr332086 1436 444 --1221 12258
NM_003181chr62578 127 ------
NM_003184chr831124 1040 395 --21140 908 1800
NM_003185chr202963 208 1360 1885 --
NM_003199chr18105180 4491 3546 1734 1708 1609 1599 741 213 57 --22211 226 14699
NM_003221chr683815 3367 3342 1555 1444 1389 1189 719 1356 --1159
NM_003222chr204962 950 799 202 --21108 927 --
NM_003223chr16----1750 --
NM_003234chr341754 506 393 152 ------
NM_003236chr263275 3235 2964 2427 1172 757 ------
NM_003246chr151236 --11694 --
NM_003253chr2131247 276 158 --1443 --
NM_003257chr153994 512 285 ----11305
NM_003262chr3125196 4957 4901 4851 4365 4017 3982 3386 1841 1501 891 302 --23951 349 15161
NM_003268chr13210 141 42 123 ----
NM_003270chrX31021 969 925 ----1741
NM_003272chr12523 65 ----2510 271
NM_003275chr911496 1292 1531 --
NM_003285chr11460 ------
NM_003286chr20----1398 21183 190
NM_003292chr13467 449 23 --11870 2647 356
NM_003298chr3155996 5758 5679 5193 4756 4604 3867 3825 1893 1475 1385 1109 982 830 248 12013 36006 2259 1203 --
NM_003304chr3--1575 21043 66 --
NM_003319chr22918 40 ------
NM_003330chr1231189 1136 293 ------
NM_003336chrX21095 107 ------
NM_003337chr531211 638 587 --31282 513 418 --
NM_003338chr1031434 718 669 1267 21916 1276 --
NM_003339chr521445 1012 --11369 --
NM_003340chr451214 490 306 195 183 ------
NM_003342chr1752350 2071 920 900 24 2812 192 12532 --
NM_003344chr721256 87 --11738 --
NM_003347chr222280 133 --21547 1509 --
NM_003350chr8----1200 --
NM_003369chr1142511 2303 1060 262 ------
NM_003381chr63832 256 184 --2116 36 --
NM_003385chr23929 920 787 1398 1876 1849
NM_003387chr252645 2184 938 869 293 --21807 556 --
NM_003392chr354133 3641 2921 430 424 22798 302 34296 3817 3619 --
NM_003400chr25787 767 572 90 35 --2657 336 --
NM_003403chr142295 269 1684 ----
NM_003404chr207739 733 640 394 348 160 108 ------
NM_003406chr831436 785 525 11314 ----
NM_003409chr1841419 1094 940 392 --31127 917 431 --
NM_003410chrX2832 353 22334 344 32777 2340 1171 --
NM_003411chrY51613 1575 1224 589 337 ------
NM_003412chr382952 2893 2732 2699 2412 2269 915 815 ------
NM_003413chrX41939 1692 1513 723 --41423 771 711 588 1765
NM_003418chr34813 762 159 97 --1562 --
NM_003423chr1942573 1716 916 283 --21657 994 1538
NM_003431chr13552 459 176 ------
NM_003442chr113900 698 332 ------
NM_003453chr131256 --1644 --
NM_003454chr1621522 602 --21383 464 --
NM_003457chr17151 1207 ----
NM_003462chr151394 1184 668 416 398 --11749 --
NM_003463chr632782 2691 1222 41311 1074 949 738 11096 --
NM_003467chr2----140 --
NM_003468chr2114110 4026 3399 2737 2721 2687 2646 840 493 274 121 --22790 1738 1297
NM_003471chr3199 --1933 1702
NM_003474chr1031494 545 81 ----12326
NM_003478chr1182781 2743 2584 1251 622 577 257 142 11234 23256 1300 --
NM_003483chr1242802 2701 584 271 1990 --1260
NM_003489chr2153186 2419 663 417 246 --22550 1292 22589 470
NM_003505chr771415 1319 782 739 693 141 114 ------
NM_003506chr81899 11183 11296 --
NM_003559chr1753610 3487 2950 1440 565 --1594 --
NM_003566chr1263342 3030 2375 1233 1009 680 12238 ----
NM_003576chr1331994 386 344 --22862 553 --
NM_003583chr1253857 3697 1415 633 102 11454 13256 13670
NM_003590chr273811 3513 3265 1559 1457 1244 310 12963 1533 --
NM_003597chr252293 1566 611 416 155 ------
NM_003603chr452162 1879 1830 668 513 ------
NM_003607chr133336 2936 155 1215 23316 1064 --
NM_003613chr152612 257 ----1495
NM_003615chr363817 3472 3362 2971 2684 587 --1700 13274
NM_003617chr1134808 4801 4637 4598 3781 3193 1904 1721 1575 1213 643 243 94 ----14158
NM_003618chr21508 ------
NM_003626chr1121300 1258 ------
NM_003630chr61562 1151 ----
NM_003633chr562252 1971 1627 957 829 712 --1818 --
NM_003637chr141275 616 583 39 11285 ----
NM_003644chr1776277 4884 4471 4448 4094 1838 1546 26142 4300 ----
NM_003657chr202905 773 --1944 --
NM_003659chr231085 853 34 21048 797 ----
NM_003663chr353286 2431 1238 1031 625 1417 21089 931 --
NM_003668chr12----133 --
NM_003671chr943205 3053 1341 1046 --22990 70 --
NM_003672chr13708 674 82 11997 146 --
NM_003676chr13878 745 672 --1111 --
NM_003686chr12271 175 ------
NM_003713chr131788 1622 1616 11380 2665 263 11474
NM_003725chr12------1286
NM_003743chr281914 1806 1718 1645 809 525 514 497 --1746 --
NM_003746chr121179 ------
NM_003750chr101888 ------
NM_003758chr151579 --31054 391 65 --
NM_003758chr151579 --31054 391 65 --
NM_003759chr4104326 4065 3917 3871 3796 1630 872 759 629 221 --14169 --
NM_003760chr12718 557 ----139
NM_003762chr131206 551 490 --190 --
NM_003763chr2021264 1234 23157 554 1661 --
NM_003783chr141180 844 422 31 ------
NM_003787chr1821519 545 11105 11261 --
NM_003800chr672228 1783 1692 955 867 406 92 --1549 --
NM_003822chr162954 2889 2399 2380 632 449 1815 ----
NM_003825chr1511564 1514 ----
NM_003828chrX1563 ------
NM_003829chr931077 784 436 --2994 78 --
NM_003831chr1881398 1257 1120 732 698 691 659 234 --1671 --
NM_003850chr133538 266 259 1690 ----
NM_003861chr1452566 2541 2285 2195 312 12365 1908 11790
NM_003872chr292894 2593 2418 2083 1961 1190 684 637 361 21891 516 ----
NM_003873chr1042450 2116 960 203 12516 ----
NM_003885chr1742496 2056 828 722 --1763 --
NM_003887chr262214 1961 822 518 383 150 12149 11850 --
NM_003888chr1521493 153 --21201 477 --
NM_003895chr2182129 1969 1719 1613 553 527 374 331 ------
NM_003899chr1362177 2145 1869 1820 1689 645 11699 ----
NM_003909chr842764 2665 2623 575 21162 218 12316 11100
NM_003913chr6114299 3140 2848 2720 1668 1496 791 771 671 641 588 23043 2924 1689 11728
NM_003919chr7----1201 --
NM_003924chr431692 1326 1305 1425 ----
NM_003931chr62657 259 1650 1134 --
NM_003932chr221410 11487 ----
NM_003934chr931277 1215 869 --1820 --
NM_003939chr10113727 3269 3179 2953 2877 2865 1575 1065 883 455 204 --23891 3016 --
NM_003941chr742465 1943 1778 102 11927 22399 2049 --
NM_003943chr411095 11082 ----
NM_003947chr331005 854 553 ------
NM_003953chr152897 2374 853 659 283 --1550 --
NM_003958chr683861 3557 3548 3138 2735 2702 1541 1242 --21486 821 --
NM_003966chr5157510 7486 7397 6961 6833 6470 5306 4777 2842 1489 973 963 535 494 471 27377 5873 11672 17871
NM_003971chr173520 210 134 ------
NM_003994chr12103977 3924 3753 3108 1618 1317 945 564 438 78 33658 3587 1444 1459 --
NM_004006chrX31063 900 99 --31992 927 332 --
NM_004007chrX31063 900 99 --31992 927 332 --
NM_004009chrX31063 900 99 --31992 927 332 --
NM_004010chrX31063 900 99 --31992 927 332 --
NM_004011chrX31063 900 99 --31992 927 332 --
NM_004012chrX31063 900 99 --31992 927 332 --
NM_004013chrX31063 900 99 --31992 927 332 --
NM_004014chrX31063 900 99 --31992 927 332 --
NM_004015chrX31063 900 99 --31992 927 332 --
NM_004016chrX2977 814 --31906 841 246 --
NM_004017chrX31063 900 99 --31992 927 332 --
NM_004018chrX2977 814 --31906 841 246 --
NM_004020chrX31063 900 99 --31992 927 332 --
NM_004021chrX2977 814 --31906 841 246 --
NM_004022chrX2977 814 --31906 841 246 --
NM_004023chrX2977 814 --31906 841 246 --
NM_004028chr1883896 3343 3316 1500 1433 938 593 278 44000 3877 1408 343 ----
NM_004035chr1775137 4081 3913 3577 1281 966 51 --14264 --
NM_004040chr21867 ------
NM_004050chr1462532 2376 2237 1871 1852 1694 ------
NM_004060chr561204 1177 1110 971 886 294 --1384 --
NM_004064chr1241079 882 462 405 11111 ----
NM_004067chr73986 393 53 ------
NM_004073chr1----1305 --
NM_004075chr124425 241 176 150 ------
NM_004081chrY21138 732 --2446 208 --
NM_004086chr141767 ----2578 178
NM_004087chr371673 1461 472 403 305 132 35 11785 21767 1410 --
NM_004094chr1452873 2654 1023 833 588 126 12066 --
NM_004100chr651913 907 693 551 287 --32499 2453 1047 --
NM_004101chr521635 490 --12092 --
NM_004105chr22896 134 ------
NM_004109chr1182021 1750 1527 726 555 274 173 139 22204 2128 11920 --
NM_004113chr332037 2000 1585 --11436 --
NM_004114chrX1361 ------
NM_004117chr642016 1676 1650 894 1258 12089 --
NM_004124chr1453491 3482 2291 2197 936 --13101 1273
NM_004133chr852535 2400 2359 805 534 22009 1695 11898 1760
NM_004136chr1553253 3059 811 650 31 --12476 --
NM_004156chr81397 1444 1182 --
NM_004161chr241594 1084 576 184 ------
NM_004170chr93516 494 285 31489 502 212 ----
NM_004171chr11169688 9647 9585 8840 8439 8356 8222 7987 7124 6753 6236 5984 2512 2411 1820 288 17157 67768 6720 5895 2703 2585 1299 28819 550
NM_004172chr561712 531 395 364 197 75 11885 2424 184 --
NM_004180chr23551 152 119 ------
NM_004183chr113806 771 88 ----1515
NM_004187chrX31479 1182 948 ----11426
NM_004202chrY2660 79 ----1495
NM_004209chr16----11090 --
NM_004229chrX62196 1918 1823 1474 1411 710 11622 ----
NM_004232chr1821173 102 1741 23425 2609 --
NM_004268chr1121156 773 1268 21185 89 --
NM_004272chr541541 1513 568 182 --11560 --
NM_004274chr1462192 2056 1087 562 427 60 ------
NM_004277chr611620 ------
NM_004279chr752092 2073 560 461 344 11621 --1640
NM_004281chr102532 120 ------
NM_004282chr64745 691 626 72 ------
NM_004301chr31120 ------
NM_004311chr1092630 2372 1920 1071 1054 998 383 319 104 11992 ----
NM_004323chr962477 2330 1681 872 120 104 --32697 2621 1830 --
NM_004327chr2242195 2043 938 906 1317 12079 --
NM_004329chr1071437 1367 1322 1236 1198 968 92 --1213 --
NM_004331chr882306 2009 1951 1940 1040 934 584 380 --22672 2361 --
NM_004337chr851466 606 572 220 128 1231 22190 1518 1476
NM_004338chr18106779 5440 5085 4844 4273 2813 2479 1541 1441 990 26111 750 25339 1626 11157
NM_004342chr731611 681 270 --1798 --
NM_004354chr42318 289 ------
NM_004360chr1631975 1746 530 21400 198 22031 290 --
NM_004370chr64617 450 352 176 ------
NM_004373chr12------1187
NM_004374chr81124 ------
NM_004379chr22649 130 ----11082
NM_004384chr51761 --1378 --
NM_004392chr1342216 529 274 259 12246 --12001
NM_004393chr362175 2111 2093 2049 889 655 --1230 --
NM_004397chr1183865 3652 3275 1639 1510 700 396 375 --1991 --
NM_004404chr252035 1964 1872 1629 340 --21772 647 --
NM_004416chr123956 883 782 ------
NM_004417chr53443 115 73 ------
NM_004419chr103884 708 39 --1404 --
NM_004423chr322344 985 1794 ----
NM_004426chr1241712 1609 1514 183 1673 ----
NM_004430chr821062 1033 12376 22288 1707 --
NM_004432chr921620 322 ------
NM_004437chr163365 3280 2633 2620 2230 231 1414 ----
NM_004438chr222573 2055 12207 --13231
NM_004454chr31565 22045 907 1408 --
NM_004457chr241666 1589 1168 341 1212 ----
NM_004458chrX52408 1746 1695 712 360 1173 ----
NM_004459chr1741472 1415 596 162 --1711 --
NM_004464chr454167 3703 927 681 406 21331 1246 53529 3324 2844 2730 94 --
NM_004466chr133234 127 96 1607 ----
NM_004482chr21193 1109 --1344
NM_004496chr1431205 233 118 ------
NM_004499chr5283 65 ------
NM_004501chr183987 2746 1474 1215 1113 866 545 80 --23999 1273 11158
NM_004503chr123678 182 95 ------
NM_004505chr173382 163 146 1522 128 --
NM_004514chr1743000 2839 2670 1914 --12699 --
NM_004516chr193129 46 33 --1233 --
NM_004520chr51142 ------
NM_004521chr101252 --1117 --
NM_004525chr221506 504 ------
NM_004529chr961446 1197 1029 559 399 155 ------
NM_004571chr2182643 2161 1354 1308 1059 813 699 152 ------
NM_004575chr441376 405 155 95 ------
NM_004586chrX54525 3926 828 633 526 24323 1453 ----
NM_004588chr1184032 3520 3321 2602 1121 1094 914 141 13076 13808 --
NM_004593chr31919 ------
NM_004598chr553274 2766 977 764 142 22798 2282 23099 2781 --
NM_004600chr131100 439 64 --2575 396 --
NM_004602chr2041530 1413 1164 499 --11501 --
NM_004606chrX2346 70 ------
NM_004612chr994775 4422 3514 1886 1677 1552 1377 1338 296 ----13692
NM_004619chr122113 2039 --11685 --
NM_004621chr1151305 1252 1205 1083 263 --2864 119 --
NM_004631chr131349 1029 1020 ------
NM_004634chr3--1663 ----
NM_004637chr3168 ------
NM_004641chr103628 369 129 --1300 --
NM_004650chrX41913 1458 603 447 31392 1298 547 11489 --
NM_004654chrY4504 402 329 158 1395 ----
NM_004660chrY31982 748 319 161 21501 444 1330
NM_004670chr1021697 432 --11409 --
NM_004673chr121333 1014 --21152 1127 2338 94
NM_004680chrY137 ------
NM_004685chr1362552 2361 2269 995 873 144 12477 2251 100 2764 331
NM_004687chr1731819 1511 26 1168 ----
NM_004689chr14--2382 175 ----
NM_004690chr61747 ------
NM_004696chr1----1124 --
NM_004709chrX41338 428 216 121 ------
NM_004719chr123174 86 51 12587 22063 703 --
NM_004723chr131040 245 74 ------
NM_004725chr102462 47 ------
NM_004726chrX105789 5730 4925 4551 4431 3753 3606 1776 725 695 ----1313
NM_004730chr53582 215 99 2857 479 ----
NM_004733chr31430 --1233 --
NM_004734chr1341240 959 353 346 23243 2867 2894 630 --
NM_004736chr13824 660 555 21638 508 21948 762 12077
NM_004738chr2032386 1823 928 1717 ----
NM_004742chr31350 ------
NM_004744chr473699 3626 3549 2667 1300 961 381 --1659 --
NM_004745chr876957 6239 5961 5156 4837 4249 1272 2836 331 56589 5547 2804 1339 191 16611
NM_004747chr1031643 1320 566 ------
NM_004748chr1534105 3306 3288 1437 23970 3412 --
NM_004760chr712168 --1129 --
NM_004772chr541258 1124 343 286 ------
NM_004774chr1722432 458 --11219 --
NM_004779chr531245 1054 337 --11143 --
NM_004788chr1151814 614 514 426 52 ----12293
NM_004791chr131247 --1287 1757
NM_004796chr143577 388 128 12222 22277 1836 --
NM_004797chr373570 3186 3020 2984 1125 218 157 12576 --13734
NM_004798chr2043594 3081 1438 632 1145 ----
NM_004804chr242377 1724 587 106 12435 ----
NM_004808chr1053327 3201 2581 2142 95 ------
NM_004815chr1104953 4861 4373 4220 3793 3629 1838 1262 951 348 --24833 472 --
NM_004824chr62192 178 ------
NM_004834chr243367 2888 1215 109 --1595 --
NM_004836chr23946 716 108 ------
NM_004857chr14124341 4314 4020 3903 3883 3863 3369 3130 1455 1221 548 124 ------
NM_004859chr1732400 2130 1235 --1558 1382
NM_004879chr111977 --1962 --
NM_004898chr442921 2022 1106 345 --11147 --
NM_004902chr202342 119 --1790 --
NM_004904chr7116174 5594 5513 5244 4867 4463 2380 2331 2038 788 209 25645 4634 44431 4406 1661 352 12063
NM_004906chr6----187 --
NM_004912chr731617 1401 1253 --1654 --
NM_004921chr141944 1871 1595 370 ------
NM_004924chr19--1787 ----
NM_004926chr1461829 1512 1367 506 387 198 21171 368 11565 --
NM_004927chr1141186 346 242 162 --11164 11446
NM_004949chr1831695 396 77 21738 499 21476 751 11409
NM_004956chr763787 3046 1830 1337 1305 1268 23805 3233 32918 1671 675 --
NM_004973chr611534 ------
NM_004982chr122479 273 ------
NM_004985chr1294438 4217 3978 3861 3553 2896 2876 1633 901 --33719 3592 882 --
NM_004992chrX78296 5504 3295 3289 2551 1189 425 18430 13370 1968
NM_004992chrX78296 5504 3295 3289 2551 1189 425 18430 13370 1968
NM_004999chr661100 1041 840 415 377 24 --13149 --
NM_005010chr71151 --11484 --
NM_005011chr751449 1304 1202 217 95 --11681 --
NM_005020chr71561 --1121 --
NM_005023chr521185 42 --2574 207 --
NM_005033chr4131 ------
NM_005037chr3------1167
NM_005056chr1244660 4495 2176 743 15112 11204 34458 2018 621
NM_005063chr1093671 1501 1252 1194 625 505 376 318 164 --12669 12927
NM_005065chr14134916 4879 4851 4635 4550 4536 4170 4115 3350 2025 1963 1763 520 --25337 232 --
NM_005066chr12656 292 ------
NM_005067chr33672 231 109 ------
NM_005068chr621481 494 11249 --1108
NM_005069chr2161728 1555 1190 506 133 106 --11458 --
NM_005076chr163281 1660 1253 625 544 227 14029 14074 24058 2832
NM_005077chr9179 ------
NM_005087chr31721 ------
NM_005093chr2065096 4510 4333 4184 4170 1251 --11153 15296
NM_005113chr143417 167 125 ------
NM_005121chr1743354 1420 721 74 23035 872 11518 --
NM_005124chr6238 27 --1674 --
NM_005126chr342064 1852 1705 651 --11972 --
NM_005128chr21--1519 ----
NM_005134chr183935 757 730 ------
NM_005135chr1563725 3676 2433 1266 555 414 11227 1425 --
NM_005151chr1841933 1863 1623 657 --21908 837 --
NM_005154chr154661 563 525 52 --1224 --
NM_005156chr9135137 4903 4783 3977 3900 3448 1727 1342 1189 739 644 107 85 ----13873
NM_005159chr15112255 2175 2075 1914 1751 1418 754 593 568 327 124 ------
NM_005168chr211652 ------
NM_005171chr1231248 966 196 1915 ----
NM_005180chr1021479 106 --31323 1095 71 --
NM_005188chr1178008 7492 6711 3008 2893 2304 2030 45418 2641 1163 701 27149 535 --
NM_005190chr631157 709 437 ----11071
NM_005197chr1465904 4423 2334 1136 312 90 ------
NM_005214chr23866 62 37 ----1166
NM_005233chr332342 2216 932 1744 --21689 915
NM_005235chr2187538 7037 6871 6700 6271 6022 5668 5495 5392 5339 4746 2305 2031 615 581 254 160 46 15909 17805 13050
NM_005238chr1163296 2754 2493 1277 843 792 --12630 --
NM_005254chr1521074 538 --1474 --
NM_005259chr231376 1083 516 --259 25 --
NM_005261chr82880 793 --1649 --
NM_005271chr1051157 1034 487 391 45 ------
NM_005277chr431853 572 143 21768 176 11886 --
NM_005278chrX190 --1480 --
NM_005302chr71317 ------
NM_005311chr732339 1949 356 --12034 --
NM_005312chr922683 2084 22306 242 ----
NM_005324chr1751946 1553 862 831 363 1452 ----
NM_005339chr4104260 4139 3489 3318 3237 2792 1320 804 640 397 1875 11505 --
NM_005342chrX42345 2300 1876 881 ------
NM_005358chr13----21367 120 --
NM_005359chr18106432 6076 5987 5893 4247 2244 1967 1433 608 499 --21708 173 11831
NM_005378chr21619 ------
NM_005380chr1------1190
NM_005385chr352459 2352 2126 734 542 149 ----
NM_005388chr911353 --21424 1078 --
NM_005391chrX1131 ------
NM_005392chr931538 1338 185 11865 ----
NM_005398chr1051366 997 475 193 73 ------
NM_005400chr272919 2373 2114 1237 1170 435 316 ------
NM_005402chr731838 1541 410 2554 207 1711 --
NM_005412chr121549 ------
NM_005413chr21331 ------
NM_005414chr32295 104 1228 ----
NM_005415chr22590 149 ------
NM_005429chr41314 --1143 --
NM_005433chr1812388 12415 32500 2470 2206 --
NM_005436chr1063593 3505 3236 3175 465 297 12767 33989 3683 199 11306
NM_005439chr121535 194 166 --
NM_005455chr131741 667 247 11350 ----
NM_005458chr942010 1644 1603 958 ------
NM_005461chr2051894 1435 705 383 282 ------
NM_005465chr151801 1550 587 406 264 140 21688 774 --
NM_005475chr12102735 2636 2430 2046 1281 1116 910 681 514 29 13248 12728 --
NM_005476chr911231 --1256 --
NM_005487chr2241726 487 348 297 ------
NM_005493chr62616 278 2748 170 ----
NM_005494chr74542 419 133 97 1526 ----
NM_005497chr1766025 5719 5628 4121 4026 660 ----26086 762
NM_005504chr1276460 5876 5547 5399 4262 2502 366 26152 213 45085 4630 1679 198 --
NM_005506chr432714 683 358 22739 2536 ----
NM_005509chr531305 721 689 21322 1173 31731 1517 708 127
NM_005522chr741278 1051 463 374 --11174 --
NM_005536chr84991 527 447 285 ------
NM_005537chr132880 762 1918 1376 --
NM_005546chr561772 1717 1572 611 185 167 11975 2547 292 --
NM_005573chr52704 228 ------
NM_005578chr394655 4503 4330 3410 3124 1153 1033 932 282 --23650 531 --
NM_005587chr151928 ------
NM_005595chr13806 594 78 --2696 36 --
NM_005596chr9105970 5694 5175 5154 5076 4675 4054 4044 2199 110 22177 885 15929 --
NM_005599chr11961 --1411 --
NM_005604chr64816 407 168 89 --12170 --
NM_005607chr83652 114 107 ----1298
NM_005610chr11676 --1765 --
NM_005613chr131910 611 215 --11880 --
NM_005637chr1832026 1937 258 --1319 --
NM_005639chr1251229 1184 744 591 115 11515 --1516
NM_005647chrX42828 2427 507 455 --31038 760 442 --
NM_005655chr82349 32 --21288 880 --
NM_005656chr2141577 1497 1291 318 ------
NM_005665chr184938 4551 4358 1233 968 598 420 294 13115 14202 11937
NM_005668chr544209 1784 457 371 23606 1697 13226 --
NM_005669chr552299 2266 1952 1805 1708 --2532 403 12194
NM_005715chr632274 2100 761 22847 1042 22373 262 1321
NM_005721chr221007 974 ------
NM_005722chr242389 1660 980 493 ------
NM_005725chr11623 --21935 748 1985
NM_005730chr1253638 2537 2350 755 207 ----1150
NM_005734chr11--1123 2181 131 --
NM_005738chr731701 1599 1371 11347 1735 --
NM_005739chr152579 96 1647 32209 1868 600 1668
NM_005746chr762691 2097 747 431 361 298 --22549 555 --
NM_005748chr1253004 1171 1053 971 845 1863 --1434
NM_005752chr163986 325 149 --21108 1040 144
NM_005754chr521233 205 ------
NM_005759chr284361 3968 3906 3503 1831 1249 511 270 14493 34583 1328 1295 --
NM_005786chr1841250 1080 998 959 1912 11053 --
NM_005788chr111811 ------
NM_005803chr62347 263 1255 ----
NM_005808chr333348 3015 169 --1512 --
NM_005813chr232418 242 64 11787 22300 705 1888
NM_005822chr631737 899 522 ----11992
NM_005826chr11621 --2592 527 --
NM_005828chr1764906 4373 3358 1638 476 434 ----13587
NM_005832chr31193 --1575 --
NM_005836chr8291 53 ------
NM_005839chr12203 54 --2821 755 --
NM_005840chrX55864 2337 2327 1931 1092 21906 935 25982 996 --
NM_005843chr251713 1698 1363 1285 534 1223 ----
NM_005859chr541520 1375 1197 1046 11164 ----
NM_005862chr341005 819 381 307 ----1403
NM_005871chr1051080 333 231 180 164 ------
NM_005880chr1611117 --31314 366 127 --
NM_005884chr191806 ------
NM_005895chr1254107 3500 1488 1145 183 ------
NM_005896chr21100 --1212 --
NM_005898chr11122930 2882 2865 1169 960 634 597 565 463 397 159 151 11178 1477 --
NM_005899chr1751358 615 280 274 24 ------
NM_005901chr18158587 8453 8261 7059 6472 6183 5962 5534 5415 5270 3198 2511 1815 596 44 25756 5524 ----
NM_005902chr15144514 4367 4230 4053 3896 3880 2878 2802 1748 1634 1325 1064 969 188 22934 2926 24467 329 --
NM_005903chr5105190 4558 4444 4393 4318 4041 3819 2027 696 463 53641 1153 1061 969 445 1298 1108
NM_005906chr611476 --1318 1275
NM_005907chr631554 1423 1073 --1448 11174
NM_005909chr593902 3568 3319 3232 2607 1568 508 110 58 --33655 1182 937 --
NM_005911chr271366 1158 1028 1003 959 940 502 ------
NM_005924chr721122 858 ------
NM_005930chr146908 774 354 213 203 184 ------
NM_005935chr465073 4383 3396 1843 1498 506 1260 34818 4506 1521 --
NM_005937chr17103870 3702 3634 3586 3054 2980 1455 1265 1210 934 13662 ----
NM_005941chr872834 1664 1373 1035 724 495 49 --23936 531 --
NM_005955chr165502 4337 4163 3621 1812 687 21109 630 15247 --
NM_005957chr164738 4242 3890 3035 1241 810 23818 3742 ----
NM_005962chr1042330 1935 910 633 --1241 11541
NM_005962chr1042330 1935 910 633 --1241 11541
NM_005964chr171172 ----11188
NM_005966chr221981 1724 --21955 1629 --
NM_005968chr191193 ------
NM_005969chr1131198 258 244 ------
NM_005977chr135825 805 783 414 296 1707 ----
NM_005990chr542671 2174 1982 29 ------
NM_005999chr161348 1332 1104 359 84 54 ------
NM_006007chr953372 1797 1746 1360 1112 24002 2774 23210 1714 --
NM_006011chr1563881 3426 3009 1506 1329 186 ----11464
NM_006015chr141173 979 391 123 11071 ----
NM_006016chr652074 1607 1551 747 509 --21948 289 --
NM_006031chr212401 32 ------
NM_006033chr1822334 135 12010 ----
NM_006036chr252514 1781 1651 1624 880 --190 --
NM_006037chr274297 4207 3735 1878 1613 1408 437 ------
NM_006038chr2061777 1484 1368 788 629 383 11955 ----
NM_006047chr2053263 2929 2659 2206 915 ----12150
NM_006054chr112549 97 1412 --1562
NM_006055chr2113010 2828 2612 2172 1277 1182 901 834 499 206 24 1977 32224 1070 445 --
NM_006063chr21348 ------
NM_006064chrX1401 1154 ----
NM_006080chr782444 2357 2256 1867 721 615 167 54 --12347 --
NM_006090chr13683 638 629 --1117 --
NM_006095chr464026 3682 3592 3534 1216 175 --23852 3163 --
NM_006100chr33626 609 58 2171 142 ----
NM_006106chr1153244 2810 2786 2519 417 --22920 628 --
NM_006108chr112858 764 12258 --182
NM_006135chr121161 533 --1948 --
NM_006141chr1622151 40 22670 627 22325 1810 --
NM_006153chr32641 146 --1629 --
NM_006154chr1542812 2334 927 383 11892 12667 1160
NM_006155chr252035 1964 1872 1629 340 --21772 647 --
NM_006158chr841749 1416 549 523 ------
NM_006160chr1711566 --1604 --
NM_006166chr1221926 1039 1287 ----
NM_006167chr872066 2059 1853 1754 847 594 337 1637 ----
NM_006177chr1411046 11111 21028 734 --
NM_006178chr1731108 459 205 11530 ----
NM_006180chr952047 1735 1297 747 414 ------
NM_006183chr123603 496 112 ------
NM_006186chr231061 1047 1011 --11275 --
NM_006187chr1253088 3013 2402 2257 259 ------
NM_006197chr861940 1708 1639 1528 830 803 --1369 --
NM_006203chr5135613 5452 5379 4896 4743 3916 3772 3474 2091 1609 1523 686 240 --1843 --
NM_006204chr10--1225 ----
NM_006206chr472860 2209 2095 2082 939 630 366 --11035 2733 325
NM_006207chr82192 58 --1266 --
NM_006212chr195439 5375 4162 4125 4087 2143 1434 983 98 25106 4843 --1178
NM_006218chr32233 58 ------
NM_006237chr1362231 1784 1684 1413 797 537 ------
NM_006241chr342357 2232 479 81 ----11519
NM_006243chr141003 709 123 111 ------
NM_006246chr14189 --3954 480 353 --
NM_006251chr5113346 3263 2746 2517 2129 1310 1023 743 610 432 125 --22603 479 --
NM_006252chr1146917 6643 6528 6503 5282 2973 2914 2316 2255 2171 1726 1702 1667 628 1427 32717 735 607 11655
NM_006256chr152453 2419 2360 2074 522 --2922 673 --
NM_006258chr1051480 1471 1094 636 57 --141 --
NM_006265chr831347 1142 164 --11537 --
NM_006267chr241513 720 559 86 2316 131 2390 68 --
NM_006275chr202424 246 12157 1215 --
NM_006281chr82880 103 ------
NM_006281chr82880 103 ------
NM_006282chr2084524 4456 4440 3928 2876 1807 1735 1525 13555 23767 1776 --
NM_006283chr884323 4233 3564 3284 1874 1523 763 60 43952 1134 653 464 11225 --
NM_006290chr621952 1646 ------
NM_006306chrX85769 4724 4407 3961 2376 2223 2115 1655 ----24644 4269
NM_006313chr1221063 144 ------
NM_006315chr433358 1264 785 --24501 126 --
NM_006317chr53926 273 139 ------
NM_006321chr331521 332 315 ----1307
NM_006352chr13649 541 121 ----12022
NM_006364chr14------1254
NM_006371chr335104 4575 4146 ------
NM_006372chr61432 1399 1382 --
NM_006379chr732130 2038 1978 1226 1416 --
NM_006380chr1754297 3647 1220 1150 887 22681 515 1386 --
NM_006386chr2262251 2058 1666 994 839 293 12191 ----
NM_006393chr1084447 3988 3720 3654 1546 704 447 126 11030 31019 697 86 --
NM_006416chr62554 529 --1564 --
NM_006420chr2053058 2614 2576 1240 1082 ----1740
NM_006449chr232103 1950 1676 ----1169
NM_006451chr53757 673 131 ----1183
NM_006457chr463670 3568 3379 2910 251 135 ------
NM_006460chr173532 524 338 ------
NM_006469chr141374 1240 415 312 11058 1537 --
NM_006479chr124971 920 866 339 --2826 42 --
NM_006482chr1253857 3697 1415 633 102 11454 13256 13670
NM_006489chr1441485 1451 1250 817 11696 ----
NM_006496chr141815 1751 1704 775 --2592 390 --
NM_006520chrX61345 1243 578 545 534 285 135 --11103
NM_006526chr2032050 682 189 12166 ----
NM_006529chr421603 1240 21695 1596 ----
NM_006534chr2053115 2108 1379 1037 112 --11167 --
NM_006537chr154409 388 234 103 ------
NM_006538chr2144156 3883 3516 3489 3452 3302 3183 2849 2771 2605 1558 1490 751 365 1458 21543 376 --
NM_006544chr14145708 5388 4483 4304 4241 4021 3950 2412 2343 1742 1549 1516 1393 526 11424 25784 1692 --
NM_006546chr1786669 6452 5152 2251 2180 1731 1280 737 --15874 14578
NM_006548chr331472 512 496 ------
NM_006549chr1262931 2368 1999 731 365 271 21003 554 1940 --
NM_006554chr22268 31 ------
NM_006557chr91657 ------
NM_006561chr1044559 1607 1517 1238 35830 4442 2487 11856 12078
NM_006570chr91420 ------
NM_006575chr143513 319 171 21403 542 ----
NM_006577chr21147 1877 ----
NM_006599chr16158272 8254 7490 6537 6063 5926 5111 3264 2960 1286 701 626 482 446 290 36901 6449 2271 48199 7892 7052 3199 --
NM_006601chr121194 3817 792 361 143 --
NM_006603chrX21877 1540 11334 31762 577 196 --
NM_006609chr262971 2939 2921 2229 1825 1194 1493 12846 --
NM_006614chr373671 2915 2854 2557 2274 1035 987 ----1924
NM_006618chr131473 279 176 1352 1562 --
NM_006620chr694817 4455 4420 3647 3056 1735 1427 1384 798 1401 2827 220 --
NM_006621chr151956 1575 1558 1424 782 --169 --
NM_006624chr1021957 1584 1462 1615 --
NM_006625chr121019 198 --11202 --
NM_006625chr121019 198 --11202 --
NM_006625chr121019 198 --11202 --
NM_006628chr15103925 3599 1574 1442 1372 1300 607 534 467 253 21662 584 1110 14122
NM_006629chr1821987 932 --12404 --
NM_006633chr51726 ----1696
NM_006646chr1342220 1947 1051 320 22336 2298 13011 --
NM_006648chr91130 ------
NM_006654chr1254416 4183 3827 1615 1489 1905 14218 --
NM_006667chrX2364 159 ------
NM_006670chr63566 485 30 --2575 560 --
NM_006675chr1253113 2828 2192 587 506 12644 ----
NM_006693chr71268 --1843 --
NM_006699chr132519 161 145 1947 1953 11035
NM_006700chr121777 ------
NM_006706chr52645 55 ------
NM_006722chr363048 2356 2088 1021 618 192 --22409 1099 166
NM_006726chr431163 930 437 188 ----
NM_006727chr52562 479 --1108 --
NM_006729chrX75292 4370 1355 1291 1058 413 177 --11339 34396 2085 1898
NM_006731chr9115646 4412 4275 4154 3599 2191 1132 923 273 267 53 34112 1580 1047 11013 --
NM_006746chrX41403 373 345 35 11021 11244 --
NM_006750chr16127534 7037 2896 2741 1811 1343 1253 1180 903 764 420 128 18055 13096 --
NM_006754chr71969 11281 ----
NM_006756chr851311 1095 304 110 77 1489 ----
NM_006763chr131649 1442 363 ----12113
NM_006766chr811703 --12252 --
NM_006777chrX32601 391 314 12785 1350 --
NM_006788chr1832147 820 276 2268 239 ----
NM_006791chr151106 ------
NM_006805chr531648 1347 1155 11667 11130 --
NM_006807chr172872 541 --11169 --
NM_006815chr1221399 1289 ----1114
NM_006825chr12294 40 1167 ----
NM_006826chr231042 445 143 --1389 1369
NM_006832chr144776 666 164 49 ------
NM_006838chr1221931 1618 --1629 --
NM_006851chr1282764 2661 1075 958 883 766 250 73 --12393 --
NM_006852chr1782463 2121 1901 1778 813 686 586 569 --1851 12146
NM_006857chr22653 77 1155 ----
NM_006873chr223308 3290 11245 ----
NM_006874chr42383 226 ------
NM_006885chr1673624 3120 2833 2806 966 703 63 1612 ----
NM_006888chr1441396 1139 414 325 22858 891 ----
NM_006895chr232233 1985 45 --11447 --
NM_006902chr142967 2168 2149 1178 12100 ----
NM_006908chr721145 124 1952 --11363
NM_006914chr941397 1375 1023 284 ------
NM_006915chrX42132 699 592 45 2412 205 1796 11607
NM_006916chr221329 181 1203 ----
NM_006920chr2--11897 21645 1300 --
NM_006922chr272473 2294 2246 2199 1708 342 169 --22569 979 --
NM_006924chr1774133 3618 3020 1326 1124 768 621 21593 683 ----
NM_006937chr17179 --2471 463 --
NM_006940chr1261809 1666 1631 633 297 84 --1418 --
NM_006948chr2142263 1929 268 245 42313 2133 1845 1814 ----
NM_006954chr1033430 2689 69 1228 32858 609 81 11012
NM_006963chr1021246 915 --122 1946
NM_006974chr1033430 2689 69 1228 32858 609 81 11012
NM_006981chr952655 2176 2115 613 333 --11092 --
NM_006993chr10168 ------
NM_007005chr91586 --11593 --
NM_007006chr1663015 2957 2409 828 492 53 ------
NM_007007chr12104701 4171 3450 3412 3192 3100 1509 1305 922 253 13121 24401 4298 --
NM_007008chr21741 ------
NM_007011chr15126734 6721 5119 5085 4620 2015 1837 1413 1268 1247 978 460 36269 5986 4749 46055 5960 5155 2106 --
NM_007013chr81846 ----1642
NM_007017chr52717 684 1754 ----
NM_007030chr565149 4063 1861 1659 1508 424 --13371 14802
NM_007038chr21125957 5886 5800 5586 5495 5317 4892 3745 1553 900 501 33 24261 887 15027 11489
NM_007042chr342431 1951 1028 363 ------
NM_007050chr20117864 7301 7247 6875 6571 5647 5359 2299 1726 1587 1123 17479 24984 1907 --
NM_007052chrX2244 152 2580 176 ----
NM_007054chr553698 3283 914 646 195 --13821 --
NM_007064chr31616 ----1439
NM_007073chr643291 1623 1125 188 1287 1988 --
NM_007078chr1062921 2210 1176 910 677 299 12872 12840 --
NM_007084chr1341075 1040 1000 338 ------
NM_007106chr133837 492 441 12174 21114 358 11983
NM_007107chr332188 704 361 --2395 277 --
NM_007114chr383190 2755 2326 2015 967 644 636 339 --22927 2367 --
NM_007118chr52879 86 --1276 --
NM_007124chr651725 1431 653 436 355 ------
NM_007129chr133968 911 777 ------
NM_007146chr1752167 1927 1134 619 146 2184 53 ----
NM_007156chrX252 36 ------
NM_007157chrX31979 448 52 1486 22113 1999 1848
NM_007159chr361633 673 543 381 225 125 --11769 --
NM_007166chr1151571 1354 564 485 474 ------
NM_007172chr2253281 3160 999 310 232 --22728 645 1114
NM_007173chr1141504 722 286 151 --11710 12011
NM_007175chr8132895 2659 2576 2558 2332 2298 1371 1117 809 792 682 484 434 ------
NM_007192chr1421142 920 --1966 --
NM_007203chr9113776 3131 2905 2671 2556 1513 984 819 601 588 65 --1880 --
NM_007212chr151743 1488 1435 507 110 ------
NM_007214chr671113 492 371 356 265 145 45 ------
NM_007222chr831718 1459 1421 1243 2561 227 --
NM_007231chrX42119 582 373 259 --1957 --
NM_007245chr162970 850 --1812 --
NM_007246chr411066 ------
NM_007249chr13159286 8255 7158 6462 6120 3656 3645 2716 2195 2076 1647 1545 1183 1064 598 --57568 3308 2516 1944 1039 --
NM_007269chr1----1559 --
NM_007287chr373112 2299 2153 1162 1153 683 671 22165 822 ----
NM_007288chr373112 2299 2153 1162 1153 683 671 22165 822 ----
NM_007289chr373112 2299 2153 1162 1153 683 671 22165 822 ----
NM_007292chr1775137 4081 3913 3577 1281 966 51 --14264 --
NM_007325chrX21985 1636 11729 1724 --
NM_007345chr1842363 2070 1726 555 12089 ----
NM_007349chr71181 ------
NM_007361chr142550 260 --1636 --
NM_007373chr1041840 1380 1183 362 1443 ----
NM_007375chr132566 890 271 ------
NM_012062chr121275 1266 ----
NM_012081chr563768 3745 3011 2896 961 848 --11493 --
NM_012082chr82693 639 ------
NM_012084chrX4476 470 380 45 ------
NM_012089chr131546 1445 200 --1338 --
NM_012095chr1072714 2556 2370 1309 1286 690 504 --13320 --
NM_012096chr363625 3575 1136 1060 910 73 ------
NM_012097chr232309 911 818 ------
NM_012098chr94476 293 251 80 ------
NM_012102chr121894 138 ------
NM_012104chr1163396 2702 2537 2378 1128 968 --23511 3221 --
NM_012104chr1163396 2702 2537 2378 1128 968 --23511 3221 --
NM_012108chr4--1411 1157 --
NM_012111chr141178 ------
NM_012120chr682996 2947 2842 2753 1831 1038 827 677 12127 --11172
NM_012129chr752353 2156 2080 1608 278 ------
NM_012137chr132738 1163 1090 12505 12104 --
NM_012141chr1384178 4000 3756 3725 3169 3040 958 284 --21431 821 13008
NM_012153chr1162554 2162 1733 1584 884 765 12088 12020 --
NM_012161chr411131 --2999 134 --
NM_012164chr9127013 6456 6448 3022 2537 2133 1476 1187 1141 803 587 442 37326 5754 1161 26670 6606 11767
NM_012177chr62414 92 164 --2224 181
NM_012183chr11133 --1608 --
NM_012193chr11135218 4738 3851 2162 1655 1234 1107 1101 1039 990 388 277 116 13508 ----
NM_012199chr154653 4495 3205 3191 1852 14061 21274 342 --
NM_012207chr103849 811 417 ------
NM_012214chr286038 5327 4447 2104 2076 1831 1523 201 1846 12261 --
NM_012215chr1051696 1654 1361 644 522 ------
NM_012223chr251218 1050 516 147 53 ------
NM_012234chr383679 2751 2724 2302 936 781 472 318 --23459 300 --
NM_012238chr1091713 1234 1144 541 498 396 262 199 162 ------
NM_012243chr11335 ------
NM_012247chr103785 213 142 ------
NM_012249chr263446 3350 2334 1361 645 65 22884 820 --11054
NM_012250chr1131218 1090 354 --1522 --
NM_012252chr7134551 4007 3526 3480 3334 3295 2103 2041 1178 896 405 354 308 14593 23867 3537 1596
NM_012262chr1135180 4418 4354 4230 3998 3206 1563 1282 1238 1129 1083 1031 440 34802 4574 603 31156 305 107 --
NM_012281chr762141 1930 871 759 738 715 --22361 1517 --
NM_012287chr394245 4127 3965 3786 3455 2859 2796 1568 55 23169 869 170 --
NM_012294chr764056 3789 3749 3737 2766 671 11108 ----
NM_012297chr452246 1749 980 388 171 ------
NM_012300chr552354 2298 2235 603 90 --22396 1958 --
NM_012301chr772174 2137 2076 1953 1680 1667 1373 --1843 --
NM_012307chr182395 345 ------
NM_012309chr11104660 4565 4336 3502 1963 1635 1203 829 685 324 23642 1666 33220 1944 1224 --
NM_012316chr195272 4863 3790 3706 2175 1691 1545 878 323 --15507 --
NM_012328chr711090 11436 2114 68 --
NM_012329chr1731613 645 99 ------
NM_012330chr1021729 727 --1275 --
NM_012333chr131550 669 527 --2499 172 --
NM_012334chr594604 3435 3368 3041 910 883 553 304 195 ------
NM_012343chr51182 1752 ----
NM_012345chr1351838 1255 755 181 27 ----1540
NM_012399chr2231906 1338 626 --1304 --
NM_012412chr72848 116 ------
NM_012417chr172589 143 ------
NM_012419chr61477 ------
NM_012421chr1----1466 --
NM_012429chr222254 50 ------
NM_012448chr172516 26 --12453 12330
NM_012454chr61503 ------
NM_012463chr1261744 1524 571 408 295 184 ------
NM_012464chr472706 2661 2000 1946 1800 563 299 1590 32829 351 279 --
NM_012465chr1062727 2230 2211 1328 1111 1078 --32865 2203 453 --
NM_012471chrX41929 1836 1421 554 1750 1603 11248
NM_012479chr742541 2128 2033 745 22281 283 ----
NM_013230chrY51769 1477 1359 1178 697 ------
NM_013231chr1453567 3258 2726 1048 35 --13373 --
NM_013233chr23302 255 247 ----11383
NM_013254chr122724 100 --1467 --
NM_013255chr7168756 8439 6985 6691 6595 6243 5916 5849 3285 2595 2495 1668 1613 1070 855 464 13072 37541 6917 6372 12376
NM_013257chr851742 935 553 354 92 11713 1563 1233
NM_013261chr493275 3261 2759 1237 1150 960 662 258 195 --13168 --
NM_013262chr641045 906 193 150 --1517 --
NM_013269chr1264449 3249 1766 742 129 53 --23388 1377 13850
NM_013280chr11----1180 --
NM_013281chr2021346 220 11104 11147 --
NM_013282chr192935 254 191 11276 --
NM_013300chr121228 ------
NM_013309chr1541697 428 289 100 --1925 --
NM_013322chr721175 664 --11185 --
NM_013336chr341974 1935 1543 278 1161 ----
NM_013341chr2--22927 2594 32627 205 33 --
NM_013372chr1563398 2412 2291 2174 1107 831 ------
NM_013377chr121661 ------
NM_013381chr1252166 1893 520 322 26 ------
NM_013386chr11221 1694 11613 --
NM_013396chr212119 101 --21546 315 --
NM_013423chrX41166 1119 523 285 --11008 --
NM_013427chrX41166 1119 523 285 --11008 --
NM_013437chr82950 65 1409 21002 156 --
NM_013438chr921768 718 11158 --11782
NM_013444chrX21050 996 1431 1745 --
NM_013448chr144705 645 132 89 --1740 --
NM_013449chr1242927 2001 1926 875 12984 11182 --
NM_013450chr2----11010 --
NM_013960chr8------1755
NM_013989chr1494863 4209 3974 3336 3166 1957 1734 535 146 13247 35121 3729 1091 --
NM_013993chr61812 ------
NM_013994chr61812 ------
NM_013995chrX22188 1898 32033 484 76 2990 333 --
NM_014011chr242451 971 501 283 1702 ----
NM_014028chr613250 2916 781 33335 561 57 --
NM_014034chr62524 174 ------
NM_014039chr1161348 1018 965 541 391 190 ------
NM_014043chr321022 458 21583 359 1533 --
NM_014048chr1695291 4508 4270 4055 3514 1806 929 398 243 13791 44343 4100 2126 536 --
NM_014057chr941559 1479 1466 1420 ------
NM_014071chr20286 59 ------
NM_014079chr311024 ------
NM_014089chr1342055 1624 1436 394 --1832 --
NM_014106chr1542611 2003 553 22 22876 2086 ----
NM_014110chr121076 149 ------
NM_014112chr8125311 4266 4059 3755 3672 3547 3475 1658 1258 1232 891 22 35238 1437 521 14654 --
NM_014117chr1642580 2343 2235 548 11013 11989 12126
NM_014154chr331289 1004 157 11278 ----
NM_014155chr11126993 6925 6893 6178 5308 4996 2213 1412 1326 973 263 78 15816 26499 658 --
NM_014160chr321407 262 --1535 --
NM_014181chr231909 648 42 42162 1995 1837 1066 21090 947 11041
NM_014217chr121865 357 --1413 11355
NM_014220chr31814 ----1582
NM_014223chr1----140 --
NM_014233chr1722038 235 --22090 1870 --
NM_014240chr334174 3624 382 --23562 950 --
NM_014241chr10----2124 82 --
NM_014250chr2241726 487 348 297 ------
NM_014253chrX82511 2466 1948 1932 1582 740 282 248 ------
NM_014258chr202460 53 ------
NM_014263chr1021266 247 --11515 --
NM_014264chr4----140 1578
NM_014267chr113658 567 236 ------
NM_014268chr1841368 948 298 239 ------
NM_014278chr4------1468
NM_014283chr131382 1242 1097 --2439 410 11217
NM_014294chr83930 529 345 --1328 --
NM_014299chr1932156 1604 1465 ------
NM_014309chr2231746 1647 653 14602 12075 1837
NM_014319chr1231911 1334 1272 21842 450 ----
NM_014322chr12989 360 ------
NM_014325chr121169 --11775 --
NM_014331chr4207711 7081 6823 6252 5727 5359 5306 5057 5036 4904 3015 2900 2091 2002 1256 1241 1166 281 229 178 22441 518 56069 5991 5292 2982 94 1836
NM_014333chr1122304 373 ----1534
NM_014335chr1541443 1159 938 49 ------
NM_014342chr1121409 1209 1315 --1174
NM_014345chr621044 423 1266 --1210
NM_014372chr142120 2080 1788 1397 --1367 --
NM_014379chr851038 676 234 173 38 --2966 423 --
NM_014380chrX--1238 ----
NM_014393chr872360 2324 2151 899 645 428 31 1688 ----
NM_014395chr412001 --2780 690 --
NM_014415chr341504 1484 1177 70 --11536 --
NM_014421chr451922 1752 1647 1385 215 --31938 1480 431 --
NM_014423chr5135556 4705 4652 4373 4024 3937 3904 3734 3601 3487 1244 556 285 11988 45305 4794 4557 2032 11096
NM_014432chr621214 343 ------
NM_014445chr372194 2082 509 370 317 87 46 --1393 --
NM_014447chr42353 158 --1127 --
NM_014452chr661064 1033 914 790 410 209 2357 38 ----
NM_014458chr131368 1304 557 1908 21411 73 --
NM_014461chr3----1170 --
NM_014491chr741009 898 817 754 ------
NM_014494chr1642337 2141 654 102 --11799 --
NM_014495chr11243 ------
NM_014498chr31259 ------
NM_014515chr123962 193 75 ------
NM_014522chrX3225 199 148 ------
NM_014547chr153648 265 211 ------
NM_014547chr153648 265 211 ------
NM_014548chr1551260 1208 1199 217 119 1499 ----
NM_014552chr251207 1114 571 445 67 --11464 --
NM_014554chr1221595 80 --31872 1527 485 --
NM_014572chr1321216 315 ----11812
NM_014574chr1421472 1159 1537 ----
NM_014577chr222768 661 179 1730 --
NM_014584chr1431247 1060 502 ------
NM_014586chr21104752 4483 4412 4058 3572 1415 994 982 944 43 --14113 --
NM_014588chr203633 499 230 ------
NM_014600chr221385 405 ----11574
NM_014602chr3151 ------
NM_014606chr431575 1073 391 ------
NM_014607chr281961 1897 1533 803 441 385 268 183 --22086 1446 11700
NM_014613chr583002 2933 2547 2150 1927 1212 882 875 --1520 --
NM_014629chr83868 419 236 --2504 453 --
NM_014630chr1533760 2640 199 13210 --13090
NM_014633chr112221 114 ------
NM_014636chr9114307 4045 3919 3726 3225 2787 2702 2660 1162 385 115 --23188 1607 --
NM_014647chr1621920 1615 --1166 --
NM_014670chr251531 1490 1173 1036 552 ------
NM_014671chr711518 ----1211
NM_014673chr8244 36 166 ----
NM_014677chr811181 1947 ----
NM_014679chr111985 ----166
NM_014699chr16--1334 1326 1363
NM_014700chr1611368 ------
NM_014701chr1532143 798 503 1224 22351 1058 --
NM_014702chr663216 3065 3001 593 116 104 --32809 2353 2163 --
NM_014705chr731607 1461 692 --11630 195
NM_014707chr721663 777 ------
NM_014711chr1641666 1531 1507 584 --1443 11752
NM_014717chr193305 257 73 ----2854 607
NM_014720chr1031623 1430 371 --11605 --
NM_014721chr6147376 7248 7037 6792 6552 6245 5793 4995 4704 2729 2200 1923 139 111 16044 47223 5533 2169 1528 --
NM_014729chr852160 1907 839 563 296 --22215 851 --
NM_014730chr1265130 4691 4153 3355 1921 1592 --15305 --
NM_014730chr1265130 4691 4153 3355 1921 1592 --15305 --
NM_014733chr532267 1568 217 11587 21684 1440 1502
NM_014735chrX4670 635 277 236 1558 ----
NM_014737chr2043621 2818 1656 168 --14066 --
NM_014739chr684060 3839 3691 3221 3089 1626 307 235 13345 14159 --
NM_014743chr452566 2457 1962 397 170 ----191
NM_014746chr263926 3025 656 447 420 281 --1592 --
NM_014747chr195711 5680 4883 4795 4753 4715 4433 4309 1360 --15200 --
NM_014751chr872165 2131 2016 1522 536 281 106 --21878 213 --
NM_014752chr111347 --2442 425 --
NM_014755chr254228 3885 2920 1279 1180 13572 11433 --
NM_014757chr562265 2058 691 582 435 73 --12125 --
NM_014761chr164228 206 66 34 --21092 1018 --
NM_014765chr142416 2142 1077 929 11831 42342 2222 2000 536 --
NM_014774chr133184 2095 130 12412 ----
NM_014776chr1272843 2708 1098 942 244 164 52 --1965 --
NM_014779chr3----11017 --
NM_014781chr81241 --1867 --
NM_014783chr1521187 208 1157 11649 --
NM_014787chr152111 1850 788 628 60 ----1912
NM_014795chr251384 1168 550 500 284 1521 1537 --
NM_014797chr622953 2430 --1957 12225
NM_014803chr1032616 1817 703 12460 1294 12979
NM_014810chr143617 3566 1292 494 --33125 3014 2760 11257
NM_014812chr131989 1360 770 --2577 92 --
NM_014822chr42185 150 1461 2627 117 --
NM_014824chr1121471 603 ------
NM_014826chr133336 2936 155 1215 23316 1064 --
NM_014828chr1422441 365 --22110 796 --
NM_014832chr1342118 1808 1673 503 ------
NM_014835chr2042236 2178 106 95 ------
NM_014839chr181780 1653 949 717 599 441 330 130 1889 ----
NM_014841chr611321 --2378 124 --
NM_014848chr1582853 2639 2107 859 738 418 333 233 --2841 714 1406
NM_014872chr942225 765 326 123 --12373 --
NM_014873chr194724 4654 4211 3497 3262 3066 3055 1906 1890 14505 11752 21582 339
NM_014877chr17117774 7679 7313 4807 2880 2698 1826 824 519 299 152 27628 6854 47471 6899 6749 213 27451 2768
NM_014879chr34773 431 354 247 1122 ----
NM_014887chr131358 1730 ----
NM_014891chr731682 1477 662 ------
NM_014893chrY22118 193 --21841 1583 --
NM_014897chr1753031 1126 765 446 228 --1730 13060
NM_014898chr1932324 620 107 ------
NM_014899chr583157 2981 2961 2935 2491 2262 1097 650 12574 ----
NM_014901chr542143 1857 1754 1506 --1852 --
NM_014903chr1242412 631 277 190 1591 --12199
NM_014904chr1083993 3889 3164 3006 2796 816 588 559 13328 23934 2511 --
NM_014905chr22541 452 1312 11820 --
NM_014906chr1744140 3718 2543 213 24007 2742 11603 --
NM_014909chr1473652 3150 2554 1458 1243 233 183 ------
NM_014912chr1073466 2835 2360 2302 2201 1279 492 ------
NM_014914chr231209 885 367 --11332 --
NM_014918chr152427 221 --11358 --
NM_014920chr663611 3545 2711 2413 2356 300 1416 11017 --
NM_014921chr1972997 2914 2473 2249 1115 716 385 ------
NM_014923chr131200 --11983 1299
NM_014924chr1433155 3060 2209 1509 22805 1014 --
NM_014932chr351933 1680 1541 349 178 ------
NM_014934chr1373480 3263 3168 3110 2870 1326 720 12951 43674 1609 1011 578 --
NM_014936chr652378 1796 1048 961 426 ----1948
NM_014939chr1861521 1231 1187 1068 402 82 --2540 307 --
NM_014942chr692634 2519 2431 989 961 774 650 186 54 21864 968 --12467
NM_014943chr841223 1214 1071 340 --11033 --
NM_014946chr263037 2232 2191 872 814 603 ------
NM_014947chr112140 --12313 1162
NM_014949chr12400 388 --1883 --
NM_014953chr1363203 1480 1329 1316 965 258 1485 34322 3444 394 --
NM_014961chr431518 806 591 12144 --144
NM_014962chr2062489 1882 997 973 54 23 --22509 442 --
NM_014974chr102705 555 ----1390
NM_014977chr141511 ------
NM_014978chr1031695 1415 1249 --21290 475 --
NM_014982chr1444708 1339 1299 1211 11323 45323 4606 1248 943 24783 4559
NM_014988chr452737 2548 2023 425 61 12304 12818 --
NM_014990chr143540 508 500 ------
NM_014991chr483239 3012 2964 2702 2399 2336 2315 65 --12302 --
NM_014992chr143675 551 99 --1619 --
NM_014999chr1211036 ----1664
NM_015000chr1253124 2585 1123 1012 220 11193 1525 --
NM_015008chr343302 3286 2965 434 170 ----
NM_015009chr31141 --1324 --
NM_015024chr831252 1226 66 ------
NM_015025chr222219 1982 2751 67 1412 12465
NM_015032chr1352918 2894 2478 464 433 --12773 --
NM_015035chr2066490 6300 5218 4853 4076 1385 --26675 778 --
NM_015039chr1103932 3630 3568 3525 3321 3114 2999 1552 1279 1261 --14326 --
NM_015040chr283374 2890 2863 2229 2195 1020 669 592 1966 --12341
NM_015045chr1041901 352 239 200 1405 --1452
NM_015051chr943362 923 805 308 21332 557 ----
NM_015055chr1172890 2881 2417 2287 1923 1843 345 --181 --
NM_015057chr131577 ------
NM_015064chr1253055 1278 481 230 162 --1172 --
NM_015068chr763914 2533 2481 1372 632 55 23671 3037 ----
NM_015071chr5116024 6011 5719 5447 4525 4086 2467 2248 1004 238 50 16042 1831 --
NM_015076chr653713 3620 1003 857 485 --1762 14188
NM_015082chr552533 2213 2073 1877 1626 ------
NM_015087chr1332373 833 128 31989 736 582 --12469
NM_015091chr141246 --1302 --
NM_015092chr1674581 3940 3764 3652 1493 171 105 13800 21321 772 14199
NM_015093chr641728 1609 1404 1283 11699 ----
NM_015097chr351860 1700 557 513 183 --22147 1539 11827
NM_015107chrX41757 1679 625 406 ----12253
NM_015110chr921722 359 11707 --1880
NM_015115chr453166 3067 904 763 484 13138 1510 --
NM_015130chr41905 ----1296
NM_015132chr731697 1342 716 --2663 415 --
NM_015137chr832524 1991 849 ------
NM_015138chr1531804 827 789 11840 21932 959 --
NM_015155chr1042831 2421 1326 665 12382 --11343
NM_015156chr14103921 3688 3547 3513 2682 2532 729 670 566 335 ----23713 3104
NM_015161chr1651238 1155 1122 604 223 --1282 --
NM_015163chr1441967 394 220 154 1295 --1475
NM_015170chr842320 2125 1449 832 --11761 --
NM_015172chr151477 1258 527 486 164 1149 ----
NM_015176chr121409 252 --21789 1179 2122 40
NM_015184chr32116 36 ------
NM_015185chrX32804 2200 876 ------
NM_015192chr2062968 2624 1961 809 427 271 ------
NM_015199chr362855 2205 698 449 376 278 22804 2567 ----
NM_015200chr472161 971 931 903 621 225 54 --11926 --
NM_015206chr1553789 3736 3169 1519 513 --21233 86 23116 29
NM_015208chr1883743 3696 3633 3214 3163 3073 746 100 --12562 21468 519
NM_015215chr172774 2661 2462 2357 2208 2183 612 --22318 217 --
NM_015216chr521263 523 21322 1069 11121 11193
NM_015225chr962949 2279 1194 1028 598 560 ------
NM_015231chr111691 --1195 --
NM_015235chr1052205 2027 1637 719 230 --11685 --
NM_015236chr441518 502 382 188 ------
NM_015245chr662745 2723 913 857 645 577 --12084 12757
NM_015247chr1611023 14986 44944 3622 875 307 --
NM_015250chr911918 --11748 --
NM_015252chr2----1224 --
NM_015263chr1521125 293 ------
NM_015265chr232089 1793 856 22649 679 12494 --
NM_015267chr1231387 486 422 --12083 --
NM_015271chr453841 3591 869 504 171 --1147 23432 1507
NM_015272chr1641673 1372 812 199 1626 ----
NM_015275chr1261768 1600 1452 661 622 546 ------
NM_015278chr673197 3071 3051 2917 1236 1108 585 1668 --13244
NM_015282chr262657 2554 2311 922 461 146 --11077 --
NM_015285chr1842577 605 596 560 12268 ----
NM_015288chr563557 3138 2997 2747 849 66 --11419 --
NM_015291chr173082 3038 2943 2834 2403 1035 477 11196 32877 1362 859 13415
NM_015292chr121695 ------
NM_015299chr1443551 1477 226 218 --22931 2811 12496
NM_015310chr8148106 8087 7721 7700 7511 6930 5703 5083 2872 2683 1296 1228 540 203 1553 45119 2404 1478 1017 --
NM_015313chr1154340 3323 2954 1772 733 11699 24364 3359 --
NM_015314chr752570 1786 947 537 485 1593 ----
NM_015317chr282781 2668 2600 2414 787 647 98 78 ------
NM_015323chr651409 1390 1255 126 87 1705 ----
NM_015326chr142891 2397 1077 382 12624 12983 --
NM_015335chr1232535 1039 367 --22492 589 --
NM_015336chr1242570 2237 1872 263 12386 ----
NM_015344chr842002 1652 1588 1366 21697 1417 ----
NM_015347chr1232441 203 34 22632 61 12168 --
NM_015350chr13520 454 433 1533 ----
NM_015355chr1731500 758 596 ------
NM_015358chr2151280 1044 981 480 343 --154 --
NM_015359chr862882 2481 2371 2220 1951 1855 22921 266 32609 2343 380 --
NM_015361chr23898 726 260 ------
NM_015365chrX64105 3519 3013 2912 2752 759 1925 --21643 1411
NM_015375chr174574 3877 3633 3185 1787 1418 1306 13305 1479 11647
NM_015379chr72234 195 ------
NM_015381chr2252035 1662 1521 818 762 ------
NM_015387chr231574 1307 456 ------
NM_015393chr473659 3231 2928 2674 2569 982 556 13189 32557 939 163 --
NM_015396chr331410 1267 544 --1283 --
NM_015397chr951614 1488 1381 570 36 --1551 --
NM_015416chr123607 329 183 ----1925
NM_015431chr153333 2709 2618 1232 1163 23043 1287 ----
NM_015435chr811433 --1988 --
NM_015436chr482977 2863 2364 2172 1232 1129 793 508 12282 22660 2530 --
NM_015446chr131525 1451 180 ------
NM_015455chr5124022 4007 3577 3419 2924 1482 1476 1365 897 882 859 578 22876 733 22813 1653 --
NM_015458chr865150 3401 1801 1195 704 360 14496 14261 11069
NM_015460chr341727 1489 1344 795 --1373 --
NM_015464chr71219 ------
NM_015477chr156999 851 812 778 734 335 --2772 24 --
NM_015483chr721003 780 ------
NM_015485chr12133 91 ------
NM_015496chr8--179 ----
NM_015509chr1231247 434 409 1351 11068 --
NM_015520chr322271 1770 --11917 --
NM_015532chr1542661 2503 2090 309 11051 11129 12617
NM_015535chr221584 836 13180 12937 --
NM_015541chr311203 --1304 --
NM_015548chr62834 724 ------
NM_015550chr782711 2553 1304 1209 966 949 502 477 --1171 --
NM_015554chr1562606 2280 1042 652 554 481 ------
NM_015564chr5113501 3414 3111 2446 2284 1306 1273 783 725 485 411 2935 907 12269 1334
NM_015567chr1351343 474 268 164 133 ------
NM_015568chr2094187 4095 3772 3384 3068 3035 2890 1245 751 ------
NM_015569chr121676 1198 22958 1479 ----
NM_015571chr682647 2440 2374 1885 1039 735 276 193 ----1777
NM_015576chr392575 2522 2167 2135 2125 2015 708 441 428 12600 ----
NM_015577chr531565 1317 1202 ------
NM_015578chr1962017 1815 1704 1366 672 591 ------
NM_015602chr111401 1350 11339 --
NM_015605chr1051148 1039 624 568 300 --21563 253 --
NM_015626chr1721050 871 1948 ----
NM_015630chr23954 396 271 --11128 --
NM_015640chr195299 4941 4123 3449 3336 2127 2104 707 81 1535 21935 1113 --
NM_015641chr73176 159 72 ------
NM_015646chr1241211 1158 532 76 --1439 11222
NM_015670chr171138 ------
NM_015678chr132314 180 --2610 528 --
NM_015695chr62264 95 1285 21481 758 11541
NM_015713chr853325 3211 2677 2445 772 --1144 --
NM_015855chr116839 813 676 362 351 188 ------
NM_015866chr121492 957 21109 59 11309 --
NM_015869chr3------1167
NM_015878chr872168 2040 1967 1889 1837 1733 157 11372 1804 --
NM_015879chr18208544 7914 7785 7466 7205 6642 6514 6222 5761 5728 5682 5318 3302 2514 1995 1762 1584 1244 623 511 25776 967 15879 12226
NM_015885chr113819 679 278 ------
NM_015888chr152697 2295 2233 1330 580 22805 331 --11163
NM_015902chr83808 683 215 1880 ----
NM_015906chr174407 1887 1393 863 752 692 661 11179 1419 --
NM_015912chr842122 2003 1936 1565 1343 ----
NM_015913chr12241 88 ------
NM_015948chr6159 ------
NM_015986chr173930 198 188 1104 1555 --
NM_015995chr1545087 4182 3717 1817 --34727 4582 113 --
NM_015999chr13570 521 451 --156 --
NM_016009chr1114923 4908 4791 3225 1977 1846 1366 856 632 252 53 41836 1387 1377 273 13822 21545 753
NM_016018chr831836 1768 1120 12249 22740 166 --
NM_016023chr871883 1823 1763 1362 813 99 21 1445 12120 11753
NM_016025chr1631738 1697 75 11844 2610 332 --
NM_016028chr111180 --146 --
NM_016037chr13292 111 61 --1756 --
NM_016038chr7------1555
NM_016045chr203652 415 84 1636 ----
NM_016060chr175939 852 815 797 143 ----11128
NM_016072chr1232397 642 499 --1954 --
NM_016075chr1352153 973 614 275 253 --12720 --
NM_016076chr173061 2883 2762 2557 2310 1282 390 ------
NM_016083chr643320 3242 281 97 13905 2587 343 --
NM_016087chr711332 11107 11687 --
NM_016103chr5--1141 2472 74 --
NM_016120chrX41104 977 901 280 ------
NM_016122chr121329 ----1437
NM_016128chr31112 ------
NM_016131chr232197 1656 881 --21785 360 12370
NM_016133chr221600 231 --1383 --
NM_016152chr331027 470 200 1174 ----
NM_016156chr1162337 2242 2163 2094 2061 518 --11933 --
NM_016179chr131217 --1206 --
NM_016201chr362094 1485 1478 901 305 298 ----11615
NM_016206chr3168878 8406 7784 7081 6855 6363 5761 5555 3495 3355 2742 2706 2173 1381 922 238 11010 68955 8859 5927 5580 3062 798 21344 1314
NM_016217chr663342 3060 2721 2246 366 263 --12883 --
NM_016220chr73474 265 96 12211 21920 163 11701
NM_016226chr121369 ------
NM_016227chr131382 1242 1097 --2439 410 11217
NM_016230chr61158 ----2470 185
NM_016231chr1741457 1399 1347 1228 --11139 --
NM_016248chr1393974 3754 3312 3245 3231 2503 2488 1257 419 1902 1887 --
NM_016252chr22753 388 ------
NM_016255chr663342 2612 1086 620 613 315 12159 ----
NM_016260chr2117523 7445 6059 5550 2609 1938 1745 1207 521 467 425 22268 1881 24787 2249 --
NM_016271chr1852043 1722 1503 734 84 --11772 --
NM_016275chr352543 1985 1893 807 308 1770 1354 12014
NM_016277chr631132 1037 23 --11460 --
NM_016279chr51350 ------
NM_016282chr941700 613 483 299 ------
NM_016287chr13627 328 304 --1543 --
NM_016289chr231478 1471 551 --21947 615 --
NM_016308chr151611 662 519 199 97 11994 1572 --
NM_016315chr231792 1744 1242 --1380 1189
NM_016316chr2----1740 --
NM_016322chr943232 823 471 167 12694 32744 2267 2160 11218
NM_016338chr51169 ------
NM_016340chr52937 93 ----1442
NM_016351chr73614 546 47 ------
NM_016357chr122411 123 1468 1201 --
NM_016374chr121377 211 ----1338
NM_016374chr121377 211 ----1338
NM_016376chr1763844 3529 3200 1357 892 626 22825 831 ----
NM_016396chr1573022 2912 2722 2485 2241 568 232 11052 --12477
NM_016422chr1162643 2571 885 736 561 253 --22707 573 --
NM_016427chr182404 105 ------
NM_016433chr1241551 1277 1210 359 ------
NM_016436chr2062411 1835 1819 1657 922 356 --1780 --
NM_016441chr292395 1655 1631 1573 1474 587 346 196 43 ------
NM_016442chr542152 1773 1586 856 ------
NM_016447chr71215 ------
NM_016454chr152296 276 ------
NM_016467chr231401 1145 33 31264 323 242 ----
NM_016470chr201530 1169 ----
NM_016480chr51608 --2762 38 --
NM_016485chr642152 2073 552 403 ------
NM_016513chr663611 3545 2711 2413 2356 300 1416 11017 --
NM_016522chr1121515 1262 ------
NM_016530chr1573930 3803 3659 3172 1390 1221 1044 --23548 575 --
NM_016531chr474240 3251 1651 1366 1244 892 842 --11669 --
NM_016542chrX61662 1578 1533 1460 679 373 --1202 --
NM_016545chr12916 216 ------
NM_016557chr36941 933 851 837 373 367 1112 ----
NM_016559chr34968 523 517 478 --11488 --
NM_016578chr11------1476
NM_016599chr43200 171 141 1113 --11080
NM_016603chr561989 1669 617 474 351 310 ----11404
NM_016613chr482126 2067 1917 1715 1053 727 475 412 --22415 2217 1687
NM_016617chr132629 401 --1320 --
NM_016618chr23436 411 110 ------
NM_016620chr121227 319 ----11044
NM_016625chr3176 --1331 --
NM_016626chr1861798 1644 1485 610 513 275 11692 ----
NM_016639chr161553 ------
NM_016644chr52509 370 ------
NM_016654chr1521074 538 --1474 --
NM_016656chrX1401 1154 ----
NM_016824chr1031434 579 269 --11720 --
NM_016931chr11148 ------
NM_016946chr1----13635 13602
NM_016950chr431389 523 319 ------
NM_016953chr296086 5772 5620 5372 2111 1950 1880 1286 1209 34961 4418 911 55064 4917 4651 3946 3826 14315
NM_017412chr821083 879 --21034 392 --
NM_017420chr1463788 2560 2398 1163 944 391 ------
NM_017423chr441696 1658 1428 82 --1408 --
NM_017437chr14--2325 312 ----
NM_017440chr122245 175 ------
NM_017447chr2173755 3658 3495 3343 1369 1214 765 14090 33898 1497 663 --
NM_017452chr2041530 1413 1164 499 --11501 --
NM_017453chr2041530 1413 1164 499 --11501 --
NM_017454chr2041530 1413 1164 499 --11501 --
NM_017489chr81426 --11149 --
NM_017516chr11--11103 ----
NM_017519chr621163 54 --21183 1066 --
NM_017522chr131349 1029 1020 ------
NM_017548chr332034 401 160 --22047 380 --
NM_017551chr1062626 2125 1813 687 477 196 --1425 --
NM_017554chr371590 674 456 338 328 230 150 --1197 --
NM_017563chr3146349 6320 5424 5185 4856 4704 4669 2148 1842 1606 1498 1107 933 190 12530 35080 4095 244 --
NM_017569chr13----1377 --
NM_017578chr33121 100 88 ------
NM_017582chr131483 1428 437 ------
NM_017590chr224536 306 300 287 12529 12641 --
NM_017599chr1281836 1505 1438 1414 501 403 248 145 1736 ----
NM_017610chr1532058 777 138 ----11518
NM_017612chr123524 496 450 --136 --
NM_017628chr4155185 4619 4495 4082 2110 2096 2079 2051 1999 1300 1143 872 746 243 22 11825 21989 1365 --
NM_017629chr141232 675 622 29 --11666 --
NM_017632chr41320 ------
NM_017634chr821536 1222 ----21953 720
NM_017635chr113612 282 31 11308 ----
NM_017637chr9179344 8876 8144 7750 6751 6483 5913 3261 3083 2768 2001 1057 1028 997 584 563 334 --29459 384 --
NM_017641chr121219 ------
NM_017643chr1782571 2405 2391 1909 1250 483 459 299 1191 33084 871 207 --
NM_017644chr384998 4511 4461 3215 1839 1130 803 554 --24830 1852 14408
NM_017650chr7105719 5587 5440 5185 4461 4391 4087 1157 461 146 1268 34743 2283 1973 --
NM_017655chr131504 1289 560 ------
NM_017658chr1463994 3469 2857 958 612 108 21736 1424 --34223 3148 1402
NM_017664chr134929 155 119 75 --194 --
NM_017673chr1------1875
NM_017680chr93935 911 868 ------
NM_017693chr1371368 1200 1147 1008 449 273 22 ------
NM_017709chr1123748 3646 3438 3385 3374 3365 3270 1529 1117 1016 715 467 14088 ----
NM_017737chr131662 1612 148 --21557 612 --
NM_017740chr1651846 1759 1250 98 75 ------
NM_017745chrX2534 69 ------
NM_017754chr694145 3586 3327 3247 1565 1527 1423 1004 602 33933 1277 1243 14810 1736
NM_017762chr1582276 2004 1720 1583 979 588 574 42 --194 --
NM_017768chr11296 2880 651 ----
NM_017778chr861380 1150 1094 431 271 165 1258 --1221
NM_017780chr81314 ------
NM_017786chr81519 1613 ----
NM_017794chr91324 ------
NM_017799chr1441825 1406 320 38 ------
NM_017801chr34936 675 277 258 12566 ----
NM_017811chr952957 2936 2217 1910 125 13040 ----
NM_017813chr8105748 5383 4063 3623 1588 1101 906 792 409 35 24483 1418 24676 402 --
NM_017824chr1072668 2533 2158 2149 1899 810 391 12561 ----
NM_017831chr1873455 3438 1228 998 925 362 337 23491 1341 14370 --
NM_017848chrX74001 3788 3385 1462 1221 1128 431 23175 511 --12881
NM_017851chr15153 --1126 --
NM_017864chr8295 21 ------
NM_017902chr1075709 5500 4751 4658 1365 318 276 25364 1439 11467 --
NM_017905chr132571 544 ------
NM_017910chr21146 ----1120
NM_017919chr9105433 5188 5028 4888 3736 1656 1540 579 516 291 12114 ----
NM_017923chr43806 521 256 ------
NM_017925chr931852 662 655 --21796 1775 --
NM_017935chr42628 272 ----1659
NM_017938chrX61908 1693 1528 1398 1382 602 --1443 --
NM_017944chr1161219 1068 1046 953 683 452 12865 ----
NM_017953chr1142 21123 761 --11042
NM_017964chr2168 152 1960 --
NM_017987chr1072176 2024 1982 1968 1617 326 80 --1258 --
NM_017998chr951119 1084 1032 960 550 --1395 --
NM_018027chr1052935 2504 2028 1277 204 --1604 --
NM_018028chr191144 --11310 --
NM_018030chr182321 127 ------
NM_018031chr3--1223 ----
NM_018036chr14144251 4145 3953 3903 3882 3679 3044 2727 1732 1343 1313 1294 731 68 13140 24187 383 --
NM_018046chr53664 286 146 1194 ----
NM_018047chr52955 889 ------
NM_018064chr6----1251 --
NM_018070chr11165 ------
NM_018084chr283085 2249 2153 1138 1120 1019 864 104 --22341 2019 --
NM_018085chr1127919 7753 6964 6912 6090 5613 5343 4949 1341 684 514 148 --15451 17137
NM_018086chr241356 749 427 389 11278 ----
NM_018087chr13248 182 42 ------
NM_018092chr1641613 539 350 101 --11065 11286
NM_018098chr31906 1406 ----
NM_018103chr11279 --140 --
NM_018117chr10--2778 300 ----
NM_018121chr1062700 1178 997 526 395 210 ------
NM_018126chr411138 1106 ----
NM_018137chr111297 --21287 439 --
NM_018139chr142141 121 ------
NM_018155chr373346 2727 2678 2488 2277 2203 674 --1387 --
NM_018157chr1282774 2608 2149 1272 1015 987 518 445 12106 ----
NM_018169chr121452 --1509 --
NM_018176chr431291 1046 320 --11511 21019 601
NM_018178chr141954 1869 464 140 --11788 --
NM_018181chr1831697 1436 557 --1219 --
NM_018206chr161747 1242 ----
NM_018211chr131723 664 70 31366 401 235 ----
NM_018214chr6--11102 ----
NM_018222chr1131927 1828 173 1292 ----
NM_018227chr453021 3013 2617 357 225 23034 663 12913 --
NM_018230chr12542 476 --193 --
NM_018246chr852646 2317 1126 508 51 --22444 719 1222
NM_018247chr643128 2594 1251 903 12185 1114 --
NM_018254chr122436 30 1616 12369 --
NM_018263chr252561 2307 1949 1895 814 12287 2983 867 --
NM_018287chr1021310 200 ------
NM_018293chr352125 2052 1953 979 303 1543 ----
NM_018299chr853128 1362 1283 892 189 --13414 --
NM_018302chr461885 1853 1690 652 532 502 --1283 --
NM_018312chr111377 1516 21404 369 --
NM_018313chr322146 171 ----1865
NM_018315chr451370 1237 388 255 193 ----11594
NM_018323chr411457 1108 1321 --
NM_018327chr2051670 1514 671 165 121 --1103 --
NM_018340chr1663826 3662 1069 1051 608 492 --14300 --
NM_018348chr1631118 788 25 ------
NM_018351chr1294559 3678 3531 3187 1884 1165 974 531 156 --13867 24250 1236
NM_018362chr1153935 3570 2603 2463 1135 34030 3763 993 --11284
NM_018364chr182510 1292 1151 836 429 256 67 31 12768 ----
NM_018372chr11572 --1134 --
NM_018374chr785207 4479 4148 3935 3569 1229 1002 979 24196 1434 34562 880 761 --
NM_018383chr231950 1710 1315 --1829 11725
NM_018386chr131134 2347 264 ----
NM_018387chr92511 505 ------
NM_018388chrX21349 274 ------
NM_018398chr3--1311 ----
NM_018409chr462527 2464 2293 916 750 170 --23300 2379 --
NM_018424chr921723 517 ----1643
NM_018429chr552375 1167 645 387 253 ------
NM_018437chr91466 ----145
NM_018442chr1189 ------
NM_018444chr832192 1671 591 --11453 --
NM_018448chr12----2817 434 --
NM_018452chr6_random53723 3696 3667 1459 1065 --2736 240 --
NM_018456chr3199 ------
NM_018466chrX------1740
NM_018469chr1751396 1141 599 185 99 21011 531 1343 11152
NM_018471chr21491 ------
NM_018482chr842268 1909 1813 497 22168 2081 ----
NM_018489chr132312 575 389 ----1321
NM_018490chr113622 396 349 1578 11729 1454
NM_018557chr211576 ----1225
NM_018566chr1175050 5036 3680 3574 3272 3154 2007 1683 1265 974 788 667 613 427 421 320 314 1123 --11782
NM_018569chr441021 1001 306 185 21056 219 ----
NM_018590chr1021411 144 1570 11609 --
NM_018602chr1521546 1163 3569 355 168 ----
NM_018638chr1285286 3974 3811 3738 3602 1787 1462 1364 --24978 3437 1633
NM_018640chr1282554 2467 2241 2105 1951 900 656 458 --2988 735 --
NM_018650chr13533 459 410 1863 ----
NM_018652chr151154 ------
NM_018657chr31150 --1550 --
NM_018660chr852779 2096 1936 346 153 ----1605
NM_018664chr1177 ------
NM_018691chr551126 931 365 329 254 11054 11008 --
NM_018695chr532230 1819 1563 --11975 --
NM_018698chrX81972 1822 1812 1488 1427 1386 1314 493 --21904 1731 --
NM_018700chr531116 244 237 ------
NM_018712chr1111475 --21224 1016 --
NM_018717chr462867 2818 2749 2401 404 27 ------
NM_018718chr761797 1606 892 879 825 335 --22001 1473 --
NM_018834chr51935 --1271 --
NM_018837chr201645 --1183 --
NM_018841chr173859 2908 2580 989 970 120 104 23091 81 ----
NM_018844chr731542 710 465 --11508 11483
NM_018847chr931984 1795 1241 1430 11558 --
NM_018890chr721145 124 1952 --11363
NM_018898chr562317 2082 1603 1491 577 387 1465 11754 11937
NM_018899chr562317 2082 1603 1491 577 387 1465 11754 11937
NM_018900chr562317 2082 1603 1491 577 387 1465 11754 11937
NM_018901chr562317 2082 1603 1491 577 387 1465 11754 11937
NM_018902chr562317 2082 1603 1491 577 387 1465 11754 11937
NM_018903chr562317 2082 1603 1491 577 387 1465 11754 11937
NM_018904chr562317 2082 1603 1491 577 387 1465 11754 11937
NM_018905chr562317 2082 1603 1491 577 387 1465 11754 11937
NM_018906chr562317 2082 1603 1491 577 387 1465 11754 11937
NM_018907chr562317 2082 1603 1491 577 387 1465 11754 11937
NM_018908chr562317 2082 1603 1491 577 387 1465 11754 11937
NM_018909chr562317 2082 1603 1491 577 387 1465 11754 11937
NM_018910chr562317 2082 1603 1491 577 387 1465 11754 11937
NM_018911chr562317 2082 1603 1491 577 387 1465 11754 11937
NM_018933chr54344 327 185 75 ------
NM_018938chr521147 434 1391 2945 108 --
NM_018945chr683432 3350 3077 2507 969 562 527 217 11005 ----
NM_018951chr71879 ------
NM_018970chr7103195 2983 2731 2493 2210 1976 1948 1212 782 342 --11121 --
NM_018975chr162667 208 1553 1812 --
NM_018976chr1282827 2778 2302 957 876 382 322 283 1829 2792 248 --
NM_018979chr1271672 1624 794 654 593 543 236 1944 1217 --
NM_018992chr161633 11647 --11400
NM_018993chr202547 156 --11018 --
NM_018999chr10144678 4626 4235 4103 3829 3252 1981 801 794 749 660 346 120 80 14413 ----
NM_019001chr364069 3580 3496 3375 1279 629 23024 527 23505 703 1444
NM_019004chr742209 2157 2022 1859 --1923 1481
NM_019006chr151177 ------
NM_019008chr2223198 2773 13693 23575 2536 12299
NM_019022chr1863166 1278 1023 914 581 255 --32503 2074 473 --
NM_019024chr21295 ------
NM_019027chr432527 527 341 1185 22421 1678 --
NM_019035chr421954 411 --1451 --
NM_019036chr63145 79 40 --1271 --
NM_019040chr11----189 --
NM_019050chr442262 1525 115 97 --22184 681 --
NM_019063chr252132 1979 1725 673 21 1171 ----
NM_019072chr574233 4179 3887 2891 2717 810 371 11101 34282 3221 833 23075 2669
NM_019073chr11107 ------
NM_019080chr1341393 1235 1110 348 --172 1594
NM_019083chr171469 1251 1075 530 517 500 475 11134 --11645
NM_019084chr1072311 2304 2022 1959 976 463 305 22152 2052 21685 571 --
NM_019087chr511718 --11633 --
NM_019091chr24455 431 397 21 --2794 207 --
NM_019094chr1283452 2993 2740 2326 1054 677 649 603 --2484 129 1534
NM_019098chr821555 219 41691 1629 725 67 ----
NM_019106chr2243442 2618 734 382 --13222 --
NM_019114chr93582 340 140 21020 561 22139 839 --
NM_019116chr1633548 568 218 1186 12568 --
NM_019117chrX82735 2485 2262 1197 1159 780 513 147 --21217 892 12567
NM_019593chr2043091 2885 2790 2505 11152 1341 --
NM_019594chr9------1390
NM_019610chr181713 1661 1499 815 740 655 263 75 --22206 769 --
NM_019891chr1----11253 --
NM_019895chr321114 25 ------
NM_019903chr1031434 579 269 --11720 --
NM_020066chr12970 321 1734 141 --
NM_020116chr431696 531 172 11656 --177
NM_020122chr2105767 5310 4627 4577 4567 4549 4390 2072 1347 64 --21330 1159 --
NM_020123chr1031310 632 34 ------
NM_020132chr2154045 1381 1339 1022 87 14554 13747 --
NM_020141chr131732 857 203 --12381 --
NM_020143chr21316 1986 2357 89 --
NM_020144chr74808 410 360 95 ------
NM_020150chr101382 --21814 59 1399
NM_020152chr214966 852 152 122 --1891 --
NM_020157chr202832 661 1646 ----
NM_020159chr421333 43 --31220 144 102 --
NM_020177chr583253 2524 2336 2256 2138 959 593 354 11121 21194 666 22317 980
NM_020189chr8----171 --
NM_020194chr2138 ----1659
NM_020210chr151290 ------
NM_020245chr654444 4433 4332 4197 3779 --1281 --
NM_020311chr21758 ------
NM_020336chr20----1265 --
NM_020337chr463101 2517 2058 1939 1215 503 --1755 --
NM_020342chr231826 473 48 22537 1059 1483 --
NM_020346chr1131286 1217 525 --11674 --
NM_020348chr1021835 411 --22407 2231 --
NM_020357chr341532 1363 1308 302 11506 1491 --
NM_020364chrY21138 732 --2446 208 --
NM_020381chr641973 1779 1325 452 ------
NM_020390chr3114904 4862 4238 3927 3369 3177 3072 1879 1464 909 796 14105 74939 4869 4440 3209 3199 3099 3054 --
NM_020403chr1351786 1745 1348 191 90 11518 3558 121 28 --
NM_020420chrY21138 732 --2446 208 --
NM_020425chr641968 718 166 140 11636 ----
NM_020429chr76918 635 543 526 445 59 --23142 1088 --
NM_020432chr742121 935 690 387 12000 ----
NM_020440chr152774 2764 1289 416 247 --33060 703 586 --
NM_020452chr112182 ------
NM_020455chr642678 1833 1039 199 12411 181 --
NM_020463chr2148 --2363 259 11203
NM_020466chr694632 4502 3753 3311 3113 1891 1650 1061 765 --13696 13124
NM_020474chr181622 --1563 --
NM_020525chr12258 28 ------
NM_020532chr21741 ------
NM_020640chr32109 70 --21660 622 1403
NM_020644chr115966 906 325 199 46 ------
NM_020647chr892313 2111 1757 1600 850 638 462 410 31 ------
NM_020651chr23404 324 152 ------
NM_020653chr17146 --135 --
NM_020654chr321432 1227 1599 197 --
NM_020666chr52657 156 1837 ----
NM_020673chr20107191 6892 6758 5946 2934 1764 1672 1574 821 475 13070 11524 11308
NM_020686chr1643079 1912 916 319 --11014 --
NM_020689chr2021648 1104 ------
NM_020693chr112481 362 ------
NM_020699chr185184 4978 4849 4787 4437 4394 1269 68 11287 24524 663 --
NM_020706chr211132 ------
NM_020711chr21932 21764 1684 41756 1676 833 822 12607
NM_020717chrX74584 4329 4265 4191 4083 3217 1407 11530 13606 --
NM_020718chr16124815 4729 4321 4233 4212 4151 4045 2190 1969 1719 1683 1366 --12563 15896
NM_020727chr2193544 3194 2858 2851 2504 1546 999 499 172 11444 21131 186 23319 703
NM_020728chr752448 2135 1201 1105 669 22492 781 ----
NM_020732chr621163 54 --21183 1066 --
NM_020734chr1243338 494 457 71 12392 22664 381 --
NM_020739chr1534105 3306 3288 1437 23970 3412 --
NM_020740chr17194 ------
NM_020742chrX2257 211 12092 22412 1080 --
NM_020747chr51820 ------
NM_020748chr1751834 1544 648 122 71 1814 11697 --
NM_020752chr1042639 719 667 389 1457 22927 580 1942
NM_020760chr21718 --1708 --
NM_020762chr123846 199 104 --181 --
NM_020766chrX34483 2977 703 ----13107
NM_020771chr631566 191 39 1124 ----
NM_020772chr17187432 6973 6912 6781 5658 5354 2873 2703 2354 2103 2036 1303 874 764 733 699 365 183 37369 5297 2466 --25884 1819
NM_020774chr18106148 5891 5859 4779 4092 3891 1625 722 651 447 35837 4586 4219 ----
NM_020778chr1584561 4286 3297 1479 850 550 409 55 1540 11462 --
NM_020779chr262887 2388 1011 436 177 24 ----1687
NM_020782chr1264736 4105 1928 1905 950 189 --21703 1593 --
NM_020783chr1862056 861 557 424 254 157 ----11519
NM_020792chr352123 1857 979 271 137 1185 1304 --
NM_020801chr532167 1881 589 --1369 --
NM_020805chr185695 284 254 185 98 1245 31744 1298 562 --
NM_020806chr143793 339 77 ------
NM_020809chr1162233 1932 1713 873 805 594 ------
NM_020810chr1442886 2415 1144 204 ------
NM_020815chr42416 119 ------
NM_020818chr14----167 --
NM_020819chr681249 1173 961 800 492 316 165 30 ------
NM_020824chr10--2590 245 ----
NM_020830chr253052 2298 1104 998 257 1938 1969 13107
NM_020834chr1441299 1262 600 490 21612 50 ----
NM_020839chr361558 1441 1407 1102 381 365 11080 1534 --
NM_020841chr12114051 3999 3353 3303 3096 2761 2712 1267 1156 1133 285 ------
NM_020850chr1673149 3001 2331 1306 1226 1095 76 --1792 --
NM_020853chr1221884 692 22288 852 11102 --
NM_020854chr1831158 1035 189 --11397 --
NM_020860chr42902 156 ----1433
NM_020861chr65971 886 323 311 193 ------
NM_020866chr1331082 354 270 ------
NM_020868chr221670 1384 31723 1363 102 --11546
NM_020870chr431862 1396 290 1701 ----
NM_020871chrX2631 498 42024 389 308 199 1447 --
NM_020872chr341310 416 193 108 --11489 --
NM_020918chr1063570 965 915 872 233 62 --1312 --
NM_020919chr221273 859 ------
NM_020921chr1453565 3411 2577 483 110 32397 2378 73 12355 --
NM_020925chr121388 1201 ------
NM_020935chr274358 4012 3915 3591 3348 1304 117 11318 ----
NM_020940chr10122729 2483 2474 2286 2206 2152 1926 743 574 564 505 221 --1443 1593
NM_020948chr193657 3179 2262 1282 1203 807 754 430 126 11069 23410 2346 --
NM_020958chr141324 ------
NM_020962chr1522133 572 ----12060
NM_020963chr11179 ------
NM_020964chr18114813 4220 4177 3989 1540 1101 950 621 454 73 53 14056 34698 4539 4464 11623
NM_020975chr1041789 1333 1284 150 11825 ----
NM_020981chr22602 264 1155 ----
NM_020987chr102953 409 1200 ----
NM_020989chr2122 ------
NM_020993chr1272845 2452 2055 1828 1135 246 67 --11751 --
NM_021003chr146752 254 154 90 59 53 ------
NM_021005chr1521108 343 --1238 --
NM_021007chr242397 2353 2004 538 1284 ----
NM_021032chr332037 2000 1585 --11436 --
NM_021033chr1393484 3391 2766 2457 805 498 373 309 228 32827 2614 1391 21208 782 --
NM_021038chr343319 2899 2127 604 22410 821 12643 13267
NM_021061chr8104442 3565 3510 3164 3124 3103 994 964 237 131 ------
NM_021064chr631721 1115 381 ------
NM_021069chr452162 1879 1830 668 513 ------
NM_021072chr572567 2088 1638 1620 529 386 123 12095 22268 720 --
NM_021076chr221225 --180 --
NM_021079chr1762941 2810 2506 2076 156 80 --13168 --
NM_021083chrX73659 2747 2696 2510 2370 1043 765 21284 853 23394 2792 12959
NM_021097chr252777 2547 2410 2271 119 --12904 --
NM_021101chr322448 2104 --1892 --
NM_021109chrX179 --1383 --
NM_021109chrX179 --1383 --
NM_021116chr7169045 8857 8838 8777 8197 7558 6630 6128 5900 5777 3323 3249 2640 1486 1459 400 --13402 --
NM_021132chr1031276 1193 242 ------
NM_021136chr143649 140 56 --1660 1537
NM_021140chrX31181 438 416 ------
NM_021145chr711144 1105 ----
NM_021148chr732414 1855 674 --12363 1475
NM_021151chr721068 857 ------
NM_021159chr431502 1163 552 ----11721
NM_021167chr732150 2095 1730 --12221 12311
NM_021176chr241883 1573 294 100 --11513 --
NM_021183chrX62567 2475 2425 1603 670 341 ------
NM_021190chr111367 1289 ----
NM_021191chr1251011 862 778 431 377 11623 1454 --
NM_021204chr41148 184 ----
NM_021228chr191219 ------
NM_021238chr123682 315 155 --1346 --
NM_021239chr1431307 1046 315 --21285 383 --
NM_021240chr92624 162 ----1154
NM_021245chr10149 ------
NM_021252chr1042104 2037 1298 249 1539 1466 --
NM_021255chr1453047 2866 2837 2769 621 11036 53685 689 679 597 25 13768
NM_021572chr621167 294 --2413 395 --
NM_021574chr2242195 2043 938 906 1317 12079 --
NM_021622chr1042030 1763 830 645 --21996 353 1325
NM_021627chr311120 1935 11159 --
NM_021629chr374005 3883 1750 1707 1598 1468 352 44462 4037 1486 1438 ----
NM_021638chr4114629 4462 3127 3111 1845 1261 1139 1050 222 124 107 14062 ----
NM_021644chr103849 811 417 ------
NM_021645chr1341699 1605 665 498 11497 --11718
NM_021647chr464773 4245 3737 3372 2941 1750 --13084 --
NM_021648chr652600 2181 1713 965 393 2919 346 ----
NM_021705chr61154 --11142 --
NM_021722chr73573 505 47 ------
NM_021723chr73614 546 47 ------
NM_021809chr2042217 1934 1842 842 --12471 --
NM_021813chr6155494 5483 4839 4772 4363 3652 2077 1748 915 905 849 636 504 371 259 --35293 5285 390 --
NM_021814chr631122 650 82 ----1314
NM_021815chr282723 2610 2321 2246 2016 1215 1131 540 --32998 430 189 12387
NM_021818chr1441475 1321 317 124 ------
NM_021911chr5104240 3993 3881 2246 2233 1945 1871 1504 1173 1081 14486 13942 14437
NM_021912chr1563695 3585 3136 2984 1166 790 11452 --1279
NM_021914chr1462074 1840 925 757 377 248 1577 1908 --
NM_021940chr641342 265 210 161 21331 1089 11605 --
NM_021945chr6143508 3296 2852 2573 2517 1401 1388 1215 1086 1004 903 749 622 42 --1734 --
NM_021946chrX1178 --1518 --
NM_021949chrX42383 2281 1920 413 12870 154 --
NM_021950chr1182223 2044 1825 911 640 476 219 189 --2890 817 --
NM_021954chr1363044 2751 1465 1381 208 27 1470 ----
NM_021956chr611441 ----154
NM_021960chr152776 2692 917 785 87 --2816 672 --
NM_021961chr11126292 5656 4896 2337 2326 1666 1593 1474 1183 273 140 85 36016 5026 1738 37312 5616 5357 --
NM_021964chr3136121 5594 5528 4422 4356 4263 4150 2164 1755 1030 686 297 150 14468 55711 1896 1505 1210 1024 12410
NM_021970chr43691 509 248 1124 ----
NM_021973chr41145 ------
NM_021977chr683771 3176 3145 1500 1362 919 624 345 --13704 --
NM_021979chr14------1149
NM_021998chrX31375 924 398 ------
NM_021999chr131820 --2583 269 --
NM_022037chr22860 202 1908 ----
NM_022041chr1632358 2014 624 --12642 --
NM_022048chr1586286 5940 5755 5155 4031 2345 1744 1126 22325 1056 ----
NM_022049chr131899 1697 1672 11195 ----
NM_022051chr13578 192 59 --2706 132 --
NM_022058chr262102 2064 1754 1517 1317 143 1109 1676 1620
NM_022087chr71567 ------
NM_022114chr154023 3973 1366 1318 142 --34615 1418 1226 --
NM_022118chr131204 --192 --
NM_022130chr531407 1166 335 --1318 --
NM_022143chr741452 254 184 57 ------
NM_022154chr431334 925 885 1864 1536 --
NM_022166chr1655859 5051 3968 1637 783 --14399 --
NM_022173chr22860 202 1908 ----
NM_022351chr862840 2787 1316 876 789 184 13293 1154 13168
NM_022373chr7169 --187 --
NM_022444chr751806 256 187 156 81 21915 358 1285 --
NM_022456chr12157351 6200 6054 5817 5754 5600 4752 3041 2808 2500 2392 2307 1311 966 39 --21881 1539 --
NM_022458chr783054 3020 2555 1220 978 792 473 186 ------
NM_022459chr13146145 5635 5590 4668 2471 2446 2001 1707 1686 1299 1067 923 178 167 11331 12112 11671
NM_022465chr1252705 864 586 358 336 1295 ----
NM_022469chr113062 --1602 13210
NM_022476chr1621109 922 1943 ----
NM_022491chr1263101 1371 1223 335 201 177 22776 93 11013 --
NM_022497chr343671 3448 2764 237 12832 ----
NM_022550chr51379 ----1112
NM_022650chr54796 625 408 163 1894 --1647
NM_022716chr142811 2012 1993 1022 11944 ----
NM_022725chr1131614 1525 308 ------
NM_022726chr621341 1297 --1697 --
NM_022728chr73646 531 90 ------
NM_022739chr171444 1913 2388 166 --
NM_022755chr932562 984 815 --22129 170 1691
NM_022756chr13569 509 321 ----1968
NM_022763chr383118 2969 2858 2604 1215 808 784 719 ------
NM_022776chr31420 --11544 --
NM_022781chr993304 2559 2295 1303 1160 1117 850 458 164 12368 ----
NM_022782chr124372 341 325 291 1253 ----
NM_022784chr153948 196 21 --1165 --
NM_022802chr1041465 1326 1273 222 ------
NM_022818chr1641666 1426 1219 194 ----11258
NM_022824chr591707 1600 1447 1408 1310 1278 1216 594 245 ------
NM_022825chrX----1300 --
NM_022832chr462263 1700 758 646 425 392 ----1985
NM_022838chrX1120 ------
NM_022841chr1522789 353 ------
NM_022843chr133263 211 100 --1112 --
NM_022845chr1652108 1736 1691 1512 96 --1428 --
NM_022897chr52363 136 ------
NM_022901chr931890 687 91 1553 --11526
NM_022912chr262541 2404 2100 908 657 327 --32625 2089 469 --
NM_022918chr1132001 1618 1383 1535 12153 11882
NM_022977chrX52408 1746 1695 712 360 1173 ----
NM_023010chrX4811 797 268 209 --1192 --
NM_023016chr262526 2409 1152 829 742 629 11032 12782 --
NM_023037chr132798 265 11078 1342 --
NM_023071chr1251155 395 53 46 40 ------
NM_023072chr1911036 ------
NM_023079chr1711625 ------
NM_023112chr1472529 2436 2378 1062 503 169 77 2568 90 12957 --
NM_023914chr351364 650 557 361 22 ------
NM_023923chr153333 3326 3278 3257 3248 13647 ----
NM_023929chr841972 1736 780 377 12552 158 1553
NM_024007chr553155 2311 2269 655 121 22991 593 12932 --
NM_024016chr17----1624 --
NM_024052chr1752374 1190 845 752 279 ------
NM_024090chr441372 624 608 433 21421 137 ----
NM_024315chr73387 375 355 --1431 1395
NM_024332chrX2607 65 --21442 408 --
NM_024345chr995830 5252 5237 5150 4515 2075 1927 1873 373 161 11211 --
NM_024348chr91296 ------
NM_024416chr941559 1479 1466 1420 ------
NM_024424chr1121155 122 1943 ----
NM_024425chr1121155 122 1943 ----
NM_024426chr1121155 122 1943 ----
NM_024512chr333141 1156 297 --11372 --
NM_024524chr373069 2856 2792 2429 2421 1290 594 --1136 --
NM_024525chr11113 ------
NM_024529chr131158 473 172 11040 1797 --
NM_024539chrX21231 173 --1292 --
NM_024548chr341785 1229 1117 34 11216 11633 --
NM_024556chr112486 94 ------
NM_024561chr13--1164 ----
NM_024567chr8--131 195 --
NM_024569chr152974 2451 930 736 360 --1627 --
NM_024586chr11156 --1565 --
NM_024595chr15783 444 213 96 67 --1146 --
NM_024612chr171866 --1273 --
NM_024613chr881889 1497 1381 1162 644 634 398 51 ------
NM_024617chr92626 269 1106 ----
NM_024636chr752708 2073 2057 622 357 32112 1992 47 ----
NM_024639chr622849 2777 11875 22880 365 --
NM_024645chr831284 1239 137 1335 ----
NM_024646chr163532 3249 1312 960 356 349 ----13311
NM_024665chr364691 4425 4103 3119 1762 938 11490 33609 874 192 --
NM_024670chr1051348 586 363 339 116 --11427 1254
NM_024675chr16----126 --
NM_024689chrX21172 223 --1418 --
NM_024713chr1541190 402 215 209 ------
NM_024715chr531639 1461 138 --21741 1615 --
NM_024721chr832214 1730 1029 --12449 --
NM_024740chr1143921 3582 1375 783 1327 --13814
NM_024744chr252391 1083 610 325 29 1305 ----
NM_024751chr431931 444 82 22082 1603 1290 --
NM_024753chr22749 53 ------
NM_024755chr153210 183 149 ------
NM_024761chr9105275 4200 3987 1719 1449 1195 1172 965 849 405 25099 2084 ----
NM_024770chr2136526 6279 5510 5291 5251 4137 2646 2620 2415 1851 997 513 319 12690 26470 4815 --
NM_024779chr1251388 1196 1121 389 137 --1450 --
NM_024792chr172196 161 ------
NM_024813chr13701 435 91 --1991 1459
NM_024817chr15105301 5020 4940 4536 4310 1796 1692 1129 1114 966 2684 119 --15054
NM_024834chr1041449 1368 1355 1340 1679 --11219
NM_024837chr1521559 140 1122 11695 --
NM_024857chr17----1119 --
NM_024887chr151715 1416 447 403 272 12074 11643 --
NM_024920chr441597 1230 532 285 21106 562 ----
NM_024921chrX91972 1789 1396 1389 622 468 449 290 27 --1167 --
NM_024930chr562745 2368 2282 2004 1036 772 --1545 --
NM_024947chr3149457 8943 8357 7739 7610 7278 3020 3011 2929 2302 2271 1552 376 73 --36474 3682 734 --
NM_024948chr103704 642 119 ----1515
NM_024953chr1262666 2578 2399 2089 365 164 ------
NM_024960chr20181 --1403 --
NM_024979chr1341684 1536 1440 1132 --21580 519 --
NM_024989chr2147699 7512 7506 6814 6807 6143 5107 2981 2970 2140 1532 1009 873 451 11680 34945 1907 654 --
NM_024993chr221410 449 1382 21495 265 --
NM_025040chr1961905 1546 1527 644 178 60 11840 1506 --
NM_025054chr873175 3146 3023 1416 1074 480 73 --1864 --
NM_025073chr164424 4021 3726 1790 1390 451 34438 335 133 1859 12962
NM_025074chr482756 2675 2019 406 304 242 232 147 11226 11254 --
NM_025114chr12143 1168 ----
NM_025125chr1011608 ------
NM_025126chr122747 546 ------
NM_025133chr26939 355 324 302 277 260 ----147
NM_025134chr161799 1570 12156 195
NM_025146chr342721 2355 1807 725 ----12662
NM_025151chr862102 2068 749 641 536 174 ------
NM_025152chr1452008 1884 1532 405 103 21703 1663 ----
NM_025160chr1104299 3910 3573 3180 3132 2987 2953 1420 783 510 54034 3649 1021 744 36 2668 24 --
NM_025179chr174195 3076 3005 1907 1870 917 430 13530 24939 4700 --
NM_025191chr183022 2486 2465 2350 2253 1223 972 943 13325 ----
NM_025221chr451273 1110 1072 504 95 ------
NM_025222chr332130 312 226 --12997 --
NM_025235chr1062177 1697 1551 879 780 271 --1387 --
NM_025238chr1541588 1536 1011 466 11205 2244 198 --
NM_025248chr1743115 1287 1088 208 1904 13123 --
NM_030576chr1752387 2334 2219 2053 1767 11009 22655 2609 --
NM_030621chr1464203 3859 2735 1544 779 342 1800 --23936 3048
NM_030623chr211282 147 1201 --
NM_030625chr103821 646 181 21652 963 1398 12522
NM_030627chr543386 1472 1348 863 32882 810 116 32616 742 555 --
NM_030634chr152024 1736 569 407 165 --147 --
NM_030647chr776192 5669 5440 3972 3911 2157 917 15336 35455 5302 366 --
NM_030648chr484948 4263 4247 4215 3523 1231 881 435 --34454 3504 134 12182
NM_030650chr273773 3203 2994 1374 1101 664 462 --1244 --
NM_030664chr1051961 1945 1732 524 167 21905 217 --1782
NM_030674chr1265859 5411 4759 950 805 773 34503 2178 201 1134 --
NM_030751chr1061810 1765 1730 1608 1180 413 11214 ----
NM_030751chr1061810 1765 1730 1608 1180 413 11214 ----
NM_030761chr172728 2665 2071 641 579 481 407 ----11058
NM_030771chr112118 83 --1301 --
NM_030773chr2051815 1608 1431 1310 1136 1240 ----
NM_030786chr161552 1429 1406 1343 585 425 11216 21459 447 --
NM_030791chr1451611 1518 1413 1270 1184 2272 109 ----
NM_030806chr1118016 7914 7575 7258 6612 6128 2832 1923 1548 291 246 13207 57684 3445 3429 2899 1319 --
NM_030815chr201553 ------
NM_030816chr142975 2819 602 562 --23323 2441 --
NM_030881chr2262251 2058 1666 994 839 293 12191 ----
NM_030915chr232302 2111 767 --21746 217 --
NM_030918chr1104882 4696 4225 4187 4147 3671 3645 3547 1072 748 --23731 1635 --
NM_030920chr152104 1783 1668 526 108 1237 11926 --
NM_030938chr172303 107 --21168 116 1463
NM_030958chr83461 64 53 ------
NM_030963chr61478 1527 ----
NM_030964chr573554 3308 3020 2597 2558 1406 136 --33498 1055 982 --
NM_031203chr191193 ------
NM_031216chr182532 23 11909 2667 265 1410
NM_031243chr722188 2088 --174 1675
NM_031262chr921062 928 --1733 --
NM_031263chr921119 985 --1790 --
NM_031266chr5283 65 ------
NM_031268chr1664831 4638 3617 1244 612 495 --15246 --
NM_031284chr152791 139 149 --1963
NM_031291chr4137 ------
NM_031296chr452487 2233 2074 2048 1033 12778 12347 --
NM_031305chr431728 1255 208 1327 21900 1867 --
NM_031362chr292510 2449 2354 2297 2139 2104 740 156 59 32664 2633 2585 21086 734 12426
NM_031365chr292646 2585 2490 2433 2275 2240 876 292 195 32800 2769 2721 1870 12562
NM_031366chr292646 2585 2490 2433 2275 2240 876 292 195 32800 2769 2721 1870 12562
NM_031369chr43555 237 55 ------
NM_031370chr43555 237 55 ------
NM_031371chr121377 211 ----1338
NM_031371chr121377 211 ----1338
NM_031411chr562317 2082 1603 1491 577 387 1465 11754 11937
NM_031418chr1182566 2546 1905 894 876 807 732 57 --12742 --
NM_031427chr1484926 4056 4020 3828 3749 3722 990 426 2155 29 14068 --
NM_031442chrX52700 2525 2088 1987 164 173 12463 --
NM_031445chr253075 2935 2848 2643 1260 --23400 3228 --
NM_031468chr7147867 7580 6168 5747 5210 5163 5154 1623 1189 1147 741 287 173 155 38107 8095 5068 37045 6806 2057 --
NM_031469chr632918 885 114 32503 1310 831 22860 1638 --
NM_031483chr2052928 2594 1418 1344 596 13272 33303 1098 1012 --
NM_031844chr183987 2746 1474 1215 1113 866 545 80 --23999 1273 11158
NM_031845chr283474 2790 2611 2483 2242 990 887 236 21211 409 1142 --
NM_031847chr283474 2790 2611 2483 2242 990 887 236 21211 409 1142 --
NM_031849chr562317 2082 1603 1491 577 387 1465 11754 11937
NM_031857chr562317 2082 1603 1491 577 387 1465 11754 11937
NM_031858chr1751358 615 280 274 24 ------
NM_031860chr562317 2082 1603 1491 577 387 1465 11754 11937
NM_031862chr1751358 615 280 274 24 ------
NM_031889chr41369 21907 775 11484 --
NM_031914chr141236 --1686 --
NM_031922chr62553 62 ------
NM_031935chr13803 357 104 --21061 757 --
NM_031942chr241243 967 423 63 11102 21183 829 --
NM_032012chr975253 5227 5107 4389 4090 1060 963 13761 25060 198 --
NM_032027chr1------1318
NM_032042chr532770 644 172 --22909 2001 --
NM_032047chr342441 2243 1959 1529 --11550 --
NM_032048chr183676 479 235 ----1623
NM_032102chr1111982 1214 22360 2341 --
NM_032105chr1208140 7972 7872 7159 6556 6450 6440 6184 6153 6109 6055 5494 5409 4945 3165 1697 1614 1509 514 434 --11548 --
NM_032121chrX51938 424 337 262 83 --22548 757 --
NM_032142chr183195 73 53 ------
NM_032144chr2--11735 21280 94 --
NM_032145chr651690 639 611 491 92 1329 11778 11929
NM_032146chr32443 30 ------
NM_032147chr122966 928 --1132 --
NM_032154chr10----1159 1115
NM_032160chr1864385 3499 3245 2865 1451 770 --13442 --
NM_032182chr1031534 573 332 ------
NM_032186chr121227 319 ----11044
NM_032189chr1374970 4895 4436 4365 3830 1609 630 14614 14381 --
NM_032199chr10103772 3396 3181 2997 2975 2495 1370 803 766 175 1883 13189 --
NM_032208chr233514 2218 206 --1493 --
NM_032217chr431109 1067 391 --2548 264 11217
NM_032221chr2041891 1673 1474 542 ----11406
NM_032228chr1133247 2596 307 ------
NM_032229chr131364 1195 ----
NM_032231chr151282 1327 ----
NM_032256chr123399 229 51 ------
NM_032268chr1672964 2597 2447 2190 799 503 420 --22008 371 --
NM_032288chr332065 894 114 12208 1579 --
NM_032291chr121791 1411 --1712 --
NM_032303chr931600 1308 536 11342 11295 --
NM_032312chr22632 373 --1148 --
NM_032315chr1--1215 1202 --
NM_032321chr2103140 3126 2453 2065 703 609 595 185 142 91 --22846 363 --
NM_032329chr284270 3978 3878 3382 3312 3057 2706 714 ------
NM_032352chr1421019 343 2974 501 --187
NM_032357chr24849 271 82 35 ------
NM_032373chr1095066 4709 4244 3883 1733 1701 1589 1565 354 --14536 --
NM_032379chr112644 353 --1753 --
NM_032380chr5----165 1139
NM_032382chr161433 --1388 --
NM_032410chr831277 1021 976 188 1471 1350
NM_032424chr1151434 1120 340 271 141 ------
NM_032435chr162209 2179 2147 1556 545 139 31851 1482 672 1209 --
NM_032437chr1--1114 ----
NM_032438chr621085 78 1422 1527 --
NM_032439chr1071119 1113 627 520 468 394 130 --11077 --
NM_032440chr1052344 2181 1938 1165 950 ------
NM_032445chr1582486 2341 2168 1951 1694 720 465 260 11820 1587 --
NM_032446chr5133144 3038 2967 2783 2581 2501 1114 737 642 487 382 115 73 11058 13246 --
NM_032449chr182608 2436 2280 820 779 613 445 358 ----1625
NM_032457chr493802 2743 2663 1259 923 827 819 752 689 ----13768
NM_032458chrX53024 2150 926 428 380 ------
NM_032471chr61336 --1821 --
NM_032482chr191233 1274 1906 --
NM_032491chr1231257 1200 849 1880 ----
NM_032499chr152254 55 11290 21283 1218 --
NM_032505chr342511 2434 749 300 42025 1018 733 452 32768 2129 1888 --
NM_032509chr862249 2135 1007 483 436 371 12582 2625 232 --
NM_032510chr1842395 2253 1684 130 ------
NM_032518chr4--1184 ----
NM_032520chr162223 158 ------
NM_032521chr2063118 2517 2186 2150 2022 554 --13146 --
NM_032523chr2262 52 ------
NM_032532chr62576 216 ------
NM_032536chr91451 ------
NM_032552chr971937 1871 1701 1637 1542 586 226 ------
NM_032557chr41674 --1861 --
NM_032558chr921027 255 --11354 --
NM_032574chr23238 215 63 ------
NM_032582chr172393 158 1533 128 --
NM_032594chr144955 920 234 81 --1434 1872
NM_032622chr451339 1191 1182 378 273 11296 ----
NM_032663chr1222011 1568 ----1442
NM_032682chr353309 3147 2944 2530 132 ------
NM_032689chr1921456 133 --173 --
NM_032784chr6--1793 1919 --
NM_032786chr121618 --1450 --
NM_032788chr231263 1137 1023 --1370 --
NM_032793chr1------1305
NM_032800chr122053 295 12684 12676 --
NM_032804chr1042507 2182 916 594 1427 12340 12072
NM_032824chr21325 ------
NM_032828chr1974863 3059 1351 975 728 211 140 --64901 3948 1360 1170 1015 887 --
NM_032833chr152666 2512 1637 921 116 1534 ----
NM_032837chr1781780 1721 1614 832 810 381 206 184 2791 64 2670 70 --
NM_032839chr32448 418 ------
NM_032858chr1246 21 ------
NM_032859chr1383868 2671 2511 1481 1425 795 758 645 --12946 --
NM_032869chr851752 1432 546 437 302 ------
NM_032873chr1154496 3648 3435 301 99 --34019 1533 404 --
NM_032880chr1----1151 --
NM_032892chr151265 ------
NM_032900chr1043542 2594 836 94 1262 12545 --
NM_032918chr1241086 1033 345 172 --21267 187 --
NM_032932chr17116241 6113 5950 5746 5730 5621 5051 4626 4123 1260 870 11251 ----
NM_032943chr112644 353 --1753 --
NM_032961chr441209 440 75 67 ------
NM_032968chrX103791 2817 1519 993 744 727 176 138 100 63 31580 1453 1108 21606 223 --
NM_032969chrX103791 2817 1519 993 744 727 176 138 100 63 31580 1453 1108 21606 223 --
NM_032973chrY113783 2812 1519 1452 993 744 727 176 138 100 63 21579 1108 21605 223 --
NM_032975chr1853419 2752 2533 1083 223 1299 ----
NM_032978chr184996 882 495 160 ------
NM_032979chr184996 882 495 160 ------
NM_032980chr1853419 2752 2533 1083 223 1299 ----
NM_032981chr184996 882 495 160 ------
NM_033014chr941559 1479 1466 1420 ------
NM_033020chr174407 1887 1393 863 752 692 661 11179 1419 --
NM_033027chr32171 143 --1244 --
NM_033030chr23487 361 73 ------
NM_033055chr13927 287 226 --1191 --
NM_033058chr82970 854 ------
NM_033081chr2021483 169 --2533 285 --
NM_033121chr1241413 1134 294 119 ------
NM_033127chr11177 ------
NM_033132chr131816 --22132 1550 --
NM_033133chr1783657 2981 2435 1380 757 738 148 126 --11337 --
NM_033138chr731611 681 270 --1798 --
NM_033139chr731611 681 270 --1798 --
NM_033140chr731611 681 270 --1798 --
NM_033143chr454498 4034 1258 1012 737 21662 1577 53860 3655 3175 3061 425 --
NM_033157chr731611 681 270 --1798 --
NM_033181chr643320 3242 281 97 13905 2587 343 --
NM_033196chr1951571 1285 1150 586 226 ----1157
NM_033211chr532046 512 209 31279 807 29 --11778
NM_033221chr982880 1941 1837 1797 1774 1043 756 300 ------
NM_033224chr7207860 7609 7372 7102 6846 6427 6254 5894 4918 3131 2753 2675 2444 2388 2371 2346 1586 568 526 266 15427 37352 5405 178 --
NM_033225chr82607 571 1783 1649 --
NM_033227chr52233 86 ------
NM_033260chr63825 663 328 --2619 198 --
NM_033285chr874505 4269 4206 2961 1330 1126 1042 23808 1400 11563 --
NM_033290chrX43651 3263 2873 938 --32945 2655 268 --
NM_033300chr131349 1029 1020 ------
NM_033326chr114579 531 444 98 ------
NM_033331chr943205 3053 1341 1046 --22990 70 --
NM_033360chr1294559 4338 4099 3982 3674 3017 2997 1754 1022 --43840 3713 1003 130 --
NM_033364chr351987 1891 1628 1550 1400 ------
NM_033379chr10------1144
NM_033380chrX4921 885 771 87 ------
NM_033381chrX4921 885 771 87 ------
NM_033394chr231608 1477 534 1222 11497 --
NM_033396chr11--1306 ----
NM_033402chr81221 --1194 --
NM_033407chr13667 642 457 ------
NM_033425chr1163111 2310 735 671 492 454 --13040 --
NM_033427chr76841 777 723 232 137 30 ------
NM_033429chr1553198 2838 2800 1037 547 --22625 2060 --
NM_033495chrX51052 1015 952 783 371 ------
NM_033503chr1543383 1229 1181 517 --23874 1359 --
NM_033505chr2105872 5396 5366 4702 4209 4103 1455 1372 1013 264 --25429 4853 --
NM_033535chr411131 --2999 134 --
NM_033632chr451370 1237 388 255 193 ----11594
NM_033637chr10113727 3269 3179 2953 2877 2865 1575 1065 883 455 204 --23891 3016 --
NM_033642chrX1361 ------
NM_033644chr552354 2298 2235 603 90 --22396 1958 --
NM_033645chr552354 2298 2235 603 90 --22396 1958 --
NM_033656chr2175893 4662 2362 1277 1102 997 90 13839 25732 408 --
NM_044472chr11725 ------
NM_052827chr121922 ------
NM_052832chr843046 1840 167 23 13018 32047 451 76 1425
NM_052834chr1842577 605 596 560 12268 ----
NM_052867chr132107 95 ----11049
NM_052879chr1243876 3567 3423 310 --23754 3546 13727
NM_052896chr152574 1945 1722 463 279 ------
NM_052900chr841709 1398 1129 588 --11550 --
NM_052904chr611311 2337 238 1142 11250
NM_052905chr251679 687 525 449 430 11469 ----
NM_052906chr2285079 5007 4965 1960 1679 1634 974 590 1571 ----
NM_052917chr242524 2406 126 77 1629 1240 --
NM_052918chr1053256 1498 1199 892 88 13339 11485 --
NM_052927chr531809 1586 307 --21493 595 --
NM_052932chr1162477 2337 1817 1584 955 663 ------
NM_052937chr842745 1692 749 705 ------
NM_052948chr193322 124 116 ------
NM_052951chr201202 ------
NM_052953chr31310 ------
NM_053002chr311142 11215 ----
NM_053016chr9177975 7949 7758 7721 7368 6891 6156 5063 4912 4888 2045 1933 1579 1473 1119 1113 642 ----11398
NM_053023chr1192762 2694 2378 2091 497 366 359 102 31 13107 ----
NM_053024chr341536 1210 1197 350 ------
NM_053025chr351753 1155 575 378 253 11364 11771 11320
NM_053026chr351753 1155 575 378 253 11364 11771 11320
NM_053027chr351753 1155 575 378 253 11364 11771 11320
NM_053028chr351753 1155 575 378 253 11364 11771 11320
NM_053031chr351753 1155 575 378 253 11364 11771 11320
NM_053032chr351753 1155 575 378 253 11364 11771 11320
NM_053042chr452859 2377 1282 1266 497 22719 828 22402 1057 --
NM_053043chr766287 5823 5270 4559 4402 1865 11961 ----
NM_053064chr1462464 1998 1201 1017 341 328 12483 22244 756 --
NM_054012chr92226 37 ------
NM_054016chr141713 1591 1480 213 12005 ----
NM_054016chr141713 1591 1480 213 12005 ----
NM_054016chr141713 1591 1480 213 12005 ----
NM_057168chr711332 11107 11687 --
NM_057169chr1272843 2708 1098 942 244 164 52 --1965 --
NM_057170chr1272843 2708 1098 942 244 164 52 --1965 --
NM_057175chr462618 2178 1905 1727 698 315 188 ----
NM_057180chr121369 ------
NM_057749chr82450 153 ------
NM_058170chr141400 1307 509 191 1166 11008 11434
NM_058241chr251800 1557 777 453 246 --21772 563 1931
NM_058241chr251800 1557 777 453 246 --21772 563 1931
NM_078483chr563959 3371 3355 2821 2529 790 --1357 --
NM_080425chr20141 ------
NM_080426chr20141 ------
NM_080546chr992245 2075 1909 1902 1746 560 341 244 58 --12287 1325
NM_080552chr202552 507 1597 ----
NM_080597chr182321 127 ------
NM_080629chr1------11270
NM_080630chr1------11270
NM_080632chrX4811 797 268 209 --1192 --
NM_080645chr64617 450 352 176 ------
NM_080664chr1472032 2001 1817 1666 1377 711 137 --1758 --
NM_080676chr2053254 2548 2526 1117 794 --2572 278 --
NM_080717chr1221032 451 --1184 --
NM_080737chrX21472 561 3514 501 310 31452 332 320 --
NM_080743chr641942 1916 1613 864 ------
NM_080752chr201437 ------
NM_080759chr1342216 529 274 259 12246 --12001
NM_080760chr1342216 529 274 259 12246 --12001
NM_080832chrX31701 609 386 --11484 --
NM_080840chr20198 ------
NM_080841chr20198 ------
NM_080867chr1475008 4686 4452 4270 3483 2016 1177 34742 1135 548 34648 2047 1363 13934
NM_080872chr843636 3448 1450 37 12485 23922 2662 1837
NM_080927chr353088 2390 1283 853 96 --1807 --
NM_130391chr973459 3347 2542 2522 614 111 98 --13431 --
NM_130392chr973459 3347 2542 2522 614 111 98 --13431 --
NM_130393chr973459 3347 2542 2522 614 111 98 --13431 --
NM_130398chr12144 48 ------
NM_130436chr2161995 1809 1091 548 251 147 ------
NM_130438chr2172572 2386 1125 828 724 451 188 --1275 --
NM_130439chr1042330 1935 910 633 --1241 11541
NM_130439chr1042330 1935 910 633 --1241 11541
NM_130798chr1511564 1514 ----
NM_130808chr3----1151 --
NM_130809chr562308 2124 962 716 632 133 22220 313 21172 644 1263
NM_130811chr2021001 147 ----1300
NM_130850chr141249 ------
NM_130851chr141249 ------
NM_130902chr4187 ------
NM_133170chr20117864 7301 7247 6875 6571 5647 5359 2299 1726 1587 1123 17479 24984 1907 --
NM_133264chr1753818 3478 3411 2498 1472 --13918 --
NM_133265chrX43341 3188 3089 765 23164 897 21033 868 --
NM_133326chr11355 ------
NM_133330chr452518 2481 2364 2334 1995 22662 2176 1802 1999
NM_133331chr452518 2481 2364 2334 1995 22662 2176 1802 1999
NM_133334chr496376 5700 5319 5207 4994 4550 2522 1512 175 1358 ----
NM_133335chr452518 2481 2364 2334 1995 22662 2176 1802 1999
NM_133367chr632872 583 554 11093 22803 2241 --
NM_133372chr542969 1016 464 332 11002 ----
NM_133378chr22918 40 ------
NM_133432chr22918 40 ------
NM_133433chr51813 ------
NM_133437chr22918 40 ------
NM_133443chr1621717 303 ------
NM_133452chr1941121 414 406 22 ------
NM_133477chr453291 3069 2979 1088 531 ------
NM_133478chr262185 1583 694 268 212 68 1541 ----
NM_133496chr184309 3964 2765 1789 1471 168 107 78 24073 1741 13263 --
NM_133503chr12--2764 683 1577 --
NM_133504chr12--2764 683 1577 --
NM_133505chr12--2764 683 1577 --
NM_133506chr12--2764 683 1577 --
NM_133507chr12--2942 861 1755 --
NM_133631chr31564 ------
NM_133638chr531129 1011 28 11037 ----
NM_133646chr2105007 4523 4378 4318 3694 3535 1644 1625 808 55 12126 14721 --
NM_133647chr1563725 3676 2433 1266 555 414 11227 1425 --
NM_134265chr1721050 871 1948 ----
NM_134442chr22649 130 ----11082
NM_134470chr33639 531 256 --1241 --
NM_138270chrX62924 2390 2368 1022 404 279 --22667 1312 --
NM_138285chr22398 79 ------
NM_138288chr1441979 1939 1640 317 --1572 --
NM_138316chr1041285 1186 373 280 ------
NM_138333chr961939 1751 996 692 686 296 --22506 2493 1465
NM_138335chr43785 703 25 1872 1668 --
NM_138340chr182514 39 2594 58 1163 --
NM_138348chr5125843 5639 5556 5531 5150 5112 4212 4082 2432 2247 2211 1882 11474 1909 --
NM_138357chr1011867 1592 ----
NM_138394chr2----146 --
NM_138395chr2--11174 11131 --
NM_138423chr1541804 759 512 235 1291 ----
NM_138426chr762132 783 579 539 424 400 --11528 --
NM_138437chrX1119 194 ----
NM_138444chr1344476 4429 4416 3682 23918 1200 13746 --
NM_138455chr8----1336 --
NM_138459chr683282 3228 3205 3013 2347 1467 1013 755 12576 1263 --
NM_138468chr2136018 5820 5811 5711 4150 2496 2151 1285 1242 882 506 133 43 --14984 --
NM_138473chr1254038 2009 1366 796 691 33822 3190 604 ----
NM_138479chr161805 1513 1498 624 509 365 21931 184 ----
NM_138558chr121076 149 ------
NM_138572chr622985 2698 --43262 3192 995 858 --
NM_138612chr16189 ------
NM_138621chr2144156 3883 3516 3489 3452 3302 3183 2849 2771 2605 1558 1490 751 365 1458 21543 376 --
NM_138635chr783142 2977 2670 2588 2133 901 183 149 1521 ----
NM_138638chr1462074 1840 925 757 377 248 1577 1908 --
NM_138690chr19----191 --
NM_138694chr6113574 2627 2456 2266 1333 1004 915 785 529 137 97 23211 269 23005 288 13325
NM_138711chr3------1167
NM_138712chr3------1167
NM_138713chr16158272 8254 7490 6537 6063 5926 5111 3264 2960 1286 701 626 482 446 290 36901 6449 2271 48199 7892 7052 3199 --
NM_138714chr16158272 8254 7490 6537 6063 5926 5111 3264 2960 1286 701 626 482 446 290 36901 6449 2271 48199 7892 7052 3199 --
NM_138720chr6154 ------
NM_138731chr14104182 3502 3344 2860 2660 2597 1626 1439 1328 909 32992 2935 90 11693 21282 247
NM_138771chr71577 ------
NM_138773chr52896 613 1790 ----
NM_138782chr552268 923 898 683 84 1957 32096 804 396 --
NM_138792chr15------1124
NM_138806chr32879 301 --1741 --
NM_138923chrX2346 70 ------
NM_138931chr31983 ----1719
NM_138959chr1126121 5310 4160 2418 1701 1281 1110 1063 965 577 311 263 26341 5454 ----
NM_138970chr143577 388 128 12222 22277 1836 --
NM_138971chr1163396 2702 2537 2378 1128 968 --23511 3221 --
NM_138971chr1163396 2702 2537 2378 1128 968 --23511 3221 --
NM_138972chr1163396 2702 2537 2378 1128 968 --23511 3221 --
NM_138972chr1163396 2702 2537 2378 1128 968 --23511 3221 --
NM_138973chr1163396 2702 2537 2378 1128 968 --23511 3221 --
NM_138973chr1163396 2702 2537 2378 1128 968 --23511 3221 --
NM_138980chr42276 211 ------
NM_138982chr42276 211 ------
NM_139012chr631592 697 550 11459 11642 --
NM_139014chr641672 777 630 40 11539 11722 --
NM_139047chr10173 ------
NM_139048chr32183 126 --31204 1155 912 --
NM_139049chr10173 ------
NM_139057chr1552792 1874 847 241 235 ------
NM_139078chr12----133 --
NM_139135chr141173 979 391 123 11071 ----
NM_139168chr521923 1593 --31402 575 119 11856
NM_139169chr1041842 1411 688 276 ------
NM_139207chr1271966 526 486 298 282 151 56 11844 1836 1456
NM_139276chr1782392 1753 1632 938 534 332 103 35 ------
NM_139279chr242899 2420 1144 81 --1553 --
NM_139283chr1231797 919 912 12250 12032 12237
NM_139312chr1021266 247 --11515 --
NM_139321chr2034139 4107 666 13492 ----
NM_139323chr207739 733 640 394 348 160 108 ------
NM_144498chr2042236 2178 106 95 ------
NM_144571chr4107041 6445 6329 5691 5637 5400 5219 461 381 291 26148 5454 35839 1599 628 12417
NM_144574chr143614 499 454 ------
NM_144578chr14105369 4444 3853 3681 3464 1297 669 349 141 116 --23740 2147 --
NM_144590chr1062842 2096 1988 1893 852 44 1966 12947 --
NM_144595chr133792 407 332 1342 --1946
NM_144599chr15115264 4365 4302 4158 4129 4079 3537 1435 1348 733 655 33364 2161 686 --15538
NM_144609chr1721357 1033 ------
NM_144610chr171381 ------
NM_144632chr232007 1838 971 22369 2119 1104 --
NM_144633chr341179 1043 463 420 --21160 173 --
NM_144658chrX1262 ------
NM_144664chr111204 1403 11603 12223
NM_144665chr111203 ------
NM_144721chr472661 2232 2217 1021 903 434 204 1589 ----
NM_144778chr1382109 1822 919 832 406 333 147 47 --11905 --
NM_144949chr242451 971 501 283 1702 ----
NM_144963chr822685 2409 --22581 2377 1589
NM_144966chr9----1199 --
NM_144967chrX51019 949 930 770 738 ------
NM_144973chr1262008 1609 1253 1152 849 752 --44406 1226 717 496 14257
NM_144982chr123821 688 617 ------
NM_145010chr1072327 1764 1500 897 751 578 347 1812 1604 2264 243
NM_145012chr101993 ------
NM_145014chr112285 77 ------
NM_145036chr17130 ------
NM_145037chr3----1592 --
NM_145055chr18123659 3443 3103 2827 2640 2625 2536 2500 2380 954 681 89 23109 2969 1256 --
NM_145117chr1142944 2662 2493 1213 ----12211
NM_145176chr6103178 3102 2835 2771 2657 1264 1023 985 482 368 13063 53293 3239 2917 2842 725 --
NM_145203chr134933 918 710 324 ------
NM_145206chr1073349 3268 3188 3046 2766 2188 2163 12607 2666 38 --
NM_145207chr454819 4509 3482 1972 349 25034 5002 14963 14841
NM_145247chr10------143
NM_145251chr1451454 1400 639 480 140 ----1552
NM_145259chr2116978 6918 6012 4830 4419 4305 2489 1835 1028 705 151 --35235 5053 1689 11744
NM_145263chr461668 1502 732 432 172 43 ------
NM_145268chr71158 ------
NM_145274chr172638 265 --1751 1799
NM_145284chrX32051 509 165 ------
NM_145305chrX31256 1039 70 ----1273
NM_145307chr1083924 3590 3313 2841 1013 723 655 40 13259 ----
NM_145320chr782711 2553 1304 1209 966 949 502 477 --1171 --
NM_145321chr782711 2553 1304 1209 966 949 502 477 --1171 --
NM_145322chr782711 2553 1304 1209 966 949 502 477 --1171 --
NM_145649chr631864 477 217 12491 21727 457 --
NM_145655chr631864 477 217 12491 21727 457 --
NM_145686chr243367 2888 1215 109 --1595 --
NM_145687chr243367 2888 1215 109 --1595 --
NM_145690chr831436 785 525 11314 ----
NM_145698chr1062139 1981 1880 1810 568 462 --22163 1699 11654
NM_145714chr161315 --1277 --
NM_145716chr11165 ------
NM_145733chr2221231 407 --11011 --
NM_145735chr1342426 1855 322 297 --1106 --
NM_145739chr2262 52 ------
NM_145753chr331405 1338 1095 11053 21135 360 --
NM_145756chr1821391 572 1541 --1325
NM_145759chr122113 2039 --11685 --
NM_145800chrX41034 775 347 148 ------
NM_145802chrX4983 724 296 97 ------
NM_145810chr241243 967 423 63 11102 21183 829 --
NM_145891chr1661678 1624 1169 1123 684 97 11438 ----
NM_145892chr1661678 1624 1169 1123 684 97 11438 ----
NM_145893chr1651800 1746 1291 1245 219 11560 ----
NM_145913chr123740 403 42 ------
NM_147147chr643291 1623 1125 188 1287 1988 --
NM_147150chr9113776 3131 2905 2671 2556 1513 984 819 601 588 65 --1880 --
NM_147156chr1021016 539 --11131 11484
NM_147164chr91559 --2449 129 --
NM_147175chrX41879 1836 518 448 1342 ----
NM_147181chr451273 1110 1072 504 95 ------
NM_147182chr451273 1110 1072 504 95 ------
NM_147183chr451273 1110 1072 504 95 ------
NM_147223chr282097 1989 1901 1828 992 708 697 680 --1929 --
NM_147233chr281914 1806 1718 1645 809 525 514 497 --1746 --
NM_148174chr872168 2040 1967 1889 1837 1733 157 11372 1804 --
NM_148414chr162518 398 --1360 --
NM_148415chr162458 338 --1300 --
NM_148416chr162435 315 --1277 --
NM_148898chr741009 898 817 754 ------
NM_148899chr741009 898 817 754 ------
NM_148904chr11156 --1565 --
NM_148905chr11156 --1565 --
NM_148906chr11156 --1565 --
NM_148907chr11156 --1565 --
NM_148908chr11156 --1565 --
NM_148909chr11156 --1565 --
NM_148957chr1332253 2154 2004 12600 11012 --
NM_148977chr1041285 1186 373 280 ------
NM_148978chr1041285 1186 373 280 ------
NM_152132chr142111 87 ------
NM_152230chr101145 ------
NM_152261chr1242517 2275 2052 1962 12398 11653 --
NM_152263chr176040 5995 5473 5444 5422 4442 3986 21267 140 ----
NM_152265chr111432 21552 631 --11413
NM_152277chr532183 2031 279 --1221 --
NM_152296chr192328 75 ------
NM_152305chr342091 408 204 151 --22132 289 --
NM_152332chr1442888 2177 1838 64 32003 996 106 22369 1928 --
NM_152348chr17----1857 --
NM_152380chr15645 570 520 416 205 --11018 --
NM_152387chr23863 766 200 1246 ----
NM_152399chr441042 182 99 32 11234 ----
NM_152400chr411827 11467 2702 638 --
NM_152407chr553298 2140 1038 851 770 --13273 1813
NM_152409chr53705 566 326 ------
NM_152415chr81348 1479 ----
NM_152417chr841194 1102 479 162 1830 --1249
NM_152422chr941804 1619 526 392 11767 1327 --
NM_152423chrX61389 1353 1325 515 247 34 ------
NM_152433chr114650 532 501 448 ------
NM_152437chr1251833 1590 1583 576 435 12475 ----
NM_152441chr125493 293 265 88 42 --1593 --
NM_152446chr143834 106 72 1227 --1667
NM_152450chr1542117 1330 793 467 --21494 299 --
NM_152457chr162284 241 --1267 --
NM_152470chr1854012 3841 1306 912 667 --11597 --
NM_152510chr221125 1813 ----
NM_152519chr242225 842 371 263 1230 ----
NM_152520chr22421 257 2801 72 11044 --
NM_152556chr762392 2264 1669 891 323 154 12170 1700 --
NM_152588chr1271799 1496 1391 1364 510 400 170 ------
NM_152594chr1592291 2214 2095 1987 1788 781 450 169 56 --32351 2109 1712 1707
NM_152608chr131659 993 103 --32527 1001 786 11959
NM_152618chr41135 ----1877
NM_152622chr573095 2958 2639 896 764 335 238 ------
NM_152624chr5127302 7086 6307 6102 4942 4659 4565 1849 1562 1178 1091 563 --47371 6586 2638 2147 --
NM_152629chr963971 3143 2817 1528 997 736 13236 11538 --
NM_152638chr121455 165 21260 357 --
NM_152647chr15144 ------
NM_152653chr32746 234 ------
NM_152660chr11782 ------
NM_152678chr352354 2141 2118 1935 1027 --12172 12250
NM_152682chr431180 1111 93 11412 1110 --
NM_152686chr552416 2056 1793 488 116 ------
NM_152688chr62122 38 --1672 1878
NM_152699chr393192 3158 3022 2799 1144 512 501 411 322 ----11029
NM_152723chr114740 391 328 116 --1749 --
NM_152736chr67916 863 767 751 400 258 165 --11022 --
NM_152737chr641752 1698 1526 646 --11520 --
NM_152738chr61114 ------
NM_152739chr721133 365 ------
NM_152742chr71489 ------
NM_152744chr791327 1276 1158 1014 961 534 194 83 41 --33587 3553 3498 --
NM_152753chr652057 846 578 331 26 ------
NM_152754chr743759 1505 974 476 22832 2783 23521 3245 --
NM_152756chr594150 3848 3222 1512 1391 814 487 422 81 31649 1054 935 22993 179 --
NM_152758chr861922 966 814 641 391 208 12751 ----
NM_152765chr862420 2278 2108 885 844 754 12264 1458 --
NM_152772chr123475 430 399 ------
NM_152774chr762719 2237 1927 1805 488 437 --11860 1389
NM_152787chrX93718 3676 3446 3210 3104 2608 2555 1234 984 --11216 --
NM_152789chr71220 --21395 1383 --
NM_152829chr73176 159 72 ------
NM_152830chr171235 ------
NM_152838chr2053263 2929 2659 2206 915 ----12150
NM_152866chr1182223 2044 1825 911 640 476 219 189 --2890 817 --
NM_152903chr1341815 1079 1012 121 12731 1331 --
NM_152924chr15126734 6721 5119 5085 4620 2015 1837 1413 1268 1247 978 460 36269 5986 4749 46055 5960 5155 2106 --
NM_152989chr1261809 1666 1631 633 297 84 --1418 --
NM_152996chr191988 1894 1629 816 720 559 349 281 54 11749 ----
NM_152999chr7104996 4280 4233 4101 3469 1850 1713 1669 247 21 1416 1330 13505
NM_153013chr532052 724 244 ------
NM_153020chr651489 1046 674 57 49 --31552 207 97 --
NM_153035chr122210 788 12702 ----
NM_153042chr631427 1397 346 ----1428
NM_153183chrX3460 207 113 --1858 --
NM_153188chr595457 5338 4732 4332 4236 1337 565 392 252 24504 4244 14283 25360 607
NM_153207chr1272796 2654 2559 1035 750 584 383 21011 274 23101 286 13787
NM_153223chr52270 106 11602 31135 631 282 --
NM_153226chr101442 1993 1186 --
NM_153234chr552701 2665 2256 2138 745 --11930 --
NM_153235chr622424 2305 1178 159 --
NM_153251chr13265 28 ------
NM_153255chr64845 708 281 199 ------
NM_153261chr1661625 1198 1082 608 439 116 21450 518 11166 --
NM_153262chr193244 2506 2163 2081 2062 1136 938 932 759 11042 21227 371 12653
NM_153267chr94894 746 697 192 --2769 96 --
NM_153321chr173810 726 369 --1750 --
NM_153322chr173810 726 369 --1750 --
NM_153332chr842294 2073 1021 245 --22173 1106 12275
NM_153346chrX31418 483 436 1609 11759 --
NM_153360chr2031309 562 280 ------
NM_153374chr152122 65 ----1412
NM_153453chr63709 648 148 ------
NM_153456chr1355812 5298 4604 4232 1994 ----16321
NM_153607chr552996 2836 2801 928 110 ----1971
NM_153619chr1543201 3194 2679 1374 ------
NM_153620chr741669 1442 1227 90 --11565 --
NM_153634chr1261526 1474 1036 528 419 277 --1612 --
NM_153640chr20181 --1403 --
NM_153645chr2253281 3160 999 310 232 --22728 645 1114
NM_153649chr131648 720 602 --32192 2054 1964 --
NM_153686chr462257 2234 2129 1787 1623 603 12303 ----
NM_153689chr22466 332 ------
NM_153690chr32763 570 ------
NM_153693chr123678 182 95 ------
NM_153704chr8----1149 --
NM_153706chr5----1194 --
NM_153712chr24773 764 251 111 --1232 --
NM_153715chr71879 ------
NM_153756chr151265 1246 661 636 482 ------
NM_153810chr1084547 4122 3882 3828 1407 1266 624 318 --23529 584 14768
NM_153828chr21741 ------
NM_153831chr83652 114 107 ----1298
NM_170606chr731563 1344 487 --1575 --
NM_170665chr1294389 3538 3111 3097 1388 913 858 467 66 44505 4416 1404 34 --14051
NM_170674chr1551115 1070 568 521 426 ------
NM_170675chr155791 746 244 197 102 ------
NM_170676chr155791 746 244 197 102 ------
NM_170677chr1551115 1070 568 521 426 ------
NM_170679chr531082 938 321 --2994 362 --
NM_170696chr1521493 153 --21201 477 --
NM_170697chr1521493 153 --21201 477 --
NM_170706chr1103932 3630 3568 3525 3321 3114 2999 1552 1279 1261 --14326 --
NM_170709chr851742 935 553 354 92 11713 1563 1233
NM_170710chr462389 2304 1241 1159 826 155 2817 457 --1844
NM_170723chrY----198 --
NM_170731chr1152348 2338 2169 730 464 ----1206
NM_170732chr1152348 2338 2169 730 464 ----1206
NM_170733chr1152348 2338 2169 730 464 ----1206
NM_170734chr1152348 2338 2169 730 464 ----1206
NM_170735chr1152348 2338 2169 730 464 ----1206
NM_170751chr62192 178 ------
NM_170752chr62192 178 ------
NM_170774chr2043621 2818 1656 168 --14066 --
NM_170780chr32879 301 --1741 --
NM_171998chrX72407 2389 1610 701 429 420 336 --22109 528 1918
NM_172037chr841473 410 317 125 ------
NM_172058chr851698 1595 187 102 30 --31746 518 344 --
NM_172059chr851698 1595 187 102 30 --31746 518 344 --
NM_172060chr851698 1595 187 102 30 --31746 518 344 --
NM_172069chr232215 1611 428 ------
NM_172070chr221896 249 173 32040 1557 266 --
NM_172071chr1127248 7114 6892 6836 6765 5803 5010 2935 713 692 559 484 35125 1516 824 36498 283 75 --
NM_172103chr651913 907 693 551 287 --32499 2453 1047 --
NM_172105chr651913 907 693 551 287 --32499 2453 1047 --
NM_172127chr43559 323 21 11917 --11714
NM_172128chr42515 279 11873 --11670
NM_172159chr3199 --1933 1702
NM_172160chr3199 --1933 1702
NM_172169chr101115 ------
NM_172170chr101115 ------
NM_172171chr101115 ------
NM_172173chr101115 ------
NM_172216chr1262931 2368 1999 731 365 271 21003 554 1940 --
NM_172315chr1551115 1070 568 521 426 ------
NM_172316chr1551115 1070 568 521 426 ------
NM_172348chr5160 ------
NM_173078chrX2443 71 ------
NM_173083chr12432 349 --1823 1865
NM_173084chr352171 1849 1582 584 105 11817 31739 1560 212 --
NM_173167chr1722491 581 ------
NM_173171chr231061 1047 1011 --11275 --
NM_173172chr231369 1355 1319 --11583 --
NM_173173chr231061 1047 1011 --11275 --
NM_173198chr952655 2176 2115 613 333 --11092 --
NM_173200chr952655 2176 2115 613 333 --11092 --
NM_173214chr16158272 8254 7490 6537 6063 5926 5111 3264 2960 1286 701 626 482 446 290 36901 6449 2271 48199 7892 7052 3199 --
NM_173354chr2132123 1798 179 --149 --
NM_173359chr331904 1698 681 1108 ----
NM_173454chr154945 829 408 351 ------
NM_173468chr455566 5464 1677 1333 1058 24107 3996 55151 4925 4380 4247 1387 24600 1663
NM_173469chr1521203 335 ------
NM_173470chrX42653 2365 1817 629 1680 1351 --
NM_173491chr521438 467 1552 --11226
NM_173495chrX102550 2482 2421 2234 2209 1781 975 832 749 70 11666 ----
NM_173508chr13462 350 141 1471 --11002
NM_173510chr2252762 1949 759 523 384 --22070 831 1411
NM_173511chr293858 3316 3229 2881 2733 1395 742 546 106 23834 2543 13143 --
NM_173515chr62410 113 ------
NM_173517chr71349 ------
NM_173518chr81154 ------
NM_173531chr1953006 2862 2728 989 492 11229 33850 3682 940 1733
NM_173536chr4115189 5136 4997 4896 4395 3512 1099 589 398 168 72 --44795 3998 3979 3899 13881
NM_173550chr9143 ------
NM_173552chr362137 1867 1654 1553 1546 651 12321 12491 --
NM_173554chr101267 ------
NM_173576chr1042305 2006 928 785 1200 ----
NM_173591chr123321 143 55 --21041 261 --
NM_173595chr1295281 4963 4927 4700 4378 3426 1940 628 99 ------
NM_173602chr1231443 1177 451 1815 21272 1049 1934
NM_173607chr1451854 1524 638 529 92 ----11745
NM_173642chr1179169 9125 8925 8762 8175 7529 7293 6240 6070 6063 5876 3043 2518 2447 2351 1650 710 15840 33430 2062 1409 --
NM_173644chr2021978 1860 ------
NM_173645chr22469 416 --1482 --
NM_173654chr36879 848 787 778 356 270 11559 12173 --
NM_173658chr32167 68 ----1270
NM_173666chr511153 ------
NM_173667chr541779 1646 417 311 --133 --
NM_173683chr821257 563 ------
NM_173694chrX92554 2450 2352 1877 1016 529 308 90 64 1654 12112 11590
NM_173698chrX31784 356 124 --31632 758 258 --
NM_173794chrX1112 ----1140
NM_173797chr531175 904 521 --1306 --
NM_173808chr164131 4080 3382 1797 1594 565 12961 34174 681 289 23182 837
NM_173822chr2----11457 11956
NM_173825chr332616 703 52 --12288 11133
NM_173826chr331660 1541 588 --172 --
NM_173829chr566004 5091 5041 4332 3920 1541 ------
NM_173833chr841484 416 195 71 ------
NM_173848chr81189 1107 ----
NM_173851chr8143928 3669 3419 3319 3132 3060 2614 1454 1262 1135 954 624 564 268 ------
NM_173854chr142374 1649 618 498 12395 ----
NM_174890chr103836 777 731 --1209 --
NM_174900chr411288 --1368 --
NM_174909chr53916 767 175 1596 ----
NM_174911chr833665 2809 854 --23179 3165 13453
NM_174916chr1562230 2022 1989 1482 878 348 21764 1718 22347 1526 --
NM_175038chr12281 70 ------
NM_175056chr351830 1508 1445 479 448 --22027 1635 --
NM_175061chr761948 1879 1787 1736 1527 1501 22144 769 ----
NM_175607chr321122 641 --11425 --
NM_175610chr153994 512 285 ----11305
NM_175611chr211108 ------
NM_175612chr321122 641 --11425 --
NM_175623chr12157351 6200 6054 5817 5754 5600 4752 3041 2808 2500 2392 2307 1311 966 39 --21881 1539 --
NM_175624chr12157446 6295 6149 5912 5849 5695 4847 3136 2903 2595 2487 2402 1406 1061 134 --21976 1634 --
NM_175625chr12157446 6295 6149 5912 5849 5695 4847 3136 2903 2595 2487 2402 1406 1061 134 --21976 1634 --
NM_175736chr12127604 7417 7074 6309 2767 2411 2394 2265 2068 1920 1615 344 ------
NM_175747chr631085 963 199 ------
NM_175854chr1342737 2237 1123 66 --22690 940 --
NM_175856chr52657 640 --1246 1316
NM_175863chr621163 54 --21183 1066 --
NM_175873chr591313 1189 1054 1043 540 474 404 159 112 ----11131
NM_175876chr152670 2315 1893 912 850 --21864 105 --
NM_175895chr1241189 1057 871 47 1853 --1981
NM_175921chr584218 2900 1532 1518 1162 1000 805 127 2928 275 23881 2934 --
NM_176792chr10------11100
NM_176812chr202726 715 ------
NM_176814chr72364 140 --1324 --
NM_176823chr173905 3887 3756 3489 3217 3192 128 --13286 --
NM_176894chr351364 650 557 361 22 ------
NM_177414chr131788 1622 1616 11380 2665 263 11474
NM_177424chr111819 2220 183 ----
NM_177438chr1464203 3859 2735 1544 779 342 1800 --23936 3048
NM_177452chr1442453 2098 940 713 1131 11534 --
NM_177559chr202213 66 ----1894
NM_177560chr202213 66 ----1894
NM_177952chr146752 254 154 90 59 53 ------
NM_177968chr241686 835 534 484 --21394 66 --
NM_177969chr2177 --2637 606 --
NM_177974chr1541804 759 512 235 1291 ----
NM_177976chr32443 30 ------
NM_177985chr232309 911 818 ------
NM_177989chr31120 ------
NM_177995chr941804 1619 526 392 11767 1327 --
NM_178010chr1261809 1666 1631 633 297 84 --1418 --
NM_178011chr1062824 2475 2442 1207 1008 344 12695 11088 --
NM_178037chr1253055 1278 481 230 162 --1172 --
NM_178038chr1253055 1278 481 230 162 --1172 --
NM_178042chr31120 ------
NM_178043chr4181 ------
NM_178123chr22849 288 ----1790
NM_178151chrX157177 7053 6837 6637 6603 4903 3100 2841 2613 2598 2545 1762 1463 1276 724 ----1585
NM_178152chrX157177 7053 6837 6637 6603 4903 3100 2841 2613 2598 2545 1762 1463 1276 724 ----1585
NM_178153chrX157177 7053 6837 6637 6603 4903 3100 2841 2613 2598 2545 1762 1463 1276 724 ----1585
NM_178313chr221855 1704 ------
NM_178424chr52454 421 2491 140 ----
NM_178426chr141785 1472 871 47 ----11731
NM_178427chr121685 771 ----11631
NM_178445chr36941 933 851 837 373 367 1112 ----
NM_178505chr1063494 3194 2481 930 519 238 --43455 1387 737 199 --
NM_178509chr1794098 4029 3538 3522 2877 2710 2623 797 504 23222 3000 --14169
NM_178539chr1221634 229 --1501 --
NM_178548chr11231 ------
NM_178554chr373036 2860 2356 1199 1103 628 485 --33015 2818 368 --
NM_178565chr811488 --11590 --
NM_178568chr172708 314 11173 ----
NM_178585chr483239 3012 2964 2702 2399 2336 2315 65 --12302 --
NM_178812chr851529 1362 1014 493 113 --21506 573 --
NM_178815chr10102025 1685 1088 921 837 725 563 239 221 172 11746 1871 12162
NM_180989chr133580 275 134 ------
NM_180991chr522194 357 --31030 731 407 --
NM_181265chr462389 2304 1241 1159 826 155 2817 457 --1844
NM_181302chr143614 499 454 ------
NM_181308chr143614 499 454 ------
NM_181332chrX2257 211 12092 22412 1080 --
NM_181349chr76918 635 543 526 445 59 --23142 1088 --
NM_181351chr1172759 2347 884 710 646 626 51 --1860 --
NM_181358chr143814 3340 1298 114 33300 840 727 ----
NM_181361chr31193 --1575 --
NM_181443chr2062489 1882 997 973 54 23 --22509 442 --
NM_181481chr18106779 5440 5085 4844 4273 2813 2479 1541 1441 990 26111 750 25339 1626 11157
NM_181482chr18106779 5440 5085 4844 4273 2813 2479 1541 1441 990 26111 750 25339 1626 11157
NM_181483chr18106779 5440 5085 4844 4273 2813 2479 1541 1441 990 26111 750 25339 1626 11157
NM_181486chr1221032 451 --1184 --
NM_181504chr574082 4064 3466 3141 1440 1365 629 13693 13005 --
NM_181521chr16147256 7134 6927 6874 6811 5635 5079 5035 4774 2720 1763 1714 1462 1086 --11435 --
NM_181523chr574082 4064 3466 3141 1440 1365 629 13693 13005 --
NM_181524chr574082 4064 3466 3141 1440 1365 629 13693 13005 --
NM_181581chr74907 755 710 112 ------
NM_181659chr2053115 2108 1379 1037 112 --11167 --
NM_181659chr2053115 2108 1379 1037 112 --11167 --
NM_181670chr1221438 517 ------
NM_181671chr173900 314 81 ------
NM_181702chr82880 793 --1649 --
NM_181705chr565717 4272 3771 1331 53 39 ----14771
NM_181706chr1162198 1994 1984 1694 520 125 ------
NM_181712chr151801 1691 1379 1288 675 ------
NM_181714chr63628 597 574 ------
NM_181723chr82584 563 42270 2249 2058 880 ----
NM_181762chrX21095 107 ------
NM_181777chrX21095 107 ------
NM_181782chr651893 826 807 393 300 ------
NM_181787chr873858 3758 3607 3494 3173 1027 451 23656 717 1908 --
NM_181794chr61336 --1821 --
NM_181795chr61336 --1821 --
NM_181833chr22------13761
NM_181836chr562675 2446 2297 2181 1662 899 1888 12419 --
NM_181838chr521445 1012 --11369 --
NM_181886chr451214 490 306 195 183 ------
NM_181887chr451214 490 306 195 183 ------
NM_181888chr451214 490 306 195 183 ------
NM_181889chr451214 490 306 195 183 ------
NM_181890chr451214 490 306 195 183 ------
NM_181891chr451214 490 306 195 183 ------
NM_181892chr451261 537 353 242 230 ------
NM_181893chr451214 490 306 195 183 ------
NM_181897chr392642 2090 1807 1018 961 804 744 624 187 2537 170 ----
NM_182485chr453374 3084 2580 1036 370 13586 ----
NM_182492chr221306 ------
NM_182493chr16115100 4518 4380 4122 3749 3731 2159 2047 1992 1714 1073 3896 705 505 35299 3954 3906 --
NM_182507chr123786 727 76 11719 --11703
NM_182511chr1831323 262 185 ------
NM_182551chr243508 3155 2919 2701 --2236 169 --
NM_182565chr172259 230 ------
NM_182641chr1741472 1415 596 162 --1711 --
NM_182645chr63709 648 148 ------
NM_182646chr453374 3084 2580 1036 370 13586 ----
NM_182648chr144705 645 132 89 --1740 --
NM_182691chr721364 1017 --31220 985 433 --
NM_182692chr721364 1017 --31220 985 433 --
NM_182697chr721256 87 --11738 --
NM_182700chr761765 1324 1285 755 347 162 ------
NM_182715chr71969 11281 ----
NM_182729chr1231189 1136 293 ------
NM_182742chr1231189 1136 293 ------
NM_182743chr1231189 1136 293 ------
NM_182744chr1------1190
NM_182757chr672981 2876 1159 745 616 299 99 12574 12897 11136
NM_182758chr1553833 3780 3385 741 449 1726 ----
NM_182763chr152765 2681 906 774 76 --2805 661 --
NM_182765chr1082349 1950 1714 1459 891 555 402 112 --1655 --
NM_182767chr1241660 393 346 153 ------
NM_182789chr53757 673 131 ----1183
NM_182797chr2041822 1460 404 330 --21188 179 1276
NM_182830chr1451807 1751 1565 1558 647 11789 --32189 1909 186
NM_182896chr331776 1144 551 ------
NM_182898chr7116174 5594 5513 5244 4867 4463 2380 2331 2038 788 209 25645 4634 44431 4406 1661 352 12063
NM_182899chr7116174 5594 5513 5244 4867 4463 2380 2331 2038 788 209 25645 4634 44431 4406 1661 352 12063
NM_182907chr632046 1888 1807 --32062 763 655 2691 381
NM_182943chr321064 472 --1119 1278
NM_182948chr1103160 3136 2627 2293 1215 1151 609 555 287 116 --12072 22364 2087
NM_182964chr1142944 2662 2493 1213 ----12211
NM_182972chr142832 2385 1891 765 --32602 2179 1994 12525
NM_182975chr14940 281 206 35 ------
NM_182977chr51182 1752 ----
NM_182978chr181752 ------
NM_183043chr135825 805 783 414 296 1707 ----
NM_183044chr135825 805 783 414 296 1707 ----
NM_183049chr4179 --1378 --
NM_183078chr683767 3463 3454 3044 2641 2608 1447 1148 --21392 727 --
NM_183227chr631132 1037 23 --11460 --
NM_183323chr53757 673 131 ----1183
NM_183353chrX41104 977 901 280 ------
NM_183376chr151854 ----22568 2073
NM_183380chr62834 724 ------
NM_183387chr143725 347 31 ----1914
NM_183419chr811433 --1988 --
NM_184085chr82858 742 ------
NM_184086chr82858 742 ------
NM_184087chr82858 742 ------
NM_184234chr202342 119 --1790 --
NM_194247chr274069 3812 3028 3007 2975 1384 381 1164 24438 2819 13657
NM_194271chr122747 546 ------
NM_194277chrX1645 149 1698 --
NM_194278chr1443702 3419 3240 155 14117 13749 --
NM_194282chr443083 2501 1988 83 --12142 --
NM_194286chr12125774 5512 5082 5063 4344 4163 2035 1986 1507 1219 521 424 21067 885 ----
NM_194291chr842470 1938 1878 461 1143 22323 687 22720 957
NM_194301chr143368 336 328 ------
NM_194314chr195282 4886 4285 4037 1924 1276 1210 434 241 11024 14594 14938
NM_194328chr993304 2559 2295 1303 1160 1117 850 458 164 12368 ----
NM_194329chr993304 2559 2295 1303 1160 1117 850 458 164 12368 ----
NM_194330chr993304 2559 2295 1303 1160 1117 850 458 164 12368 ----
NM_194332chr993304 2559 2295 1303 1160 1117 850 458 164 12368 ----
NM_194435chr63832 256 184 --2116 36 --
NM_194442chr131693 1147 585 21434 188 ----
NM_194454chr731617 1401 1253 --1654 --
NM_194455chr731617 1401 1253 --1654 --
NM_194456chr731617 1401 1253 --1654 --
NM_194463chrX21231 173 --1292 --
NM_197941chr552480 2077 1057 812 751 13089 --1501
NM_197968chr131256 --1644 --
NM_197970chr23487 361 73 ------
NM_197978chr91466 ----145
NM_198087chr1621522 602 --21383 464 --
NM_198088chr1621522 602 --21383 464 --
NM_198123chr841709 1398 1129 588 --11550 --
NM_198124chr841709 1398 1129 588 --11550 --
NM_198128chr1852043 1722 1503 734 84 --11772 --
NM_198150chr521502 416 --1519 1530
NM_198158chr363048 2356 2088 1021 618 192 --22409 1099 166
NM_198159chr363048 2356 2088 1021 618 192 --22409 1099 166
NM_198177chr363048 2356 2088 1021 618 192 --22409 1099 166
NM_198178chr363048 2356 2088 1021 618 192 --22409 1099 166
NM_198181chr1562436 2039 2027 1840 407 63 ------
NM_198182chr251207 1114 571 445 67 --11464 --
NM_198196chr362407 2399 2391 2236 2163 150 ------
NM_198215chr1031338 1005 444 1461 11262 --
NM_198217chr132880 762 1918 1376 --
NM_198218chr132880 762 1918 1376 --
NM_198219chr132880 762 1918 1376 --
NM_198240chr123932 912 330 ------
NM_198243chr154913 841 643 88 1626 1733 --
NM_198268chr143814 3340 1298 114 33300 840 727 ----
NM_198269chr143814 3340 1298 114 33300 840 727 ----
NM_198270chrX51318 1293 1023 570 93 ------
NM_198273chr532306 255 159 21980 1157 12682 --
NM_198279chrX4477 168 150 106 1194 1122 --
NM_198281chr473022 2552 1171 1056 614 340 189 1351 33132 2560 1109 --
NM_198318chr19------1158
NM_198319chr19------1158
NM_198391chr2021346 220 11104 11147 --
NM_198395chr521233 205 ------
NM_198399chr341733 1229 251 202 ------
NM_198400chr1542812 2334 927 383 11892 12667 1160
NM_198439chr114650 532 501 448 ------
NM_198465chrX3974 241 165 --22418 1119 11077
NM_198467chr72532 152 ------
NM_198503chr152199 2110 683 554 296 11480 ----
NM_198513chr871986 1886 687 643 470 390 161 11801 11978 --
NM_198549chr152696 2650 2353 430 143 --123 11307
NM_198566chr52153 135 --