TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3907
miRNA Sequence: AGGUGCUCCAGGCUGGCUCACA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_000038chr531781 1406 266 ------
NM_000044chrX--1340 ----
NM_000052chrX43161 2915 464 373 11063 ----
NM_000081chr1132 ------
NM_000084chrX76077 5888 5615 2664 2459 1756 1513 22788 1489 ----
NM_000089chr71163 ------
NM_000094chr3130 ------
NM_000096chr32945 815 ------
NM_000111chr71258 ------
NM_000115chr1331086 251 230 ------
NM_000125chr673325 1313 1304 883 606 483 384 --14256 --
NM_000138chr15--21036 131 ----
NM_000141chr102362 37 ------
NM_000161chr141348 --21607 1534 --
NM_000168chr742960 2928 2558 512 ----11193
NM_000170chr92540 51 ------
NM_000189chr221857 399 --12312 --
NM_000208chr1964186 3653 2940 1519 865 319 14695 11548 --
NM_000214chr2021302 218 ------
NM_000216chrX43137 1345 895 579 ----1331
NM_000217chr1274957 2091 2057 1744 1250 843 600 ------
NM_000220chr112698 50 ------
NM_000222chr441830 666 633 137 --1110 --
NM_000227chr182343 44 ------
NM_000232chr422701 1225 --32414 681 115 --
NM_000237chr821644 298 1176 ----
NM_000248chr323002 504 --1800 --
NM_000252chrX--11053 ----
NM_000259chr1574723 3984 2338 1076 624 449 334 34366 1498 394 14187 --
NM_000276chrX41978 758 733 328 21432 375 ----
NM_000282chr131260 ------
NM_000291chrX1154 ------
NM_000297chr431416 1398 225 --12051 --
NM_000304chr17------1903
NM_000314chr101964 22796 2740 12173 --
NM_000332chr6106754 5871 5550 5122 5107 2448 1619 1154 1099 218 15035 15796 --
NM_000333chr341093 463 192 70 ------
NM_000340chr331434 500 77 --11386 --
NM_000346chr1711768 ------
NM_000362chr2283529 3412 3187 2257 1339 1205 697 117 ------
NM_000399chr101138 ------
NM_000408chr232245 2133 584 ------
NM_000428chr142827 322 21846 204 --1797
NM_000430chr171293 1215 --22940 1452
NM_000439chr532351 1917 121 ------
NM_000448chr1132437 2201 76 12818 ----
NM_000449chr121148 153 11231 11504 --
NM_000452chr1311755 1148 ----
NM_000459chr91295 ------
NM_000461chr374171 1590 846 532 510 495 419 3281 274 37 13388 --
NM_000478chr11267 ------
NM_000484chr211714 ------
NM_000486chr1233249 2235 2158 --12929 11134
NM_000508chr4----126 --
NM_000523chr22981 392 ------
NM_000525chr1141525 1290 1201 440 ----11408
NM_000533chrX2744 305 --1603 --
NM_000555chrX45907 2620 372 31 1546 16822 --
NM_000598chr731025 280 274 --1194 --
NM_000609chr1032530 1125 1099 --1615 --
NM_000610chr1143021 2935 868 733 ------
NM_000612chr11133510 3427 3324 2932 2615 1530 1141 977 932 857 770 606 206 ------
NM_000615chr1132979 2093 62 --12700 --
NM_000618chr1245435 3995 2242 1727 --12491 1832
NM_000618chr1245435 3995 2242 1727 --12491 1832
NM_000619chr121457 ------
NM_000633chr1874655 4556 3343 1194 779 651 321 ----1937
NM_000675chr224696 331 292 253 3557 303 245 ----
NM_000689chr9144 ------
NM_000701chr11115 ----129
NM_000702chr122035 349 ------
NM_000721chr152586 2170 1044 496 206 22253 468 11796 --
NM_000757chr13864 746 718 ------
NM_000794chr51659 ------
NM_000801chr201938 11074 ----
NM_000807chr41191 ------
NM_000809chr469107 8949 8898 6682 1937 1159 15947 12680 --
NM_000810chr151444 ----196
NM_000813chr584856 3918 3600 2242 1888 1028 825 603 --12037 --
NM_000814chr1543521 3353 2745 1586 ------
NM_000817chr21975 ------
NM_000826chr432434 1754 1666 ------
NM_000827chr532367 653 641 ------
NM_000829chr1122299 1691 --12000 --
NM_000834chr1231144 443 388 1181 ----
NM_000839chr3----189 --
NM_000840chr72475 103 ------
NM_000844chr31213 ------
NM_000868chrX32259 1760 882 ------
NM_000875chr1576237 6091 2684 2216 2041 1530 658 14579 21554 279 --
NM_000891chr1743028 2585 1378 963 1181 --1871
NM_000912chr873266 2944 2342 846 793 307 224 --13026 --
NM_000921chr121525 ------
NM_000944chr421807 895 1430 ----
NM_000945chr241472 416 232 197 ------
NM_000949chr5163 ------
NM_000950chrX43200 724 371 63 ------
NM_000956chr142216 36 11057 ----
NM_000965chr3136 11153 ----
NM_000966chr121276 ------
NM_000971chr8150 ------
NM_001001323chr1222691 551 ------
NM_001001389chr1143021 2935 868 733 ------
NM_001001390chr1143021 2935 868 733 ------
NM_001001391chr1143021 2935 868 733 ------
NM_001001392chr1143067 2981 914 779 ------
NM_001001394chr22574 566 ------
NM_001001395chr122691 562 137 ----
NM_001001396chr144118 3784 1775 443 ------
NM_001001419chr564415 3591 3290 1330 1302 67 ------
NM_001001420chr564415 3591 3290 1330 1302 67 ------
NM_001001436chr16181 ------
NM_001001481chr822637 2362 11339 155 --
NM_001001664chr233615 2811 441 ------
NM_001001685chr1762820 1991 956 918 781 732 1906 ----
NM_001001787chr12463 389 ------
NM_001001928chr22128026 7466 6727 3095 3083 2723 1973 1307 1051 624 420 186 25858 53 26872 1706 --
NM_001001971chr103538 380 105 ------
NM_001001995chrX11732 1380 ----
NM_001002033chr171111 ------
NM_001002233chr811716 11743 12041 --
NM_001002296chr831133 261 188 ----191
NM_001002838chrX21894 299 ------
NM_001002843chr152525 514 ------
NM_001002860chr1431647 1602 1474 13145 --14608
NM_001002909chr1721971 1508 21951 440 1403 --
NM_001003652chr1888224 7509 6870 5357 2606 432 141 117 22047 823 ----
NM_001003688chr411164 ------
NM_001003698chr631648 396 339 --11469 --
NM_001003699chr631648 396 339 --11469 --
NM_001003712chr123860 748 521 13830 ----
NM_001003792chr311025 ------
NM_001003793chr311025 ------
NM_001003800chr953638 3486 510 357 292 1420 1208 --
NM_001003805chr14158 ------
NM_001003810chr41689 ------
NM_001003940chr1543732 3625 3239 575 --13257 131
NM_001003942chr1543732 3625 3239 575 --13257 131
NM_001003943chr1543736 3629 3243 579 --13261 135
NM_001004065chr923092 1451 1458 12763 --
NM_001004127chr13--1342 ----
NM_001004304chr1262778 2729 2211 746 675 53 ------
NM_001004317chr664418 4127 3103 2880 2807 644 43857 3487 3173 2928 ----
NM_001004360chr231641 1332 580 ------
NM_001004419chr1234077 2810 927 11118 ----
NM_001004441chr51163 ------
NM_001005266chr15------1585
NM_001005267chr15------1585
NM_001005268chr15------1585
NM_001005269chr15------1585
NM_001005368chr10142 ------
NM_001005375chrY1488 11563 --11147
NM_001005386chr242407 1955 640 501 ------
NM_001005404chr1773579 1727 1561 1374 1349 872 596 --13207 --
NM_001005408chr172194 132 ------
NM_001005463chr1031981 778 28 136 12509 --
NM_001005473chr564847 4551 4214 4198 1534 782 15777 ----
NM_001005474chr311482 ------
NM_001005781chr21465 ------
NM_001005845chr8--21542 254 11289 --
NM_001006115chr352404 2376 2046 658 633 ----1512
NM_001006600chr511715 ------
NM_001006605chr1162 11150 ----
NM_001006605chr1162 11150 ----
NM_001006618chr92175 72 ------
NM_001006634chr161264 ------
NM_001006636chr211023 ------
NM_001006932chr663220 3190 3170 2050 81 38 ----12100
NM_001007026chr121367 --151 123
NM_001007102chr61664 ------
NM_001007156chr1531863 1334 139 1566 31349 505 302 --
NM_001007226chr1721279 577 2552 155 ----
NM_001007227chr1721279 577 2552 155 ----
NM_001007228chr1721279 577 2552 155 ----
NM_001007229chr1721279 577 2552 155 ----
NM_001007230chr1721279 577 2552 155 ----
NM_001007237chr162217 1885 1082 1042 635 80 22413 1984 ----
NM_001007246chr2111818 1434 ----
NM_001007257chr131355 302 241 171 ----
NM_001007464chr6143 ------
NM_001007466chr664949 3895 3889 1652 351 86 ------
NM_001007527chr51223 ------
NM_001007553chr11417 ------
NM_001007565chr31110 ------
NM_001008220chr543506 3468 2831 431 --23858 584 23217 2396
NM_001008222chrX21190 1094 --11322 --
NM_001008407chr731700 703 176 2159 106 1592 --
NM_001008408chr774810 4390 4311 1931 1408 1357 91 12396 15097 1138
NM_001008495chr812202 --11610 --
NM_001008726chr14----1423 --
NM_001008740chr1136 ------
NM_001008860chr152640 623 ------
NM_001008892chr152640 623 ------
NM_001008894chr152640 623 ------
NM_001008925chr443488 3037 2496 1385 ----11397
NM_001009552chr81170 ------
NM_001009555chr43541 476 264 ------
NM_001009566chr131196 583 261 --11085 --
NM_001009571chr71319 11647 1231 --
NM_001009909chr1111414 23729 3543 --13773
NM_001009993chr283745 3724 3375 3210 2923 1690 1330 158 --23165 475 --
NM_001010846chr153487 3186 1488 67 35 13969 --1617
NM_001010861chr12794 213 ------
NM_001010891chr555729 5224 5032 2446 1508 ------
NM_001010895chr9--1747 22047 1812 --
NM_001010898chr163380 3148 2736 934 893 815 --13442 --
NM_001010917chr1072238 2214 1985 921 909 693 648 --181 --
NM_001010984chr112235 21781 1729 11699 --
NM_001011513chr453576 3019 1172 558 530 --12921 13558
NM_001011553chr72720 218 ------
NM_001011645chrX--1340 ----
NM_001011666chr786602 6225 5230 2599 1413 1279 1250 560 ------
NM_001012329chr132048 963 743 11859 12003 11892
NM_001012393chr1144753 1649 1620 1296 11931 24220 3442 12006
NM_001012398chr161420 1332 ----
NM_001012426chr643319 1317 1066 400 1345 ----
NM_001012427chr643319 1317 1066 400 1345 ----
NM_001012751chr10----11344 --
NM_001012755chrX64681 3435 3153 3125 1507 108 11932 ----
NM_001012761chr522232 269 1755 ----
NM_001012989chrX--1553 ----
NM_001013031chr1023116 2380 ------
NM_001013398chr731025 280 274 --1194 --
NM_001013415chr4----1456 --
NM_001013622chr4141020 1010 487 474 425 364 351 302 240 178 117 104 55 42 ------
NM_001013693chr1144 --12391 2708 267
NM_001013693chr1144 --12391 2708 267
NM_001013699chr121175 ------
NM_001014286chr13----145 --
NM_001014431chr142773 162 ------
NM_001014432chr142773 162 ------
NM_001014434chr11149 ------
NM_001014797chr1087720 6578 5933 5889 5580 3169 2511 888 27521 5999 149 --
NM_001015053chr172582 302 21368 1250 1493 --
NM_001015508chr81187 ------
NM_001015877chrX42540 2004 1226 331 22237 1235 ----
NM_001015881chrX--184 ----
NM_001017368chr171151 --11053 --
NM_001017395chr333647 2350 291 1623 ----
NM_001017396chr25784 485 422 412 146 --2607 496 --
NM_001017406chr1155 ------
NM_001017923chr141221 ------
NM_001017926chr811543 ------
NM_001017977chr1122 ------
NM_001018025chrX2330 220 ------
NM_001018054chr121076 323 ------
NM_001018056chr91390 ------
NM_001018067chr124206 1688 11142 --23718 1302
NM_001018068chr124206 1688 11142 --23718 1302
NM_001018069chr124206 1688 11142 --23718 1302
NM_001023587chr3--1784 1804 --
NM_001024070chr14151 --1657 --
NM_001024071chr14123 --1629 --
NM_001024463chr152118 67 --1408 --
NM_001024647chr1245613 5168 2121 1648 36095 1484 138 ----
NM_001024660chr321162 640 ------
NM_001024668chr122945 68 ------
NM_001024680chr221589 1290 1728 ----
NM_001024847chr352428 1985 607 223 180 --12512 --
NM_001024937chr171498 ------
NM_001025068chr321816 708 --1718 --
NM_001025069chr321816 708 --1718 --
NM_001025076chr1045530 4965 2267 1771 25658 2099 ----
NM_001025077chr1036888 6323 528 17016 1420 --
NM_001025079chr343622 1223 771 372 2813 73 2849 553 --
NM_001025100chr1853583 3056 2528 1475 1394 22866 1494 22803 988 --
NM_001025105chr52607 563 ----11299
NM_001025107chr151985 1965 1884 1711 812 12023 1285 --
NM_001025107chr151985 1965 1884 1711 812 12023 1285 --
NM_001025252chr81672 1931 ----
NM_001025253chr81672 1931 ----
NM_001025266chr354509 1722 791 451 233 23624 1552 1689 --
NM_001025356chr1243012 2019 587 24 22256 439 1696 --
NM_001025366chr6----1181 --
NM_001025366chr6----1181 --
NM_001025367chr6----1181 --
NM_001025367chr6----1181 --
NM_001025368chr6----1181 --
NM_001025368chr6----1181 --
NM_001025369chr6----1197 --
NM_001025369chr6----1197 --
NM_001025370chr6----1181 --
NM_001025370chr6----1181 --
NM_001025580chrX1654 --13599 --
NM_001025603chr121148 153 11231 11504 --
NM_001025780chr92253 189 ------
NM_001029891chrX2860 216 --135 --
NM_001030007chr1633126 2617 1003 ------
NM_001030055chr1423926 3849 11885 ----
NM_001031679chr1252624 2236 1281 708 276 13043 22347 827 --
NM_001031681chr1782314 2186 1814 919 422 414 389 27 --11452 --
NM_001031685chr12248 198 ------
NM_001031695chr2255442 5167 4074 3986 3521 11800 25410 1316 11117
NM_001031710chr71823 ------
NM_001031720chr4--1173 ----
NM_001031804chr1634292 3730 3301 ------
NM_001032221chr941839 1810 1550 1217 ------
NM_001032280chr6--11123 ----
NM_001032363chr162038 1441 526 489 273 131 ------
NM_001032363chr162038 1441 526 489 273 131 ------
NM_001032380chr1031353 466 119 169 ----
NM_001032999chr2074594 3906 3441 1965 980 807 600 33660 1852 39 --13362
NM_001033045chr263091 2822 2685 1756 1225 1098 --33210 2882 1407 --
NM_001033049chr2152330 1962 467 217 152 ----12003
NM_001033057chr331818 830 95 ------
NM_001033059chr621729 1723 ------
NM_001033112chr5--2266 244 ----
NM_001033551chr1763152 2610 1528 657 352 64 32943 2764 1015 24032 3514 11568
NM_001033561chr17--1853 ----
NM_001033564chr63404 231 93 ------
NM_001033602chr1342141 1704 899 566 12151 165 --
NM_001033756chr6----1115 --
NM_001033756chr6----1115 --
NM_001033925chr1021838 1647 ----11599
NM_001034841chr1634515 2151 677 1721 14786 --
NM_001034845chr4161 ------
NM_001034954chr1043151 2527 1082 590 148 12077 1840
NM_001034955chr1043151 2527 1082 590 148 12077 1840
NM_001034956chr1043151 2527 1082 590 148 12077 1840
NM_001034957chr1043151 2527 1082 590 148 12077 1840
NM_001035chr11423 --2415 129 --
NM_001035254chr911598 2211 152 2882 423 --
NM_001035260chr101357 --11468 1666
NM_001035521chr22520 302 ------
NM_001037132chr741967 1792 1665 54 ------
NM_001037133chr741967 1792 1665 54 ------
NM_001037164chr71784 ------
NM_001037317chr12794 213 ------
NM_001037332chr52839 120 ------
NM_001037333chr52839 120 ------
NM_001037334chr1841607 873 596 525 ------
NM_001037582chr411275 --11601 --
NM_001037631chr2--1273 ----
NM_001037872chr21504 ------
NM_001037954chr1152694 2282 1060 1034 954 11204 ----
NM_001038702chr542622 2074 1773 32 1555 1808 --
NM_001039348chr2--165 ----
NM_001039349chr2--165 ----
NM_001039395chr931872 534 65 12115 --11586
NM_001039459chr7--1135 ----
NM_001039479chr1431922 1789 623 31995 1945 1608 11935 --
NM_001039538chr21459 12390 --12634
NM_001039547chr367711 7409 6045 5512 2090 645 26030 369 12409 --
NM_001039570chr22114262 4017 3917 3265 3091 2950 2838 1386 1119 793 158 23728 1279 11727 --
NM_001039571chr22114262 4017 3917 3265 3091 2950 2838 1386 1119 793 158 23728 1279 11727 --
NM_001039590chrX23831 953 --11085 --
NM_001039591chrX23831 953 --11085 --
NM_001039618chr1154813 3909 3702 1706 1331 24426 2012 ----
NM_001039709chr2074594 3906 3441 1965 980 807 600 33660 1852 39 --13362
NM_001039840chrX33904 679 312 11312 14308 --
NM_001039937chr1334043 922 493 13745 ----
NM_001040020chr731353 1226 92 ------
NM_001040110chr721828 1439 1173 ----
NM_001040142chr221679 1663 ------
NM_001040143chr221679 1663 ------
NM_001040152chr773145 1142 1083 639 584 373 247 21328 488 1401 --
NM_001040157chr41273 32810 1981 1962 ----
NM_001040158chr52217 188 ------
NM_001040159chr41456 ------
NM_001040202chr4--22183 307 ----
NM_001040214chr621728 178 1444 ----
NM_001040272chr922149 926 12295 1811 --
NM_001040284chr1625410 4881 24812 1539 ----
NM_001040402chr433172 2551 2492 ------
NM_001040441chr175040 4487 4459 3317 1666 1460 449 13787 15161 13372
NM_001040458chr52297 261 ------
NM_001040624chr842412 1071 440 211 ----1814
NM_001040625chr842412 1071 440 211 ----1814
NM_001040626chr842412 1071 440 211 ----1814
NM_001040627chr842412 1071 440 211 ----1814
NM_001040628chr842412 1071 440 211 ----1814
NM_001040629chr842412 1071 440 211 ----1814
NM_001040630chr842412 1071 440 211 ----1814
NM_001040709chr13921 771 39 12416 ----
NM_001040712chr92799 77 --22490 2198 --
NM_001042368chr9141 ------
NM_001042388chr181304 ------
NM_001042403chr1221039 951 ------
NM_001042413chr943467 3382 3302 1280 --1815 --
NM_001042425chr6--11123 ----
NM_001042473chr1012044 ------
NM_001042475chr6----1287 --
NM_001042479chrX1674 ------
NM_001042480chrX1674 ------
NM_001042493chr621896 296 ------
NM_001042510chr821856 1657 ------
NM_001042511chr821856 1657 ------
NM_001042537chrX32334 2011 750 ----1338
NM_001042543chr421240 562 ------
NM_001042555chr1254479 3502 1219 1205 524 13587 ----
NM_001042599chr226527 443 37412 2899 1985 --26826 6752
NM_001042601chr312071 12769 --12407
NM_001042603chr1244839 4273 1362 1084 1389 --1452
NM_001042604chr363479 1944 1859 1844 418 340 13867 ----
NM_001042646chr31329 ------
NM_001042728chr121276 ------
NM_001042729chr1--2220 112 1539 --
NM_001042747chr1--2220 112 1539 --
NM_001042749chrX11734 ------
NM_001042750chrX11734 ------
NM_001042751chrX11734 ------
NM_001043318chr1453814 3287 1178 519 462 13464 ----
NM_001044305chr6----1454 --
NM_001046chr51489 ------
NM_001048183chr13759 135 82 13642 ----
NM_001070chr171184 ------
NM_001071775chr131550 ----11371
NM_001077628chr11476 ------
NM_001083620chr422432 1665 ------
NM_001092chr174643 356 317 104 --22001 729 --
NM_001094chr172282 23 ------
NM_001100108chr1108090 7083 6916 6085 6057 5445 2640 2551 860 124 27391 7205 38084 5915 1659 11350
NM_001106chr3127979 7453 7119 6084 3759 3459 3062 2218 2130 774 706 691 26759 284 28172 6709 --
NM_001111chr151985 1965 1884 1711 812 12023 1285 --
NM_001113490chrX52725 2432 743 468 354 11376 1198 --
NM_001116chr1632435 1188 723 185 1622 12728
NM_001117chr18--1176 ----
NM_001128chr1633126 2617 1003 ------
NM_001144chr1611406 --1944 1368
NM_001148chr432119 1849 720 188 165 --
NM_001149chr101208 ------
NM_001152chrX165 ------
NM_001163chr92998 240 1981 ----
NM_001167chrX46629 6018 2709 2643 1250 ----
NM_001173chr1423926 3849 11885 ----
NM_001177chr1221970 1537 ------
NM_001186chr2112144 --11245 --
NM_001187chr211126 ------
NM_001198chr61508 12119 11696 --
NM_001204chr286585 4857 3001 1630 1527 567 431 103 12744 ----
NM_001222chr1011826 --11620 --
NM_001232chr1142 1158 ----
NM_001233chr711920 21957 70 ----
NM_001257chr1641143 1050 327 182 ------
NM_001268chr132399 111 2903 884 ----
NM_001271chr1553283 1179 779 254 209 22980 2640 21292 141 --
NM_001278chr10--1272 ----
NM_001289chrX2636 464 1252 ----
NM_001292chr154770 392 353 27 ----1436
NM_001299chr191507 --1479 --
NM_001304chr171459 2828 36 ----
NM_001310chr1252777 2377 2330 1958 1182 12752 ----
NM_001321chr12----1159 --
NM_001349chr21455 ------
NM_001351chr31389 21537 1307 ----
NM_001356chrX22435 716 ------
NM_001364chr1131211 372 37 13630 24002 885 --
NM_001386chr822337 345 ------
NM_001390chr1843153 2838 2580 1036 12872 12599 --
NM_001394chr81834 --1648 --
NM_001397chr131882 855 699 32348 2342 290 ----
NM_001412chrX33252 3118 2388 ------
NM_001419chr1963964 3326 941 911 849 797 31677 1524 664 ----
NM_001420chr1931102 972 416 12068 32704 492 159 --
NM_001427chr711550 ------
NM_001430chr221481 26 --11504 --
NM_001438chr111281 ------
NM_001440chr852763 2573 2300 225 85 21793 576 22486 710 --
NM_001460chr111261 ------
NM_001482chr151864 ------
NM_001483chr7--1699 ----
NM_001493chrX2165 64 ------
NM_001497chr932416 2327 905 1620 11691 --
NM_001498chr61523 150 ----
NM_001521chr22520 302 ------
NM_001542chr162217 1885 1082 1042 635 80 22413 1984 ----
NM_001587chrX41978 758 733 328 21432 375 ----
NM_001614chr171154 ------
NM_001614chr171154 ------
NM_001616chr233376 3234 2157 ------
NM_001620chr111768 ------
NM_001621chr732008 1054 882 ----1272
NM_001621chr732008 1054 882 ----1272
NM_001634chr621729 1723 ------
NM_001650chr1864087 3366 3152 2717 2710 521 23418 2512 1698 --
NM_001663chr14--12758 ----
NM_001664chr32893 794 ------
NM_001677chr121101 1027 ------
NM_001682chr1222405 265 ------
NM_001684chr143835 3501 1492 160 ------
NM_001695chr833454 2602 1534 --1493 --
NM_001698chr91139 ------
NM_001699chr1931800 1354 47 2195 175 ----
NM_001701chr91133 1320 ----
NM_001704chr61217 ------
NM_001707chr78904 765 749 693 357 212 181 91 1162 2586 249 --
NM_001709chr1112052 12208 ----
NM_001713chr52236 153 ------
NM_001731chr121183 1654 ----
NM_001742chr731803 1265 21 ------
NM_001753chr721245 1174 ------
NM_001755chr163788 682 490 12051 ----
NM_001759chr1274012 3892 3805 1740 972 542 495 13942 ----
NM_001777chr343622 1223 771 372 2813 73 2849 553 --
NM_001788chr72720 218 ------
NM_001792chr181228 ------
NM_001794chr202269 199 ------
NM_001796chr16135 ------
NM_001797chr16------1526
NM_001806chr1921961 140 12078 ----
NM_001830chrX53126 1204 867 717 307 13320 23332 639 --
NM_001839chr12609 263 ------
NM_001891chr4--1233 ----
NM_001892chr52607 563 ----11299
NM_001894chr221190 1400 ----
NM_001901chr61315 1240 ----
NM_001923chr11------1504
NM_001933chr1451323 1134 1078 955 530 --1136 --
NM_001938chr11497 11671 ----
NM_001940chr121367 --151 123
NM_001941chr1831151 243 220 ------
NM_001945chr5--1448 ----
NM_001946chr1221043 323 165 ----
NM_001951chr81512 ------
NM_001957chr4--2893 237 ----
NM_001975chr121310 --1873 --
NM_001977chr441638 1090 193 123 1352 ----
NM_001980chr1241996 840 177 64 ------
NM_001981chr122404 91 --1301 --
NM_001987chr1273328 3064 2994 1576 1535 981 727 13978 1165 --
NM_001991chr1741705 268 159 25 --1880 --
NM_001995chr441294 1038 608 414 ------
NM_002006chr424237 3786 24109 2285 ----
NM_002009chr1531918 1830 1098 ------
NM_002024chrX1235 ------
NM_002025chrX68238 3722 1879 637 576 330 23647 26 48795 7760 6401 1858 --
NM_002040chr211176 ------
NM_002061chr131734 1709 1260 ------
NM_002069chr721424 45 ------
NM_002074chr12171 70 ------
NM_002077chr941485 332 310 272 1670 ----
NM_002089chr4------1128
NM_002126chr17103712 3698 3491 3328 2963 848 751 678 446 95 2513 64 33995 2609 2569 --
NM_002130chr521671 418 ------
NM_002137chr722382 2018 ------
NM_002138chr41689 ------
NM_002143chr12541 191 --1739 --
NM_002146chr17--1269 ----
NM_002154chr52464 153 ------
NM_002158chr22948 839 ------
NM_002160chr91581 168 ----
NM_002184chr5136 1193 ----
NM_002193chr261252 1218 489 409 99 32 --11295 --
NM_002203chr563012 2930 2626 1583 1459 37 ------
NM_002204chr174920 329 149 109 2508 81 1130 --
NM_002211chr102906 338 1739 ----
NM_002214chr744548 2214 2068 235 1965 1294 --
NM_002227chr13848 258 250 ------
NM_002233chr11137 ------
NM_002247chr1021795 188 --1311 --
NM_002253chr42533 336 ------
NM_002264chr354488 1560 1132 735 468 ------
NM_002265chr171211 ------
NM_002266chr171218 ------
NM_002267chr13--22200 46 ----
NM_002268chr341693 1632 369 35 ------
NM_002271chr1361931 1794 1781 1589 817 229 ------
NM_002310chr535652 1263 70 15739 ----
NM_002314chr7----11042 --
NM_002334chr112793 323 11384 21931 1787 11469
NM_002336chr1244440 1686 1631 309 14062 ----
NM_002349chr241361 565 478 415 --1392 --
NM_002351chrX31440 1416 133 21506 509 ----
NM_002356chr621873 1066 21839 149 ----
NM_002374chr21459 12390 --12634
NM_002387chr574126 3828 1454 885 869 728 284 34212 1324 1190 13974 --
NM_002390chr1751998 1775 600 200 31 2173 89 32049 1457 1278 --
NM_002397chr521469 205 1852 ----
NM_002398chr221199 1159 21045 252 1429 --
NM_002401chr1752110 1919 484 349 325 --1797 --
NM_002419chr112400 352 ------
NM_002489chr72412 353 ------
NM_002499chr1551968 897 134 97 83 ----1249
NM_002505chr661258 1154 1105 1020 993 299 ------
NM_002515chr1472075 1369 737 599 531 451 419 ------
NM_002519chr1111183 ------
NM_002522chr1742799 2472 969 730 --11536 --
NM_002538chr5------1112
NM_002544chr172290 33 ------
NM_002545chr1144753 1649 1620 1296 11931 24220 3442 12006
NM_002556chr1121477 27 ------
NM_002576chr112821 123 ------
NM_002581chr975152 4719 3943 1933 1862 656 117 11385 ----
NM_002595chr1211866 ------
NM_002605chr152372 334 ------
NM_002609chr561703 1354 687 678 57 50 ----11680
NM_002614chr11374 ----1326
NM_002618chr2143 ------
NM_002627chr10177 ------
NM_002628chr32362 354 ------
NM_002629chr102863 216 --135 --
NM_002633chr1168 ------
NM_002636chr63192 168 58 ------
NM_002648chr6--1404 --181
NM_002655chr843631 3518 3205 1590 1639 11706 --
NM_002657chr2073746 2939 2741 2536 1477 542 54 2704 301 1142 13029
NM_002709chr242728 2245 1438 285 ------
NM_002710chr1211056 ------
NM_002718chr32479 250 1293 ----
NM_002729chr102652 621 ------
NM_002740chr312380 ------
NM_002742chr141130 ------
NM_002745chr2284363 3940 3858 2960 1791 1134 1062 448 11202 23548 589 --
NM_002747chr1831609 1385 1186 11276 ----
NM_002752chr51365 ------
NM_002755chr15--1792 ----
NM_002757chr15--1330 ----
NM_002806chr141251 ------
NM_002823chr21478 ------
NM_002825chr71520 1180 ----
NM_002830chr21137 ------
NM_002833chr1531386 401 225 ------
NM_002839chr92799 77 --22490 2198 --
NM_002841chr31173 ------
NM_002843chr1133279 2881 487 22937 627 12763 --
NM_002844chr611076 21030 208 ----
NM_002857chr132399 2212 1657 ------
NM_002859chr1231410 311 42 ------
NM_002867chr11682 1195 ----
NM_002869chr111692 --21815 575 --
NM_002874chr932175 1602 837 ------
NM_002886chr344284 3739 3720 1028 15058 ----
NM_002892chr144630 482 278 82 ------
NM_002895chr203959 743 30 ------
NM_002906chr1122261 103 ------
NM_002911chr1941075 584 143 48 1115 1172 --
NM_002912chr6----1320 --
NM_002955chr631648 396 339 --11469 --
NM_002957chr963468 2928 2694 1464 1188 122 23168 2573 23006 2686 --
NM_002959chr144136 3714 767 47 13696 1187 13653
NM_002968chr161819 ------
NM_002971chr31389 1218 ----
NM_002999chr2031910 1533 769 11555 11895 --
NM_003011chr931458 1141 410 ------
NM_003013chr42678 42 ------
NM_003016chr1721816 1805 ------
NM_003026chr911349 ------
NM_003029chr111051 --21316 552 --
NM_003034chr1227551 5370 --17336 15024
NM_003042chr362220 1905 881 667 250 208 1494 ----
NM_003048chr231096 860 532 ------
NM_003051chr1--1541 11768 --
NM_003060chr531030 524 260 --1147 1182
NM_003068chr81174 11091 ----
NM_003079chr17--1142 ----
NM_003108chr245992 2067 2058 1651 16991 22516 2406 --
NM_003110chr1731075 821 739 ------
NM_003144chr61857 12002 ----
NM_003149chr321526 596 41411 1140 480 426 --11714
NM_003155chr842641 2622 1795 240 --11133 --
NM_003161chr1711421 --22223 61 --
NM_003162chr22718 117 21102 875 ----
NM_003174chr102585 279 ------
NM_003188chr63548 233 211 ------
NM_003189chr173211 3070 3064 2884 2590 2370 999 ------
NM_003198chr11271 ------
NM_003199chr1845382 1796 1692 1595 ----13640
NM_003200chr1972385 1708 1550 905 697 322 119 ------
NM_003204chr1721809 1654 --21607 1416 --
NM_003217chr121751 1104 ----
NM_003220chr6--11123 ----
NM_003236chr243222 2933 2625 73 --22487 1334 11194
NM_003242chr352428 1985 607 223 180 --12512 --
NM_003244chr181337 ------
NM_003246chr1521607 263 1461 ----
NM_003253chr2131239 726 301 ------
NM_003255chr174887 542 328 302 --22532 2071 --
NM_003257chr151151 ------
NM_003269chr631227 1206 444 ------
NM_003281chr184393 4198 3993 1838 1599 1085 782 239 --34006 3373 91 --
NM_003286chr201806 ------
NM_003291chr132571 252 ----1648
NM_003298chr364645 1844 1342 1258 430 419 ------
NM_003305chr41362 ------
NM_003314chr5198 ------
NM_003337chr521365 365 ------
NM_003338chr102192 33 --178 --
NM_003339chr521305 1085 ------
NM_003340chr431375 424 272 1528 ----
NM_003342chr1723241 3130 ------
NM_003344chr7----11579 --
NM_003345chr161476 ------
NM_003350chr82785 246 ------
NM_003376chr6----1181 --
NM_003376chr6----1181 --
NM_003383chr91390 ------
NM_003385chr21373 ------
NM_003392chr331628 1533 969 13758 ----
NM_003410chrX11009 ------
NM_003412chr3--1169 --12473
NM_003413chrX31895 1603 1369 ------
NM_003439chr783576 3453 3386 3222 2587 2275 919 783 1746 12396 --
NM_003455chr1131407 1276 1148 ------
NM_003458chr393314 3117 1601 1330 1090 805 688 433 216 13218 1794 1291
NM_003463chr6--1388 12924 --
NM_003466chr252407 2401 1917 929 433 1681 1382 --
NM_003468chr243437 3242 3125 576 1715 ----
NM_003469chr21389 ------
NM_003472chr6--11026 ----
NM_003478chr1122944 455 ------
NM_003482chr1242663 2639 2371 318 ----1183
NM_003486chr1652187 1090 1015 869 31 12675 11174 --
NM_003489chr2121003 76 --1972 --
NM_003506chr82945 483 ------
NM_003557chr11229 ------
NM_003563chr1721279 577 2552 155 ----
NM_003565chr121479 --1604 --
NM_003566chr1221356 928 ------
NM_003583chr1233406 2377 128 ------
NM_003586chr162639 48 ------
NM_003590chr242737 866 539 391 ------
NM_003592chr72342 324 ------
NM_003603chr411649 1820 11436 --
NM_003607chr143929 3772 3751 3311 ----1839
NM_003615chr321199 683 --1149 --
NM_003629chr11612 12227 ----
NM_003632chr172583 575 ------
NM_003633chr52825 29 ------
NM_003663chr313201 1752 ----
NM_003671chr942635 2233 1261 538 ------
NM_003672chr11792 11435 --1134
NM_003679chr132585 2495 2135 23063 2925 ----
NM_003688chrX124 --137 --
NM_003709chr2--1316 ----
NM_003713chr12684 389 11089 ----
NM_003716chr31413 ----1226
NM_003737chr112282 161 ------
NM_003743chr242299 1660 1568 1497 ------
NM_003758chr1521186 1000 2540 343 ----
NM_003758chr1521186 1000 2540 343 ----
NM_003759chr473663 3609 1604 1204 1093 795 332 23626 1722 ----
NM_003760chr1------1211
NM_003764chr63686 668 45 ------
NM_003772chr111331 ------
NM_003774chr1243260 2702 2566 1062 --1124 --
NM_003787chr182594 388 ------
NM_003794chr31957 ------
NM_003795chr6--151 --1425
NM_003800chr6----11972 --
NM_003808chr171293 ------
NM_003822chr11512 12266 ----
NM_003846chr11704 ------
NM_003861chr1432351 682 626 --12505 --
NM_003884chr331602 640 124 ------
NM_003887chr212282 11577 ----
NM_003888chr151286 11393 ----
NM_003893chr10----192 --
NM_003895chr211757 1860 ----
NM_003896chr22830 738 ------
NM_003899chr1342328 1724 741 523 22361 496 155 --
NM_003901chr1052158 1798 866 627 106 --11982 --
NM_003913chr621617 281 13612 23482 745 --
NM_003932chr2231717 1589 688 ------
NM_003939chr1043587 3324 3207 505 --13663 13875
NM_003941chr712549 22277 405 12023 --
NM_003948chr4----12568 --
NM_003955chr1711221 --11042 21625 206
NM_003958chr653753 2872 2776 949 216 22720 199 ----
NM_003966chr597838 7666 6715 6490 5708 1518 1080 616 288 ----16008
NM_003971chr171118 ------
NM_003972chr101343 ------
NM_003980chr61411 --184 --
NM_004028chr1864087 3366 3152 2717 2710 521 23418 2512 1698 --
NM_004035chr17115153 5112 5099 5035 4956 4446 3652 1740 1674 867 40 ------
NM_004055chr1141904 1674 817 277 ----1314
NM_004056chr8--1753 11007 --
NM_004067chr7--21567 36 --11336
NM_004071chr2--1261 ----
NM_004081chrY1488 11563 --11147
NM_004087chr321614 87 ------
NM_004089chrX--184 ----
NM_004093chr133829 531 109 --22140 353 --
NM_004094chr1442924 2540 305 206 12429 ----
NM_004100chr61997 12493 ----
NM_004105chr2--165 ----
NM_004114chrX--1310 ----
NM_004124chr1442718 2375 747 640 ------
NM_004156chr81170 ------
NM_004157chr31651 1161 ----
NM_004162chr3169 ------
NM_004200chr1132346 879 360 22962 171 22521 2272 --
NM_004208chrX167 ------
NM_004225chr831068 944 251 --3961 365 41 --
NM_004227chr752816 2537 2044 673 126 --22243 695 --
NM_004235chr9--1105 ----
NM_004241chr10--1218 ----
NM_004253chr91809 ------
NM_004255chr15------1122
NM_004272chr511351 ----11904
NM_004277chr62687 139 ----1346
NM_004279chr72718 328 22155 582 ----
NM_004293chr952785 1166 1085 500 93 ------
NM_004296chr1473144 1458 1245 1122 725 457 427 43688 2855 2801 542 ----
NM_004302chr1221039 741 1846 22162 1889 --
NM_004313chr171429 ------
NM_004320chr16----168 --
NM_004330chr1521172 968 11106 ----
NM_004331chr832633 2200 1031 22134 972 ----
NM_004349chr81474 ------
NM_004358chr2021139 930 --11050 --
NM_004365chr51123 ------
NM_004370chr6----11482 --
NM_004371chr12304 78 --11326 --
NM_004380chr1642475 2098 1826 1033 ----11623
NM_004381chr61133 ------
NM_004392chr1341858 1765 999 372 ------
NM_004393chr342247 2125 1991 1569 1289 1927 --
NM_004397chr1123843 1263 11506 13218 --
NM_004411chr71554 ------
NM_004417chr52503 457 ------
NM_004423chr332620 1850 1734 --1662 --
NM_004426chr1251837 1237 770 624 319 11266 --11605
NM_004430chr842532 2465 805 437 11874 ----
NM_004432chr952046 1722 657 609 130 --12276 --
NM_004433chr131422 1235 401 --2468 367 --
NM_004438chr211055 11098 --12131
NM_004440chr61138 ----11683
NM_004447chr122887 146 ------
NM_004454chr32320 150 --11623 --
NM_004456chr7162 ------
NM_004464chr443064 453 439 205 1669 ----
NM_004482chr22706 647 1151 ----
NM_004485chr184371 4018 3438 3375 1227 1133 985 405 ------
NM_004501chr123983 3379 14105 --12857
NM_004506chr62741 131 ------
NM_004514chr1772826 2559 2497 1118 315 116 73 23064 2251 1228 --
NM_004586chrX84917 4623 3745 1884 892 839 423 393 ------
NM_004598chr522508 1204 187 --11115
NM_004612chr913929 ------
NM_004630chr111230 ------
NM_004631chr121076 323 ------
NM_004637chr3122 --11280 --
NM_004654chrY2915 125 11046 ----
NM_004655chr1721148 986 ------
NM_004663chr1551416 1263 1111 1034 597 1574 ----
NM_004671chr18--1218 ----
NM_004684chr4134 ------
NM_004685chr1322295 1097 ------
NM_004690chr6--1702 ----
NM_004694chr171233 ----1145
NM_004703chr1732408 2255 718 --11813 --
NM_004717chr711014 --1966 --
NM_004719chr1242493 2330 2272 804 ------
NM_004726chrX65311 2132 1972 1879 1263 319 1515 ----
NM_004730chr541803 130 60 45 ------
NM_004731chr1221421 1247 --1748 --
NM_004734chr1342335 2074 1125 423 22180 864 11985 --
NM_004736chr141739 857 518 78 ------
NM_004738chr2052608 1904 1655 1052 761 1553 ----
NM_004744chr411261 2639 213 --164
NM_004745chr866445 5048 1695 1546 693 518 15229 --11500
NM_004755chr142196 166 --11137 --
NM_004772chr521559 1107 ------
NM_004774chr1722249 1266 1736 12313 --
NM_004779chr52268 99 ------
NM_004781chr1--1499 ----
NM_004781chr1--1499 ----
NM_004788chr1132520 1781 1088 21958 229 --1896
NM_004798chr2042974 1364 876 213 ----1550
NM_004807chr262299 2180 2054 1757 1037 397 --21958 95 --
NM_004814chr12467 90 ------
NM_004822chr1763256 2872 2673 2662 1205 983 11174 1479 12856
NM_004834chr242607 2597 843 404 ----1283
NM_004840chrX22134 664 ------
NM_004841chr12419 336 ------
NM_004845chrX73985 3743 3702 3398 3240 1284 1132 13852 ----
NM_004849chr621215 55 ------
NM_004850chr221542 1227 ------
NM_004856chr15--1611 ----
NM_004857chr1454485 3520 3497 1860 667 23829 3471 1309 --
NM_004859chr1722821 2293 ----1731
NM_004884chr1541149 655 618 452 --11185 --
NM_004893chr52217 188 ------
NM_004896chr101272 --11383 1581
NM_004898chr442811 2450 2220 738 12716 1644 --
NM_004904chr786602 6225 5230 2599 1413 1279 1250 560 ------
NM_004924chr19198 ------
NM_004925chr91182 --147 --
NM_004929chr821511 955 ----1623
NM_004937chr1792679 2551 2179 1697 787 779 754 392 214 --11817 1302
NM_004947chr32945 636 22319 990 ----
NM_004961chrX41094 1025 956 471 --1256 --
NM_004962chr10197 --1204 --
NM_004966chr10--1834 ----
NM_004975chr205971 740 614 215 209 --1714 --
NM_004979chrX21131 226 1947 197 --
NM_004985chr1223149 1179 ------
NM_004992chrX178402 8209 8032 7625 6326 5818 5751 3379 2704 2698 2287 2102 1780 840 632 318 174 11392 ----
NM_004992chrX178402 8209 8032 7625 6326 5818 5751 3379 2704 2698 2287 2102 1780 840 632 318 174 11392 ----
NM_004996chr1641495 624 70 52 1633 11626 --
NM_005010chr741967 1792 1665 54 ------
NM_005011chr721828 1439 1173 ----
NM_005012chr11119 ------
NM_005025chr31232 ------
NM_005028chr1042217 648 430 188 ------
NM_005036chr22128026 7466 6727 3095 3083 2723 1973 1307 1051 624 420 186 25858 53 26872 1706 --
NM_005056chr1245083 4517 1606 1328 2633 184 --1696
NM_005065chr1434679 4076 2045 ------
NM_005077chr9--1511 ----
NM_005079chr81672 1931 ----
NM_005093chr2074594 3906 3441 1965 980 807 600 33660 1852 39 --13362
NM_005097chr10--1136 ----
NM_005109chr331781 611 201 11889 ----
NM_005112chr44994 900 685 241 --1222 --
NM_005116chr2033826 3691 458 34128 3220 819 ----
NM_005121chr172741 301 23600 3077 ----
NM_005134chr181304 ------
NM_005137chr2232230 2134 1647 --136 --
NM_005140chrX3780 710 197 --1388 --
NM_005151chr1841607 873 596 525 ------
NM_005155chr6----1623 --
NM_005156chr924270 1549 25133 4614 11474 --
NM_005163chr142773 162 ------
NM_005168chr221480 1231 1654 1286 --
NM_005184chr1941428 1200 1085 446 ------
NM_005187chr1631719 265 34 ------
NM_005188chr1198318 7206 7067 6987 6392 5795 1285 829 65 12603 ----
NM_005197chr1434631 594 380 24130 544 25271 4960 --
NM_005206chr1711218 ------
NM_005207chr2253364 2712 2304 1208 1035 11134 ----
NM_005211chr51184 ----123
NM_005214chr2--1236 ----
NM_005215chr181462 1490 ----
NM_005233chr332041 1846 131 157 ----
NM_005235chr226527 443 37412 2899 1985 --26826 6752
NM_005238chr1122201 1345 --1988 --
NM_005241chr31548 ------
NM_005243chr221253 ------
NM_005244chr202471 190 ------
NM_005248chr1--2220 112 1539 --
NM_005254chr151897 ------
NM_005256chr112675 379 1151 ----
NM_005277chr441205 693 160 139 ------
NM_005284chr61354 ------
NM_005324chr17--1796 21995 178 --
NM_005329chr1631911 633 293 11613 ----
NM_005336chr23291 235 146 2719 636 1491 --
NM_005342chrX22673 1955 --2197 49 --
NM_005358chr133253 243 24 ------
NM_005359chr1815983 25497 4706 ----
NM_005375chr611123 1136 ----
NM_005378chr21863 ------
NM_005386chr203875 288 168 1322 1122 --
NM_005387chr112596 90 ------
NM_005392chr931405 613 340 ------
NM_005398chr1021400 1101 ------
NM_005399chr144138 3883 664 40 --11552 --
NM_005400chr222464 2152 ------
NM_005406chr1821359 1087 ------
NM_005407chr141997 11217 1339 --
NM_005426chr12248 198 ------
NM_005430chr122943 68 --199 --
NM_005436chr1022828 2518 1460 ----
NM_005445chr10--1116 ----
NM_005453chr62545 52 ------
NM_005455chr1--11845 ----
NM_005471chr5128 ----11023
NM_005474chr172582 302 21368 1250 1493 --
NM_005475chr1262553 2390 2253 1217 1031 44 22800 2745 ----
NM_005477chr151974 21895 215 ----
NM_005477chr151974 21895 215 ----
NM_005493chr61804 ------
NM_005497chr1755159 4257 2420 2004 1403 1726 ----
NM_005502chr913083 1530 ----
NM_005509chr511820 ------
NM_005522chr711149 1981 ----
NM_005527chr62374 22 ------
NM_005540chr121397 134 ----11249
NM_005544chr2--1405 ----
NM_005546chr56882 716 660 464 155 73 ------
NM_005562chr131606 1260 219 --21629 1050 --
NM_005570chr1811073 ------
NM_005573chr51555 ------
NM_005574chr111156 ------
NM_005577chr6--127 ----
NM_005587chr152704 245 ------
NM_005595chr12371 240 ------
NM_005596chr965881 4424 4317 1079 581 255 25363 4337 ----
NM_005600chr11272 ------
NM_005602chr31126 ------
NM_005603chr182539 240 --1359 --
NM_005604chr641994 567 324 27 11815 ----
NM_005607chr82392 100 1284 1745 --
NM_005611chr162487 316 21046 1038 ----
NM_005639chr1251684 1508 683 639 242 ----1550
NM_005647chrX42657 2294 1351 901 ------
NM_005650chr221166 ------
NM_005655chr82916 374 ------
NM_005665chr124055 1128 13460 1622 --
NM_005668chr544368 3143 707 94 ------
NM_005669chr522314 1610 --1184 --
NM_005688chr32377 38 ------
NM_005708chr13----1167 --
NM_005717chr1194 ------
NM_005720chr7--1239 ----
NM_005722chr242407 1955 640 501 ------
NM_005734chr111613 ------
NM_005737chr252288 1898 1093 671 664 ------
NM_005738chr71784 ------
NM_005742chr21828 ------
NM_005744chr15--1124 ----
NM_005746chr722238 451 ----12269
NM_005748chr1222707 1035 --12580 --
NM_005759chr254221 1805 1676 1018 567 ------
NM_005768chr12165 ------
NM_005779chr531394 1193 506 23467 751 1389 --
NM_005813chr22748 384 ------
NM_005822chr652227 1820 1599 539 316 12289 11812 --
NM_005828chr1735050 4391 411 1796 14943 --
NM_005832chr311289 ------
NM_005840chrX67579 6610 5682 4906 1878 862 --17497 --
NM_005859chr511102 --11424 1150
NM_005862chr31162 ------
NM_005863chr101429 ----183
NM_005869chr5--180 ----
NM_005871chr101258 1198 ----
NM_005898chr111577 11041 1498 --
NM_005900chr411164 ------
NM_005901chr1888224 7509 6870 5357 2606 432 141 117 22047 823 ----
NM_005902chr1574174 4123 3832 3100 2861 2834 1133 1869 24537 1794 23756 677
NM_005903chr564415 3591 3290 1330 1302 67 ------
NM_005904chr1831107 554 511 21315 286 ----
NM_005906chr6143 1187 ----
NM_005909chr584077 4041 3772 3149 2824 921 359 331 13868 ----
NM_005911chr22921 231 ------
NM_005917chr2--168 ----
NM_005933chr1162395 2327 2191 860 560 387 --12124 --
NM_005937chr1754153 2897 1010 534 365 22997 884 --1594
NM_005938chrX31358 1231 939 --1505 --
NM_005955chr134052 3716 3584 --1159 --
NM_005966chr221834 1791 ------
NM_005977chr131279 ------
NM_005986chr132606 471 ----12132
NM_005994chr17----2739 361 --
NM_006003chr191201 ------
NM_006011chr1574141 3154 3067 3002 2663 1102 525 34284 3712 3541 ----
NM_006016chr61624 --11972 1148
NM_006037chr233954 3147 810 13479 54284 4126 3173 1019 111 1844
NM_006040chr1641289 944 930 218 --1423 --
NM_006047chr2021157 138 13012 ----
NM_006048chr11330 ------
NM_006054chr1111614 1358 ----
NM_006070chr31110 ------
NM_006076chr783093 3008 2678 2202 589 535 493 354 --11981 --
NM_006077chr103337 281 39 1267 ----
NM_006084chr141309 ------
NM_006094chr812422 21975 920 --12302
NM_006095chr41167 ------
NM_006096chr841610 665 496 219 11315 1356 --
NM_006106chr1123380 2870 23341 2904 ----
NM_006135chr11400 ------
NM_006136chr72899 141 ------
NM_006141chr1622295 1979 ------
NM_006145chr191138 --1895 --
NM_006154chr151892 1249 --11841
NM_006166chr1232067 1938 1771 1558 ----
NM_006191chr121916 ------
NM_006195chr92572 210 ------
NM_006203chr525495 3671 21844 1744 ----
NM_006206chr42848 218 ------
NM_006224chr1782210 2168 2130 1999 1670 999 579 263 1589 ----
NM_006226chr21879 --1403 --
NM_006237chr132793 247 ----21876 572
NM_006241chr311864 197 ----
NM_006243chr1------2986 849
NM_006251chr533129 3029 2058 1915 ----
NM_006254chr32449 393 168 ----
NM_006256chr122584 2205 32712 2092 150 1207 --
NM_006265chr81225 11101 ----
NM_006266chr9141 ------
NM_006282chr2073618 3387 2916 1449 705 112 85 24352 3807 11824 --
NM_006289chr91101 ------
NM_006293chr151774 --1638 --
NM_006298chr641086 709 619 27 --22955 674 --
NM_006306chrX85691 5637 4529 4091 2219 1138 805 457 25780 4012 14319 11842
NM_006310chr172378 250 ------
NM_006315chr434062 3147 2797 24527 171 ----
NM_006320chr4--11146 ----
NM_006330chr8--139 ----
NM_006335chr11136 --1862 --
NM_006350chr51129 ------
NM_006352chr111768 ------
NM_006359chrX32334 2011 750 ----1338
NM_006364chr141464 ------
NM_006367chr14935 862 694 401 ------
NM_006371chr354268 4083 3948 3449 866 --34197 1062 338 --
NM_006375chrX21589 163 21603 434 ----
NM_006377chr921225 487 ------
NM_006379chr72737 151 1182 ----
NM_006380chr1763499 2891 2819 1618 1575 642 ------
NM_006382chr171236 ------
NM_006386chr2252054 1923 1803 763 755 ------
NM_006389chr111183 --1430 --
NM_006393chr1034300 3118 1460 14316 ----
NM_006400chr12196 ------
NM_006434chr1043151 2527 1082 590 148 12077 1840
NM_006449chr21364 --11378 --
NM_006451chr51378 ------
NM_006457chr453576 3019 1172 558 530 --12921 13558
NM_006458chr11195 ------
NM_006459chr1011859 1783 ----
NM_006467chr51866 11757 1414 --
NM_006472chr141197 1170 800 197 --11224 --
NM_006482chr1233406 2377 128 ------
NM_006489chr1472075 1369 737 599 531 451 419 ------
NM_006493chr1321400 44 ------
NM_006496chr121538 130 1632 ----
NM_006513chr12221 85 ------
NM_006516chr1160 11593 21500 584 --
NM_006534chr2052705 2620 2425 1300 435 ------
NM_006537chr15--1592 --1157
NM_006538chr264000 3859 1094 916 228 68 21250 1044 ----
NM_006539chr161515 ------
NM_006542chr1127 ------
NM_006544chr1435793 5369 1528 1459 ----
NM_006546chr1764872 4765 4141 1184 1077 689 --22169 936 --
NM_006547chr7--1839 ----
NM_006548chr321381 1331 ------
NM_006561chr1045530 4965 2267 1771 25658 2099 ----
NM_006565chr16--1105 ----
NM_006577chr211081 ------
NM_006599chr1688025 7158 6893 5318 2015 991 934 150 17942 18124 --
NM_006603chrX11734 ------
NM_006609chr232543 1089 269 ------
NM_006614chr333181 2690 183 1676 ----
NM_006628chr1524503 2871 --13911 --
NM_006629chr1832830 2202 2026 21943 127 ----
NM_006646chr1352666 1172 990 254 98 --1978 1802
NM_006650chr543506 3468 2831 431 --23858 584 23217 2396
NM_006654chr1254479 3502 1219 1205 524 13587 ----
NM_006667chrX----1108 --
NM_006670chr61520 --1505 --
NM_006682chr732251 360 62 ------
NM_006690chr2062259 2049 1763 830 368 206 1389 ----
NM_006698chr20----1474 --
NM_006699chr1----2549 348 --
NM_006706chr51330 ------
NM_006708chr621258 77 --1887 --
NM_006722chr323002 504 --1800 --
NM_006726chr4148 1454 1817 158
NM_006727chr5185 ------
NM_006729chrX54630 3828 3793 1954 656 24289 3748 --15096
NM_006734chr611439 1392 ----
NM_006735chr7--126 ----
NM_006749chr811058 ----1942
NM_006750chr1677102 2613 2371 1548 1131 468 198 --16967 --
NM_006751chr21319 ------
NM_006766chr821814 761 ------
NM_006775chr61279 22017 1932 ----
NM_006777chrX32843 2793 370 ------
NM_006807chr17--1478 1337 --
NM_006815chr12----11056 --
NM_006823chr83522 442 321 ------
NM_006826chr21513 ------
NM_006827chr1413212 192 ----
NM_006852chr1752261 2203 757 160 151 ------
NM_006854chr742004 1797 1611 24 --11596 --
NM_006885chr1623033 724 13173 ----
NM_006888chr1432683 338 142 11016 1709 --
NM_006902chr112929 2828 22 ----
NM_006915chrX1984 ------
NM_006920chr221736 1290 ------
NM_006922chr212321 ------
NM_006927chr1652100 1788 763 370 347 1159 143 --
NM_006947chr41437 ------
NM_006950chrX----1149 --
NM_006965chr1821163 30 ------
NM_006973chr10142 ------
NM_006981chr931174 288 42 21031 956 ----
NM_006991chr32288 174 --1833 --
NM_006999chr5186 --1650 11347
NM_007005chr9144 ------
NM_007006chr162403 49 13413 --11387
NM_007007chr1221376 1253 1385 11449 --
NM_007008chr2------1689
NM_007010chr1711526 --11519 --
NM_007011chr15106699 6207 5907 5415 5327 2570 1692 1206 761 269 --2920 126 16544
NM_007027chr31457 --1100 --
NM_007030chr564940 4722 3979 957 288 182 13951 13242 11463
NM_007038chr2145022 3791 1295 48 ----15148
NM_007050chr2097882 7588 7446 7092 6208 5159 2240 2175 102 25396 499 --11119
NM_007064chr321162 640 ------
NM_007067chr171253 ------
NM_007073chr663606 2850 1097 974 709 67 ------
NM_007078chr1062559 2466 1895 1886 944 429 ------
NM_007106chr131640 11125 ----
NM_007107chr342424 2279 2161 209 ------
NM_007111chr131870 ------
NM_007126chr91344 ------
NM_007146chr1742859 2628 1975 860 ------
NM_007158chr11417 ------
NM_007159chr331714 1587 1140 11101 ----
NM_007174chr1241589 880 198 89 12284 2916 218 --
NM_007176chr1421150 701 ------
NM_007178chr12--163 ----
NM_007202chr171724 196 ----
NM_007203chr923092 1451 1458 12763 --
NM_007222chr811543 ------
NM_007246chr42178 82 ------
NM_007249chr13108057 6943 6376 6042 2166 2116 1588 1133 545 51 35844 2328 912 13472 11178
NM_007275chr35473 415 370 234 27 1961 ----
NM_007276chr71173 ------
NM_007282chr31779 1217 ----
NM_007292chr17115153 5112 5099 5035 4956 4446 3652 1740 1674 867 40 ------
NM_007308chr41454 ------
NM_007327chr961104 1088 1011 864 770 306 1254 1116 21023 95
NM_007345chr18164 ------
NM_007350chr1264292 4215 3196 904 489 58 13122 ----
NM_007361chr141587 --1118 --
NM_007363chrX--11062 ----
NM_007375chr142459 1876 849 573 ------
NM_012081chr543479 2270 1471 738 ------
NM_012082chr81384 ------
NM_012095chr1033030 2178 530 22598 2240 1571 --
NM_012098chr931398 1332 303 ------
NM_012104chr1183425 3014 2773 920 699 607 217 87 11263 1102 --
NM_012104chr1183425 3014 2773 920 699 607 217 87 11263 1102 --
NM_012141chr1334043 922 493 13745 ----
NM_012154chr82582 98 ------
NM_012156chr2043296 2815 2604 469 13196 12169 --
NM_012158chr1331292 446 22 ------
NM_012164chr966731 6379 6150 5216 2784 2349 15819 26616 6102 15786
NM_012175chr11--126 ----
NM_012193chr1174461 3879 3664 3316 2181 2056 1988 24591 163 12023 --
NM_012197chr921201 515 ------
NM_012199chr143991 3710 1783 276 --13451 --
NM_012207chr10139 ------
NM_012214chr2106129 5609 5594 5486 4659 3964 2482 2240 2147 1292 34123 2072 1775 --12112
NM_012215chr1011241 1308 ----
NM_012216chrX1112 ------
NM_012231chr121182 27 1470 187 --
NM_012233chr22835 135 1155 ----
NM_012234chr331167 910 692 ------
NM_012249chr233158 566 190 ------
NM_012257chr71181 ------
NM_012261chr20167 1574 ----
NM_012262chr165060 3663 1931 1371 1231 1184 22079 638 14155 --
NM_012279chr531948 1344 607 --11512 --
NM_012281chr72976 240 ------
NM_012287chr323496 1377 34214 3683 2835 13409 --
NM_012288chr685263 4217 3583 1508 1391 1153 810 301 15132 ----
NM_012294chr783088 2733 2707 1016 1009 569 470 36 22717 316 --13217
NM_012296chr11113482 3401 3342 3232 2972 2550 1125 278 187 131 35 ------
NM_012300chr532277 2159 157 ------
NM_012304chr55757 673 643 525 80 21023 848 1772 --
NM_012307chr18--1202 ----
NM_012316chr164959 4646 4587 4125 3727 798 138 25087 167 --
NM_012325chr2021208 122 ------
NM_012326chr22667 121 1633 --1798
NM_012330chr1021723 74 1124 ----
NM_012338chr7162 ------
NM_012342chr10----170 --
NM_012347chr62840 406 --163 22626 1001
NM_012382chr531770 1593 1432 12852 ----
NM_012402chr1121162 1060 ------
NM_012412chr72604 178 ------
NM_012416chr911187 ------
NM_012421chr11428 ------
NM_013230chrY1506 ------
NM_013231chr1464387 4022 3478 3390 2868 1288 1563 ----
NM_013261chr411390 23156 2843 1388 1828
NM_013277chr121199 ------
NM_013283chr5192 --1582 --
NM_013293chr71129 ------
NM_013296chr1186 ------
NM_013316chr73862 848 114 ------
NM_013354chr831221 340 94 ------
NM_013372chr15----1223 --
NM_013374chr332756 2087 1053 ------
NM_013380chr191257 ------
NM_013381chr1221733 579 11667 ----
NM_013396chr211367 ------
NM_013401chr113720 330 144 2257 156 ----
NM_013423chrX----1156 --
NM_013427chrX----1156 --
NM_013434chr221979 762 ----11816
NM_013434chr221979 762 ----11816
NM_013436chr2--1664 ----
NM_013437chr8--1914 ----
NM_013438chr931266 624 144 ------
NM_013444chrX1764 ------
NM_013448chr141146 ------
NM_013450chr211175 ------
NM_013943chr122377 1258 13279 23062 753 --
NM_013951chr252407 2401 1917 929 433 1681 1382 --
NM_013952chr252484 2478 1994 1006 510 1758 1459 --
NM_013953chr252484 2478 1994 1006 510 1758 1459 --
NM_013986chr221253 ------
NM_013992chr252484 2478 1994 1006 510 1758 1459 --
NM_013995chrX11035 ------
NM_014011chr212256 11877 ----
NM_014021chr143000 833 304 214 1267 12728 --
NM_014023chr101730 --22248 967 --
NM_014028chr622898 2111 23237 2625 --12071
NM_014034chr61281 ------
NM_014048chr1684957 3587 3331 1643 1378 1063 884 283 35018 2105 2063 23999 2023 --
NM_014057chr931600 1547 1400 ------
NM_014079chr31175 ------
NM_014112chr844896 4708 4454 1815 14922 14374 --
NM_014117chr1622628 2037 ------
NM_014141chr7134893 4189 3965 3380 3358 3231 1746 1677 1473 863 641 91 70 ------
NM_014153chr16137 ------
NM_014154chr32503 242 ------
NM_014155chr1166781 6603 6165 5337 1872 137 34970 4964 885 27360 1969 --
NM_014159chr3195 ------
NM_014190chr4196 --11178 --
NM_014191chr12--1383 ----
NM_014216chr1431165 1080 44 ----1186
NM_014231chr1231664 540 332 ----1774
NM_014238chr1771574 1130 653 526 392 95 58 ------
NM_014240chr373707 3184 2987 1494 1368 260 129 2764 287 11012 --
NM_014243chr422139 1697 ------
NM_014246chr224880 424 329 238 1840 11490 --
NM_014252chr13172 ------
NM_014267chr11177 1254 ----
NM_014271chrX1759 1170 ----
NM_014280chr1--1626 ----
NM_014283chr1----11226 --
NM_014289chrX1165 ------
NM_014309chr2255432 5157 4064 3976 3511 11790 25400 1306 11107
NM_014345chr61121 ------
NM_014350chr51942 --152 --
NM_014351chr2221349 1189 ----11440
NM_014368chr932066 1697 1681 11662 --1199
NM_014376chr52839 120 ------
NM_014391chr101583 --1593 --
NM_014393chr82782 622 1639 ----
NM_014394chr10--11015 ----
NM_014397chr91415 136 ----
NM_014399chr74368 250 221 112 ------
NM_014400chr191405 ------
NM_014408chr1----137 --
NM_014415chr31594 ------
NM_014417chr192695 250 ------
NM_014418chr1411796 21381 346 --1799
NM_014423chr574829 4177 3952 3452 2263 1332 1037 14911 ----
NM_014445chr342246 932 542 99 ------
NM_014454chr61338 1808 ----
NM_014456chr1041465 1437 672 97 ------
NM_014469chr111247 ------
NM_014491chr7--2718 167 ----
NM_014494chr161933 1224 11865 156
NM_014517chr33525 207 190 21916 33 1636 --
NM_014554chr1212094 1782 ----
NM_014572chr133652 367 188 --1267 --
NM_014585chr2145 --11170 --
NM_014587chr1651480 1285 1274 1267 968 31153 976 286 1504 --
NM_014606chr4--11384 ----
NM_014607chr241738 1650 563 403 --21860 1470 --
NM_014629chr821226 206 11206 --11129
NM_014636chr953629 2970 1158 222 80 23343 971 23172 296 --
NM_014647chr1612056 1319 12304 11868
NM_014659chr152118 67 --1408 --
NM_014660chr7197 ------
NM_014665chr883025 2266 1473 1288 1032 940 138 97 --13306 23093 1298
NM_014666chr5----1188 --
NM_014667chr322214 241 ------
NM_014677chr821241 321 21401 446 ----
NM_014686chr1952361 2124 1933 870 674 1278 ----
NM_014702chr632667 2271 59 11155 ----
NM_014707chr71642 1609 ----
NM_014729chr841898 1434 420 117 12054 ----
NM_014730chr1274578 4570 4535 3298 1420 659 403 15014 14734 --
NM_014730chr1274578 4570 4535 3298 1420 659 403 15014 14734 --
NM_014732chr1664857 2200 1910 1034 107 63 ----11404
NM_014733chr512150 160 12027 --
NM_014739chr633941 1427 915 ------
NM_014743chr442264 2036 1944 405 12273 12476 --
NM_014755chr243362 3104 864 425 23325 879 13399 --
NM_014764chr122187 51 ------
NM_014779chr311093 ------
NM_014795chr211122 ------
NM_014797chr622604 208 --12874 12438
NM_014800chr7--1135 ----
NM_014803chr1032202 228 101 22319 1101 1900 --
NM_014810chr121374 1345 22698 564 --1617
NM_014820chr321565 262 ------
NM_014824chr1131271 324 76 21928 573 ----
NM_014826chr143929 3772 3751 3311 ----1839
NM_014827chr111623 ------
NM_014829chr51166 ------
NM_014830chr1243138 3041 2974 1535 --23323 2717 --
NM_014835chr2041576 870 711 680 1127 11420 1521
NM_014836chr1031353 466 119 169 ----
NM_014839chr1----12311 --
NM_014840chr1262992 2885 1166 933 323 242 1608 12941 --
NM_014841chr62852 507 1101 ----
NM_014847chr1--173 ----
NM_014871chr121563 ------
NM_014872chr922147 598 ------
NM_014873chr163550 1714 1344 1072 788 455 1861 ----
NM_014874chr141825 1779 123 79 1156 ----
NM_014877chr1755953 2739 2694 2440 496 27420 1856 15861 --
NM_014888chr731353 1226 92 ------
NM_014891chr721270 632 11046 ----
NM_014893chrY1912 ------
NM_014897chr1732112 405 75 --12222 --
NM_014899chr543057 3037 2560 2211 ------
NM_014903chr1232147 1601 94 ------
NM_014904chr1013608 1736 ----
NM_014917chr13642 625 260 ------
NM_014923chr1331455 689 98 ------
NM_014924chr1463072 2514 2005 1137 867 784 12923 ----
NM_014926chr321017 792 --1893 --
NM_014927chrX130 ------
NM_014932chr321444 1227 ------
NM_014935chr193751 3740 3475 3378 3302 2414 1196 953 473 12653 12987 1280
NM_014939chr1821553 1012 ------
NM_014944chr131196 583 261 --11085 --
NM_014945chr511541 --61516 1498 1482 789 468 458 --
NM_014946chr222757 252 ------
NM_014951chr1041769 883 797 136 22286 2065 ----
NM_014952chr153540 77 59 1205 11310 --
NM_014953chr1333365 3024 975 --14305 13936
NM_014961chr431651 852 641 12104 ----
NM_014962chr2012823 11012 ----
NM_014964chr173566 424 224 --22342 30 --
NM_014974chr1031426 1177 532 --11611 --
NM_014982chr1484909 3746 3676 3611 1923 1420 530 145 ------
NM_014991chr41166 --12602 --
NM_014994chr1531969 1615 375 ------
NM_014997chr742526 2396 1904 285 1754 ----
NM_014999chr1211385 ------
NM_015000chr1232376 2103 671 ------
NM_015002chr1242076 1876 1767 524 ------
NM_015008chr333647 2350 291 1623 ----
NM_015020chr1663879 3593 2812 2774 950 248 13471 21365 879 --
NM_015024chr81169 ------
NM_015025chr242253 2042 760 165 ------
NM_015033chr951263 936 920 213 77 --33148 607 440 --
NM_015035chr20126150 5299 5088 5028 4839 4564 4102 2375 1826 1600 1522 566 11508 45172 4166 1660 116 15831
NM_015039chr124321 621 21714 685 ----
NM_015042chr153772 624 414 1372 22944 1033 --
NM_015044chr1642891 2002 1229 500 12469 13115 --
NM_015045chr1012122 --11915 --
NM_015050chr651277 1245 1189 287 111 --11090 --
NM_015052chr72388 380 ------
NM_015071chr5126113 5284 5182 4740 4645 1951 1909 942 924 365 291 229 15073 31986 1348 276 --
NM_015074chr194767 4640 3294 1620 1107 1079 625 417 136 --13328 --
NM_015075chrX51718 1404 647 617 61 11847 21839 513 --
NM_015076chr652878 269 207 142 39 31480 721 465 ----
NM_015077chr1764299 3424 1486 1298 413 209 24540 1847 24479 3253 --
NM_015091chr141142 ------
NM_015092chr1673720 3645 2904 1832 1546 1518 333 ------
NM_015093chr631341 1160 556 ------
NM_015097chr322026 1445 ------
NM_015107chrX3951 889 68 12360 1194 --
NM_015110chr91613 11612 ----
NM_015113chr1732217 799 522 21819 92 21962 454 --
NM_015115chr433172 2551 2492 ------
NM_015125chr19135 ------
NM_015130chr41110 ------
NM_015132chr7--11845 11997 --
NM_015138chr1512638 1377 2713 460 --
NM_015143chr4262 29 --1256 --
NM_015144chr1643512 3120 671 294 2607 471 12874 --
NM_015147chr232672 996 552 22137 928 ----
NM_015149chr131747 1416 157 11615 ----
NM_015155chr1052568 2345 858 577 32 ------
NM_015156chr1431573 1168 555 ------
NM_015170chr871956 920 763 749 551 235 79 ------
NM_015171chr16----1197 --
NM_015180chr141288 ------
NM_015185chrX52122 858 629 124 80 22485 1040 ----
NM_015192chr203517 434 103 ------
NM_015199chr312691 11089 ----
NM_015200chr4--11918 ----
NM_015205chr1364203 1079 880 318 296 290 11537 130 --
NM_015206chr1521543 1352 --11512 --
NM_015208chr1833836 3009 247 ----13032
NM_015215chr11798 13073 ----
NM_015216chr51975 ------
NM_015233chr1342141 1704 899 566 12151 165 --
NM_015245chr662689 2224 1704 636 516 202 1748 1797 1756
NM_015250chr931940 1788 199 ------
NM_015251chr1652174 2029 1581 763 672 ------
NM_015252chr21896 ------
NM_015268chr31187 ------
NM_015271chr473830 3378 3254 2867 2834 1650 1220 ------
NM_015272chr161240 1621 ----
NM_015277chr181445 ------
NM_015278chr61236 13301 ----
NM_015285chr1812282 ------
NM_015293chr6--1248 ----
NM_015299chr1454002 3505 2983 2522 103 13185 ----
NM_015310chr8108231 7392 6923 6692 6593 5386 5216 2778 2274 558 35320 2264 2258 56808 6730 5099 2724 478 --
NM_015313chr1154580 3521 1398 1131 703 --24091 549 13263
NM_015315chr533095 2258 460 12219 13120 1506
NM_015317chr222549 1948 ------
NM_015318chr1951710 1549 624 281 80 --11486 2715 253
NM_015321chr19104851 4434 4116 3449 1776 991 641 592 531 126 --21838 1594 --
NM_015326chr122740 2616 --12757 --
NM_015327chr1174 11340 ----
NM_015328chr732726 2060 395 ------
NM_015330chr2252241 632 517 483 466 22205 858 --1311
NM_015335chr1221743 928 ------
NM_015336chr1262427 2221 978 682 434 101 22519 1692 ----
NM_015338chr2011930 --1113 --
NM_015339chr2021030 100 ------
NM_015349chr611040 11032 ----
NM_015355chr171609 ------
NM_015358chr212503 289 ------
NM_015365chrX1654 --13599 --
NM_015374chr2271374 1349 1276 1225 489 101 52 ------
NM_015379chr71207 ------
NM_015385chr1043151 2527 1082 590 148 12077 1840
NM_015388chr61134 ------
NM_015393chr432463 883 76 --12761 13406
NM_015396chr311298 --130 --
NM_015416chr122945 68 ------
NM_015436chr443307 2856 2315 1204 ----11216
NM_015443chr17----1210 --
NM_015455chr573271 3047 2778 1619 1159 968 345 ------
NM_015460chr34803 467 184 79 ----1516
NM_015461chr18--1561 ----
NM_015483chr721072 92 ------
NM_015484chr11738 ------
NM_015492chr1511037 ------
NM_015497chr1521075 55 --1866 --
NM_015508chr341356 1093 295 109 1463 ----
NM_015511chr2011157 ------
NM_015520chr3102516 793 683 536 491 467 308 242 93 27 --1299 --
NM_015523chr11--1201 188 --
NM_015525chr61998 ----1426
NM_015526chr1931338 224 44 11106 ----
NM_015548chr63689 259 35 1322 ----
NM_015550chr772963 2795 2654 2269 1451 744 609 11021 ----
NM_015553chr654937 3897 3597 3247 1546 1114 ----
NM_015554chr1532192 344 71 12111 ----
NM_015557chr153320 2612 2263 862 404 31197 593 118 11231 --
NM_015564chr512297 53349 3136 2800 2624 1245 --12203
NM_015565chr2121694 97 ------
NM_015571chr62484 263 ------
NM_015575chr233124 1384 989 ------
NM_015577chr531748 1611 1153 11186 --1607
NM_015578chr1931840 210 117 11660 --11648
NM_015601chr10------1780
NM_015630chr21314 ------
NM_015635chr921363 369 1116 1405 --
NM_015640chr124206 1688 11142 --23718 1302
NM_015676chr141273 ------
NM_015678chr1321446 42 ------
NM_015686chrX31847 836 381 1542 12164 --
NM_015714chr12238 125 ------
NM_015716chr171498 ------
NM_015833chr2152330 1962 467 217 152 ----12003
NM_015834chr211941 ----1614
NM_015840chr151985 1965 1884 1711 812 12023 1285 --
NM_015841chr151985 1965 1884 1711 812 12023 1285 --
NM_015866chr131355 302 241 171 ----
NM_015878chr8----1886 --
NM_015879chr18118426 7621 7548 7148 6328 6003 5866 5719 1415 1204 857 27609 22 12029 15897
NM_015886chr855420 5046 4526 4463 1894 --11236 --
NM_015888chr152998 2723 2608 1095 206 11310 ----
NM_015891chr641760 1580 1416 283 ------
NM_015898chr1962335 1859 1715 1628 916 556 --21696 343 --
NM_015906chr133454 3432 1373 14236 1117 --
NM_015952chr6143 ------
NM_015980chr541562 1164 635 397 ------
NM_015989chr122220 113 ------
NM_015995chr1575345 4716 3705 1576 1129 947 756 14436 44386 1656 719 621 --
NM_015999chr1--1127 ----
NM_016018chr842624 2098 390 140 ------
NM_016021chr662566 2126 1157 1149 621 387 22136 1055 --12152
NM_016022chr11868 ------
NM_016025chr16--11528 1574 --
NM_016032chrX21190 1094 --11322 --
NM_016041chr172274 126 ------
NM_016061chr211436 31650 539 84 ----
NM_016072chr12--22157 143 1363 --
NM_016075chr1322769 2168 --11181 --
NM_016076chr12547 76 1508 --12553
NM_016078chr171762 ------
NM_016089chr321653 551 ------
NM_016096chr821856 1657 ------
NM_016099chr831133 261 188 ----191
NM_016104chr6143 ------
NM_016107chr5--11286 ----
NM_016120chrX--2766 243 ----
NM_016123chr1231097 926 473 1248 ----
NM_016131chr221577 871 ------
NM_016133chr221264 1164 11611 ----
NM_016151chr16135 --143 --
NM_016152chr3136 11153 ----
NM_016156chr1122286 1801 ------
NM_016162chr121654 ------
NM_016169chr1043110 2875 2192 2061 ------
NM_016185chr171111 ------
NM_016206chr398158 6482 3533 3343 2857 2633 2483 2036 517 ------
NM_016224chr621687 1626 11409 ----
NM_016227chr1----11226 --
NM_016258chr11276 --1822 --
NM_016260chr256627 2847 2737 1919 692 21930 1909 ----
NM_016269chr441165 1069 980 451 --1352 --
NM_016271chr1811684 ------
NM_016272chr2252077 1975 1725 659 171 21804 1755 131 --
NM_016275chr32852 569 ------
NM_016281chr1211145 ------
NM_016287chr141866 1626 1465 426 1372 ----
NM_016308chr141652 1284 629 498 ------
NM_016315chr221700 306 ------
NM_016316chr21504 ------
NM_016320chr111140 ------
NM_016322chr922189 2085 1905 1292 --
NM_016351chr71472 ------
NM_016374chr1122 198 ----
NM_016374chr1122 198 ----
NM_016376chr1754358 3074 1612 1331 355 33930 3342 3297 24166 944 --
NM_016396chr1542731 2220 2197 1022 ------
NM_016418chr2283463 3267 2606 2473 919 777 631 356 13708 22742 2661 128
NM_016424chr17--11279 ----
NM_016436chr2032181 395 29 --22089 43 --
NM_016441chr221675 521 --1767 --
NM_016442chr51917 131 ----
NM_016454chr151325 ------
NM_016480chr5--2266 244 ----
NM_016507chr1711178 1188 1607 --
NM_016522chr1141390 1381 1280 448 ------
NM_016525chr9--1763 ----
NM_016530chr1563447 3362 3059 2976 876 405 ----1112
NM_016531chr433410 3352 1182 11438 --11479
NM_016577chr344419 3555 2873 2860 12758 24125 1769 13226
NM_016578chr11--1617 ----
NM_016587chr71173 ------
NM_016598chr31144 151 ----
NM_016603chr512058 11630 --11939
NM_016605chr542409 1065 995 348 1627 --32077 1663 573
NM_016613chr41161 ----1516
NM_016620chr11522 11288 ----
NM_016621chr1143009 2925 1815 1199 33585 252 155 14053 --
NM_016626chr1811708 ------
NM_016628chr101720 ------
NM_016644chr5----168 --
NM_016654chr151897 ------
NM_016830chr12126 ------
NM_016848chr9125 ------
NM_016929chr643863 3439 3127 564 53836 3584 3169 2867 173 1488 --
NM_016936chr1621450 134 --32093 388 378 --
NM_016950chr41456 ------
NM_016953chr235453 4074 207 --11387 --
NM_017415chr574007 3400 3300 2763 1417 1008 247 24157 4115 13580 --
NM_017420chr1423698 1043 --13032 --
NM_017423chr41462 ------
NM_017440chr121209 ------
NM_017443chr92160 23 --1178 --
NM_017491chr44994 900 685 241 --1222 --
NM_017519chr611373 ------
NM_017522chr121076 323 ------
NM_017545chr201465 ------
NM_017548chr31861 ------
NM_017551chr1042386 2008 1901 453 ------
NM_017553chr152907 90 --2187 158 --
NM_017563chr355698 5481 4181 2559 1249 15304 16251 --
NM_017569chr13----182 --
NM_017580chr1061969 1919 1907 1737 367 330 ------
NM_017610chr1511761 1363 ----
NM_017629chr141787 522 153 35 11507 --11418
NM_017633chr663917 3519 2959 2728 2721 180 --22476 1363 --
NM_017634chr81206 11986 ----
NM_017635chr1131282 1156 93 ----1345
NM_017637chr947987 7337 6098 953 27905 2170 1266 --
NM_017643chr1722807 2059 ------
NM_017645chr952981 2157 1086 1015 492 ------
NM_017658chr1454427 3962 3162 3086 2877 34534 1232 835 ----
NM_017661chr152525 514 ------
NM_017680chr91207 ----1952
NM_017686chr131136 876 789 --1765 --
NM_017709chr122870 1031 11492 12710 12851
NM_017721chr191324 ------
NM_017737chr12784 756 1573 ----
NM_017738chr93476 320 207 1464 ----
NM_017745chrX----1454 --
NM_017752chrX51824 822 589 329 178 ------
NM_017758chr1711505 ------
NM_017778chr81526 1315 ----
NM_017784chr33947 205 108 ------
NM_017799chr1421767 465 ------
NM_017811chr942830 2346 2184 2159 --1762 12274
NM_017813chr845039 4927 3575 1813 35451 828 134 ----
NM_017824chr1032290 2100 137 ------
NM_017848chrX34172 813 370 1261 ----
NM_017849chr211052 ------
NM_017856chrX1674 ------
NM_017860chr1167 ----1673
NM_017902chr10105753 5486 4863 3593 1915 1775 1654 1375 1275 221 1771 24942 4840 --
NM_017907chr11193 ------
NM_017913chr91128 ------
NM_017915chr12----1412 --
NM_017938chrX31626 388 374 21775 1537 ----
NM_017944chr1132538 2518 117 12900 12301 --
NM_017948chr91348 ------
NM_017954chr71319 11647 1231 --
NM_018017chr1011030 ----1894
NM_018018chr1231615 758 145 21729 370 21703 556 --
NM_018027chr1073273 3140 2713 1248 539 352 218 ------
NM_018036chr1454081 3826 1498 1053 758 13996 13332 --
NM_018045chr142603 1046 555 171 ------
NM_018054chr161264 ------
NM_018063chr10--1126 ----
NM_018078chr411072 ------
NM_018084chr212609 ----1207
NM_018085chr1158059 7814 7535 7497 7393 6986 6807 6133 6061 4996 3149 1625 1202 940 359 --12915 12970
NM_018086chr221864 653 1678 ----
NM_018092chr162267 251 ----161
NM_018098chr3189 ------
NM_018113chr121422 ------
NM_018133chr311979 ------
NM_018137chr11272 1266 ----
NM_018155chr322472 233 1565 ----
NM_018157chr1253267 2696 2250 875 42 22488 706 ----
NM_018159chrX21606 218 1451 188 --
NM_018168chr14----1408 --
NM_018172chr1121141 1035 --21416 1377 --
NM_018181chr1831759 781 509 ------
NM_018182chr171730 --11659 11761
NM_018184chr331395 831 711 1594 11429 --
NM_018206chr162299 144 1566 ----
NM_018227chr423027 1126 1622 ----
NM_018245chr101149 ------
NM_018246chr832762 2699 938 ----1690
NM_018247chr611918 32556 1071 509 ----
NM_018254chr142301 2063 1827 959 11943 ----
NM_018257chr20------12298
NM_018287chr1021267 848 ------
NM_018293chr322900 2306 2212 54 ----
NM_018299chr822637 2362 11339 155 --
NM_018302chr481992 1977 964 492 385 152 133 46 --1314 --
NM_018310chr8----121 --
NM_018312chr1131681 1535 1420 ------
NM_018313chr332054 1706 718 --12494 --
NM_018315chr4----1456 --
NM_018328chr21463 ------
NM_018351chr1234228 3649 2892 21738 257 11465 --
NM_018361chr82329 199 11615 ----
NM_018364chr133727 1241 581 11049 --1894
NM_018367chr112450 33 12037 ----
NM_018368chr61113 ------
NM_018370chr1222150 1593 --1467 --
NM_018375chr142497 463 ------
NM_018383chr231512 731 503 --1120 --
NM_018388chrX31456 1342 1301 1459 ----
NM_018398chr31122 ------
NM_018403chr354147 4028 3982 1051 668 1189 --22530 1298
NM_018440chr8128138 7965 7945 7503 7210 6671 6170 5879 3463 2293 2149 600 27458 2729 12695 --
NM_018442chr1122 ------
NM_018445chr151512 ------
NM_018448chr1211182 ------
NM_018452chr6_random73594 3574 3063 2727 2485 1263 820 --11496 12597
NM_018469chr1731193 319 81 1979 ----
NM_018471chr2----1434 --
NM_018475chr41109 ------
NM_018482chr851774 1746 1000 245 70 ------
NM_018488chr172752 149 --1169 --
NM_018489chr151784 1649 667 584 28 12156 ----
NM_018534chr2122 --1139 --
NM_018566chr183699 3499 1826 1605 1543 1142 412 305 34227 443 336 21727 989 --
NM_018584chr1183 ------
NM_018590chr101406 144 ----
NM_018638chr1215251 ------
NM_018639chr1221391 410 ------
NM_018640chr122691 562 137 ----
NM_018644chr1192170 1782 1757 893 668 630 602 508 406 1263 ----
NM_018650chr121749 698 ------
NM_018657chr32650 132 1227 ----
NM_018667chr1662431 2102 1787 775 515 505 12279 11856 --
NM_018682chr71703 ------
NM_018684chrX11201 ------
NM_018695chr511715 ------
NM_018698chrX2162 134 182 ----
NM_018704chr12764 217 ----1647
NM_018712chr1121530 521 ------
NM_018717chr412458 12859 ----
NM_018718chr7158 ------
NM_018728chr1521296 388 11451 ----
NM_018840chr201442 ------
NM_018841chr143784 3214 883 345 13901 23315 1055 --
NM_018846chr72823 669 ------
NM_018847chr911760 2744 522 ----
NM_018898chr512263 ------
NM_018899chr512263 ------
NM_018900chr512263 ------
NM_018901chr512263 ------
NM_018902chr512263 ------
NM_018903chr512263 ------
NM_018904chr512263 ------
NM_018905chr512263 ------
NM_018906chr512263 ------
NM_018907chr512263 ------
NM_018908chr512263 ------
NM_018909chr512263 ------
NM_018910chr512263 ------
NM_018911chr512263 ------
NM_018945chr642808 1168 477 452 21409 1162 ----
NM_018952chr172469 213 ------
NM_018970chr752783 2645 1998 858 559 ------
NM_018976chr1242526 1058 684 472 ------
NM_018977chrX21099 674 ------
NM_018979chr12--1939 ----
NM_018993chr20--11098 ----
NM_018999chr1084866 4636 4340 1488 918 607 516 144 24403 4151 --14668
NM_019001chr363479 1944 1859 1844 418 340 13867 ----
NM_019004chr722134 657 1527 ----
NM_019006chr15----132 --
NM_019009chr1131755 1028 845 --2344 100 --
NM_019027chr421890 373 ------
NM_019035chr4--12027 --11808
NM_019044chr2103750 3514 3318 3114 1558 1056 431 382 243 47 14176 ----
NM_019045chrX1637 ----1685
NM_019049chr1--1617 ----
NM_019050chr41531 1476 ----
NM_019059chr71327 ------
NM_019071chr7----1585 --
NM_019072chr583753 3572 2663 2594 1006 605 256 73 ------
NM_019083chr1------21319 22
NM_019087chr521224 277 ----1530
NM_019088chr19155 ------
NM_019091chr2----11099 --
NM_019096chr61399 ------
NM_019106chr2232956 2165 999 1594 1122 --
NM_019114chr932531 2221 279 ------
NM_019116chr16171 23612 2360 ----
NM_019555chr321222 87 21290 717 ----
NM_019557chr1--1880 ----
NM_019558chr21316 ------
NM_019600chr15135 ------
NM_019849chr191175 ------
NM_019862chr1641495 624 70 52 1633 11626 --
NM_019885chr242810 2517 647 458 ----12555
NM_019898chr1641495 624 70 52 1633 11626 --
NM_019899chr1641495 624 70 52 1633 11626 --
NM_019900chr1641495 624 70 52 1633 11626 --
NM_020116chr421578 1188 ------
NM_020122chr255484 5099 4734 3643 1051 ------
NM_020123chr1021004 553 ------
NM_020134chr211047 --1393 --
NM_020144chr732098 1412 120 --11504 --
NM_020148chr1832426 2122 504 12809 12486 --
NM_020163chr372157 1986 1659 1586 461 225 61 --11444 --
NM_020177chr5123 1142 166 --
NM_020178chr171211 ------
NM_020180chr181231 --1479 11175
NM_020193chr11----188 --
NM_020204chr11149 ------
NM_020225chr4192 ------
NM_020228chr1122426 29 1407 ----
NM_020235chr32326 157 ------
NM_020240chr542622 2074 1773 32 1555 1808 --
NM_020248chr132048 963 743 11859 12003 11892
NM_020310chr1762780 2052 1051 1030 953 526 ------
NM_020337chr41242 ------
NM_020341chr202398 215 ----12023
NM_020342chr231739 978 810 1905 ----
NM_020357chr3--11665 ----
NM_020374chr1231945 716 435 11417 ----
NM_020420chrY1488 11563 --11147
NM_020425chr621896 296 ------
NM_020429chr7153 --1875 1344
NM_020432chr73520 333 47 ------
NM_020440chr122540 163 11160 2721 675 1456
NM_020443chr176569 6024 5628 5485 2481 1542 1132 14871 34587 1959 90 --
NM_020449chrX1485 ------
NM_020452chr1--12065 140 --
NM_020466chr654244 1679 1356 1345 783 --23299 1404 --
NM_020526chr151714 1478 1317 538 233 1625 ----
NM_020532chr2------1689
NM_020644chr112757 298 ------
NM_020647chr812021 1553 ----
NM_020654chr311206 ------
NM_020666chr51774 ------
NM_020673chr20117329 6936 6874 6662 5796 5562 1461 1270 674 548 345 17382 11066 11942
NM_020689chr2041610 1474 1123 435 ------
NM_020699chr185330 5000 4882 3855 2165 1449 631 502 --11914 --
NM_020704chr732529 1851 783 52129 1723 1552 920 24 1521 --
NM_020718chr1645306 4388 4182 3992 21938 448 ----
NM_020727chr2123476 2964 ----11228
NM_020728chr762758 2638 2352 2173 2115 1996 ------
NM_020732chr611373 ------
NM_020734chr1222601 1180 ------
NM_020740chr171355 ------
NM_020747chr5--1631 1685 --
NM_020752chr1042863 2199 1942 448 12235 ----
NM_020760chr2--11263 ----
NM_020761chr172348 70 1642 31915 1834 1364 1236
NM_020766chrX54065 1245 1061 748 516 ----11687
NM_020769chrX1816 1632 ----
NM_020772chr1768339 7673 7347 6934 6734 1257 28179 1417 12887 --
NM_020775chr1278 44 --1158 --
NM_020776chr182723 122 22890 662 12814 --
NM_020794chr12310 139 ------
NM_020796chr532579 2564 2280 11136 188 --
NM_020804chr6102322 2134 2084 1821 1784 1714 791 782 369 166 --1521 --
NM_020809chr113759 303 285 ------
NM_020810chr1443331 1060 962 300 ----13494
NM_020825chr1653153 3091 2940 2559 550 --12670 --
NM_020834chr1431685 469 182 1346 --11858
NM_020841chr123860 748 521 13830 ----
NM_020843chr15----130 --
NM_020845chr1241781 899 543 79 12076 ----
NM_020850chr1672922 2658 1133 1048 709 513 253 22778 539 ----
NM_020856chr193405 394 58 11539 1261 --
NM_020858chr1512327 11710 ----
NM_020860chr4----1386 --
NM_020861chr6--11025 ----
NM_020868chr231641 1332 580 ------
NM_020870chr422020 75 ------
NM_020872chr32504 270 11422 ----
NM_020888chr13800 782 398 --11607 --
NM_020899chr17----1717 --
NM_020918chr1053028 2734 2263 2236 1253 --1516 --
NM_020922chrX21894 299 ------
NM_020924chr9--1132 ----
NM_020940chr1032663 2274 1131 ----1557
NM_020946chr951676 1526 1255 536 257 1188 21696 1516 1695
NM_020975chr1031388 1326 270 ------
NM_020977chr432119 1849 720 188 165 --
NM_020987chr101208 ------
NM_021003chr14149 ------
NM_021007chr221679 1663 ------
NM_021020chr893391 3065 2943 2861 2732 2210 2197 1079 857 ----11132
NM_021033chr1343182 2846 2734 433 1868 ----
NM_021038chr343134 3106 2598 1161 1641 --1770
NM_021069chr411649 1820 11436 --
NM_021072chr521669 993 1410 --12212
NM_021088chr25784 485 422 412 146 --2607 496 --
NM_021090chr2251867 1637 1143 814 792 --31630 1236 512 --
NM_021097chr222365 128 12631 ----
NM_021132chr101936 ------
NM_021135chr663220 3190 3170 2050 81 38 ----12100
NM_021136chr14--2637 111 ----
NM_021137chr174590 500 107 25 11623 2901 190 --
NM_021140chrX1163 ------
NM_021145chr71718 ------
NM_021151chr73984 393 23 ------
NM_021183chrX1696 ------
NM_021202chr2072510 2339 1948 1919 1037 895 221 12290 12657 1761
NM_021224chr91145 ------
NM_021244chr61174 ------
NM_021255chr1423692 2765 23715 3198 ----
NM_021569chr961104 1088 1011 864 770 306 1254 1116 21023 95
NM_021572chr651018 990 974 967 313 1840 ----
NM_021620chr62653 236 ------
NM_021643chr221813 1449 ------
NM_021644chr10139 ------
NM_021705chr661258 1154 1105 1020 993 299 ------
NM_021722chr71431 ------
NM_021723chr71472 ------
NM_021728chr141727 ------
NM_021738chr102585 279 ------
NM_021813chr655162 4593 982 756 733 25248 2101 ----
NM_021817chr11315 ------
NM_021872chr2021139 930 --11050 --
NM_021873chr2021139 930 --11050 --
NM_021911chr584856 3918 3600 2242 1888 1028 825 603 --12037 --
NM_021912chr1543521 3353 2745 1586 ------
NM_021913chr1931800 1354 47 2195 175 ----
NM_021914chr143587 510 432 21974 278 ----
NM_021940chr6----1454 --
NM_021945chr6112838 2770 2651 2363 2282 982 743 403 263 163 48 23319 1375 11042 11397
NM_021954chr1332955 927 186 23567 2807 1440 --
NM_021956chr61995 1185 ----
NM_021961chr1175146 2174 1805 1498 1117 1090 360 16058 --15606
NM_021962chr174643 356 317 104 --22001 729 --
NM_021964chr336358 4909 2241 11569 1925 15392
NM_021984chrX41094 1025 956 471 --1256 --
NM_021987chrX41094 1025 956 471 --1256 --
NM_021990chrX41094 1025 956 471 --1256 --
NM_021998chrX11507 1203 ----
NM_022051chr1----1566 --
NM_022066chr1721042 379 ----127
NM_022073chr1431598 1210 305 ------
NM_022079chr10------1780
NM_022080chr201341 ------
NM_022085chr611403 ------
NM_022114chr143581 3217 1018 112 --1961 143
NM_022123chr14184 ------
NM_022124chr103250 187 35 ------
NM_022130chr51293 1962 ----
NM_022133chr8--21659 570 ----
NM_022166chr1665384 5372 5201 1006 533 358 25555 4183 --1866
NM_022346chr411437 2445 167 ----
NM_022373chr73897 785 359 ------
NM_022456chr1245613 5168 2121 1648 36095 1484 138 ----
NM_022458chr743015 2127 2114 1952 11011 ----
NM_022459chr1345855 5843 4532 1987 --11603 1291
NM_022461chr321381 490 --1189 --
NM_022463chr1731403 224 163 11185 ----
NM_022469chr142933 2246 482 126 32839 2545 903 ----
NM_022474chr1431855 950 258 1629 ----
NM_022476chr161420 1332 ----
NM_022483chr521500 691 --1585 --
NM_022491chr1221004 152 --1131 12443
NM_022494chr10----1338 --
NM_022652chr1221043 323 165 ----
NM_022659chr81142 166 ----
NM_022719chr2293842 3392 3375 3345 3274 1487 1074 920 661 --43058 1401 947 402 --
NM_022728chr72678 211 ------
NM_022735chr1184 ------
NM_022745chr121198 646 32584 2132 439 ----
NM_022748chr721975 1109 12749 ----
NM_022755chr932015 662 624 ----1160
NM_022758chr642646 2324 531 380 1691 ----
NM_022763chr352487 2275 2200 2042 683 ------
NM_022780chr221558 688 ----11584
NM_022781chr922227 978 1583 ----
NM_022824chr5--11687 --1736
NM_022826chr231060 928 422 ------
NM_022828chr5------1385
NM_022831chr171805 1658 1650 1632 1221 672 523 ------
NM_022841chr1512513 21709 541 ----
NM_022845chr163742 636 444 12005 ----
NM_022893chr222677 583 11140 ----
NM_022897chr51737 1178 ----
NM_022898chr1453799 804 788 694 662 ------
NM_022902chr51322 ------
NM_022912chr232031 82 34 --32648 1229 1032 --
NM_022918chr111316 ------
NM_022970chr102362 37 ------
NM_023000chr144630 482 278 82 ------
NM_023001chr144630 482 278 82 ------
NM_023008chr191132 1794 ----
NM_023010chrX2658 51 ------
NM_023011chr131334 ------
NM_023012chr122773 81 ------
NM_023016chr212060 ------
NM_023018chr1101441 1398 1318 1265 1073 1031 1015 586 265 48 --11310 --
NM_023037chr133757 322 257 ------
NM_023068chr2031165 1002 351 --1225 --
NM_023076chr1642654 2395 991 384 --21104 34 1837
NM_023079chr1741764 1478 748 640 --3648 260 200 --
NM_023923chr13759 135 82 13642 ----
NM_023928chr122983 867 ------
NM_023929chr811794 ------
NM_024034chr2011064 ------
NM_024052chr1743029 519 453 163 --12039 --
NM_024060chr112340 62 ------
NM_024087chrX1464 2610 99 ----
NM_024090chr441904 757 409 222 ------
NM_024107chr174733 582 199 176 ----1652
NM_024294chr642646 2324 531 380 1691 ----
NM_024312chr12145 1126 ----
NM_024345chr945389 4593 1575 547 2204 168 ----
NM_024416chr931600 1547 1400 ------
NM_024430chr1841441 1184 757 675 --2309 57 --
NM_024492chr661077 422 327 269 178 80 1521 ----
NM_024503chr12426 24 ------
NM_024513chr353733 3463 3364 309 163 --11332 11377
NM_024524chr321967 1138 12542 ----
NM_024536chr21170 ------
NM_024539chrX1472 ------
NM_024548chr331617 1340 1258 ------
NM_024551chr1211632 2581 86 ----
NM_024551chr1211632 2581 86 ----
NM_024554chr151611 1243 508 350 198 --1239 --
NM_024581chr6146 ------
NM_024582chr42874 745 ------
NM_024595chr141202 1006 913 867 ----1849
NM_024612chr173978 813 105 2778 83 ----
NM_024613chr81506 ------
NM_024615chr51228 ------
NM_024617chr91881 ------
NM_024624chr211501 --1371 --
NM_024645chr831001 356 295 11368 ----
NM_024652chr153960 801 415 ------
NM_024659chr211023 ------
NM_024665chr354381 3413 3362 869 634 ------
NM_024670chr1031548 1363 531 ------
NM_024692chr221351 1177 1217 --11886
NM_024700chr12749 204 191 --171
NM_024713chr1521334 24 ------
NM_024721chr8--1110 ----
NM_024740chr1152613 1100 987 941 565 ----13355
NM_024745chr162718 310 ------
NM_024749chr12625 63 22293 184 ----
NM_024751chr41597 31670 734 173 ----
NM_024770chr2126595 6362 6313 6275 5892 4951 2411 2400 1947 1558 1452 676 26223 5374 35669 4371 2067 16292
NM_024786chr57784 763 742 675 652 610 196 ------
NM_024792chr173951 394 181 ------
NM_024852chr1--1188 ----
NM_024881chr1953697 3577 2635 1084 642 --1340 --
NM_024884chr1433918 3768 364 ------
NM_024887chr141398 609 219 81 ------
NM_024893chr203803 204 178 --127 1191
NM_024920chr411045 ------
NM_024939chr162270 76 11314 11061 --
NM_024947chr3109436 9391 9314 9256 9164 6641 3289 3227 1330 825 --26016 2648 --
NM_024949chr461851 1706 477 451 308 172 21289 417 --1670
NM_024953chr1222244 21 1351 --1584
NM_024969chr21843 1817 ----
NM_024989chr248090 2886 1653 1405 ----11426
NM_024991chr1043151 2527 1082 590 148 12077 1840
NM_024993chr211462 1237 ----
NM_025073chr153920 3639 1513 1373 314 33669 1245 919 ----
NM_025083chr1552029 1996 1953 1842 334 ------
NM_025106chr161350 1211 755 574 567 220 --11529 --
NM_025133chr21422 ------
NM_025138chr131355 1455 ----
NM_025146chr332255 1780 1036 --1504 --
NM_025151chr811716 11743 12041 --
NM_025160chr143880 1342 913 590 12688 ----
NM_025179chr194183 4017 3854 1964 1678 1315 1193 1016 620 1826 13183 --
NM_025181chr21180 ------
NM_025191chr13284 239 161 ------
NM_025195chr82685 330 ------
NM_025222chr332286 1868 304 ----12222
NM_025224chr2062293 1826 1542 356 254 226 ----11479
NM_025235chr101208 ------
NM_025248chr1752453 2429 1969 1192 886 --11028 --
NM_030594chr1511010 ------
NM_030625chr101625 ------
NM_030627chr521636 571 11598 ----
NM_030629chr1621746 1444 ----1260
NM_030637chr141140 ------
NM_030647chr756252 6014 5502 1513 1052 13834 ----
NM_030648chr464449 1666 1339 1125 926 230 24749 1882 35336 4677 1718 --
NM_030650chr233643 3531 759 ------
NM_030674chr1275484 3555 1793 1634 1401 561 539 23732 3726 23630 1237 12043
NM_030755chr1422214 1014 1159 ----
NM_030758chr221431 --11441 --
NM_030762chr1221724 1268 ------
NM_030780chr831772 1536 636 11708 ----
NM_030786chr131232 398 67 ------
NM_030795chr8194 ----1450
NM_030806chr198944 7931 7729 7003 6670 3291 2935 2728 413 38487 1609 101 38875 6705 1448 --
NM_030808chr171299 ------
NM_030810chr611403 ------
NM_030820chr61105 ------
NM_030881chr2252054 1923 1803 763 755 ------
NM_030885chr3158 ------
NM_030906chr11152 ------
NM_030917chr4--134 ----
NM_030918chr175159 5029 4652 4631 3974 3473 1278 35065 3641 1025 13959 --
NM_030920chr111887 ------
NM_030922chr152640 623 ------
NM_030939chr6----1471 --
NM_030964chr553252 3016 2722 1105 196 --22964 2894 1454
NM_031243chr722382 2018 ------
NM_031369chr41689 ------
NM_031370chr41689 ------
NM_031371chr1122 198 ----
NM_031371chr1122 198 ----
NM_031372chr4--11495 ----
NM_031411chr512263 ------
NM_031412chr121823 --130 --
NM_031417chr1952672 2539 2061 762 482 --32166 535 218 --
NM_031419chr311482 ------
NM_031427chr1445741 4165 4137 1556 14687 --15793
NM_031442chrX21108 498 ----2924 102
NM_031445chr222729 2082 12342 --1557
NM_031461chr8191 ------
NM_031469chr683462 3308 2555 1489 1394 1123 305 42 12785 ----
NM_031483chr2023416 772 --13445 --
NM_031844chr123983 3379 14105 --12857
NM_031845chr21459 12390 --12634
NM_031847chr21459 12390 --12634
NM_031849chr512263 ------
NM_031857chr512263 ------
NM_031860chr512263 ------
NM_031866chr101184 ------
NM_031922chr61392 ------
NM_031942chr23928 358 236 ----1161
NM_031953chr41475 ------
NM_032017chr131591 1533 26 ------
NM_032041chr842412 1071 440 211 ----1814
NM_032051chr223675 254 202 --1179 --
NM_032052chr222983 137 ------
NM_032102chr1132049 797 786 22506 1113 ----
NM_032121chrX32580 555 33 11934 ----
NM_032124chr18182 ------
NM_032139chr191244 1125 ----
NM_032144chr21544 --21671 424 --
NM_032145chr641466 1333 440 36 ------
NM_032147chr1221039 951 ------
NM_032160chr1834295 4083 1590 1162 ----
NM_032169chr33687 139 101 ------
NM_032186chr11522 11288 ----
NM_032193chr1162023 1410 1390 682 250 101 ----1452
NM_032195chr21----199 --
NM_032199chr102988 238 --13463 --
NM_032221chr20--11380 11565 --
NM_032236chr11745 ------
NM_032242chr393248 2803 2762 2619 2454 2429 803 569 242 --23218 914 1637
NM_032246chr151231 ------
NM_032268chr1653177 3087 2169 2151 458 11224 33026 117 44 --
NM_032281chr1931102 972 416 12068 32704 492 159 --
NM_032289chr531814 1296 59 21665 466 ----
NM_032303chr911383 ------
NM_032312chr21305 1828 ----
NM_032320chr111180 ------
NM_032352chr14----1580 --
NM_032373chr1085699 4205 3924 3896 1431 966 613 586 --14939 15397
NM_032376chr173544 481 29 ----1496
NM_032408chr7--164 1882 --
NM_032410chr811210 ------
NM_032424chr1111086 ------
NM_032438chr61664 ------
NM_032439chr102460 50 ------
NM_032440chr1022612 2199 12868 --145
NM_032442chr172194 132 ------
NM_032445chr1541594 936 919 401 11983 ----
NM_032457chr423677 3549 13623 --1685
NM_032458chrX42870 2334 661 120 22567 298 ----
NM_032491chr122439 421 1890 --1259
NM_032494chr22244 40 ------
NM_032505chr332466 1039 320 22590 447 ----
NM_032547chr42284 84 ------
NM_032560chr14127 ------
NM_032561chr222141 128 1458 2578 237 --
NM_032581chr731486 551 70 ------
NM_032632chr1441417 526 188 149 ------
NM_032638chr331562 116 29 ----11372
NM_032682chr323377 1110 ------
NM_032701chr191633 ------
NM_032780chr1151218 798 371 321 190 ------
NM_032804chr1042550 689 670 164 11772 ----
NM_032813chr13--2351 156 ----
NM_032859chr1333406 972 504 1881 12799 --
NM_032940chr162879 738 1134 ----
NM_032961chr4--2265 63 1887 --
NM_032973chrY14100 ------
NM_032975chr1843153 2838 2580 1036 12872 12599 --
NM_032980chr1843153 2838 2580 1036 12872 12599 --
NM_033014chr931600 1547 1400 ------
NM_033020chr133454 3432 1373 14236 1117 --
NM_033025chr191941 --1692 2359 257
NM_033030chr2--11565 ----
NM_033055chr12740 34 1222 ----
NM_033071chr6--1248 ----
NM_033132chr131402 1427 --11447
NM_033133chr1753065 3011 2354 1496 1376 1222 --11001
NM_033143chr443395 784 770 536 11000 ----
NM_033211chr521907 203 ------
NM_033215chrX----1388 --
NM_033224chr777760 7654 5121 4880 2461 1266 237 11219 ----
NM_033246chr151101 --1326 --
NM_033254chr33496 385 365 1489 ----
NM_033274chr531438 393 350 --22939 683 --
NM_033278chr11195 ------
NM_033285chr834371 3951 1602 ------
NM_033290chrX13302 43809 2543 1049 995 --13517
NM_033300chr121076 323 ------
NM_033317chr192204 40 ------
NM_033331chr942635 2233 1261 538 ------
NM_033360chr1223270 1300 ------
NM_033389chr1763995 3834 3144 3031 1842 1667 13977 ----
NM_033394chr221124 645 ------
NM_033425chr1152694 2282 1060 1034 954 11204 ----
NM_033426chr1441034 527 370 177 22312 608 1551 12110
NM_033427chr7--1606 ----
NM_033429chr1512268 21243 690 --21141 985
NM_033480chr62840 406 --163 22626 1001
NM_033481chr62840 406 --163 22626 1001
NM_033503chr1543732 3625 3239 575 --13257 131
NM_033505chr265447 5043 4891 2491 1065 832 21342 330 ----
NM_033546chr181160 ------
NM_033547chr11174 ------
NM_033551chr533095 2258 460 12219 13120 1506
NM_033624chr1242076 1876 1767 524 ------
NM_033632chr4----1456 --
NM_033637chr1043587 3324 3207 505 --13663 13875
NM_033642chrX--1310 ----
NM_033644chr532277 2159 157 ------
NM_033645chr532277 2159 157 ------
NM_033656chr2184980 3920 2393 1348 993 737 726 313 21560 1450 ----
NM_052834chr1812282 ------
NM_052875chr1171728 657 587 367 317 233 41 --130 --
NM_052879chr1224052 3198 33419 1597 1282 ----
NM_052885chr1243639 1172 750 548 ------
NM_052896chr152120 1848 937 758 89 12326 22113 2098 --
NM_052900chr811468 1613 1299 --
NM_052904chr62299 271 ------
NM_052910chr1361767 1622 707 595 222 63 ------
NM_052917chr22694 635 1574 ----
NM_052918chr1023315 2579 ------
NM_052925chr19----21035 426 11043
NM_052937chr831832 882 663 12500 ----
NM_053016chr997765 6615 5881 5797 5639 2060 1794 1347 1203 67165 6178 5503 2078 779 733 ----
NM_053023chr1142927 2888 2194 638 11057 12940 --
NM_053024chr31995 ------
NM_053043chr774810 4390 4311 1931 1408 1357 91 12396 15097 1138
NM_053056chr1163018 2959 2831 2407 1018 91 23115 2433 --1773
NM_054025chr1192170 1782 1757 893 668 630 602 508 406 1263 ----
NM_057158chr81834 --1648 --
NM_057175chr43450 425 406 1806 ----
NM_057178chr171151 --11053 --
NM_058170chr11425 41611 1552 1505 235 ----
NM_078469chr1051303 1245 1172 1134 412 ------
NM_080415chr173362 257 167 1893 ----
NM_080491chr11113482 3401 3342 3232 2972 2550 1125 278 187 131 35 ------
NM_080626chr121301 ------
NM_080632chrX2658 51 ------
NM_080645chr6----11482 --
NM_080666chr14----1423 --
NM_080669chr1754768 3712 3506 3393 1647 24664 157 11598 --
NM_080742chr6181 ------
NM_080743chr672281 2120 1818 1790 962 908 364 12235 ----
NM_080759chr1341858 1765 999 372 ------
NM_080760chr1341858 1765 999 372 ------
NM_080792chr2042204 173 74 26 1763 ----
NM_080821chr2021496 919 31458 519 333 ----
NM_080872chr862918 2856 1583 727 543 181 33477 3075 558 ----
NM_100264chr101720 ------
NM_100486chr101720 ------
NM_130386chr181105 ------
NM_130391chr92799 77 --22490 2198 --
NM_130392chr92799 77 --22490 2198 --
NM_130393chr92799 77 --22490 2198 --
NM_130434chr151445 1280 ----
NM_130442chr7--1135 ----
NM_130459chr9--11102 11350 21529 1268
NM_130830chr343109 3077 1302 1021 --32673 2609 1278 --
NM_133170chr2097882 7588 7446 7092 6208 5159 2240 2175 102 25396 499 --11119
NM_133264chr1763182 2658 2558 1353 1195 456 13003 --22847 2467
NM_133265chrX52725 2432 743 468 354 11376 1198 --
NM_133334chr486105 5500 5262 4661 4391 1932 1750 1644 1840 --1703
NM_133433chr52898 873 ------
NM_133452chr1911028 ------
NM_133486chrX--1488 ----
NM_133493chr633801 1024 694 --31094 943 792 --
NM_133499chrX----1219 --
NM_133646chr2115164 4954 4905 4883 3819 3791 3672 1874 1822 804 105 21888 636 ----
NM_133650chr6--1248 ----
NM_138288chr1431368 543 324 ------
NM_138328chr1753397 2736 2404 959 44 --157 11115
NM_138335chr41634 1318 141 --
NM_138357chr102521 354 ------
NM_138426chr7--1117 ----
NM_138444chr1344103 1807 868 31 11516 ----
NM_138457chr643319 1317 1066 400 1345 ----
NM_138459chr632354 1221 76 ------
NM_138473chr1254674 3619 903 244 167 13415 --21270 958
NM_138492chr521003 406 ------
NM_138555chr15--1611 ----
NM_138576chr1453799 804 788 694 662 ------
NM_138609chr52217 188 ------
NM_138610chr52217 188 ------
NM_138621chr264000 3859 1094 916 228 68 21250 1044 ----
NM_138638chr143587 510 432 21974 278 ----
NM_138694chr623649 3164 ----12635
NM_138713chr1688025 7158 6893 5318 2015 991 934 150 17942 18124 --
NM_138714chr1688025 7158 6893 5318 2015 991 934 150 17942 18124 --
NM_138717chr6----1623 --
NM_138731chr14--22779 2677 13841 --
NM_138773chr51245 ------
NM_138779chr132176 25 ------
NM_138799chr291862 1834 1291 827 797 683 249 233 61 ------
NM_138811chr7--11043 ----
NM_138927chr21--1683 ----
NM_138967chr1552292 2085 1888 803 494 --11704 --
NM_138971chr1183425 3014 2773 920 699 607 217 87 11263 1102 --
NM_138971chr1183425 3014 2773 920 699 607 217 87 11263 1102 --
NM_138972chr1183425 3014 2773 920 699 607 217 87 11263 1102 --
NM_138972chr1183425 3014 2773 920 699 607 217 87 11263 1102 --
NM_138973chr1183425 3014 2773 920 699 607 217 87 11263 1102 --
NM_138973chr1183425 3014 2773 920 699 607 217 87 11263 1102 --
NM_139057chr1532583 716 273 --1867 --
NM_139062chr17129 ------
NM_139068chr51496 ------
NM_139069chr51496 ------
NM_139070chr51365 ------
NM_139072chr21768 ------
NM_139126chr62779 153 ------
NM_139131chr112596 90 ------
NM_139132chr111140 ------
NM_139168chr531373 744 98 11986 ----
NM_139201chr12----1590 --
NM_139207chr1241396 1368 695 278 11521 ----
NM_139211chr41588 ------
NM_139212chr41588 ------
NM_139244chr61714 ------
NM_139283chr1211008 ------
NM_139321chr2064017 3829 3307 1505 188 127 12680 41179 1154 1145 522 --
NM_144498chr2041576 870 711 680 1127 11420 1521
NM_144507chr19--1144 ----
NM_144568chr141443 --1188 --
NM_144571chr435787 4772 502 24511 1932 14607 --
NM_144574chr141185 ------
NM_144582chr252636 2625 1657 1043 92 --1962 1209
NM_144599chr1564490 3702 3623 1817 1674 146 2217 158 54676 3464 1543 1402 1375 --
NM_144604chr16--1530 ----
NM_144633chr331389 1195 397 ------
NM_144634chr3125 ------
NM_144642chr3----21260 230 --
NM_144653chr9134 ------
NM_144660chr102380 304 ------
NM_144665chr11--183 --1228
NM_144710chr22993 984 --2261 205 --
NM_144721chr432191 2070 120 22573 495 2653 363 --
NM_144778chr1312588 ----12138
NM_144949chr212256 11877 ----
NM_144963chr852621 1913 1039 210 85 ------
NM_144973chr1255321 5270 4206 3470 1665 ------
NM_144978chr2--1103 ----
NM_145000chr51613 --1557 --
NM_145018chr11----1211 --
NM_145029chr6128 ------
NM_145044chr321511 44 ------
NM_145160chr15--1330 ----
NM_145176chr643461 3070 2831 686 13226 ----
NM_145206chr1032985 794 579 ------
NM_145259chr297089 5781 4396 2734 1738 1229 952 415 337 --11903 --
NM_145279chr141622 1215 1200 391 --1197 --
NM_145284chrX21715 638 --1837 11685
NM_145287chr181178 ------
NM_145307chr1023333 3190 33839 1198 279 14277 --
NM_145320chr772963 2795 2654 2269 1451 744 609 11021 ----
NM_145321chr772963 2795 2654 2269 1451 744 609 11021 ----
NM_145322chr772963 2795 2654 2269 1451 744 609 11021 ----
NM_145331chr63548 233 211 ------
NM_145332chr63696 381 359 ------
NM_145333chr63696 381 359 ------
NM_145341chr1041465 1437 672 97 ------
NM_145686chr242607 2597 843 404 ----1283
NM_145687chr242607 2597 843 404 ----1283
NM_145698chr1012044 ------
NM_145727chr65422 327 269 178 80 1521 ----
NM_145800chrX1997 ------
NM_145802chrX1946 ------
NM_145808chr742608 878 590 509 ------
NM_145810chr23928 358 236 ----1161
NM_147147chr663606 2850 1097 974 709 67 ------
NM_147150chr923092 1451 1458 12763 --
NM_147156chr102454 145 ------
NM_147166chr72813 255 1142 ----
NM_147193chr1134 ------
NM_147202chr92474 275 12771 ----
NM_147223chr242482 1843 1751 1680 ------
NM_147233chr242299 1660 1568 1497 ------
NM_148174chr8----1886 --
NM_148898chr7--2718 167 ----
NM_148899chr7--2718 167 ----
NM_148921chr173566 424 224 --22342 30 --
NM_152221chr221190 1400 ----
NM_152247chr223356 248 218 1171 ----
NM_152253chr22103742 3634 3604 3149 3112 3059 2625 1089 340 21 23557 178 23090 169 --
NM_152261chr122169 32 12582 ----
NM_152263chr134649 4042 992 25286 1921 14161 --
NM_152271chr8--1790 ----
NM_152275chr22844 342 ----12100
NM_152277chr541853 852 684 352 1346 ----
NM_152280chr143290 2572 377 368 11147 ----
NM_152284chr82332 221 1745 ----
NM_152291chr4--2121 81 ----
NM_152300chr1711526 --11519 --
NM_152309chr1032162 1932 1720 ------
NM_152345chr172755 332 2776 30 --11138
NM_152375chr172515 2412 2240 2160 997 881 481 ----12498
NM_152409chr531291 929 681 --12775 --
NM_152417chr81127 ------
NM_152420chr9--2784 744 ----
NM_152424chrX53949 3845 3110 1419 40 11366 ----
NM_152431chr111384 ------
NM_152437chr1232115 1870 406 --1202 --
NM_152440chr1221062 1008 ------
NM_152446chr141394 1762 1643 --
NM_152470chr1853430 3152 2832 2802 427 23567 1170 11216 --
NM_152493chr1--159 1233 --
NM_152495chr121026 343 ----1257
NM_152520chr22288 93 --11188 --
NM_152522chr21671 ----170
NM_152529chr263091 2822 2685 1756 1225 1098 --33210 2882 1407 --
NM_152554chr63576 239 206 --1196 --
NM_152556chr721845 1745 31800 606 245 ----
NM_152563chr1121141 1035 --21416 1377 --
NM_152574chr9139 ------
NM_152586chr10193 ------
NM_152588chr12----1247 --
NM_152594chr15--12197 ----
NM_152622chr543459 3340 3047 979 137 1605 --
NM_152624chr535676 4772 2798 ------
NM_152629chr943467 3382 3302 1280 --1815 --
NM_152636chr1142759 2341 671 33 ------
NM_152641chr1222136 404 31923 310 74 ----
NM_152653chr31721 ------
NM_152660chr11835 ------
NM_152682chr42379 30 ------
NM_152699chr333284 1044 274 13362 ----
NM_152709chr10146 ------
NM_152722chr1151840 749 644 428 150 --21643 599 --
NM_152745chr721066 432 ------
NM_152748chr72386 179 ------
NM_152749chr71143 ----1910
NM_152756chr543624 853 355 273 11031 ----
NM_152758chr842091 2015 1210 219 --12221 --
NM_152787chrX33483 1288 492 ----146
NM_152793chr7114871 4522 4513 4126 4003 3531 1708 1589 1318 120 91 14552 ----
NM_152835chr132824 2231 815 22250 1894 ----
NM_152836chr8--21659 570 ----
NM_152837chr8--21659 570 ----
NM_152838chr2021157 138 13012 ----
NM_152873chr101687 ------
NM_152877chr101687 ------
NM_152890chr11313 ----1342
NM_152910chr131153 1143 ----
NM_152924chr15106699 6207 5907 5415 5327 2570 1692 1206 761 269 --2920 126 16544
NM_152998chr7162 ------
NM_153015chr8--1406 11028 --
NM_153020chr631300 460 202 1598 ----
NM_153029chr1633989 3962 3300 --14010 --
NM_153042chr63618 192 167 ------
NM_153050chr2251867 1637 1143 814 792 --31630 1236 512 --
NM_153051chr2251867 1637 1143 814 792 --31630 1236 512 --
NM_153184chr311933 1166 ----
NM_153207chr1231246 723 416 12545 ----
NM_153252chrX2402 321 ------
NM_153262chr11774 1586 ----
NM_153273chr352404 2376 2046 658 633 ----1512
NM_153321chr17------1903
NM_153322chr17------1903
NM_153332chr852825 2396 2118 196 98 ------
NM_153453chr6161 1381 ----
NM_153499chr1262346 2323 2180 1963 991 578 11932 ----
NM_153500chr1262346 2323 2180 1963 991 578 11932 ----
NM_153607chr532654 464 188 --11097 --
NM_153616chr1512327 11710 ----
NM_153617chr1512327 11710 ----
NM_153618chr1512327 11710 ----
NM_153619chr1533565 2633 672 12948 ----
NM_153620chr731540 143 52 11372 ----
NM_153689chr231669 906 48 21825 795 ----
NM_153707chr9----1136 --
NM_153756chr141814 1695 620 207 ------
NM_153764chr112698 50 ------
NM_153765chr112698 50 ------
NM_153766chr112698 50 ------
NM_153767chr112698 50 ------
NM_153810chr1093834 1943 1288 1100 819 781 361 267 72 11978 23619 1633 13464
NM_153827chr171498 ------
NM_153828chr2------1689
NM_153831chr82392 100 1284 1745 --
NM_153832chr15574 560 247 131 88 ------
NM_170663chr171498 ------
NM_170679chr52813 160 ----1502
NM_170692chr12419 336 ------
NM_170695chr181337 ------
NM_170696chr151286 11393 ----
NM_170697chr151286 11393 ----
NM_170706chr124321 621 21714 685 ----
NM_170719chr131355 1455 ----
NM_170731chr1112052 12208 ----
NM_170732chr1112052 12208 ----
NM_170733chr1112052 12208 ----
NM_170734chr1112052 12208 ----
NM_170735chr1112052 12208 ----
NM_170750chrX1802 ------
NM_171999chr181678 ----155
NM_172037chr81163 ------
NM_172070chr211969 ------
NM_172071chr187227 4921 4667 1884 1840 1635 1370 832 ------
NM_172087chr171293 ------
NM_172088chr172163 121 1134 ----
NM_172089chr171293 1306 ----
NM_172097chr151758 --2196 178 --
NM_172103chr61997 12493 ----
NM_172105chr61997 12493 ----
NM_172110chr202471 190 ------
NM_172111chr202471 190 ------
NM_172112chr202471 190 ------
NM_172113chr202471 190 ------
NM_172169chr1011826 --11620 --
NM_172170chr1011826 --11620 --
NM_172171chr1011826 --11620 --
NM_172173chr1011826 --11620 --
NM_172196chr2--1205 ----
NM_172211chr13864 746 718 ------
NM_172226chr1262346 2323 2180 1963 991 578 11932 ----
NM_172337chr141727 ------
NM_173075chr421591 413 ------
NM_173172chr221149 326 --11376 --
NM_173198chr931174 288 42 21031 956 ----
NM_173200chr931174 288 42 21031 956 ----
NM_173207chr181337 ------
NM_173208chr181337 ------
NM_173209chr181337 ------
NM_173210chr181337 ------
NM_173211chr181337 ------
NM_173214chr1688025 7158 6893 5318 2015 991 934 150 17942 18124 --
NM_173454chr152372 334 ------
NM_173469chr1521108 97 ------
NM_173470chrX12791 ----12854
NM_173473chr1072373 1790 1762 1038 863 601 390 22481 2384 ----
NM_173476chr16102209 1978 1965 1909 1809 1607 1452 403 190 75 1427 2707 246 --
NM_173495chrX32564 1627 757 --12338 --
NM_173519chr82546 524 ------
NM_173552chr3142 --11961 --
NM_173567chr11218 ------
NM_173576chr1021773 691 1705 ----
NM_173582chr1155591 5128 4100 1886 1270 15923 24512 1388 24984 2137
NM_173595chr1244923 4840 551 80 --54232 3348 1067 486 201 --
NM_173607chr1421870 502 ------
NM_173609chr15------1585
NM_173631chr193961 479 342 ------
NM_173642chr1129073 9020 8954 8777 8618 6294 6007 3240 2739 572 248 120 27481 6459 27162 2648 18213
NM_173648chr21215 ----146
NM_173674chr6125 ------
NM_173694chrX12141 11839 ----
NM_173791chr10--157 ----
NM_173808chr131130 1021 965 --14152 --
NM_173829chr574915 4703 1499 1314 949 922 656 25988 1345 ----
NM_173833chr821654 67 --21418 41 --
NM_173848chr82624 93 ------
NM_173851chr843529 3037 2660 858 33784 2798 702 23971 870 --
NM_174886chr181337 ------
NM_174911chr833364 1353 543 13250 1363 --
NM_174921chr42953 69 ------
NM_174934chr1163554 3537 2967 2506 902 131 --1746 --
NM_175610chr151151 ------
NM_175623chr1245613 5168 2121 1648 36095 1484 138 ----
NM_175634chr81474 ------
NM_175635chr81474 ------
NM_175636chr81474 ------
NM_175733chr1132065 813 349 31769 293 134 --2651 302
NM_175736chr12117670 6445 6316 6274 5445 2469 978 729 296 162 24 46586 6229 5668 2923 15584 --
NM_175767chr521720 321 11877 11195 --
NM_175852chr162894 2619 2531 1199 1071 343 ------
NM_175854chr131695 12705 --1242
NM_175857chr21128 ------
NM_175861chr1265092 4734 4444 2327 2115 88 11645 1676 --
NM_175863chr611373 ------
NM_175866chr121495 1232 --1221 --
NM_175921chr514302 ----13281
NM_175931chr1631719 265 34 ------
NM_176792chr1031106 958 40 ------
NM_176801chr4196 --11178 --
NM_176814chr72577 204 ------
NM_176823chr153615 3058 1295 869 512 23785 806 --13863
NM_176871chr843150 834 807 585 12630 --1917
NM_177414chr12684 389 11089 ----
NM_177422chr1--1188 ----
NM_177424chr12600 373 ------
NM_177441chr174733 582 199 176 ----1652
NM_177553chr112675 379 1151 ----
NM_177952chr14149 ------
NM_177966chr321348 1270 1682 ----
NM_177990chr202398 215 ----12023
NM_177996chr2043296 2815 2604 469 13196 12169 --
NM_177999chr983653 3109 2707 2429 966 902 536 429 12417 12402 23180 2622
NM_178009chr131116 1106 ----
NM_178011chr10--1360 ----
NM_178140chr532157 824 750 12601 ----
NM_178150chr102309 112 1302 ----
NM_178151chrX45907 2620 372 31 1546 16822 --
NM_178152chrX45907 2620 372 31 1546 16822 --
NM_178153chrX45907 2620 372 31 1546 16822 --
NM_178229chr11348 ------
NM_178313chr242132 2046 1390 351 ------
NM_178423chr72129 66 1326 ----
NM_178425chr72129 66 1326 ----
NM_178439chr2163 ------
NM_178554chr362835 2338 2295 2221 1267 820 23420 2266 ----
NM_178557chr431710 1122 476 1401 21617 546 --
NM_178584chr22993 984 --2261 205 --
NM_178585chr41166 --12602 --
NM_178815chr1042421 549 360 62 3856 823 441 ----
NM_178835chr44795 688 255 117 --1184 --
NM_180989chr131119 1151 1713 --
NM_180991chr52903 234 1794 ----
NM_181077chr1531765 891 527 ------
NM_181302chr141185 ------
NM_181308chr141185 ------
NM_181349chr7153 --1875 1344
NM_181351chr1132979 2093 62 --12700 --
NM_181354chr821404 1336 ------
NM_181356chr6--1796 ----
NM_181358chr111485 22721 786 ----
NM_181361chr311289 ------
NM_181442chr2021030 100 ------
NM_181443chr2012823 11012 ----
NM_181458chr211359 ------
NM_181492chr221104 ------
NM_181504chr532925 2862 1036 ------
NM_181521chr1645850 1545 1362 819 36255 504 417 --11673
NM_181523chr532925 2862 1036 ------
NM_181524chr532925 2862 1036 ------
NM_181552chr71367 ------
NM_181659chr2052705 2620 2425 1300 435 ------
NM_181659chr2052705 2620 2425 1300 435 ------
NM_181670chr121463 21243 441 ----
NM_181671chr17195 ------
NM_181689chr203875 288 168 1322 1122 --
NM_181699chr11--141 ----
NM_181704chr21123 1249 ----
NM_181723chr8--1910 ----
NM_181776chr531622 114 30 ------
NM_181782chr632205 450 138 --11461 --
NM_181828chr2283463 3267 2606 2473 919 777 631 356 13708 22742 2661 128
NM_181829chr2283463 3267 2606 2473 919 777 631 356 13708 22742 2661 128
NM_181830chr2283463 3267 2606 2473 919 777 631 356 13708 22742 2661 128
NM_181832chr2283478 3282 2621 2488 934 792 646 371 13723 22757 2676 143
NM_181838chr521305 1085 ------
NM_181839chr83522 442 321 ------
NM_181886chr431375 424 272 1528 ----
NM_181887chr431375 424 272 1528 ----
NM_181888chr431375 424 272 1528 ----
NM_181889chr431375 424 272 1528 ----
NM_181890chr431375 424 272 1528 ----
NM_181891chr431375 424 272 1528 ----
NM_181892chr431422 471 319 1575 ----
NM_181893chr431375 424 272 1528 ----
NM_181897chr32479 250 1293 ----
NM_182314chrX21589 163 21603 434 ----
NM_182484chr21123 1249 ----
NM_182503chr674102 4016 2033 1787 1168 457 162 25444 3768 11665 22205 1642
NM_182507chr122804 30 22171 333 21533 899 1180
NM_182509chr1441681 488 320 249 21444 1309 2459 168 1121
NM_182541chrX131 ------
NM_182543chr101269 ------
NM_182643chr812422 21975 920 --12302
NM_182645chr6161 1381 ----
NM_182648chr141146 ------
NM_182680chrX--1119 ----
NM_182691chr71366 ------
NM_182692chr71366 ------
NM_182697chr7----11579 --
NM_182700chr731925 1640 493 --2556 540 --
NM_182762chr785158 5035 4666 4599 4407 2012 1648 872 24433 562 ----
NM_182765chr102373 258 ------
NM_182767chr123699 257 159 12014 ----
NM_182789chr51378 ------
NM_182796chr5192 --1582 --
NM_182848chr131125 1276 ----
NM_182898chr786602 6225 5230 2599 1413 1279 1250 560 ------
NM_182899chr786602 6225 5230 2599 1413 1279 1250 560 ------
NM_182907chr61508 12119 11696 --
NM_182910chr141288 ------
NM_182913chr141288 ------
NM_182914chr141288 ------
NM_182920chr321144 978 ------
NM_182925chr551107 1046 291 263 27 ------
NM_182931chr71703 ------
NM_182961chr6--1248 ----
NM_182970chr2073946 3781 2812 1274 823 427 78 ----14079
NM_182972chr112816 1851 22865 303 --
NM_183043chr131279 ------
NM_183044chr131279 ------
NM_183078chr663659 2778 2682 1499 855 122 22626 105 ----
NM_183238chr1233504 2803 967 ----21071 723
NM_183323chr51378 ------
NM_183353chrX--2766 243 ----
NM_183377chr172282 23 ------
NM_183380chr63689 259 35 1322 ----
NM_183381chr31779 1217 ----
NM_183383chr31779 1217 ----
NM_183384chr31779 1217 ----
NM_183393chr31413 ----1226
NM_183394chr31413 ----1226
NM_183425chr205414 238 150 126 95 1265 --21159 249
NM_194248chr251033 873 815 651 73 ------
NM_194259chr161476 ------
NM_194260chr161476 ------
NM_194261chr161476 ------
NM_194278chr1453814 3287 1178 519 462 13464 ----
NM_194282chr422644 379 12974 ----
NM_194285chr1162736 2549 1290 601 394 154 12943 12125 11015
NM_194286chr1256097 6057 1472 1111 1045 43777 949 880 197 ----
NM_194314chr155020 3675 1570 1441 418 ------
NM_194317chr231845 1815 753 12260 ----
NM_194322chr251033 873 815 651 73 ------
NM_194328chr922227 978 1583 ----
NM_194329chr922227 978 1583 ----
NM_194330chr922227 978 1583 ----
NM_194332chr922227 978 1583 ----
NM_194463chrX1472 ------
NM_197941chr522349 2290 22385 494 12041 --
NM_197970chr2--11565 ----
NM_198057chrX--184 ----
NM_198077chr11484 ------
NM_198081chr622442 2429 2740 401 ----
NM_198097chr7124 ------
NM_198123chr811468 1613 1299 --
NM_198124chr811468 1613 1299 --
NM_198128chr1811684 ------
NM_198129chr182343 44 ------
NM_198158chr323002 504 --1800 --
NM_198159chr323002 504 --1800 --
NM_198177chr323002 504 --1800 --
NM_198178chr323002 504 --1800 --
NM_198212chr711882 21919 32 ----
NM_198215chr103538 380 105 ------
NM_198225chr1031353 466 119 169 ----
NM_198261chr122773 81 ------
NM_198262chr122773 81 ------
NM_198268chr111485 22721 786 ----
NM_198269chr111485 22721 786 ----
NM_198270chrX11137 2763 108 ----
NM_198279chrX41145 1119 1078 284 --152 --
NM_198281chr422121 1370 ------
NM_198390chr1621746 1444 ----1260
NM_198399chr321816 708 --1718 --
NM_198400chr151892 1249 --11841
NM_198404chr131679 3749 566 65 ----
NM_198467chr72402 169 ------
NM_198468chr654147 3897 3238 972 429 ------
NM_198513chr821938 1280 ------
NM_198581chr226475 1303 11919 ----
NM_198715chr155087 4318 1754 1742 1718 ----24740 788
NM_198793chr343618 1219 767 368 2809 69 2845 549 --
NM_198834chr1741705 1619 577 104 ------
NM_198836chr1741705 1619 577 104 ------
NM_198837chr1741705 1619 577 104 ------
NM_198838chr1741705 1619 577 104 ------
NM_198839chr1741705 1619 577 104 ------
NM_198896chr111692 --21815 575 --
NM_198900chr12117670 6445 6316 6274 5445 2469 978 729 296 162 24 46586 6229 5668 2923 15584 --
NM_198935chr2043165 2400 319 164 --13053 --
NM_198956chr731925 1640 493 --2556 540 --
NM_198990chr722147 1261 ------
NM_199000chr71491 1785 ----
NM_199004chr171429 ------
NM_199050chr2173891 3457 2667 2504 1040 824 511 --13196 --
NM_199160chr932007 1638 1622 11603 --1140
NM_199188chr1224052 3198 33419 1597 1282 ----
NM_199190chr1224052 3198 33419 1597 1282 ----
NM_199324chr433506 3486 759 ------
NM_199328chr212882 244 ------
NM_199355chr162203 22 --191 --
NM_199436chr222757 252 ------
NM_199437chr1122426 29 1407 ----
NM_199438chr1122426 29 1407 ----
NM_199439chr1122426 29 1407 ----
NM_199454chr143581 3217 1018 112 --1961 143
NM_199464chr131581 193 ----
NM_199478chrX2744 305 --1603 --
NM_199483chr201270 ------
NM_201263chr122045 792 ------
NM_201267chr2122 --1139 --
NM_201269chr11522 11288 ----
NM_201278chr1122286 1801 ------
NM_201281chr1122286 1801 ------
NM_201403chr141622 1215 1200 391 --1197 --
NM_201413chr211714 ------
NM_201414chr211714 ------
NM_201428chr1111614 1358 ----
NM_201429chr1111614 1358 ----
NM_201430chr1111540 1284 ----
NM_201436chr72604 178 ------
NM_201516chr72660 234 ------
NM_201517chr72604 178 ------
NM_201545chr131062 324 177 --1290 --
NM_201591chr441205 693 160 139 ------
NM_201592chr441205 693 160 139 ------
NM_203305chr911598 2211 152 2882 423 --
NM_203327chr2033826 3691 458 34128 3220 819 ----
NM_203346chr23291 235 146 2719 636 1491 --
NM_203350chr1--11740 ----
NM_203351chr1752110 1919 484 349 325 --1797 --
NM_203406chr522933 79 12403 ----
NM_203454chr141135 1121 967 898 ------
NM_203458chr123503 2542 1868 1285 13466
NM_203459chr132642 2530 284 ------
NM_203463chr244223 4101 3133 3043 198 24118 1008 1396
NM_205768chr111768 ------
NM_205833chrX1660 --1259 --
NM_205836chr5--1199 ----
NM_205842chr2--1664 ----
NM_205846chr521003 406 ------
NM_205860chr11512 12266 ----
NM_205861chr141398 609 219 81 ------
NM_206594chr111281 ------
NM_206595chr111281 ------
NM_206852chr14--2637 111 ----
NM_206854chr654036 3813 3403 669 595 11188 ----
NM_206855chr675001 4778 4368 4149 1634 1560 404 12153 ----
NM_206857chr14--2637 111 ----
NM_206866chr2112144 --11245 --
NM_206876chr242728 2245 1438 285 ------
NM_206907chr533129 3029 2058 1915 ----
NM_206909chr8108231 7392 6923 6692 6593 5386 5216 2778 2274 558 35320 2264 2258 56808 6730 5099 2724 478 --
NM_206914chr122272 247 2585 215 ----
NM_207012chr1033030 2178 530 22598 2240 1571 --
NM_207113chr71255 1480 ----
NM_207170chr11738 ------
NM_207292chr343134 3106 2598 1161 1641 --1770
NM_207293chr343134 3106 2598 1161 1641 --1770
NM_207294chr343134 3106 2598 1161 1641 --1770
NM_207295chr343134 3106 2598 1161 1641 --1770
NM_207296chr343134 3106 2598 1161 1641 --1770
NM_207297chr343159 3131 2623 1186 1666 --1795
NM_207303chr1043020 1092 713 117 11064 11049 13464
NM_207304chr1312475 ----12025
NM_207321chr1051057 1000 429 305 224 ------
NM_207322chr1522162 384 ------
NM_207325chr1962086 1921 674 600 466 163 --1332 --
NM_207381chr1521104 46 ----1308
NM_207397chr13841 74 23 --1608 1677
NM_207406chr485963 5745 5383 2432 1613 1104 177 132 12626 22140 1390 --
NM_207517chr1511543 1785 --11594
NM_207520chr2------1689
NM_207521chr2------1689
NM_207647chr922050 871 ------
NM_212460chr71784 ------
NM_212464chr1561981 1914 1894 1685 778 674 21322 34 ----
NM_212467chr1552558 2491 2471 2262 123 21899 862 ----
NM_212539chr32449 393 168 ----
NM_212551chr12943 734 ------
NM_212558chr924094 3079 --14012 --
NM_213589chr251789 1565 1551 1090 585 14751 12060 --
NM_213594chr122439 421 1890 --1259
NM_213606chr1022121 1805 ------
NM_213609chr3--1370 ----
NM_213654chr32503 242 ------