TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3908
miRNA Sequence: GAGCAAUGUAGGUAGACUGUUU

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr531313 1225 877 ------
NM_000024chr52542 336 ------
NM_000037chr81403 12428 ----
NM_000038chr541274 843 339 292 ------
NM_000067chr8194 1601 ----
NM_000074chrX----1911 1760
NM_000081chr13614 497 375 11629 ----
NM_000084chrX95502 5403 4950 2720 1855 1653 1343 1087 677 26505 251 16949 --
NM_000089chr71166 ------
NM_000090chr21726 --1636 --
NM_000091chr232895 477 102 22818 780 21128 989 --
NM_000092chr233425 3165 853 13819 13128 --
NM_000093chr922391 2216 1602 ----
NM_000098chr11570 ------
NM_000109chrX52368 2009 1655 892 241 --22493 515 --
NM_000112chr595432 5111 4797 3876 3585 3571 1672 1542 1470 45576 4518 3904 1446 15391 --
NM_000138chr1532602 2304 1770 12042 12297 --
NM_000161chr1441931 622 448 53 196 ----
NM_000165chr611648 ----1491
NM_000167chrX21723 270 21248 1234 ----
NM_000168chr731164 942 377 1227 --1856
NM_000176chr51107 13192 ----
NM_000192chr12------21517 415
NM_000194chrX2225 159 1385 ----
NM_000202chrX63626 3086 2430 1333 1016 939 13143 12999 22830 1318
NM_000217chr1245171 3993 1648 833 24561 4254 12132 --
NM_000222chr432114 1726 182 ------
NM_000232chr452943 2621 713 701 604 --168 13177
NM_000240chrX21610 1419 ----1140
NM_000245chr711869 1127 ----
NM_000248chr322373 2128 --1948 --
NM_000251chr2165 ------
NM_000259chr1585988 4835 4804 2171 1545 920 853 635 45678 2366 1822 490 16332 --
NM_000264chr973242 2761 2555 1291 912 402 352 ----1134
NM_000267chr1753439 3399 3154 1255 948 13203 ----
NM_000268chr2233771 791 357 ------
NM_000276chrX52249 2158 2118 195 98 ------
NM_000280chr111814 --1959 --
NM_000291chrX3810 616 234 ------
NM_000297chr4159 2378 124 ----
NM_000303chr1611489 --11175 --
NM_000304chr172226 145 ------
NM_000313chr32941 856 ------
NM_000314chr1042199 2151 2004 94 22472 2101 ----
NM_000318chr852959 2889 2408 1914 216 12997 ----
NM_000321chr1361715 1707 274 251 150 48 11754 11548 1190
NM_000325chr41636 ------
NM_000328chrX1414 ------
NM_000329chr13929 834 802 ------
NM_000332chr687177 7138 5507 1853 1590 1281 1234 898 15378 ----
NM_000333chr321104 232 ------
NM_000345chr41320 2979 940 ----
NM_000346chr1732021 2002 1679 ------
NM_000353chr1631259 448 133 ----11130
NM_000368chr954878 4843 3926 431 37 ------
NM_000369chr1441852 711 291 183 21895 1230 ----
NM_000378chr111258 --21104 1009 --
NM_000390chrX51156 1029 981 923 797 23256 2918 --1301
NM_000393chr231891 336 125 ------
NM_000430chr1753719 3690 3220 1461 1230 13627 23589 1488 --
NM_000436chr531517 421 409 ------
NM_000437chr122094 560 ------
NM_000447chr11426 ------
NM_000448chr1142957 2547 2389 180 ------
NM_000452chr1332068 692 189 ------
NM_000459chr92837 830 --2653 322 --
NM_000461chr354210 3406 3303 183 61 14467 ----
NM_000462chr1541459 1333 1167 423 ------
NM_000474chr71650 --153 --
NM_000480chr1111635 11673 --11556
NM_000484chr211707 --2811 46 --
NM_000489chrX52224 1146 863 647 242 21330 29 21344 984 --
NM_000493chr61955 --11118 --
NM_000495chrX178 ------
NM_000503chr871685 1649 1528 1358 1352 653 125 ------
NM_000522chr71394 11301 156 --
NM_000523chr21128 ------
NM_000525chr1121626 1542 ------
NM_000551chr331882 1677 167 --1133 --
NM_000555chrX77160 6598 6148 4758 2633 142 51 ------
NM_000572chr11806 --1976 --
NM_000586chr4174 ------
NM_000590chr51123 ------
NM_000599chr224550 3867 ------
NM_000609chr1042977 1067 816 109 ------
NM_000610chr1153006 2314 2270 103 96 12916 32880 439 193 --
NM_000611chr1157075 6870 4850 1933 1916 ------
NM_000618chr1275554 4356 1410 1377 411 218 165 14920 ----
NM_000618chr1275554 4356 1410 1377 411 218 165 14920 ----
NM_000619chr121494 ------
NM_000627chr23785 316 82 ------
NM_000685chr31886 ------
NM_000685chr31886 ------
NM_000686chrX2414 392 --1174 --
NM_000719chr1296536 6505 6234 6026 5535 5354 2261 1541 967 ------
NM_000721chr142381 2302 2226 181 12195 ----
NM_000722chr7----1287 --
NM_000724chr1051413 791 730 138 131 ------
NM_000739chr72686 93 ------
NM_000756chr81319 ------
NM_000780chr82790 492 ----1902
NM_000793chr1454779 2028 1330 396 28 14137 ----
NM_000794chr52253 55 ------
NM_000806chr561823 1735 1253 659 653 87 11360 11866 --
NM_000809chr4129115 8582 8316 8272 6825 6045 1697 1514 1016 849 654 403 48160 7500 6034 2382 13530 --
NM_000810chr152419 145 ------
NM_000811chr52500 198 --1289 --
NM_000813chr5195564 5440 4771 4637 4115 3751 3722 3645 1894 1558 1488 1385 1282 1048 876 404 332 161 122 11686 13710 --
NM_000814chr1534055 3495 989 1491 ----
NM_000817chr2176 1132 ----
NM_000824chr44797 220 104 43 ------
NM_000826chr431935 860 853 32251 758 453 ----
NM_000829chr112923 659 ------
NM_000838chr632264 2144 2069 21009 908 12626 --
NM_000841chr62924 249 --1588 --
NM_000845chr7----1371 --
NM_000859chr531558 1408 89 ----11512
NM_000868chrX41753 582 225 98 ------
NM_000872chr10--11547 11384 --
NM_000875chr15106942 6565 6435 6131 5659 5411 5297 5210 2249 672 12303 25550 762 --
NM_000891chr1742954 2944 2816 1202 12649 ----
NM_000899chr1264399 3908 3765 3164 1466 1266 --13268 --
NM_000905chr71137 ------
NM_000908chr52793 613 ------
NM_000910chr431721 1208 638 11275 1326 --
NM_000912chr863520 3294 2672 1158 724 633 1871 22687 383 --
NM_000917chr103199 154 30 ------
NM_000918chr171668 ------
NM_000919chr52494 204 ------
NM_000921chr122205 117 ----1172
NM_000922chr112791 72 ------
NM_000924chr12------1949
NM_000933chr2031348 682 168 1566 1668 --
NM_000935chr31163 ------
NM_000944chr42586 71 --12037 --
NM_000945chr21804 --1664 1715
NM_000950chrX53163 2409 2363 1065 884 11020 11156 --
NM_000958chr541257 1237 968 444 1502 ----
NM_000959chr133984 651 463 12705 23960 2730 --
NM_000961chr2083999 3549 3249 3167 3128 2674 1442 1163 23955 3139 1561 --
NM_000965chr311230 ------
NM_000966chr1211067 ------
NM_000989chr8186 ------
NM_001001132chr211455 ------
NM_001001323chr1253048 2882 2814 1151 321 1927 ----
NM_001001330chr102166 145 ------
NM_001001389chr1153006 2314 2270 103 96 12916 32880 439 193 --
NM_001001390chr1153006 2314 2270 103 96 12916 32880 439 193 --
NM_001001391chr1153006 2314 2270 103 96 12916 32880 439 193 --
NM_001001392chr1153052 2360 2316 149 142 12962 32926 485 239 --
NM_001001394chr21638 ------
NM_001001395chr1252546 2108 1794 587 376 ------
NM_001001396chr132755 753 371 13806 ----
NM_001001419chr565218 3912 3676 3222 2056 287 34435 3232 31 21135 470 --
NM_001001420chr565218 3912 3676 3222 2056 287 34435 3232 31 21135 470 --
NM_001001436chr162356 113 1865 ----
NM_001001481chr893378 3256 2883 1316 1206 821 609 592 351 --22559 2498 --
NM_001001484chr1011587 12293 ----
NM_001001521chr22303 233 ------
NM_001001556chr151566 2344 114 ----
NM_001001664chr284089 3863 3203 2876 1414 1252 1227 135 ------
NM_001001668chr1993795 3517 3426 3385 2809 1666 1025 756 621 1282 33815 2792 490 13876
NM_001001715chr131428 1549 ----
NM_001001740chr1----1229 --
NM_001001740chr1----1229 --
NM_001001890chr2133018 1473 958 13553 ----
NM_001001937chr18----146 --
NM_001001971chr1021231 953 21403 564 ----
NM_001001974chr1042005 851 443 244 ------
NM_001001995chrX11214 1286 --11305
NM_001002243chr23604 251 28 1787 ----
NM_001002257chr253107 2612 1154 742 578 22637 163 ----
NM_001002259chr121243 ------
NM_001002295chr102322 278 ------
NM_001002838chrX1331 11757 ----
NM_001002843chr152832 296 --1797 1471
NM_001002860chr1474579 3382 3178 3074 1400 533 353 --13738 --
NM_001003652chr18138474 7976 7661 6791 6374 6122 5595 5561 5273 1758 1483 1160 62 21436 1259 58559 6462 5819 5281 3139 --
NM_001003674chr1876996 4345 1332 1310 1132 1067 776 36637 5901 1566 16554 --
NM_001003675chr1876996 4345 1332 1310 1132 1067 776 36637 5901 1566 16554 --
NM_001003681chr2251854 1749 1689 1605 836 --22043 44 --
NM_001003688chr421226 216 ------
NM_001003694chr31260 ------
NM_001003712chr1231175 780 604 13010 1360 --
NM_001003760chr632855 2495 2395 --22253 1109 --
NM_001003790chr81299 ------
NM_001003791chr81299 ------
NM_001003792chr321113 1005 ------
NM_001003793chr321113 1005 ------
NM_001003810chr4--1220 1203 --
NM_001003940chr152830 94 --1466 13630
NM_001003942chr152830 94 --1466 13630
NM_001003943chr152834 98 --1470 13634
NM_001004065chr963791 3317 2769 2418 1284 311 ------
NM_001004196chr331213 1078 1030 1759 ----
NM_001004308chrX21475 1216 ----11050
NM_001004317chr684287 4162 3928 3505 3279 3067 1677 993 --1937 --
NM_001004342chr135890 5666 1027 ----13882
NM_001004346chr42234 131 ------
NM_001004419chr1244247 3956 3075 1569 13272 24408 761 --
NM_001005158chr33481 475 370 ------
NM_001005159chr33481 475 370 ------
NM_001005266chr15----1110 --
NM_001005267chr15----1110 --
NM_001005268chr15----1110 --
NM_001005269chr15----1110 --
NM_001005335chr191316 ------
NM_001005366chr122366 317 --1856 --
NM_001005377chr191233 ------
NM_001005386chr22943 54 12227 ----
NM_001005404chr1724405 3125 11527 14477 --
NM_001005417chr12678 478 ------
NM_001005463chr1022557 790 21757 329 ----
NM_001005473chr574886 4556 4325 1901 1489 770 47 24409 4142 35997 4731 451 --
NM_001005474chr31258 2628 528 11527 --
NM_001005732chr211599 --162 --
NM_001005733chr211556 --162 --
NM_001005782chr24728 267 169 157 ------
NM_001005845chr82683 47 ------
NM_001005849chr172446 192 ------
NM_001005861chr33980 858 314 ------
NM_001006115chr3----157 --
NM_001006117chrY2181 28 ----181
NM_001006600chr532236 1743 1531 ------
NM_001006612chrX--2436 104 1148 --
NM_001006613chrX--2436 104 1148 --
NM_001006614chrX--2436 104 1148 --
NM_001006617chr921181 186 ------
NM_001006618chr91254 ------
NM_001006619chr921181 186 ------
NM_001006620chr921181 186 ------
NM_001006621chr921181 186 ------
NM_001006623chr252020 2006 1764 944 157 1559 11952 --
NM_001006626chr72686 93 ------
NM_001006627chr72686 93 ------
NM_001006628chr72686 93 ------
NM_001006629chr72686 93 ------
NM_001006630chr72686 93 ------
NM_001006631chr72686 93 ------
NM_001006632chr72686 93 ------
NM_001006933chrX2218 43 ------
NM_001007023chr1454779 2028 1330 396 28 14137 ----
NM_001007024chr1734276 3046 245 ------
NM_001007025chr1734276 3046 245 ------
NM_001007067chr81288 ------
NM_001007068chr81288 ------
NM_001007069chr81288 ------
NM_001007070chr81288 ------
NM_001007075chr43938 860 97 11082 ----
NM_001007097chr933980 1705 374 --21571 1172 --
NM_001007102chr631596 1438 545 1481 1348 --
NM_001007156chr1521729 1293 --21705 81 --
NM_001007226chr175959 584 207 129 56 ------
NM_001007227chr175959 584 207 129 56 ------
NM_001007228chr175959 584 207 129 56 ------
NM_001007229chr175959 584 207 129 56 ------
NM_001007230chr175959 584 207 129 56 ------
NM_001007237chr142544 2537 2374 1898 ------
NM_001007246chr2141861 684 619 66 1517 ----
NM_001007257chr141474 1250 1141 47 ------
NM_001007267chr23683 284 147 1650 ----
NM_001007466chr635202 4702 3946 --13661 --
NM_001007565chr3----1129 --
NM_001007595chr15----1288 --
NM_001007794chr11566 --1527 --
NM_001008225chr74771 514 504 299 --1219 --
NM_001008226chr1531761 1568 193 ------
NM_001008239chr1853587 3540 2891 2736 75 --23631 2572 21370 1361
NM_001008391chr111251 --1196 --
NM_001008392chr352557 1411 1133 871 670 ------
NM_001008401chr1921343 456 11351 1530 --
NM_001008408chr746241 4687 520 211 --1296 12154
NM_001008495chr862257 1753 1507 784 482 261 22022 575 11887 --
NM_001008539chr895168 5148 5132 5046 4578 4528 4494 4401 4388 12157 --11222
NM_001008541chr1011545 11564 --1680
NM_001008541chr1011545 11564 --1680
NM_001008564chr1362278 2224 2215 2088 1972 1761 ------
NM_001008660chr1131587 1275 1229 1214 ----
NM_001008701chr1913087 --1896 --
NM_001008707chr1441887 1689 543 341 ------
NM_001008738chr562829 2248 1791 1126 1098 143 ------
NM_001008783chr6----1685 --
NM_001008860chr152226 81 135 ----
NM_001008892chr152226 81 135 ----
NM_001008894chr152226 81 135 ----
NM_001008895chr131227 11406 ----
NM_001008938chr112296 141 ------
NM_001009554chr474248 4084 3447 1891 924 512 489 --23960 362 1474
NM_001009554chr474248 4084 3447 1891 924 512 489 --23960 362 1474
NM_001009567chr102151 80 ------
NM_001009571chr71391 --41679 1434 89 47 --
NM_001009881chr11417 ------
NM_001009882chr11417 ------
NM_001009899chr366556 6405 3948 1820 1061 344 26465 376 ----
NM_001009955chr12566 38 ------
NM_001009955chr12566 38 ------
NM_001009960chr732522 714 663 1687 2336 126 --
NM_001009993chr234357 4210 3559 14545 11025 --
NM_001010853chr652545 2206 2157 912 870 1852 ----
NM_001010854chr14----1231 --
NM_001010888chrX64619 4324 3634 3003 970 872 11767 24529 1173 --
NM_001010891chr565885 2703 1093 494 309 38 14909 ----
NM_001010908chr101498 ------
NM_001010934chr71734 1857 11174 --
NM_001010986chrX52447 1902 1696 1682 621 --12200 --
NM_001010989chr161489 1441 ----
NM_001010990chr161489 1441 ----
NM_001011537chr361716 1513 1471 452 409 51 --11489 --
NM_001011546chr202732 666 ------
NM_001011553chr72953 315 ------
NM_001011663chr102945 750 188 1814 --
NM_001011666chr745444 4265 1366 691 16469 21104 765 --
NM_001011708chr262813 1925 1812 1007 753 494 ------
NM_001011713chr1461545 1300 1254 1091 192 76 --11027 --
NM_001012420chr152770 369 ------
NM_001012423chr152770 425 ------
NM_001012426chr632577 2137 1129 ------
NM_001012427chr632577 2137 1129 ------
NM_001012751chr1041603 1321 755 178 11489 ----
NM_001012755chrX114840 4823 4792 4263 3606 3468 1643 979 750 472 122 13597 14771 --
NM_001012968chrX92817 2741 2721 2385 2324 1739 921 863 194 12164 ----
NM_001012977chrX31204 931 413 ------
NM_001012979chrX2218 43 ------
NM_001012989chrX3575 521 220 ------
NM_001013031chr1053277 3265 2707 1317 749 22628 878 12474 --
NM_001013406chr721214 434 ------
NM_001013415chr451253 1198 619 568 515 ------
NM_001013620chr12158237 8006 7651 7380 6799 6734 5309 1926 1712 1615 1169 968 619 609 231 37843 7000 1242 ----
NM_001013632chr1127 ------
NM_001013699chr122181 84 ------
NM_001013843chr151138 1578 1915 --
NM_001014286chr13------1108
NM_001014380chr1375414 5293 5046 4935 1759 1095 239 11832 1991 1436
NM_001014797chr10118052 7833 7333 6483 2663 2604 1949 1848 1230 424 295 --1934 --
NM_001014812chr151158 1378 ----
NM_001014831chr191816 ------
NM_001014832chr191816 ------
NM_001014834chr191816 ------
NM_001014835chr191816 ------
NM_001015045chr432062 1776 155 11785 11566 --
NM_001015053chr17136 ------
NM_001015508chr81526 ------
NM_001015877chrX42890 2547 2264 1065 --1982 --
NM_001015882chr91189 --11096 --
NM_001017368chr1732696 492 102 12732 ----
NM_001017369chr411038 --169 --
NM_001017371chr231175 61 26 --11218 --
NM_001017395chr343593 2898 2674 2231 1844 33414 2928 22 --
NM_001017424chr141534 691 317 69 11493 ----
NM_001017425chr141534 691 317 69 11493 ----
NM_001017440chr747833 7423 6178 267 ----25723 5258
NM_001017926chr821567 390 1455 --11587
NM_001017930chrX71452 1416 1359 1344 1247 1232 1127 --31304 1192 945 --
NM_001017962chr103199 154 30 ------
NM_001017969chr93659 458 102 --143 --
NM_001017979chr43774 581 252 ----1140
NM_001017999chr131856 789 747 ------
NM_001017999chr131856 789 747 ------
NM_001018000chr131856 789 747 ------
NM_001018000chr131856 789 747 ------
NM_001018001chr131856 789 747 ------
NM_001018004chr152728 699 ------
NM_001018006chr152728 699 ------
NM_001018007chr152728 699 ------
NM_001018009chr33261 153 62 ------
NM_001018020chr152728 699 ------
NM_001018053chr111965 ------
NM_001018064chr921566 566 ------
NM_001018065chr985749 5538 4547 3680 1578 1431 1362 413 25830 2419 11637 11700
NM_001018066chr985749 5538 4547 3680 1578 1431 1362 413 25830 2419 11637 11700
NM_001018067chr165053 4716 1635 1421 813 282 23663 1196 21954 1787 --
NM_001018068chr165053 4716 1635 1421 813 282 23663 1196 21954 1787 --
NM_001018069chr165053 4716 1635 1421 813 282 23663 1196 21954 1787 --
NM_001018074chr51107 13192 ----
NM_001018075chr51107 13192 ----
NM_001018076chr51107 13192 ----
NM_001018077chr51107 13192 ----
NM_001018090chr1532016 1994 88 11751 ----
NM_001018091chr1532126 2104 198 11861 ----
NM_001018102chr1532016 1994 88 11751 ----
NM_001018108chr1522257 1558 ------
NM_001023567chr1542345 1596 773 369 ------
NM_001024071chr142953 165 ------
NM_001024094chr51107 13192 ----
NM_001024455chrX52639 932 816 778 64 21745 490 ----
NM_001024463chr1511060 1429 ----
NM_001024647chr12147687 7502 6897 6121 5376 5101 4840 4793 2920 2668 2281 2096 1201 125 --27475 6810 11282
NM_001024649chr532951 1972 1861 --22162 957 --
NM_001024660chr311518 --1600 --
NM_001024668chr122695 26 ------
NM_001024688chr872227 2022 1487 785 312 201 174 ------
NM_001024808chr1232848 829 296 ------
NM_001024847chr33891 569 199 --12450 --
NM_001024934chr62513 505 ------
NM_001024935chr62513 505 ------
NM_001024936chr62513 505 ------
NM_001024947chr511073 ------
NM_001024948chr142621 2603 1257 115 ------
NM_001024956chr1195799 4540 4291 3618 2250 1051 725 431 374 35881 4596 1210 25782 933 --
NM_001025068chr321849 205 ------
NM_001025069chr321849 205 ------
NM_001025076chr1075812 5468 5035 4861 3977 3841 1312 11271 2257 128 --
NM_001025077chr10147170 6826 6393 6219 5335 5199 4948 4704 2670 1239 991 910 654 100 22629 919 21615 1486 --
NM_001025079chr324076 4012 33712 3054 154 13643 --
NM_001025105chr521324 250 ------
NM_001025108chr223078 2652 13834 ----
NM_001025201chr21243 ------
NM_001025252chr873126 1288 1277 704 420 322 77 --2905 525 --
NM_001025253chr873126 1288 1277 704 420 322 77 --2905 525 --
NM_001025266chr344860 3651 1522 916 13067 ----
NM_001025356chr1242898 2731 1060 117 ------
NM_001025366chr611192 ----11639
NM_001025366chr611192 ----11639
NM_001025367chr611192 ----11639
NM_001025367chr611192 ----11639
NM_001025368chr611192 ----11639
NM_001025368chr611192 ----11639
NM_001025369chr611208 ----11655
NM_001025369chr611208 ----11655
NM_001025370chr611192 ----11639
NM_001025370chr611192 ----11639
NM_001025389chr1111635 11673 --11556
NM_001025390chr1111635 11673 --11556
NM_001025579chr1721040 457 ------
NM_001025580chrX34135 954 119 24293 3755 ----
NM_001025616chr42381 283 ------
NM_001025780chr931512 1238 300 ------
NM_001029858chr683140 3075 2632 2486 2252 693 373 312 33232 3100 287 ----
NM_001029860chr82266 145 --1242 --
NM_001029863chr632769 2263 1254 11071 ----
NM_001029875chr52521 246 --22939 1977 1923
NM_001029882chr11476 ------
NM_001029882chr11476 ------
NM_001030006chr172671 78 ------
NM_001030007chr1653868 3553 2604 1424 70 11562 1596 1167
NM_001030055chr1434003 1648 261 11842 14550 11036
NM_001031679chr1222941 570 167 12754 --
NM_001031684chr231476 1380 1304 1310 ----
NM_001031695chr2295376 5000 4738 4185 2072 1462 1376 983 59 ------
NM_001031712chr62409 299 ------
NM_001031716chr22394 60 177 ----
NM_001031746chr1041154 1008 948 475 11376 ----
NM_001031801chr22--1187 ----
NM_001031804chr1663792 3378 1609 1441 1341 1093 ----1741
NM_001031812chr522288 1539 --21665 1655 --
NM_001032221chr921431 192 --1358 --
NM_001032279chr111378 ------
NM_001032280chr631650 1488 1285 --11517 --
NM_001032282chr8----21196 1147 --
NM_001032288chr2041601 1395 1319 1065 ------
NM_001032293chr172564 95 ------
NM_001032296chr131564 --12752 --
NM_001032380chr1012033 --11303 --
NM_001032394chr652653 2552 2489 2267 61 ------
NM_001033047chr422538 35 ----11638
NM_001033057chr341514 1380 573 306 --11955 --
NM_001033087chr2033105 2455 905 --11288 --
NM_001033506chr112406 87 ------
NM_001033507chr121594 1538 ------
NM_001033551chr1763886 3660 3093 2743 1296 854 --12848 --
NM_001033557chr23947 131 96 ------
NM_001033561chr171353 ------
NM_001033756chr611126 --1725 11573
NM_001033756chr611126 --1725 11573
NM_001033925chr1012191 --1605 --
NM_001034837chr53772 685 38 ------
NM_001034838chr53772 685 38 ------
NM_001034841chr1644091 1893 729 264 25184 715 33365 2066 1626 --
NM_001034954chr1043199 3126 2894 2492 23045 846 ----
NM_001034955chr1043199 3126 2894 2492 23045 846 ----
NM_001034956chr1043199 3126 2894 2492 23045 846 ----
NM_001034957chr1043199 3126 2894 2492 23045 846 ----
NM_001035521chr21512 1309 ----
NM_001037132chr72731 422 --2586 476 --
NM_001037133chr72731 422 --2586 476 --
NM_001037165chr748897 7405 2493 612 ------
NM_001037324chr31166 ------
NM_001037331chr183342 107 87 ------
NM_001037334chr1861887 1711 712 551 484 476 ------
NM_001037339chr131701 1412 232 11219 11769 --
NM_001037340chr131701 1412 232 11219 11769 --
NM_001037341chr131701 1412 232 11219 11769 --
NM_001037341chr131701 1412 232 11219 11769 --
NM_001037558chr111208 ------
NM_001037954chr1132862 1128 567 --13367 --
NM_001038493chr231519 1325 1064 21317 1302 ----
NM_001038702chr532678 1038 462 12372 --11715
NM_001039029chr1241929 1300 1285 665 --155 --
NM_001039111chr3----1165 --
NM_001039348chr2--152 ----
NM_001039349chr2--152 ----
NM_001039350chr7----1462 --
NM_001039538chr273705 3687 3673 1474 1128 977 403 1136 ----
NM_001039547chr365674 3098 2636 2247 1529 382 --1137 17075
NM_001039569chr213279 1819 ----
NM_001039570chr2224087 3547 --14699 --
NM_001039571chr2224087 3547 --14699 --
NM_001039573chr17--1506 ----
NM_001039574chr11190 ------
NM_001039577chr161179 1161 1143 805 597 380 ------
NM_001039585chr144241 908 720 212 12962 24217 2987 --
NM_001039590chrX64003 3552 3154 3107 2589 594 ------
NM_001039591chrX64003 3552 3154 3107 2589 594 ------
NM_001039618chr1165809 5467 5372 4896 4115 982 22138 1617 15683 --
NM_001039690chr1622374 1880 --11857 --
NM_001039693chr221227 1184 1152 1554 --
NM_001039802chr12905 355 ------
NM_001039840chrX145613 5391 5246 4807 4792 4609 2428 2277 2119 1980 1649 821 633 565 11306 26031 341 15891
NM_001039937chr1334062 3971 690 23809 1637 1100 11664
NM_001040001chr641992 1268 451 135 1750 ----
NM_001040020chr721258 173 2339 153 ----
NM_001040057chr731304 1247 1149 ------
NM_001040092chr8156 ------
NM_001040100chr33195 46 30 ------
NM_001040101chr431072 199 118 ------
NM_001040110chr721717 211 ------
NM_001040135chr73794 126 103 1309 ----
NM_001040142chr232234 868 38 11645 11872 --
NM_001040143chr232234 868 38 11645 11872 --
NM_001040144chr1622374 1880 --11857 --
NM_001040146chr1622374 1880 --11857 --
NM_001040152chr745112 5068 5041 173 24768 3711 25118 4579 14056
NM_001040153chr134755 651 395 165 --1130 --
NM_001040158chr51155 ------
NM_001040181chr3179 ------
NM_001040182chr3179 ------
NM_001040183chr3179 ------
NM_001040199chr3179 ------
NM_001040200chr3179 ------
NM_001040202chr432117 1705 891 ----12209
NM_001040214chr63942 577 528 ----1338
NM_001040260chr4------11133
NM_001040261chr4------11133
NM_001040284chr1665603 4841 4254 1960 1266 1217 11329 12171 15429
NM_001040402chr473006 2602 2244 1063 451 261 68 12170 1175 --
NM_001040409chr21345 ----1770
NM_001040429chr1373530 3394 3211 2900 2525 1062 1034 ------
NM_001040441chr195481 5462 5203 3879 3358 1873 1019 193 156 1635 11991 --
NM_001040450chr1522251 1852 ----1923
NM_001040453chr1522251 1852 ----1923
NM_001040619chr12442 242 --11426 --
NM_001040624chr822467 355 --22474 237 --
NM_001040625chr822467 355 --22474 237 --
NM_001040626chr822467 355 --22474 237 --
NM_001040627chr822467 355 --22474 237 --
NM_001040628chr822467 355 --22474 237 --
NM_001040629chr822467 355 --22474 237 --
NM_001040630chr822467 355 --22474 237 --
NM_001040647chr742119 1666 774 76 --11815 --
NM_001040648chr742119 1666 774 76 --11815 --
NM_001040653chr332499 2308 675 1897 ----
NM_001040665chr744780 4614 3853 1405 14910 ----
NM_001040666chr71482 1612 ----
NM_001040668chr191135 ------
NM_001040712chr962631 2443 2187 1182 881 323 ------
NM_001042353chr20----2538 159 --
NM_001042355chr1654567 1186 156 89 51 ------
NM_001042388chr184906 644 619 126 --1347 --
NM_001042404chr111475 --11749 --
NM_001042412chr1654567 1186 156 89 51 ------
NM_001042413chr983454 2876 2827 1173 925 552 188 45 --23988 3864 --
NM_001042414chr13--194 ----
NM_001042424chr43554 494 401 ------
NM_001042425chr631650 1488 1285 --11517 --
NM_001042453chrX31687 1476 1239 ------
NM_001042473chr102359 196 --1106 --
NM_001042479chrX32112 1564 833 ------
NM_001042480chrX32112 1564 833 ------
NM_001042481chr1452498 2398 1847 1773 472 --22224 488 --
NM_001042492chr1753439 3399 3154 1255 948 13203 ----
NM_001042494chr1543453 3132 716 686 --23741 2455 --
NM_001042495chr1543453 3132 716 686 --23741 2455 --
NM_001042496chr1543453 3132 716 686 --23741 2455 --
NM_001042497chr1543453 3132 716 686 --23741 2455 --
NM_001042506chrX31214 931 413 ------
NM_001042510chr841605 763 570 554 --11366 --
NM_001042511chr841605 763 570 554 --11366 --
NM_001042537chrX42214 1558 961 885 ------
NM_001042550chr911731 --11571 --
NM_001042555chr1264781 4012 3902 3747 1351 791 --2956 805 1375
NM_001042599chr257354 7269 5076 2270 2204 14880 ----
NM_001042601chr313044 1260 2373 125 --
NM_001042603chr1285241 5232 4852 3870 2105 2038 408 95 --14604 --
NM_001042604chr364694 3548 3127 1625 938 750 --11559 --
NM_001042635chr14159 ------
NM_001042669chr42381 283 ------
NM_001042683chr61132 1742 ----
NM_001042728chr1211067 ------
NM_001042749chrX21630 471 11614 ----
NM_001042750chrX21630 471 11614 ----
NM_001042751chrX21630 471 11614 ----
NM_001043351chr122234 772 --1506 --
NM_001044385chr253759 3428 2996 2519 605 ------
NM_001044722chr522288 1539 --21665 1655 --
NM_001044723chr522288 1539 --21665 1655 --
NM_001045556chr82281 55 ------
NM_001045557chr82281 55 ------
NM_001046chr552997 2990 2339 2158 149 --12151 --
NM_001048183chr143758 3133 1364 535 ------
NM_001049chr1442463 2085 2027 1698 ------
NM_001068chr3--1226 ----
NM_001071775chr132424 63 ----1245
NM_001083620chr431933 859 852 32249 757 452 ----
NM_001099678chr396431 6401 6173 5933 4977 4047 1534 1142 772 36008 1288 652 26016 5920 --
NM_001106chr3109548 9351 7786 7521 6533 5985 3686 3542 2441 211 18411 ----
NM_001113490chrX63245 2931 2522 2370 722 241 ------
NM_001116chr1632575 599 369 23059 2592 ----
NM_001117chr1831943 530 156 --1374 --
NM_001121chr1041891 1791 1619 43 --1428 --
NM_001122679chr531313 1225 877 ------
NM_001126chr12342 222 --1984 --
NM_001128chr1653868 3553 2604 1424 70 11562 1596 1167
NM_001148chr42816 650 1677 21720 438 --
NM_001151chr4165 ------
NM_001156chr102235 161 ------
NM_001160chr1252857 1966 945 113 101 ----12099
NM_001167chrX116729 6701 6206 4260 2617 2601 2440 2159 1835 470 442 11779 ----
NM_001173chr1434003 1648 261 11842 14550 11036
NM_001174chrX12060 ------
NM_001177chr1242441 2273 2139 536 ------
NM_001186chr2163305 2564 2385 946 516 85 12061 12584 --
NM_001187chr212418 407 ------
NM_001201chr463988 3875 3744 3264 518 420 12583 11323 --
NM_001204chr2107053 6823 6651 6060 5669 5357 3004 1913 713 327 16373 ----
NM_001206chr942819 2685 482 178 --1161 --
NM_001219chr7170 21664 547 ----
NM_001222chr1021311 245 --1650 --
NM_001233chr751914 1469 660 646 578 ------
NM_001239chr51122 ------
NM_001241chr262258 1907 1767 476 450 200 22345 151 ----
NM_001241chr262258 1907 1767 476 450 200 22345 151 ----
NM_001256chr175738 724 708 488 369 --1695 --
NM_001257chr1621327 122 ------
NM_001259chr7116250 5896 5599 5244 3921 1979 1819 1585 1177 1157 944 44836 1387 1150 97 22031 1997 --
NM_001270chr5--1122 1759 --
NM_001271chr1533233 2235 1075 --12601 --
NM_001282chr172671 78 ------
NM_001304chr1743087 2777 1411 863 23135 126 ----
NM_001310chr1241946 1014 694 230 --1324 --
NM_001326chr112416 381 ------
NM_001332chr51592 --1492 --
NM_001343chr53663 398 143 ------
NM_001356chrX52408 2218 1658 1579 380 --1218 --
NM_001358chr41343 ------
NM_001364chr1174721 4687 3824 3537 1865 648 200 --21842 1581 --
NM_001378chr2----1413 --
NM_001380chr102732 343 ------
NM_001385chr82166 68 ------
NM_001387chr552991 2587 724 178 45 12671 ----
NM_001390chr1853531 3517 3250 2499 2450 ------
NM_001397chr121777 1711 --179 --
NM_001400chr11286 ------
NM_001402chr641903 1565 519 482 1586 ----
NM_001407chr321696 481 ------
NM_001412chrX43269 763 712 388 23487 3080 22366 279 --
NM_001416chr17----1454 --
NM_001418chr113753 470 282 144 ----
NM_001418chr113753 470 282 144 ----
NM_001419chr19104908 4687 4406 4309 1912 1584 914 785 505 450 1752 ----
NM_001420chr1933152 3086 2153 12127 ----
NM_001423chr1231967 520 76 --11423 --
NM_001427chr721779 386 ------
NM_001429chr22--11099 ----
NM_001432chr433723 1327 797 1332 ----
NM_001438chr133177 838 772 33575 2705 2353 22756 795 --
NM_001451chr1611078 1208 ----
NM_001453chr641758 1723 1717 1298 --1684 11748
NM_001463chr22105 87 --158 --
NM_001465chr531905 1405 438 1191 ----
NM_001482chr151646 ------
NM_001491chr622756 634 1264 ----
NM_001497chr932714 2490 1930 1324 ----
NM_001514chr11135 ----1445
NM_001521chr21512 1309 ----
NM_001522chrX176 ------
NM_001527chr674735 4463 3948 3600 3065 1399 733 24664 4359 ----
NM_001530chr1431138 1081 236 ------
NM_001533chr191316 ------
NM_001542chr142544 2537 2374 1898 ------
NM_001546chr631101 443 416 ------
NM_001554chr11109 ------
NM_001584chr1151109 402 246 201 117 1255 ----
NM_001587chrX52249 2158 2118 195 98 ------
NM_001604chr111814 --1959 --
NM_001616chr241382 435 172 151 33480 2841 610 ----
NM_001621chr722768 2558 22729 796 ----
NM_001621chr722768 2558 22729 796 ----
NM_001635chr711002 ------
NM_001642chr113487 298 243 ------
NM_001652chr1211468 ------
NM_001656chr531584 1277 473 ------
NM_001660chr33679 288 146 1166 ----
NM_001668chr162198 2098 2051 1842 706 435 ------
NM_001677chr11311 ------
NM_001682chr1252762 2596 2528 865 35 1641 ----
NM_001684chr12470 88 13523 ----
NM_001690chr342538 1624 1028 479 12593 11690 --
NM_001695chr834248 3843 3326 23179 2851 22775 931 --
NM_001704chr62521 41 --1456 --
NM_001709chr1142649 2083 961 255 --1512 --
NM_001716chr1121570 23 ------
NM_001730chr1341496 1390 1295 160 ------
NM_001730chr1341496 1390 1295 160 ------
NM_001742chr741592 738 171 137 11665 ----
NM_001743chr23415 169 43 1498 ----
NM_001746chr532951 1972 1861 --22162 957 --
NM_001753chr731795 1144 289 181 ----
NM_001754chr2133018 1473 958 13553 ----
NM_001755chr1652253 2198 1594 1539 864 11692 194 --
NM_001759chr1261380 1363 1289 985 729 248 1748 --23960 947
NM_001769chr12------1134
NM_001777chr324076 4012 33712 3054 154 13643 --
NM_001786chr10--158 ----
NM_001788chr72953 315 ------
NM_001791chr12905 355 ------
NM_001792chr182860 392 ------
NM_001797chr163765 756 308 ------
NM_001802chr162368 36 --1116 --
NM_001822chr21243 ------
NM_001829chr44798 368 358 261 ------
NM_001839chr14750 719 693 499 ------
NM_001845chr1321334 909 11327 ----
NM_001850chr31143 ------
NM_001855chr93766 562 82 --1346 --
NM_001859chr9113950 3805 3329 2603 1600 1387 1341 1237 845 753 201 ------
NM_001866chrX130 ------
NM_001880chr21277 ------
NM_001892chr521324 250 ------
NM_001895chr201923 --2378 121 --
NM_001901chr62833 150 ------
NM_001923chr112490 451 1644 ----
NM_001931chr111826 21172 928 ----
NM_001935chr23726 279 232 ------
NM_001936chr7----1462 --
NM_001938chr121650 767 11525 ----
NM_001949chr662494 2262 2215 1253 873 801 ------
NM_001964chr511169 ------
NM_001966chr331350 1033 93 ------
NM_001969chr1453123 2996 1034 714 551 22844 415 ----
NM_001977chr451656 1410 662 157 41 ------
NM_001980chr1242288 2268 825 756 ------
NM_001993chr141143 1080 1017 38 ------
NM_001995chr411344 ------
NM_001999chr511397 1369 ----
NM_002006chr455788 1459 1369 209 153 14296 14428 --
NM_002009chr151943 1670 ----
NM_002015chr1362667 2539 2365 1001 762 560 ------
NM_002017chr1111322 ------
NM_002024chrX32229 1827 1513 --1216 --
NM_002025chrX98916 8211 6710 2566 2281 1709 508 291 156 16320 15706 --
NM_002026chr241004 988 805 214 2946 839 ----
NM_002031chr62829 288 ------
NM_002033chr1132902 2820 1067 --1240 12845
NM_002035chr1883538 3500 3477 2514 1383 1164 559 98 12742 11398 --
NM_002039chr41220 --1304 --
NM_002040chr2142733 2383 418 243 12657 ----
NM_002041chr15145 ------
NM_002044chr151566 2344 114 ----
NM_002051chr102322 278 ------
NM_002052chr821465 327 --21409 1229 --
NM_002054chr21190 --1109 --
NM_002061chr151941 691 380 216 198 2772 423 ----
NM_002063chrX31121 986 897 --21058 253 --
NM_002069chr731740 657 552 --11487 --
NM_002072chr93779 707 107 ------
NM_002086chr1722116 868 ------
NM_002111chr453866 3146 2756 2698 2523 ------
NM_002114chr62527 142 ------
NM_002126chr1722753 543 --13078 --
NM_002128chr1342466 1698 470 356 ------
NM_002136chr122584 474 ------
NM_002137chr742385 1759 583 274 ------
NM_002138chr4--1220 1203 --
NM_002139chrX----1202 --
NM_002140chr921044 300 ------
NM_002147chr17--1199 ----
NM_002154chr52405 195 ------
NM_002157chr21145 ------
NM_002158chr263826 3421 3139 2693 1327 164 ------
NM_002165chr202360 318 ------
NM_002188chr51688 ------
NM_002196chr20--21069 772 ----
NM_002196chr20--21069 772 ----
NM_002199chr44842 395 280 137 ------
NM_002202chr53875 698 415 ------
NM_002203chr544141 3823 2976 292 14133 13065 --
NM_002210chr243327 2562 908 758 --23170 836 --
NM_002211chr103452 237 84 ------
NM_002214chr7104761 1594 1576 897 845 562 368 114 95 50 141 ----
NM_002222chr31188 1148 ----
NM_002223chr1283329 3105 3098 1451 1126 958 897 97 23962 2991 ----
NM_002227chr12530 379 11167 ----
NM_002232chr11240 ------
NM_002233chr11--1145 ----
NM_002239chr22843 149 1821 ----
NM_002247chr1032216 541 516 1789 ----
NM_002264chr364519 3228 3115 3103 1541 811 14033 23573 1212 --
NM_002265chr17--1957 ----
NM_002266chr17159 ------
NM_002267chr1332305 1845 445 ----12350
NM_002268chr321602 1387 ------
NM_002269chr6----1347 --
NM_002270chr594922 4741 4735 3804 3663 2029 1978 1939 319 23501 1361 ----
NM_002271chr1362208 981 967 927 396 376 ------
NM_002284chr121568 ------
NM_002285chr223078 2652 13834 ----
NM_002293chr141948 1781 1729 435 --12224 1230
NM_002296chr111302 --11517 --
NM_002298chr1321316 1009 --11432 --
NM_002303chr11115 ------
NM_002310chr5116415 6379 5688 5534 5361 4934 2346 2064 2014 1910 1223 2105 60 25575 2214 --
NM_002332chr12--1772 ----
NM_002336chr1274844 4368 4357 3584 1944 948 609 ------
NM_002349chr21236 --21306 455 --
NM_002355chr123422 261 109 ------
NM_002356chr642862 747 741 458 22504 1152 ----
NM_002360chr762606 2279 2266 1780 550 158 ------
NM_002374chr273705 3687 3673 1474 1128 977 403 1136 ----
NM_002376chr14----1543 --
NM_002381chr22965 81 1753 ----
NM_002382chr1411090 ------
NM_002387chr575111 4948 3419 1367 897 365 180 14986 ----
NM_002398chr251426 1262 1214 1049 341 ------
NM_002399chr1511207 ------
NM_002402chr721107 895 ------
NM_002408chr142829 243 1823 1627 --
NM_002411chr111121 ------
NM_002430chr2252383 2067 527 415 109 1391 ----
NM_002438chr102151 80 ------
NM_002444chrX11974 --11795 --
NM_002449chr511289 ------
NM_002467chr81426 ------
NM_002480chr1231460 1215 1093 --1227 --
NM_002482chr1--1709 ----
NM_002485chr872227 2022 1487 785 312 201 174 ------
NM_002499chr1572269 2206 1518 947 861 764 579 --1634 --
NM_002500chr211164 ------
NM_002501chr1911668 --11303 --
NM_002509chr201575 ------
NM_002515chr1422017 26 ------
NM_002519chr1141396 1024 582 110 ------
NM_002524chr1196 ----11075
NM_002527chr12178 ------
NM_002537chr152300 164 ------
NM_002544chr171273 ------
NM_002546chr82681 296 ------
NM_002552chr211131 ------
NM_002556chr1141505 849 592 472 ------
NM_002572chr11198 ------
NM_002576chr1131152 445 26 ------
NM_002577chr342689 1237 454 330 14002 11553 --
NM_002578chrX1428 ------
NM_002581chr975476 4857 3784 3737 3639 1335 1279 15100 ----
NM_002582chr161271 ----1934
NM_002586chr611243 ------
NM_002588chr5----1687 --
NM_002594chr2012056 --12421 --
NM_002595chr1261809 1344 787 423 306 158 --1318 --
NM_002600chr131701 1412 232 11219 11769 --
NM_002608chr2231012 90 58 ------
NM_002613chr1675106 4806 4001 1828 1203 978 265 14867 11478 --
NM_002623chr20148 ------
NM_002628chr321123 1077 2991 975 ----
NM_002641chrX----11886 --
NM_002645chr11--1948 2330 218 --
NM_002648chr6----21146 260 --
NM_002655chr884968 3953 3827 3486 3371 1958 1374 926 24982 4338 1892 --
NM_002656chr621057 896 ------
NM_002657chr2033592 1182 472 --11249 --
NM_002660chr201428 ------
NM_002670chr341562 1482 514 262 ------
NM_002677chr872941 2922 2097 1085 1059 886 57 --1836 --
NM_002687chr14----1356 --
NM_002699chr121013 87 ------
NM_002703chr4--2653 628 ----
NM_002706chr21230 ------
NM_002709chr2123603 3578 3079 3014 2718 2387 1441 1271 1121 617 594 362 --12595 --
NM_002711chr71255 --2823 81 --
NM_002713chr121060 203 ------
NM_002715chr541281 465 205 27 11101 31170 890 224 --
NM_002716chr1173656 3077 2597 1278 904 783 178 1937 ----
NM_002717chr8191 ----1141
NM_002719chr1442372 2169 979 710 1454 21827 825 --
NM_002721chr92493 158 ------
NM_002727chr102548 197 ------
NM_002731chr192936 2877 2681 2489 412 402 387 197 134 ------
NM_002734chr1742208 1427 147 139 ------
NM_002736chr721937 1873 11788 ----
NM_002737chr1732003 1804 1730 --36596 6380 734 --
NM_002738chr162429 82 ----1868
NM_002747chr18--11888 ----
NM_002753chr43728 351 315 ------
NM_002811chr161518 1376 ----
NM_002814chrX1209 ------
NM_002821chr61752 --1127 --
NM_002822chr1251674 1454 530 453 21 ------
NM_002825chr7159 ------
NM_002828chr181683 ------
NM_002835chr73615 602 210 1114 ----
NM_002839chr962631 2443 2187 1182 881 323 ------
NM_002841chr3----1497 --
NM_002844chr611245 ------
NM_002845chr182545 156 ------
NM_002848chr1241207 832 398 61 ----1452
NM_002851chr73810 644 588 --2763 39 --
NM_002852chr31538 --1395 1403
NM_002858chr12493 72 1188 ----
NM_002869chr1121553 117 11934 21589 131 --
NM_002874chr962365 1764 798 772 496 118 --12445 1766
NM_002886chr395016 4727 4457 4227 1886 1763 1496 1432 682 ------
NM_002892chr1421581 1282 --11556 1102
NM_002893chrX2248 79 ------
NM_002901chr111139 164 ----
NM_002902chr151634 ------
NM_002912chr62762 653 --2906 227 --
NM_002923chr1------1532
NM_002924chr11616 1124 ----
NM_002941chr33585 345 173 ------
NM_002942chr321080 169 ----1301
NM_002951chr202277 250 ------
NM_002956chr1231358 251 70 ------
NM_002958chr33980 858 314 ------
NM_002959chr154370 3398 2712 1032 95 13924 --1990
NM_002971chr331219 907 227 --1100 --
NM_002977chr283451 3298 3024 2187 1058 945 564 23 ------
NM_003010chr1762286 2209 1674 541 462 89 --21915 1871 --
NM_003012chr832828 606 117 1882 ----
NM_003013chr42787 733 ------
NM_003016chr1771695 1550 1407 594 550 452 327 --11999 --
NM_003017chr611252 1218 1964 --
NM_003020chr15------1400
NM_003046chr895168 5148 5132 5046 4578 4528 4494 4401 4388 12157 --11222
NM_003068chr841113 697 377 304 --1343 --
NM_003069chrX3638 574 491 ------
NM_003070chr91668 --1610 --
NM_003074chr31420 ------
NM_003076chr1221566 660 ------
NM_003079chr171857 ------
NM_003081chr2041040 1011 345 118 ------
NM_003094chr16757 478 379 140 89 27 --2214 163 --
NM_003099chr1556546 5855 4751 4110 1591 26478 1621 ----
NM_003107chr632593 2243 286 ------
NM_003108chr286923 5716 4908 4737 2854 1515 797 602 --17083 --
NM_003110chr17----1945 --
NM_003111chr231175 61 26 --11218 --
NM_003112chr763045 2894 2129 1266 1029 896 ------
NM_003115chr12363 144 ------
NM_003128chr232794 2759 849 --12836 --
NM_003129chr8--1239 ----
NM_003131chr62233 55 --11713 --
NM_003133chr11274 ------
NM_003140chrY197 ------
NM_003144chr62543 152 11458 31505 740 271 --
NM_003150chr1742375 2237 449 344 ------
NM_003155chr83816 576 332 32669 2404 1967 11920 --
NM_003161chr1773457 3328 1054 887 871 314 203 ----1672
NM_003174chr10------1134
NM_003176chr11218 ------
NM_003176chr11218 ------
NM_003178chr321867 1602 --2862 101 --
NM_003182chr72501 107 ------
NM_003182chr72501 107 ------
NM_003185chr20175 11311 ----
NM_003188chr63853 287 195 --1148 --
NM_003189chr122614 2529 --23190 2388 --
NM_003198chr11312 ------
NM_003199chr1865439 5323 4620 1990 1322 889 35060 4934 4313 124 --
NM_003202chr511637 11852 ----
NM_003203chr231786 1613 996 ------
NM_003206chr61450 ------
NM_003211chr1241542 1504 1254 560 11777 ----
NM_003216chr2223042 398 ------
NM_003220chr631650 1488 1285 --11517 --
NM_003221chr664212 3274 2749 1447 1364 1316 --13900 1535
NM_003222chr2021222 805 ------
NM_003234chr31883 ------
NM_003236chr2103103 2950 2741 2417 2208 1322 1145 1129 708 423 ----13518
NM_003242chr33891 569 199 --12450 --
NM_003246chr1561888 1765 752 561 239 50 --11737 --
NM_003247chr641602 465 414 68 --1283 --
NM_003253chr2111804 ------
NM_003255chr1742420 2120 1875 400 --1861 --
NM_003262chr354967 3196 1443 1139 437 33435 2116 768 11051 --
NM_003263chr4141 ------
NM_003269chr621309 824 ----1980
NM_003274chr2162991 2964 2471 2428 2177 495 12949 ----
NM_003286chr20------11068
NM_003295chr13----1155 --
NM_003298chr386206 6147 5060 5012 4010 3951 2177 1564 14175 16125 --
NM_003304chr361579 1350 1330 455 324 59 ------
NM_003305chr41154 ------
NM_003319chr22969 166 1957 ----
NM_003326chr12528 80 32747 2565 2450 2971 311 --
NM_003336chrX2907 378 1317 ----
NM_003337chr531577 201 179 --136 --
NM_003338chr1031526 675 95 21644 731 ----
NM_003339chr521025 203 11129 --11233
NM_003340chr4----21010 919 --
NM_003342chr1733154 2225 91 12265 1406 --
NM_003348chr122519 220 --21721 574 --
NM_003349chr2041601 1395 1319 1065 ------
NM_003350chr81404 ------
NM_003352chr24728 267 169 157 ------
NM_003369chr1112428 12128 --1165
NM_003375chr10164 ------
NM_003376chr611192 ----11639
NM_003376chr611192 ----11639
NM_003390chr111292 1166 ----
NM_003392chr383874 3344 3052 2926 2819 2804 2767 1478 --11537 --
NM_003400chr22685 562 --2824 174 --
NM_003403chr14------1190
NM_003404chr2031913 1385 401 ----1773
NM_003405chr222639 190 --1175 --
NM_003406chr831715 722 284 ------
NM_003409chr181109 ----11442
NM_003410chrX42867 2360 1977 898 ------
NM_003411chrY3698 220 122 ------
NM_003413chrX41985 744 553 398 21747 649 21607 1373 --
NM_003419chr192954 384 --11120 --
NM_003423chr1941683 1050 445 157 12582 ----
NM_003432chr51174 ----1462
NM_003439chr733520 2800 1360 --23460 816 --
NM_003442chr111202 ------
NM_003452chr92870 707 ------
NM_003454chr1651428 1080 1045 530 116 1161 ----
NM_003457chr172564 95 ------
NM_003470chr1641173 652 519 510 ----1685
NM_003471chr321739 673 1461 1240 --
NM_003473chr1011081 ----1423
NM_003478chr1162602 1244 1098 747 553 330 --1564 12250
NM_003482chr1221957 909 ------
NM_003483chr1252830 2429 1073 691 87 ------
NM_003487chr171236 ------
NM_003488chr173971 387 93 ------
NM_003489chr2143480 3214 2809 820 ----12268
NM_003490chr2221075 193 ------
NM_003505chr721679 407 ------
NM_003508chr71293 ------
NM_003557chr131596 1276 337 --11119 --
NM_003558chr94641 611 273 217 ------
NM_003563chr175959 584 207 129 56 ------
NM_003565chr1231789 1527 1428 --1617 --
NM_003566chr1273449 3039 1059 840 775 711 410 ----1536
NM_003574chr1884594 4548 4421 4321 2288 365 313 276 45426 4197 3901 400 25508 1658 --
NM_003576chr131564 --12752 --
NM_003583chr1253906 3500 1275 830 732 12734 32612 919 45 --
NM_003589chr131227 11406 ----
NM_003590chr2104062 4046 3546 3458 2662 2527 1554 402 384 328 13296 ----
NM_003597chr242158 1869 1542 396 ------
NM_003603chr432060 536 411 ------
NM_003607chr144383 740 477 253 23223 1655 ----
NM_003615chr333764 3666 641 33977 3591 1116 12870 --
NM_003617chr171923 1836 1759 1490 1461 871 138 11725 ----
NM_003618chr221131 262 ----1211
NM_003622chr123734 210 100 ------
NM_003629chr133523 3409 3369 23350 1142 33398 2722 2321 --
NM_003630chr61762 1240 ----
NM_003633chr542323 1725 1708 679 --11660 --
NM_003659chr26910 833 750 353 308 202 --1440 --
NM_003663chr393455 3182 2881 2863 2661 2252 1106 608 21 1176 ----
NM_003670chr351201 1147 250 97 90 11033 ----
NM_003671chr963387 3074 3021 339 332 105 32790 2381 1234 1779 12845
NM_003672chr131889 698 689 ------
NM_003690chr21575 1445 ----
NM_003692chr92875 202 1784 ----
NM_003701chr1331045 904 848 1402 ----
NM_003713chr12411 364 --11600 --
NM_003714chr543081 3073 2528 635 --22320 2204 --
NM_003722chr322656 390 --1621 --
NM_003735chr5----1687 --
NM_003736chr5----1687 --
NM_003743chr222123 885 12100 ----
NM_003749chr1352389 2235 1633 868 218 ------
NM_003758chr153613 490 449 2259 216 ----
NM_003758chr153613 490 449 2259 216 ----
NM_003762chr131262 351 55 ------
NM_003774chr1212056 32601 2477 2153 --1422
NM_003778chr3----1110 --
NM_003780chr12678 478 ------
NM_003787chr182222 133 1436 --11474
NM_003794chr341073 913 877 260 1845 ----
NM_003797chr11----1149 --
NM_003800chr642190 1635 844 674 --1631 --
NM_003816chr81297 ------
NM_003822chr172971 2422 2270 2034 839 260 205 12856 1861 --
NM_003825chr1541280 1085 988 312 ------
NM_003850chr132283 76 --1559 --
NM_003862chr51116 ------
NM_003870chr1532078 1661 545 11827 1849 1702
NM_003873chr1072420 2331 2232 2222 1010 937 776 ----11847
NM_003876chr171310 ------
NM_003885chr1722167 1868 12536 ----
NM_003887chr252252 1981 1432 542 169 11599 --1202
NM_003895chr2152103 2079 1923 1700 95 --1441 21797 191
NM_003901chr1082454 2097 1972 1016 841 817 307 254 ------
NM_003902chr12649 34 ------
NM_003909chr842378 2187 1864 377 ----12724
NM_003913chr641206 1164 1093 667 --11003 --
NM_003922chr152353 342 ------
NM_003927chr182947 841 ------
NM_003930chr752592 2528 1926 1664 900 52385 528 478 341 227 ----
NM_003931chr62513 505 ------
NM_003932chr2241898 1449 1306 1275 ----11463
NM_003934chr93503 181 41 ------
NM_003946chr161551 ------
NM_003953chr122125 243 1598 12184 --
NM_003958chr622537 482 23401 1466 ----
NM_003968chr32489 246 ------
NM_003983chr1634443 3343 845 13489 ----
NM_003994chr1264399 3908 3765 3164 1466 1266 --13268 --
NM_004006chrX52368 2009 1655 892 241 --22493 515 --
NM_004007chrX52368 2009 1655 892 241 --22493 515 --
NM_004009chrX52368 2009 1655 892 241 --22493 515 --
NM_004010chrX52368 2009 1655 892 241 --22493 515 --
NM_004011chrX52368 2009 1655 892 241 --22493 515 --
NM_004012chrX52368 2009 1655 892 241 --22493 515 --
NM_004013chrX52368 2009 1655 892 241 --22493 515 --
NM_004014chrX52368 2009 1655 892 241 --22493 515 --
NM_004015chrX52368 2009 1655 892 241 --22493 515 --
NM_004016chrX52282 1923 1569 806 155 --22407 429 --
NM_004017chrX52368 2009 1655 892 241 --22493 515 --
NM_004018chrX52282 1923 1569 806 155 --22407 429 --
NM_004019chrX1373 ------
NM_004020chrX52368 2009 1655 892 241 --22493 515 --
NM_004021chrX52282 1923 1569 806 155 --22407 429 --
NM_004022chrX52282 1923 1569 806 155 --22407 429 --
NM_004023chrX52282 1923 1569 806 155 --22407 429 --
NM_004024chr11351 --11335 --
NM_004034chr102235 161 ------
NM_004040chr221251 870 --1878 --
NM_004046chr18----146 --
NM_004050chr141655 ------
NM_004056chr81282 11039 ----
NM_004061chr51449 ------
NM_004071chr21111 ------
NM_004080chr721414 1384 1430 ----
NM_004087chr31492 --22056 1550 --
NM_004093chr1333195 3031 979 ------
NM_004098chr1011052 ------
NM_004105chr2--152 ----
NM_004114chrX3936 829 364 21136 972 ----
NM_004117chr6----12176 1883
NM_004124chr1453530 3343 3298 3039 2823 22664 215 ----
NM_004126chr71266 ------
NM_004133chr852617 662 469 331 256 22377 169 ----
NM_004136chr1563152 3041 2721 2541 2015 1107 3978 867 207 ----
NM_004152chr191230 --1349 --
NM_004161chr241137 1078 644 256 ------
NM_004162chr341165 1094 954 909 ------
NM_004171chr11119447 8314 7714 7263 7172 6839 6822 6697 6604 1973 1485 --18692 17596
NM_004181chr41317 ------
NM_004187chrX21255 173 ------
NM_004202chrY1694 --147 --
NM_004209chr1611041 --1934 --
NM_004215chr81521 ------
NM_004227chr713161 12553 ----
NM_004229chrX31936 1796 317 ------
NM_004232chr1863561 3317 3253 2768 750 76 22374 400 11039 11302
NM_004241chr101323 ------
NM_004255chr15------142
NM_004272chr5--11484 ----
NM_004274chr1442848 1992 1106 1050 12915 ----
NM_004290chr521267 34 ------
NM_004319chr132165 826 391 11065 ----
NM_004326chr111247 ------
NM_004330chr152887 852 1243 ----
NM_004331chr852280 2019 1011 791 84 ------
NM_004338chr1876996 4345 1332 1310 1132 1067 776 36637 5901 1566 16554 --
NM_004342chr71777 --11930 --
NM_004346chr411401 1250 ----
NM_004349chr821162 378 1372 ----
NM_004370chr642122 1945 1812 758 --11468 --
NM_004379chr241754 1706 671 488 11385 11362 --
NM_004380chr1642166 1021 988 634 1876 1302 --
NM_004384chr522288 1539 --21665 1655 --
NM_004388chr12370 138 182 ----
NM_004389chr21869 ------
NM_004397chr1163303 3121 1718 1678 1071 820 22684 1692 --12781
NM_004405chr211096 --154 --
NM_004412chr10--25737 205 11109 --
NM_004414chr2131486 1404 132 11201 ----
NM_004417chr51412 ------
NM_004432chr931896 250 240 1160 1450 --
NM_004434chr1441887 1689 543 341 ------
NM_004438chr262407 2345 1324 1291 377 159 --23114 143 --
NM_004440chr641771 1349 794 638 1364 ----
NM_004441chr3--1150 11222 --
NM_004447chr121303 --130 --
NM_004456chr71165 ------
NM_004457chr221563 505 --21217 486 --
NM_004458chrX62599 2156 1010 583 557 153 12008 ----
NM_004459chr1751495 1370 621 426 402 21992 1579 ----
NM_004481chr112633 ------
NM_004491chr1933771 2901 1517 ------
NM_004496chr1441214 1179 1063 199 11249 ----
NM_004499chr51100 ------
NM_004500chr143711 363 157 21845 1492 ----
NM_004501chr153102 1640 385 312 214 13903 ----
NM_004504chr241040 637 253 131 ----2443 348
NM_004516chr1921196 514 ------
NM_004520chr51544 ------
NM_004525chr231460 1355 1153 ------
NM_004537chr1221378 452 --21132 260 --
NM_004538chrX2811 644 ------
NM_004540chr213754 190 178 1636 ----
NM_004571chr2143409 2997 1300 1043 ------
NM_004575chr441453 1212 1015 657 --11333 --
NM_004578chr11859 ------
NM_004580chr1531214 107 95 --1724 --
NM_004586chrX85408 5309 4903 4704 4035 2149 1725 597 1177 15252 --
NM_004588chr1124043 818 ----1640
NM_004591chr23406 389 157 ------
NM_004593chr3145 ------
NM_004596chr192166 140 ------
NM_004598chr523146 2072 --1106 12110
NM_004602chr2021172 999 --11281 --
NM_004607chr51182 ------
NM_004612chr9134747 4409 4005 3978 3899 3850 1373 689 589 351 285 107 74 ------
NM_004622chr241884 732 498 331 197 ----
NM_004627chr211498 --1632 --
NM_004634chr31260 ------
NM_004637chr321260 1183 ------
NM_004654chrY41106 1050 369 355 ------
NM_004655chr171457 ----11062
NM_004660chrY52278 2230 1602 378 211 ------
NM_004663chr1521143 253 21521 638 21431 1178 --
NM_004681chrY2726 205 --1134 --
NM_004684chr42333 138 ------
NM_004705chr112835 257 --1592 --
NM_004709chrX31771 1758 42 1125 11835 --
NM_004713chr142626 116 ------
NM_004718chr2----1201 165
NM_004719chr1252818 1157 1121 1012 759 --12440 --
NM_004726chrX65203 4865 4790 3612 1589 563 ------
NM_004727chr1531695 868 182 --11923 --
NM_004730chr562020 1821 826 645 439 294 ------
NM_004733chr31561 --1444 --
NM_004734chr1333125 2683 1147 12328 ----
NM_004736chr161962 1394 835 578 331 282 ----1820
NM_004742chr311238 21666 277 11695 --
NM_004745chr846652 5558 2456 928 24783 1132 36941 4674 1327 12387
NM_004748chr1534189 3890 3032 --13674 --
NM_004755chr1431212 1145 31 ------
NM_004759chr122135 1792 ------
NM_004760chr721949 878 1420 12469 --
NM_004768chr131162 366 301 ------
NM_004772chr5----1501 --
NM_004775chr1872433 2398 1723 1589 739 727 372 ------
NM_004781chr11609 1584 1574 11402
NM_004781chr11609 1584 1574 11402
NM_004786chr183153 60 30 ------
NM_004788chr1142511 2326 2283 55 22499 2446 ----
NM_004791chr131110 ------
NM_004796chr1432160 931 685 ------
NM_004814chr11422 1449 --1113
NM_004815chr143756 3697 1898 1495 11522 24053 1950 --
NM_004822chr1713812 ------
NM_004830chr64941 884 734 125 ----1862
NM_004834chr212937 12774 32647 1243 973 --
NM_004835chr31886 ------
NM_004835chr31886 ------
NM_004836chr21383 ------
NM_004840chrX52095 1492 966 803 378 ------
NM_004841chr131091 457 316 2302 95 ----
NM_004842chr641799 1599 1376 350 21263 496 1158 --
NM_004844chr33261 153 62 ------
NM_004845chrX53476 3385 3000 444 408 --1720 --
NM_004849chr621635 1327 --11334 --
NM_004857chr1433050 829 535 73974 3766 3059 1364 971 496 252 ----
NM_004859chr1742545 2318 1052 846 12373 --12972
NM_004863chr1484977 4853 4717 4327 1946 1836 590 113 24263 4051 --13897
NM_004865chr61296 ----1314
NM_004867chrX1113 --2448 192 --
NM_004869chr1831608 1449 80 1394 ----
NM_004871chr1734276 3046 245 ------
NM_004872chr11168 --1294 --
NM_004874chr81418 ------
NM_004887chr541112 1065 407 398 1154 ----
NM_004893chr51155 ------
NM_004898chr422520 274 11904 12268 12647
NM_004902chr201824 ------
NM_004904chr745444 4265 1366 691 16469 21104 765 --
NM_004912chr721214 434 ------
NM_004921chr131861 1810 955 11013 2525 113 --
NM_004926chr1411189 ------
NM_004927chr111913 11412 ----
NM_004932chr5----11298 --
NM_004947chr312480 ------
NM_004948chr184573 443 116 52 ------
NM_004949chr1832151 2078 1759 ----12012
NM_004956chr774410 3836 1778 1464 1390 1228 67 1511 ----
NM_004973chr641706 1437 1137 267 ------
NM_004985chr1254315 3585 2858 2770 1363 13089 22830 1183 --
NM_004992chrX88345 8124 8015 7209 6579 5570 5498 2799 --16370 --
NM_004992chrX88345 8124 8015 7209 6579 5570 5498 2799 --16370 --
NM_004993chr1421458 1396 11522 ----
NM_004999chr694220 4164 4071 2777 1711 1379 733 680 309 ----13703
NM_005010chr72731 422 --2586 476 --
NM_005011chr721717 211 ------
NM_005020chr71582 ------
NM_005023chr521358 1224 --11105 --
NM_005025chr31200 ------
NM_005028chr101865 --1851 --
NM_005034chr83680 576 67 ------
NM_005037chr32204 144 ------
NM_005045chr73858 839 47 ------
NM_005054chr22633 601 1624 ----
NM_005056chr1275485 5476 5096 4114 3460 652 339 --14848 --
NM_005063chr1043710 1296 274 230 1252 11101 --
NM_005065chr1485409 4371 4227 3865 1753 1658 1490 999 ------
NM_005079chr873126 1288 1277 704 420 322 77 --2905 525 --
NM_005080chr221136 ------
NM_005095chr132085 1560 826 21888 1868 ----
NM_005096chrX31265 1168 890 ------
NM_005105chr122001 228 ------
NM_005109chr33729 443 58 1646 22056 626 --
NM_005112chr4----1847 --
NM_005114chr43471 222 201 --1445 --
NM_005116chr2054469 4199 3332 1741 1113 --44157 1827 1093 232 --
NM_005121chr1793732 3685 3199 3163 2807 1173 702 596 136 1858 ----
NM_005133chr111378 ------
NM_005134chr184906 644 619 126 --1347 --
NM_005135chr1543453 3132 716 686 --23741 2455 --
NM_005139chr41319 --1131 --
NM_005140chrX2911 821 ------
NM_005151chr1861887 1711 712 551 484 476 ------
NM_005153chr164635 574 513 220 --1310 --
NM_005154chr153494 419 182 ------
NM_005156chr9165371 5186 4921 4629 4437 4273 4263 3306 2057 1631 1590 1563 1332 1313 1184 864 --14669 --
NM_005160chr2246154 6135 4563 365 15461 11725 16530
NM_005168chr211346 ----11188
NM_005171chr1221313 1173 ------
NM_005180chr1071632 1532 1486 1453 1412 1188 195 21119 551 1281 --
NM_005188chr1187402 6689 6631 5941 5432 2879 2851 2181 1774 11299 --
NM_005197chr1466112 6061 5044 4843 4764 2463 1736 1301 --
NM_005207chr2223351 101 --1301 --
NM_005208chr17----193 --
NM_005222chr72919 834 ----1673
NM_005230chr12190 ------
NM_005233chr352091 1776 665 656 217 1580 1877 --
NM_005235chr257354 7269 5076 2270 2204 14880 ----
NM_005238chr1132399 644 365 182 12169 --
NM_005239chr2131865 481 139 ------
NM_005242chr521295 1245 1136 1978 --
NM_005243chr221268 ------
NM_005249chr142196 50 1807 ----
NM_005252chr144779 767 559 233 --2756 582 --
NM_005254chr1551385 1253 1135 1011 254 ------
NM_005257chr1821147 520 ------
NM_005259chr221259 972 1408 ----
NM_005261chr81109 ------
NM_005277chr441405 630 446 284 ------
NM_005279chr24851 629 116 76 ------
NM_005296chrX2238 151 ------
NM_005316chr1131001 855 316 ----1812
NM_005324chr1741582 839 184 84 1203 ----
NM_005329chr1622273 1552 ------
NM_005336chr21102 ------
NM_005339chr473468 3201 2932 1727 1669 993 380 ------
NM_005342chrX42636 2512 918 710 11785 ----
NM_005358chr1351746 1706 350 153 52 1599 11540 --
NM_005359chr1864510 4009 1479 1095 441 371 34927 1963 799 34647 2381 2080 --
NM_005369chrX----1437 --
NM_005374chr1712276 ------
NM_005375chr62894 872 ------
NM_005378chr2168 1551 ----
NM_005382chr81106 ------
NM_005385chr332622 2517 1841 1130 ----
NM_005386chr201789 ------
NM_005387chr11----1548 --
NM_005388chr921200 263 11585 258 34 --
NM_005398chr1021269 66 --1426 --
NM_005400chr233074 3020 137 --12577 --
NM_005402chr741722 1281 110 61 ------
NM_005406chr1831286 177 127 ------
NM_005429chr41284 ------
NM_005433chr1842637 2438 895 336 22698 358 ----
NM_005436chr1073395 3060 1473 1228 1001 587 136 13343 ----
NM_005455chr121337 649 --1229 --
NM_005460chr51490 --149 --
NM_005465chr121847 238 --1312 --
NM_005474chr17136 ------
NM_005475chr1233225 3155 213 13290 ----
NM_005476chr921091 954 ----11240
NM_005477chr151352 ------
NM_005477chr151352 ------
NM_005487chr2251854 1749 1689 1605 836 --22043 44 --
NM_005493chr61812 1557 1131 --
NM_005494chr73545 220 175 ------
NM_005497chr1766015 5345 4463 1331 1266 510 ----16066
NM_005499chr191164 2580 64 ----
NM_005502chr942961 2939 2093 2013 --1473 22665 721
NM_005504chr1296233 5796 5229 2629 2360 2212 1650 611 146 26167 5414 ----
NM_005509chr541668 1652 694 191 ------
NM_005513chr331472 1336 1178 ------
NM_005517chr111465 --1151 --
NM_005520chr52738 711 1257 ----
NM_005522chr7--1890 ----
NM_005536chr841109 997 542 32 1944 11045 --
NM_005537chr131951 --160 --
NM_005542chr711919 ------
NM_005544chr22919 409 ------
NM_005559chr18------135
NM_005562chr141389 1191 477 172 11498 ----
NM_005563chr11612 ------
NM_005570chr1841065 1035 325 78 ------
NM_005578chr354853 4548 3480 1168 829 13923 --13393
NM_005582chr53451 103 49 ------
NM_005595chr11845 1963 ----
NM_005596chr955996 5771 5349 5066 4687 26347 4389 --15120
NM_005598chr131274 246 221 11266 ----
NM_005600chr1----1229 --
NM_005604chr651893 1827 1026 1001 98 ------
NM_005611chr1621214 1116 --11241 --
NM_005613chr131533 293 104 --11665 --
NM_005614chr71370 1324 1758 --
NM_005625chr81288 ------
NM_005626chr11550 1134 ----
NM_005627chr61137 --2747 662 --
NM_005638chrX3693 301 212 1395 ----
NM_005647chrX73478 3137 2811 1220 877 648 458 12556 ----
NM_005651chr41103 --1292 --
NM_005665chr164894 3872 3138 3000 496 204 ------
NM_005668chr574600 4573 3406 2914 2857 1712 1479 14480 14463 --
NM_005669chr541994 1890 1689 575 1264 ----
NM_005711chr51821 --1257 --
NM_005717chr131053 456 43 ----1402
NM_005721chr21695 ------
NM_005722chr22943 54 12227 ----
NM_005725chr11794 ------
NM_005733chr51244 ------
NM_005734chr111530 ------
NM_005737chr212347 ----11843
NM_005744chr152190 132 ------
NM_005746chr732606 489 342 12538 ----
NM_005748chr124952 582 442 162 1520 1883 12165
NM_005751chr71181 ------
NM_005752chr161461 --21231 1047 --
NM_005754chr52836 461 ------
NM_005756chrX31257 1150 1069 21235 1111 11103 --
NM_005759chr254772 3135 1763 1070 394 --1731 --
NM_005766chr131252 ------
NM_005776chr141566 ------
NM_005780chr131241 1278 ----
NM_005795chr252703 1940 661 394 328 21851 609 ----
NM_005807chr12237 182 ------
NM_005808chr352557 1411 1133 871 670 ------
NM_005819chr162354 2223 795 592 342 78 2863 848 1474 --
NM_005822chr642082 1461 891 814 --21603 928 --
NM_005826chr1--1521 ----
NM_005828chr1754497 3650 3485 1940 1550 --1110 --
NM_005829chr1521224 769 1573 ----
NM_005832chr32929 390 ----11162
NM_005833chr91173 ------
NM_005836chr8--133 ----
NM_005839chr11158 2112 65 ----
NM_005840chrX85439 5269 5113 2937 2310 2229 2167 1582 --12512 --
NM_005841chr421080 411 ------
NM_005842chr133714 606 235 ------
NM_005843chr231690 1353 1319 ------
NM_005845chr1341073 536 345 71 --1429 --
NM_005857chr121498 401 ------
NM_005859chr521458 423 ------
NM_005860chr192280 62 1335 ----
NM_005868chr772472 1882 1732 831 625 264 123 1907 ----
NM_005869chr51275 --167 --
NM_005870chr13181 1937 ----
NM_005871chr101110 ------
NM_005875chr32320 259 ------
NM_005880chr1621517 350 --11132 --
NM_005884chr191816 ------
NM_005885chr51265 ------
NM_005891chr6------1195
NM_005898chr1153073 2692 2412 2224 847 23143 1024 ----
NM_005900chr421226 216 ------
NM_005901chr18138474 7976 7661 6791 6374 6122 5595 5561 5273 1758 1483 1160 62 21436 1259 58559 6462 5819 5281 3139 --
NM_005902chr1524551 3137 14564 189 --
NM_005903chr565218 3912 3676 3222 2056 287 34435 3232 31 21135 470 --
NM_005904chr1821192 205 ------
NM_005906chr621142 191 --132 --
NM_005909chr532902 2657 1538 1179 ----
NM_005924chr721027 914 2455 302 ----
NM_005933chr1142860 2489 2292 243 ------
NM_005934chr1912570 ------
NM_005935chr4105259 5236 4855 4093 3878 3383 2008 1289 656 599 14589 ----
NM_005940chr221688 ------
NM_005941chr883698 1468 1399 1358 880 848 798 145 --11568 --
NM_005944chr331213 1078 1030 1759 ----
NM_005955chr165441 4087 4031 3614 1332 414 --11641 --
NM_005962chr1011545 11564 --1680
NM_005962chr1011545 11564 --1680
NM_005964chr173236 226 175 ------
NM_005966chr231764 1574 771 11733 ----
NM_005977chr13--1223 158 --
NM_005986chr1342495 2371 678 654 --1387 --
NM_005994chr17----1677 --
NM_005996chr1231274 1082 992 ------
NM_006007chr964032 3165 1423 1302 1100 1074 13362 --1717
NM_006015chr12879 482 ------
NM_006016chr631665 607 179 ------
NM_006036chr232156 1601 629 ------
NM_006037chr264333 1946 1749 1108 901 688 --11575 --
NM_006039chr1711082 ------
NM_006040chr1611320 ------
NM_006047chr20113476 3394 3305 2202 811 571 524 509 100 64 40 --22262 184 --
NM_006060chr774277 3700 3568 3518 3059 3023 1754 11199 ----
NM_006070chr3----1129 --
NM_006076chr722343 964 --1519 --
NM_006080chr752918 1896 1099 363 325 11938 1819 --
NM_006086chr162279 198 ------
NM_006089chrX21241 295 11592 ----
NM_006090chr11566 --1527 --
NM_006095chr423753 3138 24509 2896 ----
NM_006100chr31115 --1224 --
NM_006106chr1163247 3112 2988 2768 652 181 13412 1165 --
NM_006129chr81370 ------
NM_006133chr1112407 ------
NM_006134chr213387 174 77 11330 ----
NM_006135chr11522 --11188 --
NM_006136chr731231 1145 55 ------
NM_006141chr1612545 12484 --1559
NM_006147chr12336 64 --1456 --
NM_006152chr121235 ------
NM_006153chr34572 521 224 98 ------
NM_006154chr1532898 1958 1815 ------
NM_006158chr821419 1297 11558 11236 --
NM_006162chr1841348 1314 1159 501 ------
NM_006164chr22412 340 ------
NM_006166chr1251824 956 281 274 250 --12451 --
NM_006178chr1731596 1521 579 ------
NM_006180chr921566 566 ------
NM_006186chr221138 452 2327 182 ----
NM_006190chr22781 366 ------
NM_006194chr1421120 394 --11233 --
NM_006195chr911014 --1241 --
NM_006197chr862053 1963 1919 775 475 252 11606 ----
NM_006203chr551357 1235 925 382 49 --24114 795 15319
NM_006206chr442281 1946 350 72 ------
NM_006209chr8156 ------
NM_006212chr1105430 5061 4023 3687 3631 3553 3281 1669 1064 536 --12020 14061
NM_006218chr31277 ------
NM_006226chr241333 968 420 378 --11257 --
NM_006241chr32124 28 12348 164 --
NM_006246chr1411297 1292 1235 --
NM_006251chr543273 3224 2481 203 22625 2398 12947 11080
NM_006252chr1107568 7279 7018 5741 5420 4616 2353 2109 2078 28 25945 5193 11019 26011 2334
NM_006254chr31305 ------
NM_006256chr141720 948 611 184 1770 ----
NM_006258chr101270 ------
NM_006259chr41310 1929 ----
NM_006265chr841502 1483 1408 1011 11338 ----
NM_006281chr83818 317 310 ------
NM_006281chr83818 317 310 ------
NM_006282chr20134707 4645 4385 4304 4172 3365 2908 1600 1299 960 924 335 302 --1893 --
NM_006283chr834978 4741 4675 21945 453 11092 --
NM_006287chr242379 1040 181 159 ------
NM_006292chr11186 ------
NM_006300chr1952449 1913 1681 396 170 1643 1136 --
NM_006306chrX44823 1731 1646 1410 11485 --12016
NM_006307chrX137 ------
NM_006310chr1711300 ------
NM_006315chr474393 3917 1343 821 624 563 76 ----12951
NM_006317chr52767 170 ------
NM_006320chr41927 ------
NM_006322chr133893 845 42 ------
NM_006323chr42603 280 --1622 --
NM_006325chr12----1189 --
NM_006329chr142255 164 --1236 --
NM_006330chr82424 43 ------
NM_006350chr5196 ------
NM_006352chr171917 1906 1664 1656 1574 644 315 ------
NM_006359chrX42214 1558 961 885 ------
NM_006364chr1441253 1218 316 97 ------
NM_006366chr611334 1469 11169 1351
NM_006371chr343920 3855 1991 1217 14905 35323 5189 5000 --
NM_006377chr921181 444 ----11260
NM_006380chr1774359 4262 3931 3748 2992 1682 1455 14384 ----
NM_006386chr2262168 2000 1971 690 567 421 --11827 --
NM_006389chr112392 361 ----11369
NM_006393chr1094378 4294 4215 4033 4025 3517 2980 2867 1347 14557 ----
NM_006403chr631704 1652 414 ------
NM_006410chr112479 413 ------
NM_006415chr911232 1120 ----
NM_006421chr82913 432 ------
NM_006434chr1043199 3126 2894 2492 23045 846 ----
NM_006439chr41582 ------
NM_006459chr1021714 1698 ------
NM_006464chr284472 4136 3885 3458 1754 1245 1206 431 --23204 247 --
NM_006467chr532203 2050 1801 22182 359 ----
NM_006482chr1253906 3500 1275 830 732 12734 32612 919 45 --
NM_006489chr1422017 26 ------
NM_006504chr1022876 2412 --12458 --
NM_006520chrX21640 1465 --11075 --
NM_006526chr2032106 1547 586 1601 ----
NM_006534chr2063433 3323 3155 2556 2183 530 --21078 79 12835
NM_006538chr254069 3845 3353 2989 544 ------
NM_006544chr1465582 1874 1631 1254 1053 301 1466 13721 --
NM_006546chr1775769 2410 2378 2220 1564 1300 263 1502 26542 532 --
NM_006547chr73601 385 55 21787 402 ----
NM_006557chr92367 346 11713 11133 --
NM_006561chr1075812 5468 5035 4861 3977 3841 1312 11271 2257 128 --
NM_006565chr1621114 866 ------
NM_006572chr1743404 2880 1146 545 --22811 939 --
NM_006577chr22990 899 ------
NM_006582chr1170 ------
NM_006585chr21--1141 ----
NM_006595chr113624 505 83 ------
NM_006597chr111171 --128 --
NM_006599chr1698059 7764 7618 7426 7170 6763 5195 2408 1569 77877 6660 2919 2846 2418 342 269 26429 401 25187 3143
NM_006601chr121182 ------
NM_006603chrX21630 471 11614 ----
NM_006614chr363484 2721 1183 1099 895 210 1344 1782 12248
NM_006620chr634007 1270 1231 24554 3844 ----
NM_006624chr1062055 2042 1964 1691 1610 80 ------
NM_006625chr11962 --1739 --
NM_006625chr11962 --1739 --
NM_006625chr11962 --1739 --
NM_006628chr1543756 3064 1445 989 --14090 14296
NM_006629chr1822110 176 ----12498
NM_006633chr51786 ------
NM_006636chr21345 ----1770
NM_006646chr1341977 422 239 123 12174 ----
NM_006653chr62392 99 ------
NM_006654chr1264781 4012 3902 3747 1351 791 --2956 805 1375
NM_006660chr151307 ------
NM_006667chrX21119 1008 ------
NM_006670chr61673 ------
NM_006682chr752895 1997 1071 322 288 ------
NM_006699chr142564 1856 439 287 1862 ----
NM_006704chr134403 314 65 52 ------
NM_006713chr52835 735 ------
NM_006717chr962926 2234 2114 912 369 73 23005 1101 32408 2224 1049 --
NM_006718chr621057 896 ------
NM_006722chr322373 2128 --1948 --
NM_006726chr421212 1036 1137 ----
NM_006729chrX65121 1461 1028 915 649 159 ----1667
NM_006734chr62592 535 ------
NM_006735chr71329 ------
NM_006745chr411038 --169 --
NM_006748chr82281 55 ------
NM_006750chr16158121 8029 7090 6655 6555 5977 5690 5560 4920 2982 1717 1706 1098 843 458 --3356 319 300 --
NM_006754chr721181 885 1928 1494 --
NM_006756chr831319 1156 1038 ------
NM_006759chr22303 233 ------
NM_006761chr173840 561 75 ------
NM_006766chr821066 103 1555 11928 --
NM_006775chr652901 2724 2242 583 169 --12132 12766
NM_006777chrX52697 2396 1117 991 632 ------
NM_006788chr1842011 1305 854 197 --12121 --
NM_006791chr155628 587 510 259 204 ------
NM_006805chr51521 11339 ----
NM_006807chr1711342 --11020 --
NM_006813chr62262 199 ------
NM_006826chr221154 1147 2926 893 ----
NM_006832chr1411036 ------
NM_006838chr1251813 1237 734 385 319 ------
NM_006851chr1222953 2066 ------
NM_006870chr202732 666 ------
NM_006873chr222710 1193 12416 ----
NM_006874chr4------1370
NM_006885chr1684250 3359 3076 2788 2680 866 555 250 --1540 --
NM_006888chr1422158 1064 --2804 635 --
NM_006902chr142502 1159 702 92 --13319 --
NM_006908chr72538 488 --1342 --
NM_006910chr161125 ------
NM_006914chr91359 ------
NM_006915chrX3974 491 137 --2681 391 --
NM_006918chr1195799 4540 4291 3618 2250 1051 725 431 374 35881 4596 1210 25782 933 --
NM_006920chr221839 37 ------
NM_006922chr262009 852 815 289 206 35 21950 1944 ----
NM_006924chr1754164 3949 665 624 211 ----22762 893
NM_006930chr541298 1239 733 444 1770 11769 --
NM_006931chr1251938 1565 1515 1322 309 12140 ----
NM_006936chr212886 511 1205 21121 41 --
NM_006937chr172446 192 ------
NM_006940chr1221543 690 --11331 --
NM_006948chr2122426 1571 1814 ----
NM_006981chr921863 372 21957 278 12933 --
NM_006996chr121670 634 ------
NM_007005chr971554 1519 1161 1134 1120 512 113 ------
NM_007007chr1274778 3605 3068 1789 1734 550 196 ------
NM_007008chr24924 884 747 95 ----1841
NM_007011chr1565576 4437 4278 1019 277 212 11497 --1219
NM_007013chr82399 183 ------
NM_007014chr1621767 1736 ------
NM_007017chr51924 1743 ----
NM_007023chr22885 84 ------
NM_007026chr17------1187
NM_007033chr132248 632 588 ----154
NM_007042chr352686 1932 1067 691 539 ----1532
NM_007054chr533907 214 205 ------
NM_007061chr221368 ------
NM_007064chr311518 --1600 --
NM_007068chr223858 184 23 11043 ----
NM_007111chr133740 688 155 ------
NM_007114chr31138 12461 --12563
NM_007124chr661913 1874 1627 1568 666 208 11487 ----
NM_007137chrX65516 4340 1847 1586 724 107 35317 3542 303 ----
NM_007146chr17102359 2331 2316 1117 985 884 702 668 488 464 --1237 --
NM_007147chr191916 ------
NM_007159chr341665 1617 1607 1446 --1139 --
NM_007166chr1131587 1275 1229 1214 ----
NM_007172chr2263234 3206 2476 2229 38 29 ------
NM_007173chr1131496 682 67 ------
NM_007178chr122465 439 ------
NM_007185chr121095 997 ------
NM_007192chr142933 263 ------
NM_007195chr1843637 2475 2465 327 --22566 1452 1907
NM_007197chr12--1872 ----
NM_007203chr963791 3317 2769 2418 1284 311 ------
NM_007204chr12225 159 --1503 --
NM_007212chr131756 1395 592 ------
NM_007217chr31137 ------
NM_007220chrX54646 4368 4275 3915 1197 34940 4001 65 ----
NM_007222chr821567 390 1455 --11587
NM_007235chr123343 212 114 --1101 --
NM_007236chr1522445 775 22159 2045 12115 --
NM_007249chr1399231 8198 8170 8045 7721 7211 2210 1689 662 11699 29270 249 --
NM_007269chr13432 185 68 ------
NM_007282chr31918 ------
NM_007315chr221549 1391 ------
NM_007345chr182315 145 11556 1197 --
NM_007353chr742717 2591 2401 575 12819 ----
NM_007357chr11208 ------
NM_007358chr161998 1555 1479 753 560 540 ------
NM_007359chr1731731 1075 700 ------
NM_007363chrX2866 200 ------
NM_007372chr172736 654 1677 ----
NM_007373chr1061477 1365 1263 1130 478 393 ------
NM_007375chr1----12344 12120
NM_009585chr31886 ------
NM_009585chr31886 ------
NM_012062chr12194 ------
NM_012064chr121906 ------
NM_012073chr541220 1051 496 207 187 ----
NM_012081chr562959 2441 626 510 261 68 23066 910 13087 --
NM_012082chr81995 ------
NM_012090chr131179 1084 799 194 1506 --
NM_012096chr373497 2674 1248 853 839 594 316 12328 ----
NM_012115chr6135 ------
NM_012120chr662908 2701 2278 878 697 246 1748 ----
NM_012124chr112956 916 1759 ----
NM_012137chr122213 146 22570 801 ----
NM_012141chr1334062 3971 690 23809 1637 1100 11664
NM_012155chr19161 ------
NM_012156chr201872 ------
NM_012158chr1321237 138 11151 ----
NM_012161chr421084 1069 ------
NM_012164chr987357 6520 5886 5323 5140 4797 1847 363 --26971 1414 --
NM_012175chr114745 165 119 81 ------
NM_012177chr61464 122 ----
NM_012193chr1164544 3494 2107 1620 1261 895 25313 4292 11053 --
NM_012197chr911530 ------
NM_012199chr164574 3542 3465 1612 1285 596 --13276 --
NM_012207chr1011128 ------
NM_012214chr275780 5701 5684 5085 2234 1898 1047 2998 292 14128 --
NM_012215chr1041926 1459 1431 190 ------
NM_012218chr19----23095 125 --
NM_012223chr251187 1130 843 445 80 ------
NM_012234chr333173 2513 1082 --1211 --
NM_012238chr1031359 140 30 ------
NM_012242chr10--1321 ----
NM_012243chr14759 694 277 172 ------
NM_012247chr1041015 1006 162 94 1236 ----
NM_012248chr16140 ------
NM_012249chr242486 1395 420 403 13081 22464 2314 --
NM_012250chr1111311 11173 ----
NM_012252chr7115055 4984 4829 4415 4388 3378 2015 1866 466 453 83 15244 11251 15214
NM_012255chr203394 337 164 ------
NM_012262chr195127 3818 3779 3415 3335 967 933 169 83 15214 24938 4700 13446
NM_012281chr7----12350 --
NM_012286chrX2498 248 1192 ----
NM_012287chr354464 4207 3753 1020 933 --33540 1558 752 --
NM_012289chr19----152 --
NM_012290chr221542 1527 ------
NM_012294chr742663 848 706 95 --3753 277 72 --
NM_012297chr472564 2517 2450 2311 2155 1884 959 ----1193
NM_012300chr55963 807 560 366 287 22524 2458 11587 --
NM_012301chr731974 670 489 ------
NM_012302chr131155 866 376 ------
NM_012309chr1133533 3431 3297 ------
NM_012316chr174473 3980 1739 1631 1535 652 599 11953 ----
NM_012323chr2221520 1056 ------
NM_012325chr2031342 661 476 --11520 --
NM_012326chr21750 ------
NM_012328chr731017 586 429 21072 496 ----
NM_012329chr1741312 1238 378 76 --11109 --
NM_012330chr1021572 1549 1657 ----
NM_012347chr63624 269 171 ------
NM_012382chr544446 3638 3519 1613 1708 13988 11171
NM_012399chr2231735 1610 1400 11770 ----
NM_012402chr112434 190 --1486 1155
NM_012425chr1052482 2175 2072 979 307 1182 ----
NM_012432chr1167 ------
NM_012464chr472587 1951 1847 937 923 676 430 22855 2845 12836 --
NM_012467chr161101 ------
NM_012482chr12598 500 1562 ----
NM_012486chr11426 ------
NM_013229chr1252857 1966 945 113 101 ----12099
NM_013230chrY3612 557 495 --1547 --
NM_013231chr1454241 4174 4038 3503 251 ------
NM_013233chr231467 1409 261 21352 938 21245 406 --
NM_013261chr453716 3699 3134 2791 77 22902 1056 ----
NM_013262chr631273 923 484 ------
NM_013269chr1244174 3883 3002 1496 13199 24335 688 --
NM_013280chr111284 --1223 --
NM_013281chr2021403 1290 ------
NM_013283chr53864 853 317 ------
NM_013293chr72196 153 ------
NM_013305chr18----1125 --
NM_013309chr1532318 1993 439 1574 ----
NM_013314chr101186 --130 --
NM_013316chr71302 1431 ----
NM_013320chr121129 ------
NM_013326chr18151 ------
NM_013341chr262813 1925 1812 1007 753 494 ------
NM_013358chr141664 1609 1268 324 1666 ----
NM_013361chr191162 --2593 138 --
NM_013371chr11316 ------
NM_013374chr323120 907 32883 795 737 13068 1494
NM_013377chr123569 543 507 ------
NM_013386chr1----21655 725 --
NM_013390chr91149 ------
NM_013400chr71829 2956 940 ----
NM_013411chr132254 1958 405 ------
NM_013437chr841419 1011 253 221 --11056 --
NM_013438chr921541 398 11661 ----
NM_013444chrX1887 ------
NM_013446chr721393 1287 ------
NM_013448chr14143 ------
NM_013449chr1232869 2038 1078 --11137 --
NM_013943chr183288 2358 1211 1138 821 596 504 308 2485 363 ----
NM_013960chr81669 1653 ----
NM_013986chr221268 ------
NM_013989chr1454779 2028 1330 396 28 14137 ----
NM_013995chrX32614 787 676 22115 1672 1501 --
NM_013996chr72501 107 ------
NM_013996chr72501 107 ------
NM_013997chr72501 107 ------
NM_013997chr72501 107 ------
NM_013998chr72501 107 ------
NM_013998chr72501 107 ------
NM_014011chr282567 2364 2112 2103 979 911 893 780 ------
NM_014016chr33403 279 44 ------
NM_014021chr163428 3286 3120 2876 2663 2587 ------
NM_014023chr1052892 2777 1829 450 349 ------
NM_014028chr652439 1174 1049 701 444 1457 ----
NM_014043chr321665 411 11384 ----
NM_014048chr1675067 4938 4787 4654 920 803 172 --194 --
NM_014056chr321680 80 22356 748 ----
NM_014071chr201515 ------
NM_014089chr1362278 2224 2215 2088 1972 1761 ------
NM_014110chr121060 203 ------
NM_014112chr864443 2039 1962 1909 1669 429 15293 12052 24320 1872
NM_014117chr1642673 2189 1877 407 --12258 --
NM_014154chr321215 349 ------
NM_014155chr11147380 6765 6118 5878 5398 4722 2821 1619 1592 1561 1192 1057 1015 458 ----22540 557
NM_014170chr3----189 --
NM_014178chr141518 ------
NM_014181chr241083 937 790 512 12886 1818 --
NM_014191chr123928 328 56 --1970 --
NM_014211chr5----31721 430 161 --
NM_014217chr141534 691 317 69 11493 ----
NM_014228chr5----11114 11428
NM_014231chr1241379 840 144 32 --11567 --
NM_014240chr354066 3915 2609 1551 50 ------
NM_014243chr461839 760 584 535 491 159 1250 ----
NM_014250chr2251854 1749 1689 1605 836 --22043 44 --
NM_014251chr72793 179 1594 ----
NM_014253chrX31695 583 164 11960 ----
NM_014263chr1061455 1005 548 183 57 37 ------
NM_014267chr11--145 ----
NM_014268chr18132 ------
NM_014278chr42356 347 1461 1176 --
NM_014279chr92683 618 ------
NM_014280chr13941 898 377 ------
NM_014283chr131325 1280 1195 ------
NM_014294chr811203 1170 ----
NM_014296chr321049 631 11006 1413 --
NM_014309chr2295366 4990 4728 4175 2062 1452 1366 973 49 ------
NM_014317chr101262 ------
NM_014322chr131177 1131 982 ------
NM_014323chr222990 865 2754 721 ----
NM_014333chr1122507 1910 11794 12220 --
NM_014342chr1131223 923 591 ----1540
NM_014345chr64838 804 746 401 ------
NM_014350chr521216 182 --1442 --
NM_014363chr1361225 958 118 110 80 58 2948 100 ----
NM_014372chr151818 1618 528 411 256 21904 1712 ----
NM_014374chr71829 2956 940 ----
NM_014379chr851050 976 789 284 135 ------
NM_014382chr321590 662 --11557 11476
NM_014392chr431072 199 118 ------
NM_014393chr872349 2319 2273 2251 2096 1723 941 1450 --11730
NM_014399chr72741 243 1843 1178 --
NM_014415chr321085 225 11250 11475 --
NM_014421chr451453 1419 1344 361 354 31865 1500 464 --1494
NM_014423chr585076 4897 4750 3415 1897 1843 1592 1458 54091 3811 3699 1723 871 ----
NM_014445chr342420 2405 2363 622 31780 1538 237 ----
NM_014458chr121371 1185 ----11094
NM_014469chr11--1200 ----
NM_014478chr742119 1666 774 76 --11815 --
NM_014487chr4--1253 ----
NM_014488chr111264 --1591 --
NM_014515chr121393 --1387 --
NM_014547chr151311 ------
NM_014547chr151311 ------
NM_014548chr1541307 1107 463 188 1135 ----
NM_014552chr231423 1096 181 ------
NM_014554chr1272118 2056 1983 1967 1816 1766 1438 ----11564
NM_014570chr224935 814 657 102 ------
NM_014571chr152814 2586 2305 2189 2096 ------
NM_014575chr3--2213 71 ----
NM_014577chr222684 65 ------
NM_014592chr53772 685 38 ------
NM_014606chr4--21450 1128 ----
NM_014607chr21627 --134 --
NM_014608chr151221 --1435 --
NM_014612chr941202 1096 1086 586 ------
NM_014613chr543084 1100 700 316 22813 1234 ----
NM_014614chr231007 976 546 ------
NM_014615chr1623617 490 2845 713 --11196
NM_014616chr343436 1303 965 295 12487 ----
NM_014620chr121542 ------
NM_014630chr1523184 869 ------
NM_014636chr944293 1165 917 425 --23911 2687 --
NM_014646chr1863213 2564 2290 2246 2151 294 ------
NM_014647chr1631961 1923 1883 11999 ----
NM_014659chr1511060 1429 ----
NM_014660chr71807 --1310 --
NM_014666chr511190 11047 ----
NM_014670chr231497 617 155 --1539 --
NM_014671chr731073 456 254 --1197 --
NM_014677chr821372 166 ------
NM_014682chr83526 255 124 ----11679
NM_014683chr1731559 1535 594 ------
NM_014685chr161489 1441 ----
NM_014686chr1922504 907 --11896 --
NM_014693chr31166 ------
NM_014701chr151400 ----13050
NM_014702chr612732 ----12495
NM_014705chr752121 1843 577 542 166 11544 ----
NM_014707chr722248 2073 --11531 --
NM_014709chr21564 1600 ----
NM_014711chr1631765 1496 412 ------
NM_014712chr161210 ------
NM_014713chr21460 ------
NM_014717chr191677 1868 ----
NM_014720chr1031830 1576 1185 11840 ----
NM_014721chr6117422 6085 5587 5293 5159 5099 2208 1306 1082 369 76 11339 27059 1424 14987
NM_014726chr1711314 ------
NM_014729chr862019 1875 1812 876 722 62 1111 1204 --
NM_014730chr1211499 --25284 619 --
NM_014730chr1211499 --25284 619 --
NM_014733chr532071 705 28 ------
NM_014735chrX------1331
NM_014741chr1121855 498 11376 1766 --
NM_014743chr492768 2559 2538 2319 2299 2250 1195 357 27 1831 11262 --
NM_014751chr852168 2158 1757 1595 419 12066 11561 --
NM_014755chr2103952 3888 3217 2765 2670 1447 1260 1069 586 370 23709 1309 ----
NM_014756chr112296 141 ------
NM_014757chr5--12261 ----
NM_014765chr122678 2595 ------
NM_014772chr1832707 2455 723 --32834 2728 445 --
NM_014779chr31876 ------
NM_014781chr851140 947 803 485 297 21155 969 ----
NM_014783chr151552 1100 ----
NM_014790chr5150 ------
NM_014791chr91246 ------
NM_014795chr2--3417 180 50 ----
NM_014802chr122873 827 1389 ----
NM_014803chr1052510 2504 2120 1078 937 ----11913
NM_014810chr123427 969 --22978 1282 --
NM_014812chr111475 --11749 --
NM_014813chr12597 581 ------
NM_014819chr532447 2328 833 12389 --11716
NM_014820chr321997 525 ------
NM_014826chr144383 740 477 253 23223 1655 ----
NM_014827chr1----1214 --
NM_014828chr1412423 22009 1812 ----
NM_014830chr1253868 3806 2797 2767 1157 --13896 --
NM_014832chr1352110 1740 702 537 413 2743 212 ----
NM_014836chr1012033 --11303 --
NM_014839chr121019 850 ----12123
NM_014847chr11443 ------
NM_014871chr122489 170 ------
NM_014873chr173888 3658 1786 1717 1506 1194 901 --23586 2953 --
NM_014874chr13329 301 188 11200 21903 1799 --
NM_014877chr17117711 7080 6814 6576 6557 2924 2658 2190 1232 801 132 1253 ----
NM_014883chr432062 1776 155 11785 11566 --
NM_014888chr721258 173 2339 153 ----
NM_014892chr6----1173 --
NM_014893chrY31957 1745 1660 --1930 --
NM_014897chr1723017 1167 11187 11233 --
NM_014899chr532121 368 267 ------
NM_014903chr1222390 1948 22103 1869 ----
NM_014904chr1053979 3017 2968 2925 2541 11330 ----
NM_014905chr22227 138 ------
NM_014906chr1743872 3422 3090 2674 11628 ----
NM_014912chr1073057 3041 3024 2528 885 559 376 13420 --13163
NM_014913chr1841492 1430 1142 190 21385 1127 ----
NM_014918chr152494 430 1378 ----
NM_014920chr653754 2963 2329 2313 399 --13258 --
NM_014921chr1913087 --1896 --
NM_014923chr1321740 69 1151 ----
NM_014924chr1422223 999 --23147 481 --
NM_014926chr321121 330 ------
NM_014932chr341799 1711 212 199 ------
NM_014934chr131967 11211 13838 --
NM_014937chr1021355 984 ------
NM_014945chr511988 ------
NM_014946chr252559 2385 1211 944 606 --12152 --
NM_014947chr163104 3010 2872 2284 1262 626 22624 838 1758 --
NM_014950chr14----11755 --
NM_014951chr1052535 2362 1922 1786 558 --22546 1757 --
NM_014961chr442207 584 414 183 --1380 --
NM_014962chr2032683 2098 534 12263 12471 --
NM_014965chr322357 21 ------
NM_014974chr1031830 1204 412 --148 1478
NM_014978chr1021836 1786 --11456 --
NM_014982chr1455385 4569 4204 3652 298 13858 ----
NM_014988chr472469 2114 2056 1840 729 616 181 ------
NM_014989chr6--1150 2817 86 --
NM_014990chr142536 360 11082 ----
NM_014991chr433200 3110 870 ------
NM_014994chr1542413 1828 712 653 ------
NM_014996chr32986 658 ------
NM_014999chr1231688 1084 50 --11424 --
NM_015000chr1262734 2710 1979 1211 692 482 13100 ----
NM_015001chr11802 ------
NM_015008chr343593 2898 2674 2231 1844 33414 2928 22 --
NM_015009chr32754 679 ------
NM_015015chr1921452 369 --1471 --
NM_015018chr61186 ------
NM_015020chr1663899 3789 3218 2705 2615 702 --13199 --
NM_015024chr831465 1255 590 ------
NM_015025chr262638 2470 1685 934 539 519 22285 1047 12175 --
NM_015026chr1223735 608 11869 ----
NM_015027chr16138 21412 1335 ----
NM_015032chr1322752 2200 32898 2482 2472 ----
NM_015033chr942988 2508 993 876 ------
NM_015039chr153956 3020 1611 1489 605 14334 ----
NM_015040chr283243 2878 2597 2275 1313 1266 534 325 ------
NM_015042chr1513376 --44231 3790 3406 2695 --
NM_015045chr1032074 1498 1457 12276 ----
NM_015046chr91200 ----1465
NM_015049chr223236 414 ----12841
NM_015055chr1132860 845 532 ------
NM_015057chr131482 ------
NM_015061chr9--1675 ----
NM_015068chr743964 3920 3893 1597 23620 2563 23970 3431 12908
NM_015071chr564197 2144 1777 1754 1494 1306 1118 21569 434 --
NM_015074chr164083 3500 2001 1889 1866 1313 34421 3816 1396 21940 169 11048
NM_015075chrX42234 1740 761 301 ------
NM_015076chr664513 2765 1429 1222 231 145 --13956 --
NM_015091chr141702 ------
NM_015092chr1683134 3025 1825 1508 1422 1390 801 485 --23354 1096 --
NM_015093chr61594 ------
NM_015097chr331564 766 106 1429 ----
NM_015100chr11546 ----1455
NM_015107chrX3112 53 41 11854 ----
NM_015115chr473006 2602 2244 1063 451 261 68 12170 1175 --
NM_015130chr431303 1283 1202 ------
NM_015137chr832321 1967 357 32413 2291 2255 ----
NM_015143chr431298 1190 282 --1199 --
NM_015144chr1653072 948 297 174 81 --13589 12865
NM_015153chr61540 --1240 --
NM_015155chr1022348 717 12600 12546 13022
NM_015156chr1463896 3189 3013 2719 740 520 ------
NM_015158chr92235 52 ------
NM_015161chr1661443 1375 1353 1284 342 42 ------
NM_015170chr821866 1798 11590 ----
NM_015180chr142587 560 ------
NM_015184chr33645 628 209 ------
NM_015185chrX41919 871 703 433 --1351 --
NM_015192chr2042813 2160 2150 573 --1438 --
NM_015197chr1423313 592 13347 13321 --
NM_015199chr332649 905 248 ------
NM_015200chr461811 1776 981 753 634 284 1964 ----
NM_015203chr12191 68 ------
NM_015206chr1513549 13149 22363 461 --
NM_015208chr1831074 772 237 22987 104 11093 --
NM_015209chr131856 789 747 ------
NM_015213chr112703 552 ------
NM_015215chr11194 32874 2868 1076 138 --
NM_015225chr923057 688 --12702 --
NM_015231chr11--1687 ----
NM_015234chr641448 1325 1075 1062 1179 ----
NM_015236chr41289 ------
NM_015239chr91442 ------
NM_015245chr612490 22603 902 1270 --
NM_015247chr1654567 1186 156 89 51 ------
NM_015250chr91602 11733 ----
NM_015265chr242546 2164 2112 1784 ----12661
NM_015269chr11417 ------
NM_015271chr453607 2884 2778 1714 796 --11089 --
NM_015272chr1621950 1539 --12136 --
NM_015275chr1232072 1576 89 31638 1333 47 1635 1568
NM_015278chr6103346 3320 3276 3208 2928 2839 2773 1228 732 569 --23259 2258 --
NM_015285chr1872301 1665 490 465 300 86 61 1539 ----
NM_015286chr1552415 2248 2240 2184 594 22353 2192 ----
NM_015288chr573676 3044 2386 2368 1482 1182 273 ------
NM_015291chr163429 3278 2860 2775 2631 112 --22657 1181 --
NM_015294chr1721075 932 ------
NM_015296chr131346 1803 11254 1820
NM_015305chr1411586 11940 11373 --
NM_015308chr113666 206 35 ------
NM_015310chr8128322 8265 8109 7813 7759 6186 5168 2511 1778 1740 523 372 28060 822 ----
NM_015313chr1133792 3696 796 21601 1002 11560 --
NM_015314chr742471 1659 577 457 --1380 --
NM_015317chr252838 2722 1019 710 236 ------
NM_015323chr611639 --21561 653 --
NM_015328chr752799 2144 1146 1036 884 --12865 --
NM_015336chr1242523 1836 416 28 --1438 --
NM_015344chr822042 1689 3767 687 658 ----
NM_015347chr1292847 2760 2705 1987 1955 815 584 338 106 --12497 1345
NM_015349chr683086 2905 2389 2135 973 639 575 520 13033 ----
NM_015355chr1721683 490 --31740 730 656 --
NM_015358chr2131215 279 196 ----11083
NM_015359chr832982 2829 1878 ------
NM_015361chr21867 --1833 --
NM_015365chrX34135 954 119 24293 3755 ----
NM_015375chr144311 4117 933 307 14887 ----
NM_015378chr12805 416 ------
NM_015379chr7----1284 --
NM_015385chr1043199 3126 2894 2492 23045 846 ----
NM_015387chr241776 1389 812 272 ------
NM_015393chr473824 3797 2480 1331 1248 1222 642 ------
NM_015394chr1261748 1727 809 691 356 121 22440 2214 1427 12062
NM_015396chr321447 1206 1548 1475 --
NM_015397chr931890 1235 380 11854 1254 --
NM_015416chr122695 26 ------
NM_015419chrX2156 24 ------
NM_015423chr111586 31707 1332 1318 21540 1377 --
NM_015429chr33766 155 35 ------
NM_015435chr81150 --1268 --
NM_015439chr61507 ------
NM_015455chr542914 2861 1177 1084 ------
NM_015457chr111274 1332 ----
NM_015458chr875107 4865 4534 3371 3222 1779 903 1738 24753 1250 --
NM_015460chr342103 1733 541 133 ------
NM_015461chr182754 109 ----185
NM_015464chr721010 59 --1263 --
NM_015472chr32511 151 ------
NM_015472chr32511 151 ------
NM_015475chr221043 939 ------
NM_015477chr151956 ------
NM_015497chr152950 798 1448 1733 --
NM_015508chr3--1210 11521 --
NM_015514chr142552 517 ------
NM_015520chr332212 2078 1004 --12653 11757
NM_015525chr64918 768 381 247 ------
NM_015528chr171192 ------
NM_015532chr1532016 1994 88 11751 ----
NM_015534chr1------159
NM_015535chr264079 3131 2951 1624 1225 464 --24040 1373 --
NM_015542chr101773 ------
NM_015548chr6193 ----1773
NM_015550chr773307 956 686 658 488 191 126 11341 ----
NM_015553chr685182 4794 3861 3510 3451 1579 1449 889 --1310 --
NM_015554chr1582903 2706 2684 2370 2260 2066 1997 765 22471 324 ----
NM_015565chr211181 12151 11698 --
NM_015567chr1321115 1013 ------
NM_015568chr2044282 3927 3625 3177 --13105 --
NM_015569chr154062 3637 1587 299 69 14122 1154 --
NM_015570chr721714 408 1580 11531 --
NM_015575chr253624 3511 1426 992 542 --11403 --
NM_015576chr322877 102 ------
NM_015577chr51677 --182 --
NM_015578chr1942056 1556 1356 628 ------
NM_015602chr131459 390 46 ------
NM_015622chr7--1274 ----
NM_015626chr172986 321 11022 ----
NM_015630chr22872 859 ------
NM_015635chr932264 578 93 12212 --12156
NM_015640chr165053 4716 1635 1421 813 282 23663 1196 21954 1787 --
NM_015649chr191156 ------
NM_015652chr10----1617 --
NM_015676chr141364 ------
NM_015678chr1341672 1159 264 141 ------
NM_015693chr4160 3244 233 128 ----
NM_015695chr642041 1680 1374 515 ------
NM_015718chr6127 ------
NM_015866chr141474 1250 1141 47 ------
NM_015869chr32204 144 ------
NM_015878chr821659 747 --11796 --
NM_015879chr1898587 8000 7133 1624 1565 1278 1198 1150 817 18168 16522 26910 840
NM_015886chr865748 5742 4326 3834 2155 2147 24033 1757 --14073
NM_015888chr133147 1286 858 ------
NM_015891chr631780 1287 45 --1797 --
NM_015902chr8121 ------
NM_015904chr21599 ------
NM_015906chr134660 91 26 1287 14824 --
NM_015957chr111358 ------
NM_015980chr531382 258 205 ------
NM_015981chr51737 --128 --
NM_015990chr43938 860 97 11082 ----
NM_015995chr1555536 5146 5102 5096 1072 --11999 --
NM_015999chr1------1677
NM_016009chr154409 4358 3887 3147 1020 24601 4552 11048 11036
NM_016018chr871898 1748 1128 926 660 448 303 ------
NM_016019chr7157 1676 ----
NM_016021chr682658 2651 2591 1950 1123 499 307 77 --12971 --
NM_016025chr1641954 1630 660 356 11464 ----
NM_016039chr141148 --1142 --
NM_016045chr2021245 389 ------
NM_016048chr51340 --1916 --
NM_016060chr1721108 183 1153 ----
NM_016072chr1212171 --12275 --
NM_016073chr1521200 1065 1887 ----
NM_016075chr1362439 2305 2239 1238 997 735 22991 1038 ----
NM_016078chr172419 219 ----11039
NM_016083chr663722 3497 2654 1392 936 573 23789 3693 ----
NM_016090chr1121014 324 --122 --
NM_016096chr841605 763 570 554 --11366 --
NM_016097chr185985 884 694 301 242 1280 ----
NM_016098chr62362 42 ------
NM_016101chr1641387 1354 906 377 1310 ----
NM_016107chr53945 361 312 ------
NM_016120chrX2479 142 --1124 --
NM_016124chr111252 --11358 --
NM_016127chr82741 228 ------
NM_016131chr232116 1971 1868 --21843 1532 --
NM_016132chr1553275 2578 1138 1129 998 --13330 --
NM_016133chr241664 346 316 183 ------
NM_016141chr34617 552 219 208 ------
NM_016144chr53288 268 68 ----1165
NM_016147chr113985 788 278 --1176 --
NM_016152chr311230 ------
NM_016169chr101536 ------
NM_016192chr21187 ------
NM_016200chr71119 ------
NM_016206chr3148100 7671 6710 5508 3435 2889 2626 2540 2004 1889 1660 773 655 480 ------
NM_016224chr611654 ------
NM_016226chr122149 41 ------
NM_016227chr131325 1280 1195 ------
NM_016231chr171347 ------
NM_016235chr1621098 455 --21384 1176 11049
NM_016247chr31434 ------
NM_016248chr1393977 3958 3667 3049 2560 2552 2472 1001 293 ------
NM_016257chr123022 2574 ------
NM_016260chr277078 6962 6197 5944 5649 4922 215 11184 12909 24707 506
NM_016269chr4--1990 ----
NM_016271chr1832342 2106 309 12314 ----
NM_016272chr2222775 597 ------
NM_016275chr362783 2638 2370 810 774 47 21731 1708 ----
NM_016277chr641440 190 137 35 1330 ----
NM_016281chr1221018 345 --1100 --
NM_016284chr161791 ------
NM_016287chr12658 121 ----11526
NM_016290chr5----186 --
NM_016297chr293647 3421 3272 2773 2717 1263 905 313 182 13328 1111 --
NM_016300chr32367 116 ------
NM_016303chrX--2436 104 1148 --
NM_016308chr1143 11485 ----
NM_016312chr12195 ------
NM_016322chr9113175 2567 2561 2204 2183 1996 1277 1091 950 430 77 ------
NM_016329chr33481 475 370 ------
NM_016340chr51456 1311 --2101 83
NM_016351chr71429 ------
NM_016374chr141073 444 203 118 ------
NM_016374chr141073 444 203 118 ------
NM_016376chr1743476 2847 1550 815 --13779 --
NM_016377chr641799 1599 1376 350 21263 496 1158 --
NM_016395chr1541917 1744 1505 377 11901 ----
NM_016396chr1563015 2929 2129 802 627 72 ----12807
NM_016410chr9----2164 132 --
NM_016424chr174756 611 528 47 --1201 --
NM_016436chr20102669 2603 2390 2008 1952 1911 1744 1664 969 889 --12115 --
NM_016441chr261832 1808 882 864 435 413 1237 ----
NM_016467chr221122 345 --11314 --
NM_016470chr20--1500 ----
NM_016472chr1421357 998 1443 --1205
NM_016485chr622208 183 11967 ----
NM_016486chr11349 1370 ----
NM_016505chr11603 --1649 --
NM_016507chr1742233 1181 1125 306 --21058 965 --
NM_016513chr653754 2963 2329 2313 399 --13258 --
NM_016530chr1521585 1425 ----11269
NM_016531chr473887 3335 3210 3192 3116 3046 2895 13255 11691 --
NM_016542chrX31687 1476 1239 ------
NM_016559chr31296 --1500 --
NM_016569chr1231274 1082 992 ------
NM_016570chr12------1489
NM_016575chr12115488 5152 4848 4194 3960 3931 3596 2175 1513 1287 83 11783 ----
NM_016577chr353763 2876 2851 1106 51 11138 13917 --
NM_016603chr512229 --22210 255 --
NM_016607chrX41120 472 210 37 ------
NM_016614chr63291 103 35 ------
NM_016620chr121435 904 ------
NM_016626chr1841474 1370 684 526 1258 ----
NM_016631chr211904 ------
NM_016641chr1641572 1447 1354 206 ------
NM_016651chr1441092 979 844 143 ------
NM_016654chr1551385 1253 1135 1011 254 ------
NM_016655chr15145 ------
NM_016823chr1731249 477 469 ------
NM_016824chr1041891 1791 1619 43 --1428 --
NM_016831chr132272 1777 161 --11834 --
NM_016931chr111358 ------
NM_016936chr1632213 1835 1701 12183 ----
NM_017412chr831140 157 145 --1915 --
NM_017420chr1482990 2623 1509 1173 1093 763 394 187 ------
NM_017423chr412208 189 ----
NM_017435chr121698 1733 ----
NM_017440chr12155 1150 ----
NM_017447chr2164370 3942 1676 1091 1043 919 ------
NM_017450chr1711514 ------
NM_017452chr2021172 999 --11281 --
NM_017453chr2021172 999 --11281 --
NM_017454chr2021172 999 --11281 --
NM_017488chr211534 ------
NM_017489chr81177 ------
NM_017491chr4----1847 --
NM_017544chrX1219 ------
NM_017548chr352130 1343 866 357 134 ----1199
NM_017563chr376196 5934 2215 1110 518 476 25 25625 5297 15317 --
NM_017569chr13----1243 1145
NM_017580chr1021886 1874 11850 2626 305 --
NM_017594chr983085 3041 2863 2723 2664 1337 263 110 13263 ----
NM_017610chr151259 12085 ----
NM_017632chr4198 ------
NM_017633chr633336 3329 1187 ------
NM_017634chr82667 238 1437 ----
NM_017637chr9139193 9075 8336 8224 8193 6564 6048 3282 2463 2153 1807 1137 883 ------
NM_017643chr171557 --12318 1277
NM_017644chr3105079 4653 4622 4422 3544 3404 1288 924 838 603 --11666 --
NM_017645chr963098 3068 2550 2035 1036 443 12775 --12043
NM_017649chr101335 ------
NM_017650chr796063 5906 5868 5751 5113 4914 2243 1803 1712 ------
NM_017657chr23604 251 28 1787 ----
NM_017658chr1464632 3261 3251 1380 615 172 34229 4179 1654 195 --
NM_017661chr152832 296 --1797 1471
NM_017664chr132293 266 ------
NM_017666chrX11663 12226 --1168
NM_017672chr1541379 1070 378 82 1886 ----
NM_017676chr521891 27 ------
NM_017680chr92792 213 1776 ----
NM_017709chr151621 1519 942 675 538 13241 ----
NM_017714chr203699 286 110 ------
NM_017736chr1662691 760 753 440 404 56 11213 ----
NM_017737chr11272 --1171 --
NM_017738chr94230 152 70 24 ------
NM_017742chr1831404 1222 781 21724 1475 ----
NM_017745chrX2708 605 ------
NM_017747chr52315 131 ------
NM_017749chr111957 ------
NM_017752chrX11876 21711 373 ----
NM_017754chr654306 4213 4029 3257 665 ------
NM_017757chr1821099 815 ------
NM_017769chr1432394 2287 868 --22516 1052 12940
NM_017778chr831108 1082 168 ------
NM_017780chr83916 844 654 ------
NM_017787chr1022872 1879 --21964 411 --
NM_017798chr201357 ------
NM_017801chr392538 2430 2290 1930 727 399 261 92 46 --12214 --
NM_017811chr932796 2194 1923 23154 771 ----
NM_017813chr895769 5704 3900 1513 1213 1053 1038 629 185 ----1296
NM_017824chr1012587 12338 1199 --
NM_017831chr1822922 1515 24766 138 24796 4247 1246
NM_017845chr42246 39 --1677 --
NM_017847chr12632 186 ----12288
NM_017848chrX84158 4011 3816 3736 3082 1870 1610 769 --24375 726 --
NM_017856chrX32112 1564 833 ------
NM_017866chr82843 308 193 ----
NM_017890chr821736 77 11550 ----
NM_017902chr1055283 5262 4980 4725 93 ------
NM_017915chr1221223 438 --1145 --
NM_017919chr955537 5425 4372 1675 511 15706 35811 4129 3576 24491 914
NM_017925chr921955 153 --21262 324 --
NM_017926chr143302 260 41 1833 ----
NM_017938chrX22138 677 1863 ----
NM_017943chr14----1130 --
NM_017944chr1152909 1157 914 663 312 --11091 --
NM_017954chr71391 --41679 1434 89 47 --
NM_017972chr143302 260 41 1833 ----
NM_017988chr123936 647 364 ------
NM_017994chr742706 1933 438 345 22205 1820 ----
NM_017998chr951332 507 492 383 134 ----11063
NM_018004chr31387 --152 --
NM_018011chr132626 496 1469 1206 --
NM_018025chr19279 64 ------
NM_018028chr1921339 969 ------
NM_018032chr163918 877 337 ------
NM_018046chr51718 1595 21461 570 --
NM_018047chr51847 ------
NM_018048chr1242027 1957 1467 335 1689 ----
NM_018061chr151098 498 236 219 168 1192 ----
NM_018070chr12566 38 ------
NM_018071chr141151 --1222 --
NM_018084chr233075 881 514 ------
NM_018098chr311125 1269 ----
NM_018101chr131296 1266 80 ------
NM_018103chr12313 271 ------
NM_018120chr841462 1419 969 201 --157 --
NM_018121chr1022292 2252 1202 ----
NM_018126chr431251 1225 483 1209 ----
NM_018133chr332104 1987 877 12093 1296 1129
NM_018137chr111422 --1528 --
NM_018149chr171168 ------
NM_018155chr313453 1632 12261 --
NM_018156chr12805 416 ------
NM_018157chr1223070 30 ------
NM_018159chrX31644 1463 1081 ------
NM_018164chr12134 ------
NM_018171chr121262 --1298 --
NM_018176chr421115 1107 11558 1616 --
NM_018182chr1721605 1595 1409 ----
NM_018184chr3----11848 --
NM_018195chr111420 --21668 694 --
NM_018200chr154692 572 511 362 11744 1755 11992
NM_018206chr161720 ------
NM_018211chr132196 1688 861 ------
NM_018221chr21121 146 --163
NM_018227chr462729 2659 2269 2091 1998 1078 1893 ----
NM_018229chr1411071 ----1325
NM_018230chr11378 --124 --
NM_018243chr432767 1358 1170 --1765 13870
NM_018247chr632906 2542 1077 12043 --12632
NM_018254chr121543 567 ------
NM_018257chr204401 230 217 41 --12435 --
NM_018263chr222490 2087 --12415 --
NM_018287chr1011220 ----21181 878
NM_018293chr3--12080 21187 910 --
NM_018299chr893378 3256 2883 1316 1206 821 609 592 351 --22559 2498 --
NM_018312chr1161449 595 583 235 187 156 1653 ----
NM_018313chr342350 2342 1689 108 11715 ----
NM_018315chr451253 1198 619 568 515 ------
NM_018323chr431895 1575 400 21668 95 ----
NM_018326chr72809 539 ------
NM_018330chr1031227 685 106 ------
NM_018335chr141147 ------
NM_018339chr92686 462 --11723 11265
NM_018351chr1284724 3859 3802 3252 3178 1168 348 136 ------
NM_018361chr84631 566 75 40 ------
NM_018362chr1133807 3492 1117 --1515 21520 679
NM_018364chr143616 3234 1499 775 24054 1024 --23440 1136
NM_018365chr15199 ------
NM_018373chr1466225 5128 4720 2564 784 184 25262 1585 45804 4854 4265 4022 --
NM_018374chr775125 3882 3357 3266 1198 1048 941 ----21635 461
NM_018403chr363907 3294 2643 1592 847 252 --1840 --
NM_018416chr1232371 1000 434 --32617 2570 2345 --
NM_018429chr542731 2462 2108 676 --1591 12242
NM_018439chr181404 12645 ----
NM_018444chr842004 1592 1443 429 12285 ----
NM_018448chr12----1157 --
NM_018452chr6_random63166 2821 2683 1231 962 112 23364 1240 ----
NM_018466chrX1678 ------
NM_018469chr1731385 1287 1102 --11502 --
NM_018471chr22560 232 ------
NM_018482chr852595 2420 1874 1728 1006 22404 1630 ----
NM_018489chr132275 1748 357 --1225 --
NM_018490chr1141561 1538 1262 747 11687 1673 --
NM_018553chr1741202 604 375 309 ------
NM_018557chr241728 1429 1157 129 ------
NM_018559chr13------1223
NM_018566chr125071 608 ------
NM_018569chr431472 1090 353 ------
NM_018584chr121247 348 ------
NM_018602chr1521409 132 11588 ----
NM_018638chr1285127 4452 4099 3618 1828 937 808 457 1882 24515 2054 --
NM_018640chr1252546 2108 1794 587 376 ------
NM_018641chr71140 ------
NM_018650chr13676 484 282 ------
NM_018660chr822824 164 ------
NM_018662chr124245 1299 ------
NM_018667chr1622596 2313 --12386 --
NM_018682chr72597 565 ------
NM_018684chrX21249 882 ------
NM_018691chr51143 ------
NM_018695chr532236 1743 1531 ------
NM_018698chrX51854 1502 401 289 165 --11844 --
NM_018700chr551700 1286 1210 576 303 1630 ----
NM_018703chr161125 ------
NM_018710chr851400 1147 413 179 157 ------
NM_018712chr1131350 1326 47 ------
NM_018718chr742241 1697 818 560 --11582 --
NM_018719chr73547 322 146 ------
NM_018723chr16165 ------
NM_018840chr201461 ------
NM_018841chr133933 3231 649 --13906 --
NM_018844chr731957 305 179 ------
NM_018890chr72538 488 --1342 --
NM_018898chr522146 1523 12386 --22140 1595
NM_018899chr522146 1523 12386 --22140 1595
NM_018900chr522146 1523 12386 --22140 1595
NM_018901chr522146 1523 12386 --22140 1595
NM_018902chr522146 1523 12386 --22140 1595
NM_018903chr522146 1523 12386 --22140 1595
NM_018904chr522146 1523 12386 --22140 1595
NM_018905chr522146 1523 12386 --22140 1595
NM_018906chr522146 1523 12386 --22140 1595
NM_018907chr522146 1523 12386 --22140 1595
NM_018908chr522146 1523 12386 --22140 1595
NM_018909chr522146 1523 12386 --22140 1595
NM_018910chr522146 1523 12386 --22140 1595
NM_018911chr522146 1523 12386 --22140 1595
NM_018912chr5----1687 --
NM_018913chr5----1687 --
NM_018914chr5----1687 --
NM_018915chr5----1687 --
NM_018916chr5----1687 --
NM_018917chr5----1687 --
NM_018918chr5----1687 --
NM_018919chr5----1687 --
NM_018920chr5----1687 --
NM_018921chr5----1687 --
NM_018922chr5----1687 --
NM_018923chr5----1687 --
NM_018924chr5----1687 --
NM_018925chr5----1687 --
NM_018926chr5----1687 --
NM_018927chr5----1687 --
NM_018928chr5----1687 --
NM_018929chr5----1687 --
NM_018945chr622344 948 1852 23171 613 --
NM_018948chr141024 993 913 438 ------
NM_018958chr1523452 2867 13873 33353 1163 635 1977
NM_018970chr742813 2298 2154 446 23157 659 --1618
NM_018975chr163739 724 129 --2795 291 --
NM_018976chr1221954 494 1737 2996 316 --
NM_018981chr22905 367 ------
NM_018993chr2021476 251 ------
NM_018999chr1074834 4078 4007 3909 3508 1939 677 --14176 --
NM_019001chr364694 3548 3127 1625 938 750 --11559 --
NM_019006chr151172 --1625 --
NM_019022chr1842740 2227 1096 735 12855 12932 --
NM_019027chr412378 ----12511
NM_019045chrX2787 201 ------
NM_019050chr441774 1509 516 86 ------
NM_019063chr2------12266
NM_019067chrX54732 4585 1084 673 434 ------
NM_019072chr533974 3599 559 13704 11022 --
NM_019074chr15170 --162 --
NM_019080chr1321543 1020 ------
NM_019084chr1032340 2226 1798 1518 ----
NM_019091chr21865 268 37 11027 --
NM_019094chr1273430 3310 3048 2813 2796 853 369 1993 ----
NM_019098chr841744 1623 653 406 21408 232 --11816
NM_019106chr2222261 1274 13421 43452 2855 2557 775 --
NM_019114chr931731 664 431 ------
NM_019116chr1673757 3108 3064 2914 1195 430 51 --1819 --
NM_019555chr331314 581 331 ------
NM_019556chrX21483 1341 1319 ----
NM_019590chr102549 93 1196 ----
NM_019593chr202940 708 --22740 76 --
NM_019596chr2162873 2227 2121 1845 711 356 ------
NM_019600chr15--2770 564 ----
NM_019610chr131971 1581 1530 --1208 --
NM_019843chr221192 ------
NM_019860chr10--11626 11463 --
NM_019884chr19--1385 ----
NM_019895chr3179 ------
NM_019903chr1041891 1791 1619 43 --1428 --
NM_020066chr16847 764 704 668 153 33 ------
NM_020116chr441416 1262 142 47 --162 --
NM_020122chr244890 3735 1582 119 24474 817 ----
NM_020123chr1041283 1245 1073 475 ------
NM_020139chr441481 629 579 200 ------
NM_020141chr152396 2297 1749 891 569 1782 ----
NM_020148chr1853034 2909 1160 542 202 --1142 --
NM_020156chr72526 414 ------
NM_020159chr431655 1185 278 21558 500 11072 --
NM_020168chr1511350 --11013 --
NM_020177chr5103370 3284 3136 3014 2973 2474 905 420 199 111 ------
NM_020180chr181534 --1941 --
NM_020184chr222013 856 ------
NM_020189chr81133 ------
NM_020190chr11452 --1443 --
NM_020194chr22558 86 ------
NM_020198chr1721261 372 --21141 469 --
NM_020205chr122226 710 ------
NM_020209chr19189 ------
NM_020228chr1142352 1922 1615 615 ------
NM_020231chr31645 ------
NM_020235chr3126 ------
NM_020240chr532678 1038 462 12372 --11715
NM_020245chr635108 4608 3852 --13567 --
NM_020297chr1273408 2965 2915 2796 1302 391 171 12836 ----
NM_020311chr2--1495 ----
NM_020337chr472945 2801 2142 2095 999 437 33 11149 1481 --
NM_020338chr1013085 13688 1972 --
NM_020341chr2041880 1521 1314 502 11561 ----
NM_020342chr232580 2350 2128 --31768 948 81 --
NM_020346chr113492 394 50 ------
NM_020347chr331996 1780 1556 11713 --1404
NM_020351chr31143 ------
NM_020357chr31543 ----1550
NM_020362chr12333 317 ------
NM_020382chr1211643 ------
NM_020390chr384698 4635 1830 1448 1427 573 445 119 --13275 --
NM_020403chr1341262 619 256 235 --21674 715 --
NM_020422chr162639 350 ------
NM_020432chr721545 398 1732 22168 326 --
NM_020438chr911395 ------
NM_020440chr143314 2709 2389 1007 11110 ----
NM_020445chr73794 126 103 1309 ----
NM_020449chrX5677 645 488 201 143 1169 ----
NM_020453chr431607 1448 454 ------
NM_020455chr652653 2552 2489 2267 61 ------
NM_020456chr1322144 531 --1556 --
NM_020457chr162247 157 --166 --
NM_020463chr231361 335 186 ------
NM_020466chr644547 3980 3172 450 --1696 --
NM_020473chrX----11886 --
NM_020475chr81340 12365 ----
NM_020476chr81340 12365 ----
NM_020477chr81340 12365 ----
NM_020478chr81403 12428 ----
NM_020480chr81340 12365 ----
NM_020529chr142446 172 ------
NM_020532chr24924 884 747 95 ----1841
NM_020640chr31236 1884 ----
NM_020647chr832085 1485 495 ------
NM_020651chr231512 377 314 ------
NM_020654chr331585 1470 164 1615 ----
NM_020659chr19----1578 --
NM_020666chr51589 ------
NM_020673chr2077691 7563 7355 6298 2492 2015 867 --25460 911 --
NM_020689chr2021716 493 ------
NM_020696chr31304 ------
NM_020699chr165237 3546 2177 1422 1313 505 ------
NM_020708chr2022449 2218 ------
NM_020717chrX54877 4577 4167 1739 1026 1843 21288 728 --
NM_020718chr1685507 5341 4376 2483 1993 1859 1563 172 25688 4073 ----
NM_020727chr2133996 2498 1568 1117 23974 1197 1757
NM_020728chr742805 983 770 139 11193 ----
NM_020734chr1273391 3178 2807 2655 789 662 389 22757 262 --12684
NM_020739chr1534189 3890 3032 --13674 --
NM_020742chrX42024 1811 1754 737 --12162 --
NM_020747chr54857 769 164 22 ------
NM_020750chr631458 1406 1276 ------
NM_020751chr1321264 197 ------
NM_020752chr1042650 2391 2250 494 1632 ----
NM_020755chr631638 1319 39 ------
NM_020760chr231776 1648 1518 ------
NM_020765chr1------1105
NM_020766chrX184421 4369 4346 4023 3973 3936 3830 3723 3510 3053 1159 968 854 789 599 585 130 73 1608 24533 338 --
NM_020771chr621133 509 ------
NM_020772chr1798031 7597 6561 6048 5760 5633 2997 2505 1282 --28678 6827 --
NM_020773chr412617 12722 ----
NM_020774chr1856209 5705 5247 4858 897 25620 4299 34174 1353 645 --
NM_020782chr1243197 1830 756 292 --24390 1914 --
NM_020783chr1842437 2232 1653 801 1122 ----
NM_020791chr1731303 943 511 11129 11315 --
NM_020796chr532466 966 710 ------
NM_020800chr3--21429 79 ----
NM_020801chr542628 2170 2026 346 ------
NM_020807chr1621688 217 ------
NM_020808chr121079 757 1929 11071 --
NM_020809chr1122040 1956 ----2589 120
NM_020815chr41410 ------
NM_020819chr631204 769 295 2891 356 ----
NM_020824chr101790 189 ----
NM_020839chr331467 590 483 ------
NM_020841chr1231175 780 604 13010 1360 --
NM_020854chr181456 ----1388
NM_020858chr1522125 642 --11881 --
NM_020859chr41775 13856 --23473 474
NM_020860chr431047 884 738 11116 ----
NM_020861chr621187 1069 ------
NM_020865chr3----156 --
NM_020866chr1331015 826 687 1923 ----
NM_020870chr42827 293 ------
NM_020871chrX42520 758 727 570 ------
NM_020872chr341684 1676 1277 1209 --1508 11564
NM_020873chr3--2699 244 ----
NM_020897chr121346 98 --1518 --
NM_020918chr1043634 2887 2793 1336 --12292 --
NM_020920chr141156 --124 --
NM_020922chrX1331 11757 ----
NM_020925chr131196 1142 478 ------
NM_020927chr1642310 2211 2164 1557 --1814 --
NM_020935chr253993 3799 1614 1064 705 --14379 --
NM_020940chr1072848 2715 2451 2168 858 845 113 12628 1231 12643
NM_020948chr142909 2834 2359 597 1789 11338 --
NM_020951chr1952115 518 347 289 151 ------
NM_020960chr973619 3527 1341 1257 1204 797 471 ------
NM_020962chr1532089 532 129 --11864 --
NM_020964chr1833202 1889 511 --24743 32 --
NM_020973chr41246 ------
NM_020977chr42816 650 1677 21720 438 --
NM_020981chr2------1234
NM_020993chr1232848 829 296 ------
NM_021003chr141639 --1573 --
NM_021005chr151930 2877 312 ----
NM_021007chr232234 868 38 11645 11872 --
NM_021012chr1712435 ------
NM_021033chr1353421 3375 3119 1066 287 12954 13264 --
NM_021038chr3113286 3026 3015 2914 2622 2572 2246 933 715 266 143 12103 --12080
NM_021045chr1042464 2338 1987 1849 1660 ----
NM_021069chr432060 536 411 ------
NM_021072chr551998 1051 940 796 585 1456 1776 12429
NM_021079chr1721186 163 --13324 --
NM_021083chrX53567 3242 2965 2807 1401 12822 12907 --
NM_021090chr2254612 4499 4384 3214 3157 12015 ----
NM_021097chr233053 2991 390 22853 2605 1956 --
NM_021116chr789113 7860 7419 6485 6438 5500 3436 137 18946 12888 17264
NM_021120chrX63118 3110 2790 2639 1030 923 --1295 --
NM_021131chr9----31449 1043 388 --
NM_021132chr1031308 946 118 ------
NM_021140chrX51184 1062 854 828 804 11144 ----
NM_021141chr2------1222
NM_021145chr7----1138 --
NM_021148chr732516 1708 105 11864 ----
NM_021159chr421555 238 ------
NM_021165chr13832 688 673 ------
NM_021183chrX22280 2135 --11831 11944
NM_021189chr11931 --1962 --
NM_021190chr131202 1077 856 1329 138 --
NM_021191chr1232507 288 178 ------
NM_021194chr1--1343 ----
NM_021202chr2031891 1222 539 13054 ----
NM_021204chr42601 228 2781 286 ----
NM_021239chr14189 ------
NM_021249chr141663 --21463 377 --
NM_021252chr1031652 640 108 ------
NM_021255chr1454022 3923 1571 1380 1174 13398 21652 993 13494
NM_021614chr51220 1209 ----
NM_021622chr1042005 851 443 244 ------
NM_021627chr331216 323 71 ------
NM_021637chrX11338 ------
NM_021638chr464106 3624 3452 1974 1953 1911 --1310 --
NM_021639chr11170 ------
NM_021643chr221401 1211 ------
NM_021644chr1011128 ------
NM_021647chr474248 4084 3447 1891 924 512 489 --23960 362 1474
NM_021722chr71388 ------
NM_021723chr71429 ------
NM_021728chr142924 889 --1372 --
NM_021738chr10------1134
NM_021807chr73944 805 271 --1486 --
NM_021809chr2021955 627 11716 11650 --
NM_021813chr665873 5760 4579 4441 4175 759 15806 23743 1981 15725
NM_021814chr611395 ----21686 1580
NM_021911chr5195564 5440 4771 4637 4115 3751 3722 3645 1894 1558 1488 1385 1282 1048 876 404 332 161 122 11686 13710 --
NM_021912chr1534055 3495 989 1491 ----
NM_021914chr1432113 863 831 --1789 --
NM_021935chr31988 ------
NM_021943chr622159 215 ------
NM_021946chrX41327 1297 469 220 11359 --1209
NM_021951chr91604 2837 802 1902 --
NM_021954chr1363676 3375 3254 2509 883 662 ------
NM_021956chr611484 ------
NM_021959chr61990 ------
NM_021961chr1136204 1501 194 --16163 --
NM_021964chr3106386 5685 5637 5583 5423 4862 4231 391 319 300 15166 14675 --
NM_021979chr143388 349 103 ------
NM_021988chr2041601 1395 1319 1065 ------
NM_022037chr21270 --1166 --
NM_022048chr1595709 4817 4359 4324 4252 1512 1265 1171 716 15818 1280 12320
NM_022051chr15656 637 594 514 208 144 ----
NM_022091chr622335 2218 12021 --12267
NM_022103chr192942 204 ------
NM_022114chr144363 4046 1723 535 --1559 14197
NM_022130chr521383 1183 ------
NM_022138chr61384 --11521 --
NM_022154chr411347 ------
NM_022173chr21270 --1166 --
NM_022337chr11----142 --
NM_022351chr842781 2674 666 237 13442 12863 --
NM_022361chr62163 130 2545 390 --1203
NM_022442chr2041601 1395 1319 1065 ------
NM_022443chr3136 ------
NM_022456chr12147687 7502 6897 6121 5376 5101 4840 4793 2920 2668 2281 2096 1201 125 --27475 6810 11282
NM_022457chr1----1229 --
NM_022459chr1366381 5643 1389 1175 891 55 --11886 --
NM_022463chr1711492 ------
NM_022465chr1252982 1946 1934 1076 184 12591 ----
NM_022469chr121067 759 ------
NM_022475chr42616 286 ------
NM_022477chr2021533 27 11405 11382 11749
NM_022484chr7----11231 11395
NM_022550chr52484 142 ------
NM_022552chr231130 910 371 ------
NM_022716chr132346 1003 546 --13163 --
NM_022726chr611675 11214 ----
NM_022731chr11199 ------
NM_022733chr131215 183 116 --11100 --
NM_022735chr121843 540 --11754 --
NM_022745chr152785 2329 1113 967 913 12297 ----
NM_022753chr132530 2083 158 --22660 382 --
NM_022763chr373096 2798 2615 2499 904 733 686 ------
NM_022771chr1231013 822 280 1408 ----
NM_022776chr341384 1189 492 75 ------
NM_022778chr111480 ------
NM_022780chr22740 695 --1638 --
NM_022781chr953136 2271 1168 635 290 1189 ----
NM_022782chr121362 ------
NM_022783chr8----1280 --
NM_022784chr1511048 --2299 37 --
NM_022787chr132021 919 369 --11884 --
NM_022824chr52767 329 11420 --11512
NM_022831chr131675 655 636 ----1717
NM_022832chr422177 1654 1247 1925 1411
NM_022840chr1811248 --137 --
NM_022841chr1562765 2718 2431 2398 1986 1926 ------
NM_022842chr373056 2925 2681 2331 2179 739 714 --1148 --
NM_022843chr1321222 445 ------
NM_022845chr1652207 2152 1548 1493 818 11646 148 --
NM_022893chr262966 2760 2319 2032 428 288 --1412 --
NM_022894chr221640 400 1196 ----
NM_022898chr1444703 4596 4097 45 21505 1100 ----
NM_022899chr321511 1005 ----1286
NM_022900chr73481 426 228 ------
NM_022902chr52330 68 ------
NM_022918chr1131839 1778 179 ------
NM_022977chrX62599 2156 1010 583 557 153 12008 ----
NM_023000chr1421581 1282 --11556 1102
NM_023001chr1421581 1282 --11556 1102
NM_023039chr53420 392 383 ------
NM_023073chr541087 1060 1008 897 11043 11298 --
NM_023074chr192924 169 ------
NM_023075chr181785 ----1868
NM_023923chr143758 3133 1364 535 ------
NM_023925chr121243 ------
NM_023927chr52995 126 ------
NM_023929chr852260 2069 1117 118 66 ------
NM_024007chr552975 2959 2761 2138 642 33104 3076 750 12511 --
NM_024016chr171740 1686 ----
NM_024017chr1721687 620 ------
NM_024019chr41749 ------
NM_024036chr111268 ------
NM_024117chr921181 186 ------
NM_024315chr71358 ------
NM_024334chr311845 ------
NM_024345chr955162 4065 3755 812 53 35485 4044 576 --14395
NM_024411chr2031439 586 113 ------
NM_024424chr111258 --21104 1009 --
NM_024425chr111258 --21104 1009 --
NM_024426chr111258 --21104 1009 --
NM_024430chr1821878 1785 ------
NM_024482chr1170 ------
NM_024523chr72963 90 ----1441
NM_024524chr363179 3116 2341 2057 582 26 22403 268 ----
NM_024525chr11412 ------
NM_024529chr11787 --1356 --
NM_024546chr1321137 165 --2841 334 --
NM_024557chr1121664 1629 11579 ----
NM_024563chr561734 1687 1452 1435 1366 558 --11591 --
NM_024569chr122202 320 1675 12261 --
NM_024581chr6--165 ----
NM_024582chr46394 360 318 219 66 57 ------
NM_024583chr21168 --2921 746 --
NM_024613chr821843 1277 11223 ----
NM_024615chr51249 193 ----
NM_024617chr91766 1154 ----
NM_024620chr1931401 1276 1124 --1138 --
NM_024624chr221637 451 --11530 --
NM_024626chr11403 ----139
NM_024636chr752033 2017 919 755 352 --1145 --
NM_024645chr821605 62 ------
NM_024646chr143774 3567 1607 218 --13336 --
NM_024664chr1132 ------
NM_024665chr364676 4311 3744 3630 1647 1640 --24493 1786 --
NM_024674chr112929 11256 1442 --
NM_024676chr111331 ------
NM_024692chr231236 1156 610 11478 ----
NM_024713chr1521540 247 ------
NM_024721chr8102690 2684 2366 2324 2081 2045 1683 669 657 131 ------
NM_024744chr222578 370 1469 ----
NM_024745chr162225 73 ------
NM_024755chr151138 1578 1915 --
NM_024769chr1131112 747 126 ------
NM_024772chr12424 68 ------
NM_024779chr1231272 262 182 ------
NM_024780chr1631012 240 195 2701 392 ----
NM_024814chr71322 --1303 --
NM_024824chr1441615 355 130 106 --11351 --
NM_024828chr911510 ----11415
NM_024834chr1031917 1329 284 11284 21618 82 --
NM_024852chr12253 163 ------
NM_024854chr1221495 1099 ------
NM_024899chr182453 55 ------
NM_024900chr431622 811 143 ------
NM_024900chr431622 811 143 ------
NM_024911chr11206 ----1255
NM_024915chr842619 635 512 254 ------
NM_024941chr521360 1346 ------
NM_024946chr1651511 1261 592 449 338 --11601 11657
NM_024947chr3119575 9507 9248 8894 7938 6895 2711 1456 1255 1233 912 37849 7200 761 39518 8974 8040 --
NM_024949chr464797 4600 4539 4304 1153 267 14631 ----
NM_024953chr1222604 2426 --12303 --
NM_024969chr21170 1343 180 --
NM_024989chr286936 5726 5102 3049 1920 1448 1376 823 23170 865 57536 7066 6397 5843 1632 --
NM_024991chr1043199 3126 2894 2492 23045 846 ----
NM_024993chr231386 1235 1177 ------
NM_025047chr32369 58 ------
NM_025054chr873990 3105 2937 2635 1129 855 656 ------
NM_025073chr134689 672 351 14748 14727 --
NM_025076chr2134 ------
NM_025079chr12754 242 ------
NM_025126chr12----2696 511 --
NM_025134chr1632372 1824 938 --1465 --
NM_025135chr181433 ------
NM_025146chr341090 473 351 196 1709 12731 1528
NM_025147chr22852 825 1419 --1254
NM_025154chr711217 ------
NM_025160chr174256 3001 1662 1398 1246 539 339 13739 ----
NM_025164chr1132239 1682 1349 --22083 488 11466
NM_025181chr21726 ------
NM_025191chr163414 2931 2603 2196 724 714 --1545 --
NM_025222chr322494 2447 32082 2029 1863 ----
NM_025235chr1052131 2097 1917 1898 506 --21970 445 --
NM_025237chr1731538 101 88 11338 --11584
NM_030594chr1541385 1299 1233 847 --11239 --
NM_030625chr1052583 1922 1916 1646 683 --2570 463 1486
NM_030627chr533821 3647 208 22814 358 ----
NM_030629chr1631872 777 377 1704 --1500
NM_030640chr122891 664 ------
NM_030647chr734507 4198 834 24192 1662 ----
NM_030648chr455300 3886 1301 1145 1111 15577 11594 --
NM_030650chr254249 4202 3254 1139 59 ------
NM_030660chr1421458 1396 11522 ----
NM_030664chr1011587 12293 ----
NM_030665chr1731464 1416 1339 ------
NM_030667chr1241207 832 398 61 ----1452
NM_030668chr1241207 832 398 61 ----1452
NM_030669chr1241207 832 398 61 ----1452
NM_030670chr1232239 1864 1430 ----11484
NM_030671chr1232239 1864 1430 ----11484
NM_030674chr1245419 5319 4938 1841 ------
NM_030751chr10--21166 643 1359 --
NM_030751chr10--21166 643 1359 --
NM_030755chr1482872 2727 2710 2287 876 441 318 99 ------
NM_030767chr922332 2068 ----12867
NM_030771chr11161 ------
NM_030777chr2021858 1785 11531 22067 852 --
NM_030780chr831314 361 112 --21713 1507 --
NM_030786chr11761 ------
NM_030791chr142735 157 ------
NM_030796chr732042 737 198 11409 ----
NM_030806chr169162 8369 6517 6053 3616 223 39421 518 181 18542 13651
NM_030808chr172954 371 ------
NM_030809chr1242482 2059 650 146 12281 ----
NM_030816chr153708 3627 3074 1128 691 13257 ----
NM_030817chr1253803 3403 2698 1480 749 ------
NM_030820chr63834 699 281 ------
NM_030881chr2262168 2000 1971 690 567 421 --11827 --
NM_030885chr352069 1921 1736 773 724 ------
NM_030911chr1341539 1413 1397 46 ------
NM_030915chr221596 97 ------
NM_030918chr135411 4888 312 --15369 --
NM_030920chr13660 507 218 ------
NM_030922chr152226 81 135 ----
NM_030945chr5----196 11066
NM_030954chr8--1346 ----
NM_030962chr1141586 1507 1106 1003 1147 1566 --
NM_030964chr523430 401 23761 443 12586 --
NM_030965chr11297 ----1670
NM_030978chr91430 ------
NM_031157chr122584 474 ------
NM_031216chr183654 472 251 --11605 --
NM_031243chr742385 1759 583 274 ------
NM_031262chr92987 243 ------
NM_031263chr921044 300 ------
NM_031266chr51100 ------
NM_031268chr1675106 4806 4001 1828 1203 978 265 14867 11478 --
NM_031296chr452687 2014 1716 1084 126 ------
NM_031305chr42381 283 ------
NM_031314chr143711 363 157 21845 1492 ----
NM_031362chr232821 403 28 22744 706 21054 915 --
NM_031365chr232957 539 164 22880 842 21190 1051 --
NM_031366chr232957 539 164 22880 842 21190 1051 --
NM_031369chr4--1220 1203 --
NM_031370chr4--1220 1203 --
NM_031371chr141073 444 203 118 ------
NM_031371chr141073 444 203 118 ------
NM_031372chr43671 283 132 1620 ----
NM_031407chrX----142 --
NM_031411chr522146 1523 12386 --22140 1595
NM_031412chr1231265 488 288 ------
NM_031419chr31258 2628 528 11527 --
NM_031424chr20----2538 159 --
NM_031431chr1351846 1301 1196 647 523 --11359 --
NM_031435chr1263408 2534 2248 2205 1333 355 ------
NM_031438chr531723 513 189 11431 1548 --
NM_031439chr831792 1680 263 ------
NM_031442chrX52440 770 737 334 292 ----22579 942
NM_031445chr253138 2513 622 487 131 11348 21231 635 --
NM_031461chr862079 1981 887 840 544 282 1233 11918 --
NM_031468chr747833 7423 6178 267 ----25723 5258
NM_031469chr633982 2903 175 1674 13443 --
NM_031471chr111391 ------
NM_031476chr1632774 2125 76 ------
NM_031479chr12----11158 --
NM_031483chr2073318 2731 2627 1362 1263 655 511 11034 1717 --
NM_031844chr153102 1640 385 312 214 13903 ----
NM_031845chr273705 3687 3673 1474 1128 977 403 1136 ----
NM_031847chr273705 3687 3673 1474 1128 977 403 1136 ----
NM_031849chr522146 1523 12386 --22140 1595
NM_031850chr31886 ------
NM_031850chr31886 ------
NM_031857chr522146 1523 12386 --22140 1595
NM_031860chr522146 1523 12386 --22140 1595
NM_031866chr101743 1113 1910 --
NM_031889chr411963 ------
NM_031890chr2232362 2306 389 ------
NM_031911chr452564 2323 2288 1036 315 --22648 1050 --
NM_031953chr4------1398
NM_032012chr975098 4980 4951 4265 3339 1480 666 21261 414 ----
NM_032013chr2021533 27 11405 11382 11749
NM_032041chr822467 355 --22474 237 --
NM_032042chr552825 2684 880 603 99 ------
NM_032047chr341834 744 333 182 42337 2289 2085 392 11627 1778
NM_032049chr31886 ------
NM_032049chr31886 ------
NM_032050chr222990 865 2754 721 ----
NM_032052chr2231375 1250 313 21139 1106 ----
NM_032088chr5----1687 --
NM_032092chr5----1687 --
NM_032102chr1183064 2973 2623 2257 1178 998 676 409 --1980 --
NM_032105chr166159 5783 5577 1290 1208 917 --11027 --
NM_032116chr1375414 5293 5046 4935 1759 1095 239 11832 1991 1436
NM_032119chr5----1280 --
NM_032124chr1821154 502 ----1771
NM_032144chr221575 1410 11790 11446 --
NM_032145chr611485 21832 495 11725 --
NM_032153chr332645 2355 1967 22425 1918 ----
NM_032154chr102945 750 188 1814 --
NM_032156chr121243 ------
NM_032160chr1873479 3375 3312 2897 1699 384 146 ------
NM_032177chr52121 48 ------
NM_032186chr121435 904 ------
NM_032189chr13--14913 ----
NM_032199chr1043444 991 786 663 --12738 12807
NM_032208chr263652 3139 2911 2694 1336 824 1672 22319 362 13576
NM_032213chr211237 --11066 --
NM_032217chr41394 ------
NM_032221chr2021516 745 ------
NM_032228chr1142605 1330 810 618 23531 2147 ----
NM_032229chr131341 --1427 --
NM_032231chr15134 1254 ----
NM_032236chr1----1976 --
NM_032256chr1221059 219 1707 1159 --
NM_032268chr1631256 599 281 --12912 --
NM_032281chr1933152 3086 2153 12127 ----
NM_032288chr361716 1513 1471 452 409 51 --11489 --
NM_032291chr131593 1248 351 1208 ----
NM_032320chr112123 92 --1805 --
NM_032324chr11208 ------
NM_032329chr234419 2729 1158 ------
NM_032373chr1064824 1350 917 826 318 129 25508 4218 35301 1750 856 15650
NM_032379chr113827 740 103 1306 ----
NM_032380chr5172 ------
NM_032403chr5----1687 --
NM_032408chr731187 1021 407 ------
NM_032410chr831202 844 447 ------
NM_032420chr51794 --1360 --
NM_032427chr111444 ------
NM_032435chr141812 1567 181 162 1904 ----
NM_032438chr631596 1438 545 1481 1348 --
NM_032439chr1031570 572 245 ------
NM_032440chr1052913 2434 2361 1029 943 12242 31840 72 58 --
NM_032445chr152428 167 ------
NM_032446chr563848 3325 3064 1219 674 330 32867 1178 469 1217 11094
NM_032452chr142291 257 --1331 --
NM_032457chr433904 3728 2388 12852 ----
NM_032458chrX43220 2877 2594 2098 --11312 --
NM_032466chr821656 1080 ------
NM_032468chr821656 1080 ------
NM_032471chr621111 103 ------
NM_032491chr122466 100 ------
NM_032494chr2--1552 ----
NM_032505chr31587 --22795 1866 --
NM_032510chr1842226 2031 910 155 ------
NM_032521chr2022727 120 1161 ----
NM_032523chr21384 --1546 --
NM_032547chr42522 33 11215 ----
NM_032549chr73469 333 24 ------
NM_032557chr41693 ------
NM_032564chr113973 648 395 ------
NM_032569chr1611714 ------
NM_032594chr142996 814 ------
NM_032595chr1741536 976 533 483 --148 --
NM_032622chr41106 --41251 416 403 235 --
NM_032632chr1431920 1438 680 --1316 --
NM_032682chr353087 2980 2601 596 84 ------
NM_032782chr521205 185 ------
NM_032804chr1042229 1802 460 202 12457 11790 --
NM_032813chr1311078 ------
NM_032828chr1941269 1143 1057 446 ------
NM_032829chr1211171 ------
NM_032834chr1241181 977 503 231 11254 ----
NM_032837chr1722137 179 ------
NM_032838chr191864 1370 ----
NM_032842chr72326 200 ------
NM_032844chr101247 ------
NM_032857chr151203 ------
NM_032858chr11132 ------
NM_032859chr1373894 2808 1093 915 363 266 22 1285 ----
NM_032873chr1194509 4426 3760 3565 3463 3326 2997 1830 562 --13272 --
NM_032918chr12181 --1125 --
NM_032926chrX2218 43 ------
NM_032936chr7130 ------
NM_032943chr113827 740 103 1306 ----
NM_032960chr121508 1165 ------
NM_032961chr421272 163 ------
NM_032966chr1121570 23 ------
NM_032967chrX1356 ------
NM_032968chrX54245 4224 3966 3359 612 ------
NM_032969chrX54245 4224 3966 3359 612 ------
NM_032971chrY1383 ------
NM_032972chrY1383 ------
NM_032973chrY54237 4216 3958 3354 612 ------
NM_032975chr1853531 3517 3250 2499 2450 ------
NM_032980chr1853531 3517 3250 2499 2450 ------
NM_032982chr762588 2095 2086 647 367 231 ------
NM_032983chr753402 2909 2900 1181 1045 ------
NM_032991chr411401 1250 ----
NM_033012chr1331045 904 848 1402 ----
NM_033016chr2231012 90 58 ------
NM_033020chr134660 91 26 1287 14824 --
NM_033031chrX2207 138 ------
NM_033044chr131179 1084 799 194 1506 --
NM_033055chr121058 406 ------
NM_033089chr2021518 1144 11479 21073 458 --
NM_033116chr141198 ------
NM_033119chr16--3119 103 85 ----
NM_033121chr1241792 1534 522 367 1615 ----
NM_033132chr1351904 1805 773 559 251 ----11543
NM_033138chr71777 --11930 --
NM_033139chr71777 --11930 --
NM_033140chr71777 --11930 --
NM_033157chr71777 --11930 --
NM_033181chr663722 3497 2654 1392 936 573 23789 3693 ----
NM_033211chr52339 137 --21839 461 --
NM_033222chr941231 1012 963 538 ------
NM_033224chr7137458 6193 5316 3107 2419 2339 2056 1923 1744 1257 891 826 709 13153 ----
NM_033225chr862840 1230 1180 869 733 327 --12050 12989
NM_033228chr51154 ------
NM_033254chr3136 ------
NM_033281chr51200 ------
NM_033290chrX33768 2797 1117 11440 11506 --
NM_033326chr1132408 997 124 1194 ----
NM_033331chr963387 3074 3021 339 332 105 32790 2381 1234 1779 12845
NM_033342chr51115 ------
NM_033360chr1254436 3706 2979 2891 1484 13210 22951 1304 --
NM_033379chr10--158 ----
NM_033380chrX178 ------
NM_033381chrX178 ------
NM_033393chr462781 2686 2226 937 891 451 --11113 --
NM_033394chr241387 1073 355 274 ------
NM_033401chr161215 ------
NM_033402chr81186 ----1347
NM_033411chr62240 183 ------
NM_033425chr1132862 1128 567 --13367 --
NM_033430chr454127 3253 2855 1676 996 --1259 --
NM_033437chr454127 3253 2855 1676 996 --1259 --
NM_033449chr531724 858 537 --1191 --
NM_033480chr63624 269 171 ------
NM_033481chr63624 269 171 ------
NM_033503chr152830 94 --1466 13630
NM_033505chr276787 6717 5772 5070 4522 2066 1500 --26551 701 36585 2141 1395
NM_033512chr862938 2515 995 765 442 268 ----12883
NM_033515chr6----11370 --
NM_033535chr421084 1069 ------
NM_033547chr111154 ------
NM_033631chr163641 3409 2634 2619 1418 1320 --1824 --
NM_033632chr451253 1198 619 568 515 ------
NM_033642chrX3936 829 364 21136 972 ----
NM_033644chr55963 807 560 366 287 22524 2458 11587 --
NM_033645chr55963 807 560 366 287 22524 2458 11587 --
NM_033656chr2155169 4207 3923 3740 810 14160 15653 --
NM_052832chr822759 2302 ------
NM_052834chr1872301 1665 490 465 300 86 61 1539 ----
NM_052840chr1541533 550 360 163 ------
NM_052845chr1242557 2451 281 256 --11293 --
NM_052854chr111420 ------
NM_052879chr1283971 3234 2858 2630 1601 985 953 492 ------
NM_052886chr851940 1423 763 330 296 11952 ----
NM_052898chr821421 524 ----1244
NM_052900chr851834 1219 1121 672 619 11181 21531 503 --
NM_052905chr221420 310 ------
NM_052907chr1243521 3412 2719 394 ----1298
NM_052911chr183275 172 58 ------
NM_052917chr272446 2092 1089 928 393 281 129 13220 ----
NM_052918chr1053476 3464 2906 948 154 22827 1077 12673 --
NM_052927chr522185 2092 12067 12083 --
NM_052936chrX2910 65 --1256 --
NM_052950chr1332219 1729 334 --1262 --
NM_052953chr3185 ------
NM_052958chr81302 ------
NM_052996chr1631711 1568 1383 ------
NM_053002chr331056 827 760 ------
NM_053016chr945206 1682 860 129 21993 482 35906 1257 769 11503
NM_053023chr1152617 2477 1225 188 125 1898 ----
NM_053024chr341445 1399 1055 38 21313 1297 ----
NM_053043chr746241 4687 520 211 --1296 12154
NM_053056chr1162644 2204 2115 1960 1226 600 --12032 --
NM_053064chr1421992 770 12925 ----
NM_054012chr9168 ------
NM_054016chr121525 307 ------
NM_054016chr121525 307 ------
NM_054016chr121525 307 ------
NM_057175chr411920 12464 2749 80 --
NM_057178chr1732696 492 102 12732 ----
NM_057749chr81937 21225 1161 11366 --
NM_058170chr131472 597 585 ------
NM_058241chr262158 1807 1667 376 350 100 22245 51 ----
NM_058241chr262158 1807 1667 376 350 100 22245 51 ----
NM_078469chr1011339 1407 ----
NM_078487chr943250 2350 2214 272 ------
NM_079420chr2----127 --
NM_079422chr2----127 --
NM_080546chr942169 1787 1577 1449 ------
NM_080599chr101773 ------
NM_080618chr2031292 268 231 --11037 --
NM_080645chr642122 1945 1812 758 --11468 --
NM_080647chr221311 ------
NM_080651chr81246 --144 --
NM_080669chr171841 11518 ----
NM_080672chr201571 ------
NM_080676chr2033105 2455 905 --11288 --
NM_080678chr22647 170 ------
NM_080717chr12------21517 415
NM_080738chr11736 ------
NM_080742chr6193 ------
NM_080743chr682561 2488 2040 1928 1845 989 831 243 ------
NM_080752chr201407 1129 ----
NM_080867chr1454510 1527 899 334 167 ------
NM_080872chr883823 3799 3444 2884 2571 1258 814 449 --33806 3107 962 --
NM_080927chr352924 2152 2044 587 515 13277 1507 --
NM_130385chr1143079 2173 1988 1280 --33020 2573 1250 11294
NM_130386chr181216 ------
NM_130391chr962631 2443 2187 1182 881 323 ------
NM_130392chr962631 2443 2187 1182 881 323 ------
NM_130393chr962631 2443 2187 1182 881 323 ------
NM_130435chr1022876 2412 --12458 --
NM_130439chr1011545 11564 --1680
NM_130439chr1011545 11564 --1680
NM_130797chr7----1462 --
NM_130798chr1541280 1085 988 312 ------
NM_130811chr2041040 1011 345 118 ------
NM_130838chr1541459 1333 1167 423 ------
NM_130839chr1541459 1333 1167 423 ------
NM_130847chr1185952 5680 4382 3673 1880 1413 958 280 --11038 --
NM_130901chr15158 ------
NM_130902chr4131 ------
NM_133265chrX63245 2931 2522 2370 722 241 ------
NM_133329chr231615 1197 99 --1756 --
NM_133330chr43554 494 401 ------
NM_133331chr43554 494 401 ------
NM_133334chr4105383 4704 4265 2299 2243 1789 721 689 450 337 15135 ----
NM_133335chr43554 494 401 ------
NM_133369chr511009 ------
NM_133372chr562829 2248 1791 1126 1098 143 ------
NM_133378chr22969 166 1957 ----
NM_133432chr22969 166 1957 ----
NM_133433chr52737 242 ------
NM_133437chr22969 166 1957 ----
NM_133443chr1621720 265 ------
NM_133445chr963628 3450 3185 2651 896 388 1361 12608 --
NM_133452chr191903 --1321 --
NM_133468chr731943 222 157 --11638 --
NM_133477chr452632 2547 2288 450 373 11240 32680 2155 1138 12482
NM_133486chrX1400 ------
NM_133493chr664069 3654 3020 1507 608 58 24614 4226 ----
NM_133496chr184082 2816 1474 1121 1045 553 517 69 --13588 --
NM_133507chr12--1735 --1235
NM_133631chr33585 345 173 ------
NM_133633chr2221191 309 ------
NM_133638chr51973 ------
NM_133646chr2115368 5332 5238 4832 4105 2096 1841 1769 1747 589 404 13899 ----
NM_133647chr1543453 3132 716 686 --23741 2455 --
NM_134265chr172986 321 11022 ----
NM_134428chr91326 1334 ----
NM_134442chr241754 1706 671 488 11385 11362 --
NM_134470chr32169 29 2643 182 ----
NM_138270chrX52224 1146 863 647 242 21330 29 21344 984 --
NM_138288chr1441968 890 864 230 ------
NM_138290chr73296 118 92 ------
NM_138316chr1031256 940 55 ------
NM_138335chr42889 860 1769 ----
NM_138340chr18--1198 ----
NM_138357chr1051483 1406 1360 181 65 ------
NM_138370chr21774 ------
NM_138391chr12400 300 ------
NM_138423chr1521778 1738 11573 ----
NM_138426chr742415 2373 913 842 ------
NM_138444chr1333988 1331 369 ------
NM_138457chr632577 2137 1129 ------
NM_138459chr673231 2399 2283 717 697 626 516 --13023 --
NM_138468chr232380 1738 1328 ------
NM_138473chr1264593 3474 3385 1624 1255 526 13459 13909 --
NM_138479chr111371 --11747 --
NM_138485chr3----189 --
NM_138494chr732522 714 663 1687 2336 126 --
NM_138558chr121060 203 ------
NM_138576chr1444703 4596 4097 45 21505 1100 ----
NM_138609chr51155 ------
NM_138610chr51155 ------
NM_138621chr254069 3845 3353 2989 544 ------
NM_138633chr641799 1599 1376 350 21263 496 1158 --
NM_138635chr732074 1225 284 12008 ----
NM_138638chr1432113 863 831 --1789 --
NM_138639chr191135 ------
NM_138689chr11--1187 ----
NM_138711chr32204 144 ------
NM_138712chr32204 144 ------
NM_138713chr1698059 7764 7618 7426 7170 6763 5195 2408 1569 77877 6660 2919 2846 2418 342 269 26429 401 25187 3143
NM_138714chr1698059 7764 7618 7426 7170 6763 5195 2408 1569 77877 6660 2919 2846 2418 342 269 26429 401 25187 3143
NM_138731chr1454280 3225 1248 837 702 ----12868
NM_138766chr52494 204 ------
NM_138771chr761513 1488 1405 1332 978 73 ------
NM_138779chr13170 ------
NM_138782chr511616 12298 ----
NM_138819chrX1463 1381 ----
NM_138821chr52494 204 ------
NM_138822chr52494 204 ------
NM_138927chr213759 342 247 ------
NM_138966chr181201 --1421 --
NM_138970chr1432160 931 685 ------
NM_138980chr43597 220 184 ------
NM_138981chr43728 351 315 ------
NM_138982chr43597 220 184 ------
NM_138994chr161215 ------
NM_139035chrX3638 574 491 ------
NM_139045chr91668 --1610 --
NM_139048chr311178 1130 ----
NM_139071chr1221566 660 ------
NM_139076chr421462 66 ------
NM_139126chr62680 662 1212 ----
NM_139131chr11----1548 --
NM_139135chr12879 482 ------
NM_139168chr551426 794 608 395 290 ------
NM_139201chr122717 131 ------
NM_139207chr1222052 461 --11806 1232
NM_139215chr171236 ------
NM_139239chr191247 ------
NM_139244chr63974 790 726 ------
NM_139276chr1742375 2237 449 344 ------
NM_139283chr1211598 22272 824 1557 --
NM_139312chr1061455 1005 548 183 57 37 ------
NM_139316chr711002 ------
NM_139318chr141192 ------
NM_139321chr2063762 3723 2652 1267 436 256 ------
NM_139323chr2031913 1385 401 ----1773
NM_144563chr21821 1169 ----
NM_144563chr21821 1169 ----
NM_144567chr122380 44 --1498 12257
NM_144571chr485746 5090 4481 2758 2407 1878 1199 769 35440 5068 37 ----
NM_144574chr14----1548 --
NM_144578chr1495476 5121 4792 1343 1325 1135 848 771 79 22118 337 ----
NM_144583chr22605 119 ------
NM_144588chr1011171 ------
NM_144591chr103453 393 137 ------
NM_144595chr134755 651 395 165 --1130 --
NM_144599chr1575461 4623 4241 941 844 513 399 ------
NM_144600chr1631364 1192 207 ------
NM_144604chr161537 ------
NM_144609chr1751417 1367 433 117 84 --1397 --
NM_144610chr172190 85 ------
NM_144629chr221173 52 142 ----
NM_144632chr221682 759 32161 844 115 ----
NM_144633chr311005 1373 ----
NM_144643chr4--1404 1125 --
NM_144644chr4----1184 --
NM_144657chrX1580 --2196 112 --
NM_144660chr101394 ------
NM_144721chr451803 1756 850 724 576 12652 ----
NM_144726chr51178 ------
NM_144778chr1332051 2041 1784 ----158
NM_144949chr282567 2364 2112 2103 979 911 893 780 ------
NM_144963chr84552 182 170 22 ------
NM_144967chrX1715 11046 ----
NM_144973chr1235174 4753 1463 15190 13589 1440
NM_144975chr1721586 1128 ------
NM_144979chr42531 72 1653 ----
NM_144982chr122793 638 ------
NM_145012chr10----1970 --
NM_145025chr641124 741 187 141 ------
NM_145044chr361811 1602 1587 1472 556 386 --1362 --
NM_145049chr541055 993 768 393 ------
NM_145055chr1853587 3540 2891 2736 75 --23631 2572 21370 1361
NM_145112chr1411090 ------
NM_145113chr1411362 ------
NM_145117chr1143042 2329 254 241 ------
NM_145175chr221258 891 11437 --1990
NM_145203chr132310 249 ------
NM_145206chr1063260 2310 1059 598 532 390 --12041 --
NM_145234chrX2914 358 ------
NM_145251chr1451164 653 377 293 117 11646 ----
NM_145259chr2117056 6501 6488 5950 2800 2781 2270 2109 1594 1003 487 15264 15294 --
NM_145263chr42421 184 ------
NM_145266chr5142 ------
NM_145274chr171620 --1312 --
NM_145284chrX92241 1779 950 773 606 589 471 335 254 12332 ----
NM_145305chrX31221 877 313 11321 ----
NM_145307chr10114700 3341 1828 1786 1721 1265 1235 750 511 382 247 --11756 13602
NM_145313chr1011418 ------
NM_145320chr773307 956 686 658 488 191 126 11341 ----
NM_145321chr773307 956 686 658 488 191 126 11341 ----
NM_145322chr773307 956 686 658 488 191 126 11341 ----
NM_145330chr22118 63 ------
NM_145331chr63853 287 195 --1148 --
NM_145332chr621001 343 --1296 --
NM_145333chr621001 343 --1296 --
NM_145649chr622756 634 1264 ----
NM_145655chr622756 634 1264 ----
NM_145686chr212937 12774 32647 1243 973 --
NM_145687chr212937 12774 32647 1243 973 --
NM_145690chr831715 722 284 ------
NM_145693chr232584 2552 1007 ------
NM_145698chr102359 196 --1106 --
NM_145716chr12566 38 ------
NM_145728chr1552415 2248 2240 2184 594 22353 2192 ----
NM_145733chr22150 11210 21241 346 --
NM_145735chr1352776 2751 2060 1047 135 --12370 --
NM_145739chr21384 --1546 --
NM_145805chr151468 2571 116 ----
NM_145808chr772207 2127 2042 2028 1144 604 169 ------
NM_145859chr31137 ------
NM_145860chr31137 ------
NM_145861chr11736 ------
NM_145891chr1641083 565 227 65 ------
NM_145892chr1641083 565 227 65 ------
NM_145893chr1651205 687 349 187 75 ------
NM_145909chr651033 934 253 182 37 1339 --1537
NM_147150chr963791 3317 2769 2418 1284 311 ------
NM_147166chr73855 659 218 ------
NM_147171chr71181 ------
NM_147175chrX41995 1929 1742 267 ------
NM_147185chr71181 ------
NM_147189chr832062 1475 105 ------
NM_147190chr122719 264 ------
NM_147202chr912709 --22336 140 --
NM_147223chr212306 12283 ----
NM_147233chr222123 885 12100 ----
NM_148174chr821659 747 --11796 --
NM_148894chr42974 170 ------
NM_148955chr1556546 5855 4751 4110 1591 26478 1621 ----
NM_148957chr1371754 1632 1070 902 739 563 158 22515 808 12577 --
NM_148977chr1031256 940 55 ------
NM_148978chr1031256 940 55 ------
NM_152233chr141663 --21463 377 --
NM_152237chr2211132 ----11677
NM_152243chr221368 ------
NM_152261chr1232145 2072 1933 158 --11945
NM_152271chr82430 234 ------
NM_152277chr551801 1589 603 520 326 ------
NM_152298chr1--1709 ----
NM_152305chr332103 1740 645 --1415 --
NM_152309chr1022257 2213 --1122 --
NM_152323chr121153 ------
NM_152330chr1452498 2398 1847 1773 472 --22224 488 --
NM_152375chr162636 2022 1819 815 694 394 ------
NM_152380chr141686 1331 672 254 ------
NM_152381chr231815 231 25 ------
NM_152388chr253759 3428 2996 2519 605 ------
NM_152390chr22638 532 ------
NM_152400chr431607 1528 22 ------
NM_152408chr5--188 ----
NM_152409chr573037 2913 2357 1282 1235 1091 195 13057 ----
NM_152412chr8173 21494 320 ----
NM_152424chrX63590 3520 3480 2871 1639 533 24386 3359 ----
NM_152429chr1021378 395 --21520 1453 --
NM_152437chr1222363 305 12429 1116 --
NM_152447chr142297 97 ------
NM_152450chr1541866 800 407 95 1605 ----
NM_152455chr15146 ------
NM_152478chr193534 146 124 ------
NM_152487chr11973 1102 ----
NM_152522chr2246 23 1874 1167 --
NM_152527chr242174 135 61 32 2927 879 11922 --
NM_152556chr752259 2027 1649 678 48 ------
NM_152557chr721481 121 ------
NM_152564chr821736 77 11550 ----
NM_152574chr92447 338 ------
NM_152588chr12------1222
NM_152594chr1511728 ------
NM_152608chr131820 1768 825 ------
NM_152613chr221227 --1932 --
NM_152621chr41152 ------
NM_152622chr553164 3139 1391 1218 830 23411 3270 ----
NM_152624chr5107432 7421 7135 6217 5689 4824 2687 2669 883 234 11773 ----
NM_152629chr983454 2876 2827 1173 925 552 188 45 --23988 3864 --
NM_152636chr1142660 1943 1124 91 ------
NM_152641chr1211781 12632 ----
NM_152660chr12957 395 1769 ----
NM_152665chr11234 1511 1326 --
NM_152676chr18122 ------
NM_152678chr32602 320 --1573 --
NM_152682chr421695 1531 11153 ----
NM_152688chr6--1395 1282 --
NM_152699chr332557 2466 179 1124 ----
NM_152721chr181689 2727 617 ----
NM_152724chr1052482 2175 2072 979 307 1182 ----
NM_152726chr132454 33 ------
NM_152727chr16--1281 ----
NM_152731chr63776 397 381 --1146 1879
NM_152737chr641742 835 387 35 12131 ----
NM_152739chr731111 848 435 ------
NM_152744chr742823 2323 955 832 --11216 1858
NM_152745chr731087 400 323 ------
NM_152753chr62786 707 ------
NM_152754chr721396 49 13826 11366 --
NM_152756chr543965 3480 1624 255 23929 2687 --14359
NM_152758chr823074 2257 1866 ----
NM_152765chr81350 1208 11919 --
NM_152773chr3--165 ----
NM_152774chr761866 961 866 473 233 144 --12395 --
NM_152787chrX42980 2900 2828 543 23032 307 33159 1404 460 13377
NM_152789chr731304 1247 1149 ------
NM_152826chr1556546 5855 4751 4110 1591 26478 1621 ----
NM_152835chr122921 2430 12748 ----
NM_152838chr20113476 3394 3305 2202 811 571 524 509 100 64 40 --22262 184 --
NM_152857chr621014 994 ------
NM_152858chr621014 994 ------
NM_152860chr1221500 485 --1424 --
NM_152878chr2221520 1056 ------
NM_152890chr14967 810 516 47 ------
NM_152896chr92798 549 --1617 --
NM_152902chr111391 --11371 21983 1847
NM_152905chr12177 ------
NM_152924chr1565576 4437 4278 1019 277 212 11497 --1219
NM_152989chr1221543 690 --11331 --
NM_152991chr11----1679 --
NM_152998chr71165 ------
NM_152999chr744780 4614 3853 1405 14910 ----
NM_153015chr82933 651 1376 ----
NM_153020chr621694 29 11359 ----
NM_153035chr152733 1221 1204 1184 1100 1258 ----
NM_153050chr2254612 4499 4384 3214 3157 12015 ----
NM_153051chr2254612 4499 4384 3214 3157 12015 ----
NM_153181chr181201 --1421 --
NM_153184chr321872 1629 11548 1232 --
NM_153186chr92235 52 ------
NM_153188chr594922 4741 4735 3804 3663 2029 1978 1939 319 23501 1361 ----
NM_153201chr111171 --128 --
NM_153207chr1232537 2477 1439 24056 1235 11084 --
NM_153218chr131323 ------
NM_153223chr511475 ------
NM_153260chr1531293 1159 1112 ------
NM_153261chr1611290 --21072 636 --
NM_153262chr153093 3035 2587 561 520 12206 --22075 232
NM_153273chr3----157 --
NM_153321chr172226 145 ------
NM_153322chr172226 145 ------
NM_153353chr3143 ------
NM_153354chr52619 348 1199 ----
NM_153367chr1073648 3289 3196 3067 2734 906 593 --1186 --
NM_153371chr1321701 74 12267 --11808
NM_153426chr41636 ------
NM_153427chr41636 ------
NM_153450chr111340 ------
NM_153456chr1355271 4257 2497 2204 1284 36265 1808 799 --22346 607
NM_153464chr193789 151 107 ------
NM_153487chr644276 3661 2941 60 --11369 --
NM_153499chr1262779 1172 516 408 372 27 ----12445
NM_153500chr1262779 1172 516 408 372 27 ----12445
NM_153605chr331505 634 63 ------
NM_153607chr593144 2030 898 891 496 406 392 175 57 --23171 123 --
NM_153616chr1522125 642 --11881 --
NM_153617chr1522125 642 --11881 --
NM_153618chr1522125 642 --11881 --
NM_153619chr1523363 52 --23119 503 --
NM_153633chr121542 ------
NM_153634chr1231488 295 206 --11366 --
NM_153645chr2263234 3206 2476 2229 38 29 ------
NM_153649chr122234 772 --1506 --
NM_153689chr261813 1719 893 800 673 98 22072 317 1291 --
NM_153712chr242620 928 711 74 --12490 --
NM_153758chr11316 ------
NM_153759chr231130 910 371 ------
NM_153809chr91578 ------
NM_153810chr1055110 4476 3804 3781 3198 11713 44521 3922 3838 190 --
NM_153812chr111640 12345 --1315
NM_153825chr411602 2240 160 ----
NM_153828chr24924 884 747 95 ----1841
NM_170606chr7----1321 --
NM_170607chr1721545 1094 --11118 --
NM_170665chr124790 509 324 56 11648 2777 684 11693
NM_170674chr1511207 ------
NM_170675chr151883 ------
NM_170676chr151883 ------
NM_170677chr1511207 ------
NM_170679chr53348 143 38 175 11074 --
NM_170692chr131091 457 316 2302 95 ----
NM_170706chr153956 3020 1611 1489 605 14334 ----
NM_170721chr1751343 1243 1188 1016 239 135 1177 --
NM_170724chr63354 278 120 11000 ----
NM_170731chr1142649 2083 961 255 --1512 --
NM_170732chr1142649 2083 961 255 --1512 --
NM_170733chr1142649 2083 961 255 --1512 --
NM_170734chr1142649 2083 961 255 --1512 --
NM_170735chr1142649 2083 961 255 --1512 --
NM_170750chrX1355 ------
NM_170775chr51220 1209 ----
NM_171825chr51737 --128 --
NM_171998chrX32270 2216 197 ------
NM_172037chr841408 1332 1241 1043 --176 --
NM_172058chr871685 1649 1528 1358 1352 653 125 ------
NM_172059chr871685 1649 1528 1358 1352 653 125 ------
NM_172060chr871685 1649 1528 1358 1352 653 125 ------
NM_172070chr212235 ----11615
NM_172071chr1107344 6851 6758 5895 5035 4550 2876 2079 1564 1080 --11397 --
NM_172127chr431356 747 378 11661 2720 217 11514
NM_172128chr431312 703 334 11617 2676 173 11470
NM_172159chr321739 673 1461 1240 --
NM_172160chr321739 673 1461 1240 --
NM_172164chr1--1709 ----
NM_172169chr1021311 245 --1650 --
NM_172170chr1021311 245 --1650 --
NM_172171chr1021311 245 --1650 --
NM_172173chr1021311 245 --1650 --
NM_172196chr21135 ------
NM_172226chr1262779 1172 516 408 372 27 ----12445
NM_172315chr1511207 ------
NM_172316chr1511207 ------
NM_172337chr142924 889 --1372 --
NM_172344chr231615 1197 99 --1756 --
NM_172373chr1331056 304 30 3938 261 113 ----
NM_172387chr1841301 1267 1112 454 ------
NM_172388chr1841348 1314 1159 501 ------
NM_172389chr1841348 1314 1159 501 ------
NM_173054chr73858 839 47 ------
NM_173078chrX1436 ------
NM_173082chr61522 1479 ----
NM_173083chr1----3219 167 38 --
NM_173084chr36960 809 779 572 270 134 ----147
NM_173156chr141708 1415 1407 419 --11656 --
NM_173171chr221138 452 2327 182 ----
NM_173172chr211446 2635 490 132 --
NM_173173chr221138 452 2327 182 ----
NM_173198chr921863 372 21957 278 12933 --
NM_173199chr9187 --1169 --
NM_173200chr921863 372 21957 278 12933 --
NM_173214chr1698059 7764 7618 7426 7170 6763 5195 2408 1569 77877 6660 2919 2846 2418 342 269 26429 401 25187 3143
NM_173354chr2121945 1879 --1368 --
NM_173355chr22855 376 ------
NM_173359chr321683 324 --1528 --
NM_173468chr465917 5414 5246 2262 91 26 1172 --15082
NM_173469chr1571352 1242 1020 561 490 380 36 1526 11431 --
NM_173470chrX62766 2753 2544 2066 1068 1012 ------
NM_173473chr1021999 1735 1110 ----
NM_173475chr163707 563 444 ------
NM_173477chr1711958 --1447 --
NM_173478chr171300 1870 ----
NM_173491chr52368 49 ------
NM_173494chrX3869 636 74 ------
NM_173495chrX41918 367 359 116 12274 1426 --
NM_173496chr1042914 2203 1957 965 ----11065
NM_173508chr13900 883 364 ----11086
NM_173510chr2252356 2120 655 310 249 1500 11934 --
NM_173511chr233940 3047 565 33899 2954 892 ----
NM_173515chr61317 --1337 --
NM_173517chr71413 ----1319
NM_173519chr832039 1711 532 ------
NM_173548chr192529 163 ------
NM_173550chr9152 ------
NM_173552chr332337 1798 669 32115 1678 282 ----
NM_173557chr181196 1501 ----
NM_173560chr61512 --2408 120 --
NM_173563chr62293 122 ------
NM_173576chr1041612 931 500 144 ------
NM_173582chr11135613 5336 4562 4556 4370 4133 3914 2078 2038 1870 1648 1430 480 22049 463 ----
NM_173609chr15----1110 --
NM_173631chr1911190 1943 1858 --
NM_173642chr1149188 9142 8561 8485 8234 7565 6964 6750 2879 2306 1774 1104 656 292 --13443 --
NM_173644chr2052003 1954 1886 1651 656 11754 11843 --
NM_173645chr21130 1140 ----
NM_173654chr322345 2307 1140 --1189
NM_173665chr5--1200 ----
NM_173667chr542328 2155 1664 275 ------
NM_173683chr831736 1661 1302 ------
NM_173694chrX52513 1968 1762 1748 687 --12266 --
NM_173794chrX2381 335 ------
NM_173797chr52231 89 --11375 --
NM_173803chr1641645 1394 1386 386 --11526 --
NM_173808chr173908 3457 3399 474 352 210 140 13386 --14424
NM_173822chr251961 1913 1613 82 55 ------
NM_173825chr362776 2629 2068 1038 723 518 --2405 364 --
NM_173830chr63896 703 188 --1246 --
NM_173848chr82810 143 ------
NM_173851chr833594 1562 1216 12450 ----
NM_173872chr44730 300 290 193 ------
NM_174890chr102274 239 ------
NM_174900chr441203 1177 99 69 ------
NM_174916chr1552354 1981 1857 1645 159 ------
NM_174921chr431116 394 127 ------
NM_175056chr342214 1371 419 309 1174 ----
NM_175061chr761967 1903 1445 318 306 45 ------
NM_175607chr341169 1077 1055 88 11716 ----
NM_175612chr341169 1077 1055 88 11716 ----
NM_175613chr3188 ------
NM_175619chr42157 138 ------
NM_175623chr12147687 7502 6897 6121 5376 5101 4840 4793 2920 2668 2281 2096 1201 125 --27475 6810 11282
NM_175624chr12147782 7597 6992 6216 5471 5196 4935 4888 3015 2763 2376 2191 1296 220 --27570 6905 11377
NM_175625chr12147782 7597 6992 6216 5471 5196 4935 4888 3015 2763 2376 2191 1296 220 --27570 6905 11377
NM_175629chr231130 910 371 ------
NM_175634chr821162 378 1372 ---