TargetMiner : Prediction of miRNA Targets

miRNA ID: hsa-miR-3910
miRNA Sequence: AAAGGCAUAAAACCAAGACA

mRNAChromosome6mer (count)6mer (position)7mer-A1 (count)7mer-A1 (position)7mer-m8 (count)7mer-m8 (position)8mer (count)8mer (position)
NM_001122679chr51862 1110 ----
NM_000016chr11168 1616 ----
NM_000037chr822356 1907 --1999 --
NM_000038chr551956 1814 1308 516 166 2522 300 ----
NM_000051chr1173313 1391 1352 1029 930 751 197 --22423 1268 --
NM_000052chrX63150 2617 2278 2145 1148 586 33108 2485 528 53079 2942 2164 608 390 13272
NM_000055chr31321 ------
NM_000074chrX1355 ------
NM_000081chr141544 616 530 499 11163 --11408
NM_000084chrX196717 6679 6385 6350 5406 4770 4612 4584 2743 2688 2332 1897 1686 1665 1316 1160 620 449 272 36952 2203 943 26522 5277 --
NM_000087chr42128 34 ------
NM_000090chr23861 769 238 --1199 --
NM_000091chr242682 2228 367 356 11889 --11900
NM_000103chr154523 374 324 288 ------
NM_000109chrX22123 688 22657 418 --12633
NM_000110chr12859 164 1275 ----
NM_000112chr5145364 5187 5066 4212 4080 3554 3496 3467 3430 2167 1472 1087 758 26 21587 1569 34904 1336 683 14268
NM_000125chr694187 3934 3827 3777 3432 2708 1679 725 179 1917 24044 3205 --
NM_000129chr631190 565 87 --1164 --
NM_000133chrX31171 1105 120 ------
NM_000138chr1522638 327 --22095 1842 --
NM_000141chr1051341 1238 585 304 73 ----1981
NM_000163chr532357 1616 180 1260 1133 --
NM_000165chr631260 1237 1169 --11495 --
NM_000167chrX2734 444 ------
NM_000168chr7113303 2988 2748 2703 2384 2369 2282 731 715 702 199 12873 11225 --
NM_000170chr93446 199 38 ------
NM_000176chr573951 3766 3470 2959 2392 994 496 126 ----
NM_000192chr1241575 1504 1354 393 11552 ----
NM_000217chr1275038 4482 1758 1692 1656 1270 313 --34094 3249 341 --
NM_000222chr451850 1813 1578 1555 128 --11976 --
NM_000227chr18----1289 --
NM_000228chr1148 --179 --
NM_000240chrX52235 2186 2172 1861 1584 ------
NM_000248chr352932 840 345 300 202 1491 --1123
NM_000252chrX31066 401 143 ------
NM_000253chr41768 ------
NM_000254chr142525 316 180 21 22351 67 1638 --
NM_000259chr15115852 5557 5113 4670 4277 4157 2018 1315 815 650 300 24904 2175 45449 5208 4002 2107 --
NM_000264chr953373 2873 2721 990 669 --13005 --
NM_000266chrX2934 153 ------
NM_000267chr1743133 2746 372 186 --11111 12965
NM_000269chr173233 180 24 ------
NM_000278chr1031887 816 106 ------
NM_000280chr112685 639 ------
NM_000288chr61259 --193 --
NM_000304chr1741072 973 815 232 ------
NM_000314chr1063201 3007 2903 2613 2079 1029 ------
NM_000317chr112365 125 ------
NM_000319chr1241097 451 360 280 ------
NM_000321chr1341718 1694 618 348 21711 282 ----
NM_000332chr6136707 6331 5730 5371 5298 4617 2766 2333 1405 1236 990 737 281 12021 24472 176 --
NM_000333chr32234 178 --189 --
NM_000334chr17102213 1964 1865 1728 1710 1576 1485 641 108 63 ----1462
NM_000335chr332028 1563 839 --11864 --
NM_000337chr596633 6506 5762 5604 4916 2256 1402 1210 835 14524 14813 11410
NM_000340chr341490 1231 977 583 21412 1159 ----
NM_000345chr41378 1892 ----
NM_000346chr1731867 1681 607 21505 736 11360 --
NM_000353chr161141 ------
NM_000362chr2293589 3379 3145 2996 1373 1289 776 660 95 --1814 --
NM_000368chr964644 1903 526 488 373 184 ----13825
NM_000369chr1441854 1765 1271 580 ------
NM_000376chr1273054 2650 2607 1186 1146 297 24 1805 --13199
NM_000378chr1141130 237 166 57 ------
NM_000386chr172514 285 1160 ----
NM_000387chr32583 531 1151 ----
NM_000389chr621467 1258 291 71 ----
NM_000390chrX63347 2945 2843 2152 853 518 ------
NM_000391chr1171765 1685 1662 1604 1493 522 250 2444 207 ----
NM_000393chr251988 1856 1365 1309 145 1607 21348 535 --
NM_000397chrX12414 ------
NM_000399chr101863 2913 293 11013 --
NM_000408chr273179 3089 2717 2632 2439 2142 108 --11274 --
NM_000411chr2173011 2982 2369 2027 777 581 471 --11213 --
NM_000424chr12124 --1357 --
NM_000428chr1452474 2347 278 222 131 ------
NM_000430chr1753804 2643 2554 1276 370 --1711 11248
NM_000437chr132096 1646 1506 --1696 --
NM_000439chr582222 1815 1720 1576 715 422 101 38 --12326 --
NM_000447chr11429 --1398 --
NM_000448chr1162888 2384 2014 1162 912 431 --12660 1933
NM_000449chr121042 432 ------
NM_000450chr121313 1251 --1118 --
NM_000459chr93586 228 77 --1926 --
NM_000461chr333188 1615 1136 11478 24335 1570 --
NM_000462chr1551428 738 521 163 157 --21684 1557 --
NM_000480chr1141443 1200 287 108 1420 ----
NM_000484chr2141067 1038 401 157 ----1381
NM_000486chr1273146 2846 2483 2301 1988 1005 365 ------
NM_000489chrX42425 2405 851 310 1528 23409 2887 --
NM_000492chr721464 1083 ------
NM_000495chrX2776 450 ------
NM_000503chr82674 146 ------
NM_000522chr731226 82 58 ------
NM_000523chr211118 --1741 --
NM_000527chr1962318 1757 1612 1547 694 527 ----12472
NM_000531chrX2334 309 --1135 --
NM_000533chrX31243 240 88 --1402 --
NM_000539chr321473 299 ------
NM_000555chrX197635 6571 5898 5711 5687 5300 4821 2936 2275 2048 1849 1506 1423 1335 1200 968 606 298 97 17019 1859 --
NM_000565chr142142 1855 1789 71 21554 488 ----
NM_000590chr5----1130 --
NM_000598chr721452 163 --21073 553 141
NM_000599chr264601 3735 3242 3235 3210 2810 --11851 --
NM_000601chr72333 43 ------
NM_000609chr1032254 795 270 23047 258 2869 760 --
NM_000610chr1151918 1110 516 441 195 --12835 11122
NM_000611chr11146689 6128 5849 5560 5484 5177 2498 1965 1918 1492 1347 703 618 251 16802 11282 12779
NM_000615chr1152622 969 785 150 143 1846 12499 --
NM_000618chr1296141 5855 5154 2503 2032 1972 1269 664 168 16399 25092 1063 --
NM_000618chr1296141 5855 5154 2503 2032 1972 1269 664 168 16399 25092 1063 --
NM_000619chr122475 379 1400 ----
NM_000633chr18114935 4278 4139 3856 3572 3454 1085 954 557 355 291 11806 14485 --
NM_000637chr81514 1471 ----
NM_000676chr171216 ------
NM_000679chr51152 ------
NM_000686chrX41242 491 315 43 ----1613
NM_000693chr1531426 662 187 --21592 343 --
NM_000700chr91252 ------
NM_000702chr121907 1507 11874 ----
NM_000719chr12116750 6412 6377 6109 4687 4535 2578 1763 787 350 71 ------
NM_000721chr162304 2285 2229 2106 797 354 1184 ----
NM_000723chr1741494 1191 1065 562 --1122 11717
NM_000724chr1041878 1799 1641 111 2677 496 ----
NM_000726chr211075 11329 11489 --
NM_000735chr6122 ------
NM_000780chr8--1514 21125 1050 --
NM_000792chr11970 ------
NM_000793chr1475055 4056 4023 3508 3424 3290 399 --23555 318 --
NM_000801chr202956 62 11116 ----
NM_000806chr51503 297 83 --1694
NM_000807chr42626 215 ------
NM_000809chr4129036 8379 8146 7810 7784 6207 5741 5648 3303 2523 1792 1178 16469 151 --
NM_000810chr152495 148 ------
NM_000811chr52281 92 ------
NM_000813chr543624 2170 1661 1379 1979 35457 1628 625 13782
NM_000814chr1563935 3824 3024 1665 680 405 12666 21194 361 --
NM_000816chr53632 566 58 ------
NM_000817chr2----21029 37 --
NM_000824chr41950 1803 ----
NM_000826chr442264 1687 1035 823 1194 12552 --
NM_000827chr592274 2163 2145 2128 1999 1977 1847 1830 626 1361 ----
NM_000828chrX51540 1509 1402 814 228 1173 1716 --
NM_000829chr1132312 583 369 127 12171 --
NM_000831chr1106025 5835 5525 5387 5264 2342 1956 1023 499 260 ------
NM_000838chr672753 2562 2376 2004 1795 1754 384 1157 --11979
NM_000841chr65876 826 793 368 91 ------
NM_000844chr3--2336 163 1897 --
NM_000859chr551560 1429 1397 1219 92 1208 ----
NM_000860chr441577 1299 1063 277 ------
NM_000864chr12970 60 ------
NM_000868chrX41797 615 508 156 22571 2501 ----
NM_000870chr561277 645 461 368 253 36 1438 11370 --
NM_000872chr1051053 982 317 260 82 ------
NM_000875chr15147036 6618 6445 6284 6260 4914 4713 4540 2823 2380 2199 1959 1733 947 --45883 4829 1455 1371 --
NM_000876chr6298 83 1327 ----
NM_000880chr82610 90 ------
NM_000891chr1773612 1448 1416 902 786 318 190 1374 --13683
NM_000899chr1243770 1745 1271 352 --33795 1401 702 --
NM_000901chr442529 2365 1958 960 21977 30 1639 --
NM_000902chr3103259 3252 2895 2460 2383 2310 1073 635 608 235 ------
NM_000909chr461335 1173 950 239 147 132 ------
NM_000912chr823538 385 12547 ----
NM_000917chr101397 1841 --1386
NM_000919chr51207 ----1571
NM_000922chr113432 393 294 --1441 --
NM_000924chr1231084 921 854 ------
NM_000933chr2051521 1358 1148 516 136 1671 --1328
NM_000935chr331010 810 181 --1251 --
NM_000937chr171380 --1120 --
NM_000938chr4145 --1133 --
NM_000944chr452077 1686 1601 638 243 --1231 --
NM_000945chr22537 36 --11852 --
NM_000950chrX93561 3292 3126 2957 2822 2756 2366 2237 887 2979 328 23120 1004 --
NM_000963chr182496 2443 2330 2088 1568 639 511 42 ----11782
NM_000965chr34966 475 392 381 --11246 --
NM_000983chr131000 511 338 --11580 --
NM_001001132chr2141191 1155 319 133 ------
NM_001001323chr1293122 2885 2635 2514 2469 1936 1187 476 385 13184 21197 961 --
NM_001001331chr352501 1813 1725 740 484 ------
NM_001001342chr1011475 --21349 239 155
NM_001001389chr1151918 1110 516 441 195 --12835 11122
NM_001001390chr1151918 1110 516 441 195 --12835 11122
NM_001001391chr1151918 1110 516 441 195 --12835 11122
NM_001001392chr1151964 1156 562 487 241 --12881 11168
NM_001001395chr1272606 2521 2299 2187 1855 842 810 --22339 422 --
NM_001001396chr193878 3796 2925 1745 1490 1344 1076 858 851 13688 13315 --
NM_001001419chr5105176 5119 4680 4136 2059 1900 1449 1069 920 796 13849 2998 276 --
NM_001001420chr5105176 5119 4680 4136 2059 1900 1449 1069 920 796 13849 2998 276 --
NM_001001433chr2053090 3001 2901 2733 371 ------
NM_001001436chr162745 349 ------
NM_001001481chr812797 --1199 --
NM_001001483chr112427 372 ------
NM_001001484chr104898 430 173 144 1832 ----
NM_001001523chr12995 532 ------
NM_001001549chr752757 2566 2546 1058 750 1967 12452 --
NM_001001550chr752757 2566 2546 1058 750 1967 12452 --
NM_001001555chr752757 2566 2546 1058 750 1967 12452 --
NM_001001556chr1531479 224 163 ------
NM_001001557chr831821 776 764 1352 1543 --
NM_001001560chr221528 1759 ----
NM_001001567chr211190 ------
NM_001001568chr211190 ------
NM_001001571chr211190 ------
NM_001001572chr211190 ------
NM_001001573chr211190 ------
NM_001001574chr211190 ------
NM_001001575chr211190 ------
NM_001001576chr211190 ------
NM_001001577chr211190 ------
NM_001001579chr211190 ------
NM_001001580chr211190 ------
NM_001001581chr211190 ------
NM_001001582chr211190 ------
NM_001001584chr211190 ------
NM_001001585chr211190 ------
NM_001001664chr2113784 3734 3173 2879 2771 1309 1140 893 620 269 233 1929 --13085
NM_001001665chr282583 2511 2310 1312 961 472 266 113 13239 13428 --
NM_001001668chr1953519 3388 1189 580 38 12813 11677 13808
NM_001001669chr552472 2453 851 326 221 12494 12249 --
NM_001001740chr1192 ------
NM_001001740chr1192 ------
NM_001001787chr1379 64 47 1164 ----
NM_001001890chr21104046 4016 3641 3559 3207 3110 1475 1387 600 333 --13362 --
NM_001001924chr821321 294 21672 1476 ----
NM_001001925chr821321 294 21672 1476 ----
NM_001001928chr2286903 3288 1726 1327 1248 743 550 360 58341 7937 2315 866 300 26470 6039 --
NM_001001931chr821321 294 21672 1476 ----
NM_001001936chr104992 471 390 60 2375 298 11121 --
NM_001001938chr974038 3978 3262 3203 3116 2611 1296 11631 23609 2832 --
NM_001001971chr101281 ------
NM_001001974chr1042324 895 473 342 31524 703 653 12296 --
NM_001001995chrX41867 1470 1460 1258 1763 ----
NM_001002032chr17128 ------
NM_001002033chr173534 128 47 ------
NM_001002233chr851572 1551 1425 225 74 --1602 --
NM_001002243chr2131 --1273 1691
NM_001002257chr243536 3136 874 748 33324 3146 1426 ----
NM_001002258chr231974 1407 596 --1617 11911
NM_001002264chr13199 --161 --
NM_001002295chr1031113 966 792 ------
NM_001002814chr8143851 3438 3295 3065 2857 2727 1572 1551 1425 1165 1030 917 225 74 23694 1328 1602 --
NM_001002838chrX1742 1511 --1280
NM_001002843chr1541206 1180 1148 518 --1822 --
NM_001002860chr14114389 4112 3950 3717 3617 1337 1238 1228 988 212 26 --11369 --
NM_001002876chr221367 ------
NM_001002909chr17102116 2022 1838 1648 1429 1385 835 430 327 168 ------
NM_001002914chr1711291 ------
NM_001003406chr2243059 2931 695 449 --11020 --
NM_001003407chr1035028 4981 1217 15142 34339 3744 1598 --
NM_001003408chr1035028 4981 1217 15142 34339 3744 1598 --
NM_001003652chr18128623 7367 6638 3345 2884 2580 1925 1829 1580 1467 553 473 46465 6441 3142 875 48489 2976 2748 2362 22100 249
NM_001003665chr121385 164 --13245 --
NM_001003674chr18105626 5126 5117 4963 4946 4928 4853 2690 2107 646 15446 44683 4664 1269 279 --
NM_001003675chr18105626 5126 5117 4963 4946 4928 4853 2690 2107 646 15446 44683 4664 1269 279 --
NM_001003676chr1121048 334 ------
NM_001003677chr111604 ------
NM_001003681chr2261895 1758 1481 1315 779 180 3419 410 281 ----
NM_001003682chr121397 330 --1586 --
NM_001003712chr1253019 2789 1525 1400 606 23550 794 12782 11316
NM_001003790chr82582 208 1303 ----
NM_001003791chr82582 208 1303 ----
NM_001003792chr33943 415 36 1782 ----
NM_001003793chr33943 415 36 1782 ----
NM_001003800chr983704 3480 2966 2721 1241 1137 783 699 --13610 --
NM_001003805chr14163 1106 ----
NM_001003810chr44720 655 225 196 1324 ----
NM_001003845chr24509 476 470 147 ------
NM_001003891chr222131 118 ------
NM_001003940chr1532779 847 83 22346 469 ----
NM_001003942chr1532779 847 83 22346 469 ----
NM_001003943chr1532783 851 87 22350 473 ----
NM_001004051chrX161 ------
NM_001004065chr943931 2929 1589 944 ------
NM_001004196chr331098 1080 502 1817 1936 --
NM_001004298chr101795 ------
NM_001004304chr1242888 2740 2559 1023 --22261 770 --
NM_001004308chrX31266 526 387 ------
NM_001004317chr694465 4427 4164 1713 1287 782 660 316 214 23922 3869 14223 24474 3811
NM_001004329chr1211496 ----1132
NM_001004342chr1125795 5018 4759 4573 4060 3982 1636 1611 593 340 306 26 ------
NM_001004346chr421003 987 --11195 --
NM_001004360chr252007 1976 1699 644 472 --21686 772 --
NM_001004419chr1274250 4156 3035 1594 827 552 71 14113 --1401
NM_001004441chr521372 233 --41602 1514 1410 1071 --
NM_001004720chr21662 ------
NM_001004722chr22831 50 ------
NM_001005158chr31394 165 ----
NM_001005159chr31394 165 ----
NM_001005209chr22671 636 ------
NM_001005366chr122759 46 ------
NM_001005375chrY31851 1739 1608 ------
NM_001005386chr241695 908 243 142 --2349 37 --
NM_001005404chr1784422 4313 3762 3592 3357 2797 721 191 --21747 1258 --
NM_001005417chr1--1702 ----
NM_001005463chr1062105 2027 946 658 394 318 11008 --11695
NM_001005473chr596643 6492 5928 5414 5113 4941 4733 4650 2332 1457 15559 --
NM_001005474chr321354 261 21058 83 11543 --
NM_001005609chrX83731 3609 2846 1469 869 829 663 500 ------
NM_001005611chrX1119 ------
NM_001005732chr21164 ------
NM_001005733chr21164 ------
NM_001005739chr2171 --1351 --
NM_001005743chr143831 238 202 11337 ----
NM_001005744chr143831 238 202 11337 ----
NM_001005745chr143831 238 202 11337 ----
NM_001005746chr211075 11329 11489 --
NM_001005747chr211075 11329 11489 --
NM_001005751chr102476 167 ------
NM_001005782chr23933 817 781 ------
NM_001005849chr171509 ------
NM_001005861chr34658 359 110 38 1128 173 1139
NM_001005910chr34515 482 441 270 2565 225 ----
NM_001005911chr34515 482 441 270 2565 225 ----
NM_001006115chr352706 2478 2122 1881 91 1246 ----
NM_001006600chr5----21588 661 --
NM_001006612chrX2184 48 ------
NM_001006613chrX2184 48 ------
NM_001006614chrX2184 48 ------
NM_001006617chr931061 288 232 --11314 --
NM_001006619chr931061 288 232 --11314 --
NM_001006620chr931061 288 232 --11314 --
NM_001006621chr931061 288 232 --11314 --
NM_001006623chr272497 2464 2249 697 538 247 159 12332 1483 --
NM_001006657chr273151 3121 2736 2672 2301 2236 1061 12346 32721 866 496 --
NM_001006665chr13290 162 56 ------
NM_001006933chrX155 ----188
NM_001006935chrX--136 ----
NM_001006936chrX--136 ----
NM_001006937chrX--136 ----
NM_001006946chr251437 1381 1292 1191 338 ------
NM_001007023chr1475055 4056 4023 3508 3424 3290 399 --23555 318 --
NM_001007024chr17104306 3579 1632 1617 1512 731 570 385 247 88 23896 2672 ----
NM_001007025chr17104306 3579 1632 1617 1512 731 570 385 247 88 23896 2672 ----
NM_001007027chr111190 ------
NM_001007067chr821074 436 --1275 --
NM_001007068chr821074 436 --1275 --
NM_001007069chr821074 436 --1275 --
NM_001007070chr821074 436 --1275 --
NM_001007075chr43988 840 121 1906 ----
NM_001007097chr994356 4017 3630 3202 3090 1302 907 340 262 1681 --21775 1152
NM_001007098chr16918 825 378 210 132 70 1153 ----
NM_001007099chr12690 194 --1864 --
NM_001007100chr12690 194 --1864 --
NM_001007102chr611440 138 ----
NM_001007214chr151901 1197 427 347 177 ------
NM_001007224chr74881 472 277 244 --11842 12044
NM_001007226chr1741215 1206 1135 348 ------
NM_001007227chr1741215 1206 1135 348 ------
NM_001007228chr1741215 1206 1135 348 ------
NM_001007229chr1741215 1206 1135 348 ------
NM_001007230chr1741215 1206 1135 348 ------
NM_001007237chr182609 2376 1932 983 973 839 774 584 ------
NM_001007246chr21----11191 11881
NM_001007267chr22249 173 ------
NM_001007466chr665129 5025 4323 3949 855 184 1426 33273 1222 1132 --
NM_001007467chr22----1107 --
NM_001007471chr9--196 2704 126 --
NM_001007527chr52701 547 3715 501 230 ----
NM_001007553chr121187 873 1412 --1460
NM_001007559chr1832007 1909 521 ------
NM_001008220chr553838 3625 3157 2579 1244 ------
NM_001008225chr73709 131 86 ------
NM_001008239chr18113182 3132 3018 2910 2739 2723 2369 1478 696 563 297 ------
NM_001008392chr3113359 3228 3221 3028 2877 2301 1060 782 403 231 136 22401 482 ----
NM_001008407chr741825 1723 1389 620 --11553 --
NM_001008408chr7146040 5948 5514 5426 5398 5276 5081 4817 4721 4697 4554 1730 1066 465 11162 14713 --
NM_001008410chr272171 2153 2077 1755 1503 843 600 --12235 --
NM_001008495chr83426 321 219 ------
NM_001008539chr885203 4230 3966 3893 1350 1113 926 277 25360 1119 15379 --
NM_001008540chr21120 ------
NM_001008564chr1322280 2227 11579 ----
NM_001008660chr1151600 1524 1170 1118 238 ------
NM_001008707chr1411773 --1329 --
NM_001008738chr562836 2800 2150 1103 935 471 --1628 22819 2684
NM_001008777chr173568 496 21 ------
NM_001008783chr61649 1688 ----
NM_001008925chr433342 2872 2313 1498 --21121 633
NM_001009552chr82121 23 ------
NM_001009554chr4104605 4530 3608 3349 3341 3287 1440 1408 450 364 --1292 14754
NM_001009554chr4104605 4530 3608 3349 3341 3287 1440 1408 450 364 --1292 14754
NM_001009566chr121137 32 ------
NM_001009899chr396190 5572 5247 4505 4267 4256 2376 1831 1176 15384 34992 4608 621 --
NM_001009955chr1----1442 --
NM_001009955chr1----1442 --
NM_001009959chr252656 2052 656 494 316 --1664 182
NM_001009960chr722827 860 ------
NM_001009993chr284360 3672 3277 3182 3026 1168 920 703 23444 945 1845 13821
NM_001009996chr32498 110 ------
NM_001010000chr1883033 2869 2814 2641 2404 1057 989 480 33215 2436 924 23451 741 --
NM_001010853chr672657 2472 2073 1170 815 506 77 --12394 --
NM_001010861chr12637 190 --11932 12021
NM_001010862chrX63299 3047 2855 2708 395 69 ------
NM_001010867chr1136709 6102 5654 4878 4841 4757 2451 2238 1898 1693 1621 476 394 22465 1551 ----
NM_001010888chrX74531 4100 3450 3399 3263 1862 1175 14345 14235 13679
NM_001010891chr586109 2328 2074 924 764 545 464 293 21233 272 26283 741 --
NM_001010895chr941759 1646 395 82 --1121 11523
NM_001010897chr13----1390 --
NM_001010927chr6--1391 ----
NM_001010932chr72333 43 ------
NM_001010934chr71277 ------
NM_001010971chr11994 --1872 --
NM_001010984chr141712 995 747 538 11963 ----
NM_001010986chrX52494 2449 1883 930 83 --22171 530 --
NM_001010989chr161491 1509 2208 130 --
NM_001010990chr161491 1509 2208 130 --
NM_001011513chr4104052 4010 3230 2764 2756 2717 2533 1291 1022 983 23997 839 --1394
NM_001011515chr431038 953 785 195 1946 --
NM_001011516chr431038 953 785 195 1946 --
NM_001011537chr362055 1841 1743 1562 1502 455 12294 22118 1692 --
NM_001011546chr205742 694 673 217 108 ------
NM_001011658chrX22096 1667 ------
NM_001011663chr101408 --1953 --
NM_001011666chr7176064 6051 5430 5207 4751 4652 4614 4502 2551 2112 1837 1715 1485 847 811 229 154 11536 ----
NM_001011713chr1481547 1302 1157 1046 1029 601 578 78 11111 --1536
NM_001011724chr131327 ------
NM_001011725chr131327 ------
NM_001011885chr1521718 350 11656 ----
NM_001012267chr921413 412 1699 ----
NM_001012329chr132311 2174 607 2753 359 ----
NM_001012393chr11104507 4190 3684 3545 3320 2030 1810 1345 885 156 13377 --14960
NM_001012398chr16--1203 --1781
NM_001012410chr31438 ------
NM_001012418chr6124226 3940 3722 3658 3255 3205 3147 2976 1123 632 337 164 --31379 447 90 --
NM_001012446chr9--175 ----
NM_001012514chr23827 259 124 --11082 --
NM_001012516chr23827 259 124 --11082 --
NM_001012614chr4--1490 ----
NM_001012732chr41257 1198 21027 64 --
NM_001012751chr1061526 1302 1215 504 223 139 3727 551 77 ----
NM_001012754chr1341889 1796 492 459 11664 12002 --
NM_001012755chrX74651 3627 1794 1774 1647 1339 412 --14728 --
NM_001012761chr532576 2535 550 --1874 --
NM_001012968chrX52017 887 833 712 197 --32775 2195 457 --
NM_001012977chrX31426 1064 468 ------
NM_001012979chrX2165 55 188 ----
NM_001012989chrX1256 --1163 --
NM_001013031chr10133528 3311 3280 3026 2781 2400 2220 1100 1081 1062 757 534 182 12984 ----
NM_001013398chr721452 163 --21073 553 141
NM_001013399chr61839 --168 --
NM_001013406chr711182 ------
NM_001013437chr182115 66 1382 150 1332
NM_001013620chr12148425 8011 7040 5703 5311 5123 3319 2835 1656 1055 1028 893 590 323 --38333 6917 3351 --
NM_001013635chr124904 341 92 37 --21179 915 --
NM_001013642chr12997 218 1913 ----
NM_001013693chr172921 2237 2142 1102 903 616 232 ------
NM_001013693chr172921 2237 2142 1102 903 616 232 ------
NM_001013703chr15--1384 1501 --
NM_001013843chr152920 140 ------
NM_001014283chr1331467 203 164 ------
NM_001014443chr1191 ------
NM_001014444chr16132 ------
NM_001014445chr1741000 743 736 56 ------
NM_001014797chr10108183 7505 7308 5600 2838 2689 1418 980 827 286 ------
NM_001014831chr191819 ------
NM_001014832chr191819 ------
NM_001014834chr191819 ------
NM_001014835chr191819 ------
NM_001015045chr411905 22413 163 11628 --
NM_001015048chr1462849 2769 1971 1151 723 146 12745 23182 1274 --
NM_001015049chr1462849 2769 1971 1151 723 146 12745 23182 1274 --
NM_001015053chr1751535 636 462 370 210 ----1402
NM_001015508chr82646 518 ------
NM_001015877chrX42892 2409 984 627 22551 2194 1147 --
NM_001015880chr1061704 1668 1548 1515 1499 1160 11604 2360 71 --
NM_001015881chrX1812 --1883 --
NM_001015887chr361751 1461 1446 1366 400 324 11372 ----
NM_001017368chr1762303 2180 2050 376 304 155 32824 460 29 11833 --
NM_001017371chr21872 ----1147
NM_001017395chr393279 2852 2699 1358 1248 1068 969 464 396 22504 2220 ----
NM_001017396chr221374 826 21438 66 ----
NM_001017402chr1148 --179 --
NM_001017405chr41230 ------
NM_001017415chr12517 306 ------
NM_001017416chr12517 306 ------
NM_001017423chr104701 575 314 131 157 ----
NM_001017424chr12238 191 1480 1246 --
NM_001017425chr12238 191 1480 1246 --
NM_001017434chr13476 277 174 ------
NM_001017440chr7167264 7068 6991 6884 6407 5180 2798 2780 1952 1913 1638 1611 1512 1081 617 207 1217 ----
NM_001017523chr1231892 1811 23 1721 11430 --
NM_001017535chr1273054 2650 2607 1186 1146 297 24 1805 --13199
NM_001017922chr121719 423 --1620 --
NM_001017926chr841332 708 368 50 ----1509
NM_001017962chr101397 1841 --1386
NM_001017963chr141312 1684 1199 --
NM_001017977chr11371 ------
NM_001017999chr131767 860 682 ------
NM_001017999chr131767 860 682 ------
NM_001018000chr131767 860 682 ------
NM_001018000chr131767 860 682 ------
NM_001018001chr131767 860 682 ------
NM_001018003chr82475 256 ------
NM_001018004chr152487 447 ------
NM_001018005chr151142 ------
NM_001018006chr152487 447 ------
NM_001018007chr152487 447 ------
NM_001018008chr152467 105 ----1535
NM_001018009chr321032 981 11199 ----
NM_001018020chr152487 447 ------
NM_001018050chr2273415 3368 2776 2571 1117 943 562 --12661 --
NM_001018052chr2273415 3368 2776 2571 1117 943 562 --12661 --
NM_001018053chr181968 1798 1563 1451 1431 715 555 212 ------
NM_001018054chr141447 1166 973 25 --1428 --
NM_001018057chr113474 396 265 168 11289 --
NM_001018064chr921338 441 --1425 --
NM_001018065chr9125477 5033 4497 3971 1456 1404 947 741 618 415 167 65 34696 1365 1108 34473 3817 1476 11774
NM_001018066chr9125477 5033 4497 3971 1456 1404 947 741 618 415 167 65 34696 1365 1108 34473 3817 1476 11774
NM_001018067chr174930 3323 1711 1359 745 443 64 15056 ----
NM_001018068chr174930 3323 1711 1359 745 443 64 15056 ----
NM_001018069chr174930 3323 1711 1359 745 443 64 15056 ----
NM_001018072chr1231892 1811 23 1721 11430 --
NM_001018074chr573951 3766 3470 2959 2392 994 496 126 ----
NM_001018075chr573951 3766 3470 2959 2392 994 496 126 ----
NM_001018076chr573951 3766 3470 2959 2392 994 496 126 ----
NM_001018077chr573951 3766 3470 2959 2392 994 496 126 ----
NM_001018090chr1552484 556 527 315 148 12494 1358 --
NM_001018091chr1552594 666 637 425 258 12604 1468 --
NM_001018100chr15--1631 2725 637 --
NM_001018102chr1552484 556 527 315 148 12494 1358 --
NM_001018111chr763177 2450 1478 1082 428 212 13010 --23903 3090
NM_001018676chr81124 --131 --
NM_001018677chr81124 --131 --
NM_001020658chr121618 1612 --1643 --
NM_001020658chr121618 1612 --1643 --
NM_001020818chr1931464 1183 668 1689 ----
NM_001020819chr1931464 1183 668 1689 ----
NM_001020820chr1931464 1183 668 1689 ----
NM_001020821chr1931464 1183 668 1689 ----
NM_001020825chr541426 1241 945 434 ------
NM_001023567chr1562439 1663 1620 1559 355 183 12367 ----
NM_001023587chr311095 ------
NM_001024071chr141391 3806 397 215 ----
NM_001024094chr573951 3766 3470 2959 2392 994 496 126 ----
NM_001024218chr143646 302 245 ------
NM_001024226chr121091 834 142 ----
NM_001024227chr121091 834 142 ----
NM_001024228chr121091 834 142 ----
NM_001024372chr841986 921 832 22 21725 241 1729 --
NM_001024401chr1622734 639 11904 12800 --
NM_001024460chr64854 816 331 26 11122 ----
NM_001024465chr6158 ------
NM_001024647chr12157462 6812 6535 5288 5154 4978 3071 2879 2748 2107 1489 1224 1029 643 22 1911 11824 --
NM_001024649chr562873 2287 2072 1975 1913 1823 --1845 --
NM_001024668chr122790 698 ------
NM_001024736chr1531204 359 198 2406 268 31550 1434 1303 --
NM_001024808chr1242215 1098 859 423 11799 ----
NM_001024847chr362456 578 545 341 284 91 11609 1190 --
NM_001024855chr32160 123 ------
NM_001024934chr62486 95 1530 ----
NM_001024935chr62486 95 1530 ----
NM_001024936chr62486 95 1530 ----
NM_001024937chr172213 100 --1158 --
NM_001024947chr521104 751 ------
NM_001024948chr153144 2922 2434 2182 1347 52841 2260 2169 276 231 22500 223 --
NM_001024956chr1193847 3791 2044 1906 1718 1451 1344 344 209 24783 3562 24315 1366 --
NM_001024959chr35725 618 303 197 48 ------
NM_001024960chr35725 618 303 197 48 ------
NM_001025068chr361691 1591 1261 1132 652 486 --11462 1158
NM_001025069chr361691 1591 1261 1132 652 486 --11462 1158
NM_001025076chr1065934 5470 5206 4208 3794 2161 26053 4910 21790 139 --
NM_001025077chr1077292 6828 6564 5566 5152 4950 306 37411 6268 5025 11497 11045
NM_001025079chr353443 2523 1592 1362 730 13150 1302 --
NM_001025105chr51361 ------
NM_001025203chr21125 ------
NM_001025204chr21125 ------
NM_001025205chr33401 110 102 ------
NM_001025233chr1242649 1840 761 407 11818 ----
NM_001025252chr853200 2431 910 355 102 22875 312 ----
NM_001025253chr853200 2431 910 355 102 22875 312 ----
NM_001025266chr384918 3869 3653 3434 3399 3252 1953 908 ------
NM_001025356chr1262741 2560 1082 987 734 715 --22887 592 --
NM_001025366chr61466 ------
NM_001025366chr61466 ------
NM_001025367chr61466 ------
NM_001025367chr61466 ------
NM_001025368chr61466 ------
NM_001025368chr61466 ------
NM_001025369chr61482 ------
NM_001025369chr61482 ------
NM_001025370chr61466 ------
NM_001025370chr61466 ------
NM_001025389chr1141443 1200 287 108 1420 ----
NM_001025390chr1141443 1200 287 108 1420 ----
NM_001025580chrX83665 3477 3361 3052 1518 871 326 284 --12781 --
NM_001025595chr421647 1495 --11468 --
NM_001025596chr113387 134 68 ------
NM_001025603chr121042 432 ------
NM_001025616chr471544 1526 1479 1242 645 609 336 ------
NM_001025780chr931371 1057 107 --21588 310 --
NM_001029858chr643378 2982 696 207 ----13411
NM_001029875chr572393 2281 2143 1006 524 254 113 11012 21082 715 --
NM_001029884chr652511 2300 873 439 229 ------
NM_001029891chrX4792 768 746 298 ------
NM_001030006chr1762687 2614 2431 1747 637 586 ------
NM_001030007chr1673996 3322 3132 3084 2846 1380 529 23556 2441 --11504
NM_001030055chr1473557 3067 1791 1218 651 506 384 --1372 --
NM_001030287chr12467 86 ----1816
NM_001031623chr621347 127 1587 ----
NM_001031679chr1222943 2221 33455 3390 2984 13384 --
NM_001031684chr2168 ------
NM_001031690chr772565 2389 2336 990 431 406 24 ------
NM_001031692chr71307 ------
NM_001031695chr2295050 4345 3569 2187 2181 1919 617 292 204 24577 3947 1960 13336
NM_001031716chr21379 ------
NM_001031723chr41370 ------
NM_001031732chr433254 885 370 23675 3649 32320 1104 852 --
NM_001031804chr1653084 2853 2734 1180 898 22883 912 13715 --
NM_001031812chr5102298 2255 2128 1828 1463 1451 1438 768 231 53 1153 --11785
NM_001031855chrX1202 1194 ----
NM_001032221chr951714 1617 590 513 443 ------
NM_001032279chr111381 ------
NM_001032280chr641680 1403 1317 1149 --1582 --
NM_001032282chr8170 1947 ----
NM_001032296chr1352721 987 979 567 291 1375 ----
NM_001032363chr121383 541 11987 --2465 119
NM_001032363chr121383 541 11987 --2465 119
NM_001032367chr152444 115 ------
NM_001032393chrX1228 --1493 --
NM_001032999chr2095245 4943 4033 3827 3635 1659 1605 1448 1339 ----14207
NM_001033002chr172233 207 ------
NM_001033044chr11147 --11267 --
NM_001033045chr274205 3474 1551 1369 966 737 503 ------
NM_001033047chr42242 158 ------
NM_001033056chr11147 --11267 --
NM_001033059chr621767 89 --160 --
NM_001033081chr151910 1671 1421 1233 492 130 21758 751 --
NM_001033082chr151910 1671 1421 1233 492 130 21758 751 --
NM_001033085chr21263 ------
NM_001033087chr20103262 3169 2921 2296 1246 1015 936 874 341 264 13009 12306 12341
NM_001033088chr152324 27 ------
NM_001033112chr56730 720 639 332 299 139 ------
NM_001033117chr354874 4103 3909 3544 3297 13809 ----
NM_001033503chr5------1456
NM_001033504chr172598 160 ------
NM_001033506chr11--1325 ----
NM_001033518chr752882 1998 1957 1902 1003 ------
NM_001033519chr752882 1998 1957 1902 1003 ------
NM_001033520chr752882 1998 1957 1902 1003 ------
NM_001033551chr1743173 3140 1338 323 ------
NM_001033557chr23299 123 28 151 ----
NM_001033564chr641574 1438 333 190 1344 ----
NM_001033566chr17------162
NM_001033568chr17------162
NM_001033578chr841766 1720 749 99 --12043 --
NM_001033602chr1342351 829 635 463 11882 ----
NM_001033723chr832536 856 279 11020 --11122
NM_001033756chr62732 400 ------
NM_001033756chr62732 400 ------
NM_001033925chr1092071 2062 1448 827 762 550 175 162 143 ------
NM_001034025chr124877 662 653 164 ------
NM_001034194chr4--1143 ----
NM_001034841chr1695218 5200 3935 1823 1606 1114 889 795 458 25538 3530 15276 --
NM_001034850chr531545 1497 1470 ------
NM_001034853chrX2959 376 --151 --
NM_001034915chr831511 453 299 1168 1470 21456 987
NM_001034954chr1052624 2502 2394 710 332 --12594 --
NM_001034955chr1052624 2502 2394 710 332 --12594 --
NM_001034956chr1052624 2502 2394 710 332 --12594 --
NM_001034957chr1052624 2502 2394 710 332 --12594 --
NM_001035003chr411278 ------
NM_001035004chr411278 ------
NM_001035005chr181614 ------
NM_001035254chr972401 2365 1660 670 373 115 36 ------
NM_001035260chr1041522 424 322 289 ------
NM_001037132chr751952 1886 1573 838 593 --1463 --
NM_001037133chr751952 1886 1573 838 593 --1463 --
NM_001037163chr71303 2206 47 --1959
NM_001037164chr721359 155 ------
NM_001037165chr7207943 6821 6337 6011 5436 3332 3217 2790 2768 2324 2140 2071 1596 1485 1358 1126 974 452 240 167 18505 ----
NM_001037172chr321400 102 ------
NM_001037317chr12637 190 --11932 12021
NM_001037324chr32177 170 1629 ----
NM_001037331chr182370 173 ------
NM_001037332chr52459 247 --21902 730 --
NM_001037333chr52459 247 --21902 730 --
NM_001037334chr1852453 1856 790 323 23 22270 432 1284 --
NM_001037339chr141752 438 403 195 --21687 428 --
NM_001037340chr141752 438 403 195 --21687 428 --
NM_001037341chr141752 438 403 195 --21687 428 --
NM_001037341chr141752 438 403 195 --21687 428 --
NM_001037582chr441509 1160 1079 26 ------
NM_001037631chr22939 854 --1454 --
NM_001037637chr5171 ------
NM_001037872chr21636 ------
NM_001037954chr1163369 2680 2550 2182 2151 164 1655 ----
NM_001038493chr211522 --11397 --
NM_001038707chr132229 508 137 11649 ----
NM_001038707chr132229 508 137 11649 ----
NM_001039091chrX21063 418 1227 ----
NM_001039348chr22420 186 11055 ----
NM_001039349chr22420 186 11055 ----
NM_001039366chr22180 --1152 1483
NM_001039465chr14198 --1200 1372
NM_001039479chr1442127 1885 770 160 --1805 --
NM_001039538chr262592 2467 1351 1068 979 307 ------
NM_001039547chr3187789 7529 7001 6956 6188 5633 4954 3100 2921 2902 2555 2076 1122 944 884 852 814 139 24886 614 2865 585 --
NM_001039570chr2264101 3775 3436 3367 1372 779 --1447 --
NM_001039571chr2264101 3775 3436 3367 1372 779 --1447 --
NM_001039574chr131004 661 281 ------
NM_001039577chr194498 4432 3919 3182 1708 1590 686 219 185 ----11050
NM_001039582chrX1292 --162 --
NM_001039590chrX63544 3234 2859 2591 1581 597 23511 139 ----
NM_001039591chrX63544 3234 2859 2591 1581 597 23511 139 ----
NM_001039618chr1195983 5844 5714 5040 4330 1809 850 477 331 35126 4861 1413 1793 --
NM_001039690chr1642329 2006 1831 1513 11637 ----
NM_001039709chr2095245 4943 4033 3827 3635 1659 1605 1448 1339 ----14207
NM_001039711chr14927 836 184 107 ------
NM_001039712chr14927 836 184 107 ------
NM_001039715chr11970 ------
NM_001039716chr111034 ------
NM_001039762chr1021520 571 --1725 11710
NM_001039772chr11----161 --
NM_001039802chr131371 916 320 1909 11362 --
NM_001039840chrX175622 5330 4680 4246 4171 4007 3670 2430 1982 1902 1741 1569 1472 1384 447 176 54 2511 321 21830 462 --
NM_001039877chr193319 286 177 ------
NM_001039916chr1231065 479 51 ------
NM_001039917chr1231065 479 51 ------
NM_001039918chr1231065 479 51 ------
NM_001039919chr1231065 479 51 ------
NM_001039920chr1231065 479 51 ------
NM_001039937chr1383769 3580 3074 2540 1232 970 693 610 13905 ----
NM_001039960chr1251702 1664 619 595 41 11067 ----
NM_001040001chr631872 1437 331 ------
NM_001040057chr761290 1283 1191 579 535 45 21145 999 ----
NM_001040092chr83350 165 135 ------
NM_001040100chr351051 346 165 138 80 1201 1909 --
NM_001040101chr41139 ------
NM_001040142chr252239 1802 1727 708 138 ----11818
NM_001040143chr252239 1802 1727 708 138 ----11818
NM_001040144chr1642329 2006 1831 1513 11637 ----
NM_001040146chr1642329 2006 1831 1513 11637 ----
NM_001040152chr744998 4581 3499 54 14211 11887 --
NM_001040153chr132848 691 --2928 306 --
NM_001040158chr5--2483 374 ----
NM_001040159chr42978 184 ----1434
NM_001040172chr561277 645 461 368 253 36 1438 11370 --
NM_001040173chr561277 645 461 368 253 36 1438 11370 --
NM_001040181chr341038 957 765 317 --21144 1007 --
NM_001040182chr341038 957 765 317 --21144 1007 --
NM_001040183chr341038 957 765 317 --21144 1007 --
NM_001040199chr341038 957 765 317 --21144 1007 --
NM_001040200chr341038 957 765 317 --21144 1007 --
NM_001040202chr462518 1708 1575 934 433 401 1175 --1124
NM_001040214chr641735 1639 956 416 32047 753 562 ----
NM_001040260chr421144 191 ------
NM_001040261chr421144 191 ------
NM_001040272chr931752 402 227 ------
NM_001040284chr1695868 5606 4788 4034 3943 1122 1086 1003 25 25416 1270 35079 1506 1207 --
NM_001040402chr473077 3008 2824 2528 2381 2326 193 --21241 831 --
NM_001040429chr1373122 2894 2219 1232 1159 763 236 1114 13584 1943
NM_001040441chr194608 4473 3801 3329 1785 1291 931 798 32 --23346 140 --
NM_001040446chr572683 2473 1820 1096 733 584 265 11967 --12221
NM_001040450chr1542665 2556 1858 93 11000 137 --
NM_001040453chr1542665 2556 1858 93 11000 137 --
NM_001040455chr1131216 939 250 --1353 --
NM_001040619chr12536 234 --11024 11266
NM_001040624chr882429 1022 910 883 782 655 283 170 ------
NM_001040625chr882429 1022 910 883 782 655 283 170 ------
NM_001040626chr882429 1022 910 883 782 655 283 170 ------
NM_001040627chr882429 1022 910 883 782 655 283 170 ------
NM_001040628chr882429 1022 910 883 782 655 283 170 ------
NM_001040629chr882429 1022 910 883 782 655 283 170 ------
NM_001040630chr882429 1022 910 883 782 655 283 170 ------
NM_001040633chr71828 1359 ----
NM_001040653chr372200 1664 993 985 862 837 324 --21778 228 --
NM_001040665chr784808 4593 4319 4261 3085 1855 1364 1194 14956 14208 --
NM_001040666chr73510 295 21 1658 ----
NM_001040712chr943511 3357 2708 414 13201 12461 --
NM_001040875chr872256 2096 1884 796 670 480 292 42291 502 178 83 12329 --
NM_001040876chr421519 603 11616 21437 1295 --
NM_001042353chr202576 540 ------
NM_001042355chr1694830 3722 3402 1189 529 419 365 158 136 --1105 --
NM_001042361chr103615 481 141 ------
NM_001042364chr103615 481 141 ------
NM_001042365chr103615 481 141 ------
NM_001042387chr103615 481 141 ------
NM_001042388chr186988 918 716 349 271 22 ------
NM_001042393chr103615 481 141 ------
NM_001042396chr103615 481 141 ------
NM_001042397chr103615 481 141 ------
NM_001042403chr122945 817 ----1255
NM_001042404chr12598 122 --11675 --
NM_001042406chr62918 434 1999 ----
NM_001042412chr1694830 3722 3402 1189 529 419 365 158 136 --1105 --
NM_001042413chr984057 3990 3716 3264 3199 2554 682 237 12880 12532 --
NM_001042425chr641680 1403 1317 1149 --1582 --
NM_001042453chrX51446 1158 257 97 75 --11126 --
NM_001042473chr1092106 1901 1763 1734 1602 1371 821 343 108 ------
NM_001042479chrX72135 1869 1538 792 660 338 320 --1366 --
NM_001042480chrX72135 1869 1538 792 660 338 320 --1366 --
NM_001042481chr1462694 2313 2009 1854 926 623 22165 1777 2953 316 2820 792
NM_001042492chr1743133 2746 372 186 --11111 12965
NM_001042506chrX51387 1074 1060 578 468 ------
NM_001042510chr852002 1651 1404 1368 79 2545 372 --12178
NM_001042511chr852002 1651 1404 1368 79 2545 372 --12178
NM_001042517chr132677 80 1282 1158 --
NM_001042533chr353142 1083 832 754 23 33015 2203 1269 23066 1163 --
NM_001042537chrX51964 1711 467 270 88 --1672 --
NM_001042543chr4----11387 --
NM_001042555chr1284389 4365 1781 1752 600 559 318 237 24730 889 --24626 876
NM_001042599chr2147822 7768 7314 7271 7158 6709 6290 5639 5361 5301 5137 4785 2800 1053 15918 --12888
NM_001042601chr32313 136 --22880 530 13287
NM_001042603chr12154656 4026 3872 3706 1822 1685 1404 1301 1162 989 968 758 271 233 203 24237 1316 54766 4159 3553 2051 880 --
NM_001042604chr384391 3998 3623 3153 3040 1443 1207 70 1604 24032 533 --
NM_001042646chr341354 1235 678 146 --1628 --
NM_001042669chr471544 1526 1479 1242 645 609 336 ------
NM_001042681chr122361 2244 11890 11034 --
NM_001042682chr122361 2244 11890 11034 --
NM_001042682chr122361 2244 11890 11034 --
NM_001042749chrX51418 689 496 127 121 --21864 281 11410
NM_001042750chrX51418 689 496 127 121 --21864 281 11410
NM_001042751chrX51418 689 496 127 121 --21864 281 11410
NM_001043351chr152067 906 774 149 116 1454 1256 --
NM_001044305chr631516 593 443 ------
NM_001044385chr283872 3766 3704 3494 3007 1460 447 173 23690 2999 ----
NM_001044722chr5102298 2255 2128 1828 1463 1451 1438 768 231 53 1153 --11785
NM_001044723chr5102298 2255 2128 1828 1463 1451 1438 768 231 53 1153 --11785
NM_001046chr583002 1188 1178 764 461 403 335 46 --12964 --
NM_001048183chr173714 3374 1322 940 236 209 37 1981 ----
NM_001049chr1412224 22031 1520 12293 --
NM_001068chr32287 56 ------
NM_001071775chr1341532 1483 1205 704 --1235 --
NM_001079874chr122071 715 2508 372 ----
NM_001083620chr442262 1686 1034 822 1194 12550 --
NM_001092chr1731880 831 652 ------
NM_001094chr173802 592 325 --1768 --
NM_001096chr171332 2718 91 1710 --
NM_001099678chr3116434 6117 6082 5964 4889 2350 2061 2055 1924 1764 507 25116 693 ----
NM_001100108chr1148326 8317 7437 6531 6203 6071 5988 5746 2660 2561 2325 832 813 589 35237 3054 2536 22945 1200 --
NM_001105518chr11229 --1801 --
NM_001106chr3167771 7268 7207 7185 7033 6739 6388 3146 3092 2797 2443 2336 2141 1515 1374 563 28145 392 ----
NM_001109977chr42348 53 1578 ----
NM_001113490chrX63650 2965 725 630 613 188 12755 33372 1003 42 21464 1066
NM_001116chr1672980 2577 2270 991 372 254 75 --11958 --
NM_001117chr1842065 1977 1610 639 ------
NM_001121chr1021823 1808 --11710 1454
NM_001122679chr51862 1110 ----
NM_001123chr103688 339 156 ------
NM_001126chr13862 850 150 --1925 --
NM_001128chr1673996 3322 3132 3084 2846 1380 529 23556 2441 --11504
NM_001143chrY148 ------
NM_001145chr14144 --1164 --
NM_001148chr412009 1312 ----
NM_001149chr1011059 11010 ----
NM_001153chr22886 95 ----2720 183
NM_001157chr104669 468 132 72 1656 1200 --
NM_001159chr23182 133 35 ------
NM_001160chr1292795 2738 2423 2222 860 605 403 381 282 32516 2386 484 ----
NM_001167chrX96703 6381 6165 5330 4172 1963 1630 1163 1054 ----11108
NM_001173chr1473557 3067 1791 1218 651 506 384 --1372 --
NM_001177chr1222309 227 --1675 --
NM_001186chr2132407 2351 2074 12054 12520 --
NM_001189chr421026 312 ------
NM_001196chr222900 282 --11257 --
NM_001198chr632187 463 59 ----12446
NM_001200chr2011078 ------
NM_001201chr4103747 3413 3379 2961 2567 1527 1195 1189 586 27 1424 43722 1304 946 876 --
NM_001204chr267491 5308 5140 3114 2611 174 2135 87 47662 7344 7288 7116 12362
NM_001206chr962862 2369 2136 760 596 463 --31049 838 269 --
NM_001207chr5171 ------
NM_001219chr72862 710 ------
NM_001238chr192179 86 --1465 --
NM_001241chr231831 834 401 21487 233 ----
NM_001241chr231831 834 401 21487 233 ----
NM_001254chr171929 174 ----
NM_001256chr1742887 700 645 371 12899 --2639 312
NM_001257chr1621439 1398 11306 ----
NM_001259chr7146356 6326 5974 5472 4236 2461 2200 2127 1735 1538 1439 1213 1096 123 11654 11457 1793
NM_001260chr131341 ------
NM_001262chr1----1335 --
NM_001264chr62773 134 --130 --
NM_001270chr51744 173 ----
NM_001271chr1532490 2040 693 13052 --12270
NM_001278chr101290 11165 21183 791 --
NM_001282chr1762687 2614 2431 1747 637 586 ------
NM_001283chr72669 274 ------
NM_001286chr121160 1143 1385 12900 --
NM_001290chr41433 ----11062
NM_001304chr1773710 2882 2714 2687 2433 1313 847 22780 1319 11342 --
NM_001310chr1282994 2449 1948 1138 858 617 374 261 3983 327 175 ----
NM_001315chr631422 173 86 1611 1368 --
NM_001316chr20--1143 ----
NM_001319chr19--11036 ----
NM_001328chr4--1490 ----
NM_001331chr1162193 2081 1118 1078 759 145 --22827 2092 --
NM_001332chr521565 476 1274 ----
NM_001343chr521195 318 1132 1166 --
NM_001349chr21531 ----1388
NM_001351chr331830 1807 1712 ------
NM_001356chrX32208 887 314 12096 21608 554 --
NM_001358chr42296 174 ------
NM_001364chr11114731 4193 3878 3808 3588 3007 2984 1583 1439 1085 345 23022 353 ----
NM_001378chr22474 74 ------
NM_001385chr81171 ------
NM_001386chr872361 2133 1909 1800 1729 1564 396 ------
NM_001387chr54955 929 726 181 ------
NM_001389chr211171 ------
NM_001390chr1833160 2220 1437 11152 11026 --
NM_001391chr18268 45 ------
NM_001392chr18----1259 --
NM_001394chr83920 802 692 ------
NM_001396chr2162409 1729 1127 1108 1072 286 22451 1752 22665 901 --
NM_001397chr122305 961 --21760 324 --
NM_001399chrX83731 3609 2846 1469 869 829 663 500 ------
NM_001400chr11919 --11280 --
NM_001401chr941366 996 473 434 ----1578
NM_001402chr621473 484 11982 11660 --
NM_001406chr1741595 1328 1232 495 ------
NM_001407chr331609 490 249 1641 1417 --
NM_001408chr161326 1163 576 425 390 72 180 ----
NM_001412chrX62946 2900 2826 335 284 243 1876 13374 --
NM_001417chr1251734 1386 1241 338 291 --11916 --
NM_001418chr11------1174
NM_001418chr11------1174
NM_001419chr19114409 4327 4093 3743 3507 3004 1143 1101 989 347 110 13186 1466 1308
NM_001422chr1141056 1042 247 41 ------
NM_001423chr1241936 1425 490 410 11805 ----
NM_001427chr741602 1463 1380 1296 11760 11908 --
NM_001429chr222899 310 ------
NM_001431chr641142 916 850 317 ------
NM_001432chr452681 848 278 250 41 1980 ----
NM_001438chr133447 797 334 12367 13644 --
NM_001447chr541258 1113 562 423 ------
NM_001448chrX31427 700 84 21552 522 ----
NM_001449chrX31250 367 358 ------
NM_001451chr1621275 74 --1485 --
NM_001453chr661300 604 379 349 334 229 ------
NM_001457chr321169 43 1511 1138 --
NM_001493chrX1586 --1684 --
NM_001494chr10188 ------
NM_001497chr942767 1859 1849 1827 12096 2540 222 --
NM_001511chr42607 111 --1586 --
NM_001527chr674586 4475 4164 3940 1855 1761 1595 --1937 1213
NM_001530chr14----1435 --
NM_001542chr182609 2376 1932 983 973 839 774 584 ------
NM_001543chr594000 3941 3748 3635 3432 1935 1641 1565 659 11128 ----
NM_001546chr641486 1240 1151 1045 ----1580
NM_001560chrX52668 2165 877 668 327 --11630 --
NM_001564chr4136 ------
NM_001584chr1121010 455 ----1322
NM_001604chr112685 639 ------
NM_001614chr171528 --1496 --
NM_001614chr171528 --1496 --
NM_001616chr262578 1384 1201 713 337 106 11271 --12656
NM_001621chr761079 549 521 495 460 157 1805 22954 835 --
NM_001621chr761079 549 521 495 460 157 1805 22954 835 --
NM_001634chr621767 89 --160 --
NM_001635chr72885 236 ------
NM_001642chr1131256 1137 1102 ------
NM_001650chr1843467 3333 1519 1333 --12974 --
NM_001656chr541727 1295 428 373 1160 --12010
NM_001658chr121091 834 142 ----
NM_001659chr1252345 2061 2013 1067 397 1824 12536 --
NM_001660chr34681 660 643 252 ------
NM_001663chr1432169 2028 522 12266 1392 --
NM_001665chr115532 492 144 61 53 183 1129 --
NM_001668chr182056 1785 1532 856 642 575 346 265 --12264 --
NM_001674chr12467 86 ----1816
NM_001677chr13864 717 317 1802 --1123
NM_001678chr1721795 1484 --11455 --
NM_001679chr32765 46 ------
NM_001682chr1282836 2599 2349 2228 2183 901 190 99 12898 31010 911 675 --
NM_001683chr352501 1813 1725 740 484 ------
NM_001684chr193595 3513 2642 1462 1207 1061 793 575 568 13405 13032 --
NM_001688chr14656 565 241 200 ------
NM_001689chr231974 1407 596 --1617 11911
NM_001690chr341820 1785 481 121 11032 ----
NM_001696chr22180 --1152 1483
NM_001698chr93346 76 57 ------
NM_001699chr1941821 1720 524 116 ------
NM_001701chr921566 79 ----11414
NM_001704chr6--1459 ----
NM_001706chr34972 835 677 98 --121 --
NM_001707chr7----1221 --
NM_001709chr1172689 2651 2504 2314 1794 818 458 2515 309 11128 --
NM_001711chrX41074 790 774 664 ------
NM_001714chr121451 ------
NM_001716chr1121361 29 --11597 --
NM_001718chr62227 36 2129 61 11010 --
NM_001722chr8------1258
NM_001730chr1331646 1126 204 ------
NM_001730chr1331646 1126 204 ------
NM_001731chr12156 ------
NM_001735chr92400 145 ------
NM_001737chr51103 1248 ----
NM_001742chr741774 1768 1393 173 --1604 --
NM_001743chr22506 53 ------
NM_001744chr52489 188 1170 ----
NM_001746chr562873 2287 2072 1975 1913 1823 --1845 --
NM_001748chr11923 1932 ----
NM_001753chr781811 1755 1738 1431 660 623 561 162 ----1584
NM_001754chr21104046 4016 3641 3559 3207 3110 1475 1387 600 333 --13362 --
NM_001755chr1612255 32238 2071 774 ----
NM_001759chr12105203 4965 4780 4600 1597 1530 925 318 278 197 25008 4735 14767 13816
NM_001760chr63650 370 185 ------
NM_001769chr123363 344 166 ------
NM_001773chr1----11286 --
NM_001777chr353443 2523 1592 1362 730 13150 1302 --
NM_001781chr122668 126 1692 ----
NM_001791chr131371 916 320 1909 11362 --
NM_001792chr183401 370 244 ------
NM_001794chr201241 ------
NM_001795chr1631537 1058 406 ------
NM_001797chr162606 515 1768 ----
NM_001801chr52623 53 ------
NM_001802chr161118 ------
NM_001806chr1922785 309 ----12796
NM_001810chr203687 544 122 ------
NM_001812chr42302 78 ------
NM_001819chr202258 233 ------
NM_001826chr12152 86 ------
NM_001830chrX64023 3004 2906 2650 915 833 ----13734
NM_001834chr5165 ------
NM_001838chr171865 ------
NM_001839chr12181 86 1133 ----
NM_001843chr12------1239
NM_001854chr1----2573 145 --
NM_001855chr91896 ----1574
NM_001858chr684294 3842 3499 1551 1462 1238 868 93 1220 25107 4920 --
NM_001859chr993717 3215 3102 2960 2428 1162 1084 849 529 22606 1324 1260 13887
NM_001876chr113514 501 346 ------
NM_001880chr21208 ------
NM_001888chr16132 ------
NM_001892chr51361 ------
NM_001894chr22138 ------
NM_001895chr203901 856 25 ------
NM_001901chr62673 334 --1697 --
NM_001903chr52614 223 --1180 --
NM_001904chr341047 1007 884 402 --1160 --
NM_001907chr16170 ------
NM_001913chr72628 170 ------
NM_001918chr188482 8194 7192 6692 6579 3378 2758 2660 26411 830 59240 9024 6529 964 850 26753 2342
NM_001921chr41257 1198 21027 64 --
NM_001932chr174749 649 619 302 --1696 --
NM_001933chr1471337 1315 925 513 418 313 277 ------
NM_001935chr231024 737 177 1898 ----
NM_001938chr141300 484 130 74 ------
NM_001939chrX83850 3825 3005 2509 1473 1137 888 322 13403 ----
NM_001945chr521038 153 ------
NM_001946chr122387 78 ----1810
NM_001949chr662757 2028 779 423 339 225 --1444 --
NM_001951chr82610 498 1189 ----
NM_001955chr61210 --11072 --
NM_001967chr31384 ----1587
NM_001968chr44964 874 816 160 ------
NM_001969chr1463578 3495 2448 1036 799 696 --32618 1018 990 11115
NM_001977chr41583 --2138 112 1495
NM_001978chr82864 342 ------
NM_001981chr131815 863 315 --12156 12041
NM_001987chr1223113 755 11567 44269 3532 681 571 --
NM_001991chr172864 45 ------
NM_001995chr42969 368 21439 175 ----
NM_001999chr521122 507 31188 965 127 ----
NM_002006chr485790 4033 3633 1936 1671 1500 1395 975 64788 4638 4417 1720 1705 269 13578 --
NM_002009chr1521968 613 --52611 2502 1011 887 497 --
NM_002014chr121659 --1514 --
NM_002015chr1383299 3204 3131 2817 2731 2541 939 322 --2447 81 --
NM_002017chr1111053 --21177 47 --
NM_002023chr121222 519 21269 532 21642 1462 --
NM_002024chrX31829 549 218 --1681 --
NM_002025chrX149214 9146 8673 8316 8184 7905 7874 6970 6727 6629 6248 2736 2117 123 29071 264 38168 3216 1330 26222 826
NM_002026chr22381 34 1907 ----
NM_002027chr81124 --131 --
NM_002037chr62360 316 ------
NM_002039chr41167 ------
NM_002040chr2152849 2417 2014 466 219 2421 409 42938 2214 1968 1253 --
NM_002044chr1531479 224 163 ------
NM_002051chr1031113 966 792 ------
NM_002052chr8--11469 1187 --
NM_002054chr21111 1426 ----
NM_002056chr21710 ------
NM_002061chr131720 625 201 ------
NM_002062chr641059 505 185 145 ------
NM_002063chrX51124 848 467 349 70 ------
NM_002065chr11147 --11267 --
NM_002072chr91782 ------
NM_002073chr2231155 1073 319 ------
NM_002074chr11263 ------
NM_002077chr941515 1387 709 688 --1781 --
NM_002080chr16140 ------
NM_002087chr171240 ------
NM_002092chr474734 4261 1155 936 889 674 636 23485 1031 31264 1146 619 14032
NM_002095chr82255 82 ------
NM_002103chr1951015 813 719 330 199 --1711 --
NM_002107chr11478 ------
NM_002114chr62195 24 ------
NM_002126chr1773450 3266 2903 1259 1210 812 545 33149 2738 1664 1280 --
NM_002128chr1362142 1654 526 436 168 133 --22343 1006 --
NM_002129chr41392 1399 ----
NM_002130chr51194 ------
NM_002133chr221409 1423 ----
NM_002136chr121477 ------
NM_002137chr752002 1910 1762 1604 1521 11681 1245 --
NM_002138chr44720 655 225 196 1324 ----
NM_002139chrX4565 496 445 204 ------
NM_002140chr92769 349 1999 ----
NM_002141chr7142 ------
NM_002146chr173998 916 170 ------
NM_002156chr21281 ------
NM_002158chr251492 1210 781 749 179 43143 2611 485 282 23574 3065 --
NM_002163chr1631026 1001 411 ----1113
NM_002165chr201320 ------
NM_002166chr23768 679 530 1659 ----
NM_002190chr621075 344 --2893 836 --
NM_002192chr71481 ------
NM_002193chr241718 1451 554 330 ------
NM_002199chr42681 315 1653 ----
NM_002202chr531024 1004 418 ------
NM_002203chr573865 2985 2965 1333 653 394 312 23109 2689 ----
NM_002211chr1061161 1100 940 838 830 241 ------
NM_002214chr764417 4133 2060 1892 655 565 25498 203 14559 11671
NM_002223chr1283696 3566 2833 900 853 646 515 91 1352 ----
NM_002224chr61500 1762 --1249
NM_002227chr11381 ------
NM_002232chr141357 1249 412 173 ------
NM_002233chr11--1435 1454 --
NM_002234chr123757 624 599 ------
NM_002235chr1251671 1644 1606 1332 352 --11426 --
NM_002239chr231155 1140 419 ------
NM_002240chr21189 ----1538
NM_002241chr12462 291 12216 22082 1159 --
NM_002247chr102905 397 --11500 11521
NM_002252chr21161 ------
NM_002253chr43915 524 202 --11416 --
NM_002254chr252392 1808 660 356 147 ------
NM_002264chr3124995 4521 4363 3916 3646 3579 1968 1891 1294 1015 643 134 24876 782 14163 --
NM_002265chr173404 361 336 ------
NM_002266chr17--154 ----
NM_002267chr1361849 1659 955 140 122 106 --1691 --
NM_002268chr361901 1618 1371 487 318 266 ------
NM_002270chr5125379 4683 4548 3824 3812 2237 1397 1226 931 570 369 240 --13741 13490
NM_002271chr1321576 614 12370 ----
NM_002274chr174351 117 53 29 ------
NM_002293chr162666 2406 1731 1686 576 65 12687 ----
NM_002296chr121560 700 11138 ----
NM_002309chr2272807 2666 2240 1104 537 414 137 12903 ----
NM_002310chr5226553 6521 6354 6064 5951 5038 4982 4832 4476 3986 2594 2375 1934 1878 1813 1297 1251 1127 740 597 585 157 --25440 1447 --
NM_002313chr1035028 4981 1217 15142 34339 3744 1598 --
NM_002336chr1264896 4793 4629 1789 1668 1292 24985 4848 24421 970 1286
NM_002355chr1261100 1054 424 163 130 118 ------
NM_002356chr632408 498 262 --2999 121 --
NM_002359chr1763604 3511 3281 1283 1170 816 --13042 --
NM_002360chr752633 2508 2363 2251 2161 1576 ----
NM_002370chr1195 ------
NM_002374chr262592 2467 1351 1068 979 307 ------
NM_002381chr241009 968 780 124 ------
NM_002382chr1421291 1170 ------
NM_002383chr162795 325 ------
NM_002387chr584740 1952 1630 1171 655 457 277 251 --15058 --
NM_002389chr151424 358 310 265 29 --11627 11546
NM_002395chr631405 982 195 11437 --11236
NM_002397chr532235 1604 429 --1880 --
NM_002398chr211368 1971 ----
NM_002401chr1732380 805 420 1595 ----
NM_002402chr71862 11111 1457 --
NM_002408chr141160 198 ----
NM_002409chr2283199 2630 2005 1072 1050 1013 775 648 --21086 555 12146
NM_002430chr2252475 2103 953 473 417 12092 ----
NM_002436chrX3443 365 333 168 ----
NM_002449chr52356 36 --11014 --
NM_002457chr111127 ------
NM_002467chr82401 183 ------
NM_002473chr2231211 1040 112 11303 ----
NM_002478chr111484 ------
NM_002480chr1221033 327 11096 ----
NM_002481chr1187957 7811 7658 7627 7572 7418 7267 7212 6974 6922 6704 5447 2743 2428 2067 830 774 75 26730 5460 11669 --
NM_002486chr932306 2186 79 2609 57 12537 --
NM_002487chr153740 229 133 ------
NM_002489chr7--2302 29 ----
NM_002499chr1561809 1763 1521 766 324 172 1394 ----
NM_002505chr641507 1433 1388 166 1196 ----
NM_002515chr1421891 1585 ------
NM_002518chr21996 ------
NM_002519chr1131198 1099 413 --11386 --
NM_002522chr17103901 3355 3218 2934 2819 2755 1502 1328 494 459 --23127 550 --
NM_002524chr15732 702 372 321 101 ------
NM_002538chr5--1131 --1214
NM_002539chr2----195 --
NM_002545chr11104507 4190 3684 3545 3320 2030 1810 1345 885 156 13377 --14960
NM_002546chr81320 1302 ----
NM_002547chrX74265 3649 3330 1576 922 510 207 ------
NM_002552chr251282 1134 263 148 137 --1328 --
NM_002556chr1161619 1560 852 818 222 94 32124 1975 182 11633 --
NM_002563chr33264 182 50 ----1824
NM_002568chr8--1424 ----
NM_002576chr1131065 413 96 ------
NM_002577chr3133948 3936 3502 3332 3189 3083 2973 2806 2597 1560 790 472 456 --13963 --
NM_002581chr994859 4154 3905 2015 1486 1470 1103 821 132 1931 ----
NM_002583chr12----1242 --
NM_002586chr61312 --11181 --
NM_002588chr541532 1371 605 352 --1709 --
NM_002590chr131455 1103 ----
NM_002591chr202531 220 ------
NM_002594chr2032311 1617 1584 ----22104 1654
NM_002595chr1221523 364 11240 ----
NM_002600chr141752 438 403 195 --21687 428 --
NM_002606chr211190 ------
NM_002607chr72441 415 31177 903 103 1504 --
NM_002613chr1654477 3793 3533 3365 875 25350 3481 11302 --
NM_002623chr202703 149 ------
NM_002628chr33931 345 33 1266 ----
NM_002641chrX41732 1362 598 73 --1472 --
NM_002645chr1192738 2329 2181 2155 2117 1958 1064 635 553 32838 1077 622 1566 --
NM_002646chr152083 1736 1636 795 284 ------
NM_002651chr13847 832 790 ------
NM_002653chr51175 ------
NM_002655chr884297 4102 4070 4054 3911 3847 105 75 23489 3380 23753 3681 --
NM_002657chr2083651 3522 3323 2762 2595 2506 2472 2459 13361 ----
NM_002674chr12----1158 --
NM_002687chr1441204 833 511 358 2839 93 --11122
NM_002693chr15185 ------
NM_002697chr11233 ------
NM_002698chr1952682 1993 1958 338 310 11058 ----
NM_002699chr1189 ------
NM_002703chr431362 505 114 21847 1534 21958 1695 1300
NM_002707chr2170 ------
NM_002709chr222894 870 22598 688 ----
NM_002710chr121735 --1955 --
NM_002711chr72716 284 --1729 --
NM_002713chr12186 118 ----11024
NM_002714chr63830 719 317 ------
NM_002715chr51275 ------
NM_002716chr1183518 3280 2743 2520 2368 988 754 702 12488 --1262
NM_002717chr81194 ------
NM_002718chr331944 1885 84 ------
NM_002719chr1452323 1782 1564 1549 511 --11755 --
NM_002721chr92454 121 ------
NM_002729chr101598 ------
NM_002731chr162684 2652 1171 1159 389 250 1520 ----
NM_002734chr173698 141 47 32273 2101 67 21919 284 --
NM_002738chr164923 793 431 299 ----1879
NM_002742chr143554 287 73 ----1624
NM_002745chr22124505 4452 3597 3582 3571 3518 1689 1428 1352 1308 982 292 23342 277 34020 3199 166 --
NM_002747chr181100 1165 1505 --
NM_002748chr152316 52 ------
NM_002750chr10151 ------
NM_002752chr52186 65 --1126 --
NM_002753chr4------1776
NM_002755chr154822 688 172 77 ------
NM_002756chr173877 334 225 1673 ----
NM_002757chr15----1358 --
NM_002760chrY145903 5812 5595 5459 5407 5390 4780 4429 4011 3875 1993 1730 1477 449 15360 1274 --
NM_002763chr12217 206 ------
NM_002764chrX3853 747 343 ------
NM_002765chrX21063 418 1227 ----
NM_002767chr17189 --1429 --
NM_002788chr14--1106 ----
NM_002790chr11122 ------
NM_002809chr17----1316 --
NM_002819chr1921104 349 31344 957 336 1265 --
NM_002822chr123500 432 313 1524 11806 --
NM_002823chr21230 ------
NM_002827chr2011478 ----11770
NM_002829chr911233 --1267 --
NM_002835chr72651 220 2214 151 ----
NM_002837chr1264300 3546 3199 3187 1365 580 34361 3156 1216 ----
NM_002838chr131030 343 196 ------
NM_002839chr943511 3357 2708 414 13201 12461 --
NM_002840chr131185 515 290 ------
NM_002841chr3----1467 1154
NM_002843chr1193397 3143 2685 2541 922 538 522 421 90 ------
NM_002844chr6----11110 --
NM_002845chr183459 107 97 ------
NM_002847chr731562 1438 82 11469 ----
NM_002849chr121412 --1894 1392
NM_002852chr31230 ------
NM_002859chr1261655 1251 687 582 429 170 ------
NM_002860chr104701 575 314 131 157 ----
NM_002865chr81257 ------
NM_002866chr19136 ------
NM_002868chr1272401 2261 2231 1843 1710 670 380 ------
NM_002869chr1182128 2065 1913 1845 1405 388 188 43 1757 ----
NM_002871chr161977 1509 411 385 185 92 ------
NM_002873chr5--1389 183 --
NM_002874chr962238 1588 939 880 809 175 1342 ----
NM_002886chr3115198 5171 5119 4775 4665 3591 3546 1048 635 119 82 23861 1803 14637 --
NM_002890chr5170 --2820 693 --
NM_002892chr1411660 --11268 --
NM_002893chrX2251 51 ------
NM_002894chr181151 ------
NM_002895chr205909 843 633 215 140 --1687 --
NM_002897chr21556 3612 583 86 2703 675 --
NM_002906chr1131888 1741 182 --12425 --
NM_002912chr62628 73 1634 ----
NM_002923chr11610 ------
NM_002924chr12197 173 --1481 --
NM_002931chr62303 209 ------
NM_002938chr431985 1625 1281 --11910 --
NM_002940chr421519 603 11616 21437 1295 --
NM_002941chr331269 266 54 11029 ----
NM_002943chr15131 ------
NM_002945chr172863 259 ------
NM_002948chr331330 202 56 1209 21034 113 --
NM_002951chr201252 ------
NM_002953chr13290 162 56 ------
NM_002956chr121532 --21257 1177 --
NM_002957chr973689 3460 2811 2600 1564 1520 747 --13343 13387
NM_002958chr34658 359 110 38 1128 173 1139
NM_002959chr154170 4099 3363 3087 816 --11207 --
NM_002968chr164922 757 391 205 1968 ----
NM_002970chrX165 ------
NM_002971chr321017 71 2838 809 ----
NM_002977chr282767 2363 2190 929 588 441 421 305 ------
NM_002979chr12690 194 --1864 --
NM_002994chr451838 1658 1636 1289 332 11434 ----
NM_002997chr251437 1381 1292 1191 338 ------
NM_002998chr861656 1517 1400 478 345 296 21626 593 1450 --
NM_003002chr114813 290 54 39 --1822 --
NM_003009chr19----1262 --
NM_003010chr1741879 465 404 139 22290 544 ----
NM_003013chr41135 1791 ----
NM_003016chr1741755 1410 578 398 --11713 --
NM_003017chr62903 256 1574 ----
NM_003020chr152171 151 ------
NM_003022chrX21014 51 --11256 11291
NM_003024chr212717 362 ------
NM_003026chr93410 212 61 ------
NM_003030chr3----1782 --
NM_003034chr12157568 7408 7081 6467 6077 5715 5641 5362 5142 2848 2626 2448 1621 1354 855 47003 5121 1379 420 28036 2959 11640
NM_003038chr212290 12673 1117 --
NM_003040chr71148 ------
NM_003042chr322195 71 --12008 --
NM_003043chr344280 4236 4013 1173 ------
NM_003046chr885203 4230 3966 3893 1350 1113 926 277 25360 1119 15379 --
NM_003048chr232574 349 269 ------
NM_003051chr141817 1586 1556 674 1285 ----
NM_003054chr10--182 ----
NM_003059chr5----1248 --
NM_003060chr561295 1243 1198 941 809 44 ------
NM_003068chr83949 848 380 2701 446 ----
NM_003069chrX2795 576 --1297 --
NM_003070chr94855 770 595 322 --1786 --
NM_003071chr311829 11970 ----
NM_003074chr351839 1653 534 356 134 1362 22114 323 --
NM_003075chr121220 ------
NM_003077chr173570 272 220 ------
NM_003081chr203887 455 168 --159 --
NM_003088chr721078 112 ------
NM_003099chr15145686 5646 5595 5577 5393 5072 4987 4920 4599 4462 2215 1575 1523 41 34754 1872 214 22615 914 --
NM_003100chr5----1381 --
NM_003104chr1521282 292 21050 163 ----
NM_003107chr612414 12502 ----
NM_003108chr2107265 6705 6498 6337 5141 5107 4739 4553 2573 2461 16343 1673 --
NM_003110chr173704 189 89 ------
NM_003111chr21872 ----1147
NM_003112chr722640 1994 --23082 958 --
NM_003113chr21164 ------
NM_003114chr82780 173 ------
NM_003128chr221841 90 --11098 --
NM_003130chr741208 1037 924 71 11282 --1248
NM_003131chr651718 1586 663 590 60 1688 ----
NM_003137chr621997 546 --1745 --
NM_003139chr112826 94 172 ----
NM_003144chr641899 879 526 400 11859 12103 --
NM_003149chr351640 1621 1097 249 49 --11209 11504
NM_003150chr1742345 378 368 203 1926 1293 --
NM_003155chr831925 544 82 32030 701 522 --1414
NM_003156chr1141321 1003 448 365 ----1265
NM_003161chr1723551 2643 23515 1411 21259 950 --
NM_003162chr231089 975 753 ------
NM_003174chr102697 284 --1308 --
NM_003178chr372076 1904 1582 1441 650 487 267 ------
NM_003179chrX41315 1297 426 116 ------
NM_003182chr71358 --1490 --
NM_003182chr71358 --1490 --
NM_003184chr8--11002 ----
NM_003185chr2031229 1211 378 ------
NM_003189chr1132574 2346 2222 961 933 721 691 670 551 386 331 304 130 12634 11022 --
NM_003199chr1875429 4396 3897 3672 1324 1094 333 ------
NM_003203chr251949 1504 879 746 76 1155 ----
NM_003204chr1741719 1676 1359 1233 --21553 100 --
NM_003211chr1231507 1434 1425 1538 11307 --
NM_003215chr431254 1091 625 1199 ----
NM_003216chr2242602 2303 2283 963 --1411 --
NM_003217chr1221758 590 --1540 --
NM_003220chr641680 1403 1317 1149 --1582 --
NM_003221chr663996 3509 3185 2999 2892 1449 12722 23635 394 11465
NM_003223chr164830 694 637 276 ------
NM_003234chr32954 254 --22429 139 --
NM_003236chr273336 2952 2216 875 739 325 86 11148 13309 1610
NM_003242chr362456 578 545 341 284 91 11609 1190 --
NM_003243chr11321 21202 1188 2973 473 --
NM_003244chr18----2435 141 --
NM_003246chr1541988 1937 304 241 11740 ----
NM_003248chr5127 ------
NM_003250chr174417 334 182 81 ------
NM_003253chr2141923 1509 1498 480 ------
NM_003255chr1732622 2079 296 1914 12632 --
NM_003257chr152945 247 ------
NM_003262chr3104700 4046 3675 3597 3531 3280 3243 1567 1300 1141 23635 1338 ----
NM_003263chr4147 ------
NM_003269chr61350 --11005 --
NM_003274chr2172072 1013 566 500 403 355 200 ------
NM_003275chr921229 1180 1425 2387 25 --
NM_003292chr111607 11407 ----
NM_003298chr3115484 5159 3957 3781 2186 2162 1941 1821 1578 1566 1470 --36098 496 205 13863
NM_003300chr14166 ------
NM_003304chr331555 1366 1065 1274 1567 --
NM_003309chr661830 1747 1586 290 182 98 11631 21301 86 --
NM_003311chr111254 ------
NM_003319chr24658 382 372 353 --1775 --
NM_003320chr11104454 4373 4354 4339 4119 4066 3670 922 734 621 33149 1741 1163 23438 3112 --
NM_003336chrX3961 337 235 ----1918
NM_003337chr541740 1612 1537 1324 --11131 21725 325
NM_003338chr1031950 1470 1336 1550 --11750
NM_003339chr521623 86 11152 ----
NM_003340chr41200 --1295 1479
NM_003342chr1773062 2669 2602 2564 2148 681 567 12700 32475 1324 338 --
NM_003344chr731743 1378 420 --1536 --
NM_003345chr161450 ------
NM_003348chr1221310 256 --1163 --
NM_003350chr8--126 158 1363
NM_003352chr23933 817 781 ------
NM_003368chr12517 306 ------
NM_003369chr1162245 2175 2135 292 206 193 --1859 --
NM_003370chr192526 60 ------
NM_003371chr921355 454 ------
NM_003373chr1041804 717 694 448 --11662 --
NM_003374chr5187 ------
NM_003376chr61466 ------
NM_003376chr61466 ------
NM_003379chr641092 453 282 71 ------
NM_003380chr102261 86 ------
NM_003387chr242657 1123 392 93 12619 ----
NM_003390chr1141097 822 307 201 ------
NM_003404chr2041859 1481 1359 589 --21999 1473 --
NM_003405chr223801 261 192 ------
NM_003406chr851928 1722 1501 1430 322 ------
NM_003410chrX32017 1998 503 12198 23073 1185 --
NM_003411chrY21236 686 11751 ----
NM_003412chr332297 1112 648 12933 ----
NM_003413chrX31648 1335 576 1729 1443 --
NM_003418chr3----1222 --
NM_003439chr742202 1362 800 157 ------
NM_003454chr1661431 1158 1099 1074 935 407 11212 11315 --
NM_003458chr363809 3125 2777 2626 357 261 --33798 3365 2517 --
NM_003463chr663301 3165 2337 2287 808 802 --52957 1057 873 685 676 --
NM_003466chr212525 --11678 --
NM_003467chr21120 ------
NM_003468chr2144313 3945 3404 2828 1635 1565 1341 1115 847 727 481 417 307 221 23004 1468 ----
NM_003470chr1681811 1789 1667 1647 1557 1176 714 352 ------
NM_003471chr32714 257 2905 647 ----
NM_003472chr641228 1070 960 235 11245 ----
NM_003474chr1062053 1942 1610 1464 354 291 --11571 --
NM_003478chr1132936 2238 332 23069 126 ----
NM_003482chr1211835 ------
NM_003483chr1262795 2014 1964 1906 1177 1035 --12061 --
NM_003487chr17172 ------
NM_003489chr2153118 1162 508 365 341 --11236 13027
NM_003498chr1652383 1950 1003 867 272 ------
NM_003503chr11169 11255 1817 --
NM_003505chr731913 1737 1209 ------
NM_003507chr241770 610 441 284 --11263 --
NM_003557chr161389 1315 1146 1104 617 205 ------
NM_003558chr93614 505 261 ------
NM_003559chr1773283 3198 3189 3128 1375 1135 1073 23905 817 ----
NM_003563chr1741215 1206 1135 348 ------
NM_003566chr1243454 950 742 496 23304 2997 ----
NM_003567chr11282 ------
NM_003571chr3--1165 1222 --
NM_003574chr18135130 4795 4043 3882 3813 2290 2208 2049 1675 1614 1488 452 138 24424 2074 25094 5051 21668 1647
NM_003576chr1352721 987 979 567 291 1375 ----
NM_003581chr21662 ------
NM_003583chr1273220 2818 2662 2623 847 789 734 22926 2470 --1190
NM_003590chr243698 2806 1412 1187 --33821 2626 1548 --
NM_003591chr103306 169 84 --1273 --
NM_003600chr202769 297 1148 ----
NM_003603chr421355 492 ----195
NM_003607chr164030 3742 3148 1145 348 255 24228 4177 11077 --
NM_003612chr152572 24 ------
NM_003615chr363954 3717 2901 1287 1068 822 33669 838 413 53343 3098 2498 754 278 1848
NM_003618chr231133 101 69 1328 ----
NM_003620chr1731121 999 394 11048 ----
NM_003622chr122955 53 1483 ----
NM_003624chr192405 37 11356 ----
NM_003626chr1141370 1240 1221 339 ------
NM_003629chr1103248 2939 2911 2578 2270 2124 1335 1173 988 422 13153 23320 358 --
NM_003632chr171713 1604 ----
NM_003633chr592404 1917 1638 1012 783 717 706 687 263 ------
NM_003637chr141486 1175 488 328 ------
NM_003642chr21263 ------
NM_003644chr17105364 4230 4122 1894 1661 1634 1053 614 596 326 --24813 4307 --
NM_003651chr121530 --1405 --
NM_003654chr11--177 --1776
NM_003658chr113678 578 188 1218 ----
NM_003659chr22892 398 --21073 786 --
NM_003663chr373389 2566 2496 2343 2324 988 308 23185 2884 22545 783 --
NM_003664chr53194 68 47 1142 ----
NM_003670chr351204 1140 484 191 25 ------
NM_003671chr983390 2974 1446 1361 1066 1028 553 107 1571 ----
NM_003672chr141808 1784 1335 108 11266 ----
NM_003673chr173284 149 93 ------
NM_003676chr12317 247 1651 ----
NM_003681chr2194903 2347 1985 1465 1239 1223 932 406 168 181 35888 5279 1591 --
NM_003684chr151120 1007 950 402 206 ------
NM_003685chr193996 947 642 --1203 --
NM_003692chr91204 --153 --
NM_003701chr1321048 806 --1772 --
NM_003704chr4----1669 --
NM_003710chr152444 115 ------
NM_003716chr35980 738 700 306 198 1987 ----
NM_003718chr71487 ------
NM_003722chr312662 ----12601
NM_003726chr172265 36 ------
NM_003735chr541532 1371 605 352 --1709 --
NM_003736chr541532 1371 605 352 --1709 --
NM_003743chr241950 793 613 162 ------
NM_003744chr143831 238 202 11337 ----
NM_003749chr1342311 1837 904 325 --1932 11561
NM_003750chr101723 133 1748 --
NM_003758chr1531122 1038 451 1457 11273 --
NM_003758chr1531122 1038 451 1457 11273 --
NM_003762chr111233 ------
NM_003763chr2053090 3001 2901 2733 371 ------
NM_003766chr172480 383 129 ----
NM_003768chr121158 178 21533 1497 ----
NM_003769chr122261 51 193 ----
NM_003774chr12103386 2881 2373 2275 2058 1047 1026 847 831 735 12649 --1205
NM_003780chr1--1702 ----
NM_003783chr11969 ------
NM_003787chr1831249 615 225 11322 11480 --
NM_003795chr6--1174 1105 --
NM_003796chr192424 242 ------
NM_003797chr112191 169 ------
NM_003798chr9----1181 --
NM_003800chr672362 2309 2277 1842 1801 1775 1543 1821 ----
NM_003818chr203754 740 109 ------
NM_003822chr133035 3003 26 32895 617 128 ----
NM_003825chr1561358 1282 525 374 293 189 ------
NM_003829chr91430 --1159 --
NM_003831chr1831828 1414 122 1386 1292 --
NM_003861chr1482848 2804 2637 2416 1950 1887 464 177 12422 12323 --
NM_003870chr1512096 11435 ----
NM_003872chr2102793 2786 2718 1993 1984 864 773 631 536 466 ------
NM_003873chr1031650 944 753 11691 11940 --
NM_003876chr171285 ------
NM_003884chr361668 1580 1472 590 548 46 ----11793
NM_003885chr1732172 1721 856 12216 ----
NM_003888chr1531261 371 54 --1322 --
NM_003895chr2132229 1637 34 1444 ----
NM_003901chr1072682 2573 1884 1706 1029 967 785 1825 ----
NM_003902chr11327 1340 1278 --
NM_003908chr2031412 1055 229 --21160 895 --
NM_003909chr882895 2789 2283 1230 1123 688 488 383 12686 ----
NM_003913chr654357 3261 1321 1075 1029 33089 972 184 24048 3229 13752
NM_003916chrX21508 138 11214 21124 98 --
NM_003930chr711870 12238 145 --
NM_003931chr62486 95 1530 ----
NM_003932chr2241359 1309 468 120 --11722 1481
NM_003934chr941195 1186 898 278 ------
NM_003939chr1074049 3712 1489 1223 631 535 377 13338 22821 237 --
NM_003941chr72132 123 12215 11909 --
NM_003947chr321336 1265 11027 ----
NM_003949chr1721866 1681 ------
NM_003951chrX1283 ------
NM_003953chr172620 2197 1936 1855 1788 1127 246 1335 12692 --
NM_003956chr10144 2508 111 ----
NM_003958chr653351 2711 2491 831 157 13830 --11399
NM_003968chr31106 --1673 --
NM_003970chr82133 37 1452 ----
NM_003987chr1031887 816 106 ------
NM_003988chr1031964 893 183 ------
NM_003989chr1031823 752 42 ------
NM_003990chr1031823 752 42 ------
NM_003993chr1168 ------
NM_003994chr1243770 1745 1271 352 --33795 1401 702 --
NM_003998chr41476 ------
NM_004006chrX22123 688 22657 418 --12633
NM_004007chrX22123 688 22657 418 --12633
NM_004009chrX22123 688 22657 418 --12633
NM_004010chrX22123 688 22657 418 --12633
NM_004011chrX22123 688 22657 418 --12633
NM_004012chrX22123 688 22657 418 --12633
NM_004013chrX22123 688 22657 418 --12633
NM_004014chrX22123 688 22657 418 --12633
NM_004015chrX22123 688 22657 418 --12633
NM_004016chrX32037 1018 602 22571 332 --12547
NM_004017chrX22123 688 22657 418 --12633
NM_004018chrX32037 1018 602 22571 332 --12547
NM_004020chrX22123 688 22657 418 --12633
NM_004021chrX32037 1018 602 22571 332 --12547
NM_004022chrX32037 1018 602 22571 332 --12547
NM_004023chrX32037 1018 602 22571 332 --12547
NM_004024chr11445 ----11175
NM_004028chr1843467 3333 1519 1333 --12974 --
NM_004035chr17114948 4782 4459 4331 4299 4057 4038 3410 3309 2052 1218 14756 24910 1623 --
NM_004036chr22657 185 1699 ----
NM_004037chr16697 686 663 121 113 90 ------
NM_004040chr221256 1019 --1258 --
NM_004050chr142893 632 11889 11045 --
NM_004055chr1151958 1800 1623 821 635 ------
NM_004061chr51243 ------
NM_004067chr751295 628 591 242 229 --11250 --
NM_004068chr33401 110 102 ------
NM_004074chr111145 ------
NM_004080chr731457 1361 1025 ------
NM_004081chrY31851 1739 1608 ------
NM_004085chrX2767 702 --1276 --
NM_004086chr143553 286 164 ----182
NM_004087chr321713 539 21943 685 ----
NM_004089chrX1812 --1883 --
NM_004093chr1363114 2074 1102 583 56 27 13183 12688 --
NM_004094chr1481893 1072 1058 964 747 664 324 292 12788 ----
NM_004096chr1052031 1955 1607 673 545 --22070 666 --
NM_004098chr1021177 1025 --11189 --
NM_004099chr931977 1921 1497 1421 1366 --
NM_004100chr622117 72 32662 657 99 ----
NM_004102chr13435 250 242 ------
NM_004103chr82738 63 ------
NM_004105chr22420 186 11055 ----
NM_004112chr171226 11424 1283 --
NM_004114chrX1877 ----1905
NM_004116chr2183 1308 ----
NM_004124chr1493301 3041 2900 2624 2492 2169 1139 796 79 ------
NM_004126chr72293 275 --176 --
NM_004130chr31207 --1606 --
NM_004133chr831962 664 260 2544 334 ----
NM_004156chr82121 23 ------
NM_004157chr34613 358 300 280 ------
NM_004161chr21258 --11042 --
NM_004162chr31434 ------
NM_004163chr18----1108 --
NM_004170chr921501 1421 --1324 --
NM_004171chr11218415 8055 7812 7390 6361 6138 3585 3322 2971 2767 2506 2097 1835 1436 1371 1036 891 841 487 424 182 2651 532 29475 8573 1199
NM_004175chr221216 ------
NM_004177chr1131235 743 71 --2706 318 --
NM_004181chr4183 --1239 --
NM_004187chrX------11251
NM_004193chr10------1551
NM_004200chr1143269 1195 1118 230 --11034 --
NM_004202chrY149 ------
NM_004225chr81139 ------
NM_004227chr752841 2737 2663 2367 1919 --22884 546 --
NM_004229chrX72030 1988 1980 1548 1524 745 644 11538 32113 1691 1368 --
NM_004232chr1863319 3176 2674 755 661 170 13273 23219 406 --
NM_004235chr92578 70 1755 --1715
NM_004236chr151132 ------
NM_004237chr52826 26 ------
NM_004238chr2----1275 --
NM_004239chr14----2153 120 --
NM_004241chr101734 ------
NM_004242chr61345 --1161 --
NM_004253chr92955 324 ------
NM_004261chr11358 1907 1245 --
NM_004263chr251553 1121 596 340 219 ------
NM_004268chr1151048 971 936 286 177 11178 ----
NM_004272chr551413 1375 447 378 330 ------
NM_004274chr1463137 2165 920 783 745 701 12952 22723 904 --
NM_004277chr641615 1379 1121 643 ------
NM_004279chr772409 2372 2348 2175 1839 865 354 ------
NM_004281chr10--144 1170 --
NM_004286chr2232674 2500 292 ----12766
NM_004290chr521354 1155 ------
NM_004293chr953457 3122 2874 1255 617 --1662 1852
NM_004295chr1741280 382 304 155 --2985 269 --
NM_004301chr32314 251 --2347 265 --
NM_004302chr1261922 1868 1822 1103 719 585 ------
NM_004311chr1062931 2767 2511 1901 252 72 ------
NM_004316chr1241096 1073 205 79 1952 ----
NM_004319chr172773 2478 2140 949 891 845 260 --12305 --
NM_004321chr283032 2700 2582 2427 1224 664 656 409 ----23508 2882
NM_004326chr13289 129 63 ------
NM_004327chr2242387 2183 2033 1767 12441 12379 --
NM_004329chr103932 402 342 11010 1240 --
NM_004330chr1521202 947 1400 ----
NM_004331chr841788 1713 793 725 11757 ----
NM_004338chr18105626 5126 5117 4963 4946 4928 4853 2690 2107 646 15446 44683 4664 1269 279 --
NM_004342chr762349 1932 1487 886 513 201 --22302 737 --
NM_004343chr19173 ------
NM_004349chr811236 ----1346
NM_004354chr42843 191 ----1601
NM_004359chr192498 144 ------
NM_004360chr1651846 1552 1536 1314 463 ------
NM_004362chr4--1686 1569 --
NM_004364chr195987 346 319 289 123 1938 1854 --
NM_004369chr2----1114 1593
NM_004370chr662127 1624 1573 1557 760 565 22164 1949 --1377
NM_004379chr24593 577 245 155 21274 368 ----
NM_004380chr162639 616 --1317 --
NM_004384chr5102298 2255 2128 1828 1463 1451 1438 768 231 53 1153 --11785
NM_004385chr52460 61 ------
NM_004386chr1952123 1893 1820 373 40 --1628 --
NM_004389chr23717 563 98 ------
NM_004392chr1312365 --22340 925 12111
NM_004393chr362408 1951 1586 1466 558 376 --22221 1625 --
NM_004396chr17126 ------
NM_004397chr1143460 3259 3238 883 1462 1568 11731
NM_004411chr72696 263 --1172 --
NM_004412chr1065137 4186 3719 2240 742 716 --35887 3730 2252 24360 212
NM_004415chr62653 117 ------
NM_004416chr125924 657 313 54 32 ------
NM_004423chr362573 2197 2156 2064 687 600 ------
NM_004424chr16--1148 ----
NM_004426chr1211446 1777 ----
NM_004428chr12268 70 --1798 --
NM_004429chrX21458 205 --1378 --
NM_004430chr882559 2329 1814 1099 1041 872 732 41 ------
NM_004432chr992190 1898 1836 1808 1632 459 384 327 253 --21767 86 --
NM_004433chr141800 1551 666 268 1693 11708 --
NM_004434chr1411773 --1329 --
NM_004438chr252494 2480 2239 436 413 ------
NM_004440chr621600 1337 1290 11380 --
NM_004441chr311333 11132 ----
NM_004442chr131552 1062 592 ------
NM_004447chr1211100 --2729 54 --
NM_004449chr2121292 86 ------
NM_004454chr342311 1606 1596 221 11990 1378 --
NM_004456chr71168 142 ----
NM_004457chr25604 593 521 468 71 --11628 --
NM_004458chrX61700 770 683 608 377 369 22257 1064 ----
NM_004459chr1721693 692 --1545 --
NM_004463chrX2423 53 ------
NM_004469chrX2198 51 --1182 --
NM_004475chr1751150 368 267 251 152 1102 ----
NM_004481chr152452 1903 1727 1701 526 ------
NM_004483chr16--157 ----
NM_004484chrX----1300 --
NM_004492chr152226 49 ------
NM_004496chr1431160 862 403 11217 ----
NM_004499chr5----140 --
NM_004500chr1421789 234 ----11558
NM_004501chr193947 3817 3005 1642 1146 833 328 314 108 12822 23318 1417 --
NM_004502chr171386 ------
NM_004504chr251984 1918 996 529 76 12873 1661 --
NM_004505chr172666 562 ------
NM_004506chr63469 140 95 ------
NM_004514chr1732638 2284 597 ------
NM_004516chr193785 320 189 1385 21211 450 --
NM_004520chr51173 ------
NM_004521chr10--1291 ----
NM_004523chr1031146 1093 129 ------
NM_004525chr231242 308 147 ------
NM_004537chr1221258 1238 ----1186
NM_004540chr211832 ------
NM_004554chr1471572 1483 1297 1215 1158 191 142 ------
NM_004563chr141151 ------
NM_004566chr1062056 1783 1621 881 215 148 --12533 --
NM_004569chr143568 483 31 ------
NM_004571chr2183414 2973 2750 2469 2393 2109 1302 680 ------
NM_004575chr451626 1578 1214 598 462 ------
NM_004576chr5----1270 --
NM_004578chr11869 ------
NM_004580chr1521225 42 2344 237 1512 --
NM_004586chrX85272 5243 5071 2142 2085 1381 497 149 24222 3701 1517 --
NM_004588chr1184002 3656 3350 3341 2837 2489 1269 832 14038 --13624
NM_004591chr22172 118 ------
NM_004593chr33590 189 94 ----1673
NM_004598chr553296 2557 2450 1168 685 --13240 --
NM_004602chr2051459 1174 557 477 65 ------
NM_004603chr741097 779 449 309 ------
NM_004612chr9134620 4559 4537 4280 4101 3834 3252 3131 2967 1919 1276 984 664 13853 31484 824 619 21788 374
NM_004616chr12153 ------
NM_004626chr112471 138 ------
NM_004630chr113987 248 239 ------
NM_004631chr141447 1166 973 25 --1428 --
NM_004639chr6196 ------
NM_004643chr143733 566 184 ------
NM_004645chr171623 --136 --
NM_004654chrY31062 376 261 ------
NM_004655chr172855 57 1422 21251 526 --
NM_004660chrY1860 22021 245 11552 --
NM_004661chr51990 --21214 270 --
NM_004663chr1521241 1025 ----1523
NM_004670chr1061704 1668 1548 1515 1499 1160 11604 2360 71 --
NM_004671chr18145 ------
NM_004673chr131101 514 473 11197 ----
NM_004687chr1731824 1480 536 ------
NM_004689chr141449 ------
NM_004694chr172817 784 ------
NM_004703chr1782164 2144 1708 1032 995 553 291 128 1394 ----
NM_004708chr19----193 --
NM_004709chrX51820 499 264 167 44 ------
NM_004713chr143758 722 119 ------
NM_004715chr183603 191 93 --1626 --
NM_004717chr741545 1437 1287 1266 ------
NM_004719chr1242677 2622 2318 653 12443 --12420
NM_004723chr11819 --1233 --
NM_004724chr111501 --128 --
NM_004726chrX115521 5328 4792 3796 3614 1940 1781 1691 776 767 381 14311 45514 4483 4000 407 --
NM_004729chrX82104 1848 1732 1535 1485 615 319 112 --154 --
NM_004730chr551889 1738 1661 1454 31 194 --11588
NM_004733chr32610 184 ------
NM_004734chr1382703 2685 2302 2154 1149 1054 899 216 ------
NM_004736chr111965 1844 12028 --
NM_004737chr222434 357 --2342 97 --
NM_004738chr2072161 2031 1831 627 473 464 121 --12124 --
NM_004739chr113560 191 183 --1410 --
NM_004742chr351457 1333 1264 1254 380 31834 477 61 ----
NM_004745chr8106749 6307 5206 5127 4902 4855 4416 1816 310 198 16655 ----
NM_004747chr1041120 1072 606 479 1221 ----
NM_004748chr1563724 3086 2717 1668 733 681 2987 76 23379 3328 --
NM_004753chr1290 21 ------
NM_004755chr143364 321 56 --176 --
NM_004757chr41538 ------
NM_004759chr162169 2089 1371 778 502 441 ------
NM_004760chr752049 941 881 789 407 1545 1520 --
NM_004762chr1731990 1703 787 --1771 --
NM_004766chr3180 ------
NM_004772chr521263 328 1130 1278 --
NM_004774chr1722496 2158 22576 2460 ----
NM_004775chr1842304 2284 2230 850 12172 2814 313 --
NM_004776chr2062955 2722 2463 2402 1161 1050 2299 25 1640 12271
NM_004779chr551294 972 834 526 88 ------
NM_004781chr141202 1133 207 145 1444 21546 387 --
NM_004781chr141202 1133 207 145 1444 21546 387 --
NM_004785chr161365 ------
NM_004788chr1142537 2048 867 390 ------
NM_004796chr1452431 2379 2202 2147 1692 11640 1776 --
NM_004798chr20153441 3105 3019 2921 2721 2571 1469 1374 1108 925 687 597 493 301 42 --12478 --
NM_004800chr132174 77 ------
NM_004801chr21257 ------
NM_004805chr23924 907 238 --1459 --
NM_004815chr1104055 4046 3935 3851 3462 823 501 429 196 125 34207 3941 3635 ----
NM_004816chr92596 404 ------
NM_004817chr91602 ------
NM_004818chr122253 51 ------
NM_004824chr641330 1181 1079 1072 ------
NM_004836chr2165 1767 ----
NM_004840chrX62222 910 597 362 347 31 12473 ----
NM_004844chr321032 981 11199 ----
NM_004845chrX53826 3107 831 796 314 1590 11628 --
NM_004850chr21710 ------
NM_004857chr1444578 3263 1404 280 ------
NM_004859chr1752473 2423 1952 1911 693 ------
NM_004862chr1651608 1222 1200 1081 444 2496 394 1127 --
NM_004866chr554887 3842 3341 1092 468 33950 1795 159 ----
NM_004867chrX------1123
NM_004869chr1841586 1433 625 22 ----11312
NM_004871chr17104306 3579 1632 1617 1512 731 570 385 247 88 23896 2672 ----
NM_004872chr11367 ------
NM_004873chr1462849 2769 1971 1151 723 146 12745 23182 1274 --
NM_004874chr82427 85 ------
NM_004883chr5--1169 ----
NM_004893chr5--2483 374 ----
NM_004896chr1041437 339 237 204 ------
NM_004897chr102118 56 ------
NM_004898chr4102735 2672 2332 2291 1993 1962 1155 569 362 242 1924 ----
NM_004902chr202287 223 1593 ----
NM_004904chr7176064 6051 5430 5207 4751 4652 4614 4502 2551 2112 1837 1715 1485 847 811 229 154 11536 ----
NM_004912chr711182 ------
NM_004924chr193401 324 258 ------
NM_004925chr92879 721 ------
NM_004926chr1431310 657 374 --21202 296 --
NM_004929chr851490 562 468 264 217 ------
NM_004930chr11603 ------
NM_004936chr942030 1083 438 283 2960 189 11184 --
NM_004947chr32955 533 --1273 --
NM_004949chr1832090 2084 1662 2586 462 ----
NM_004952chr12936 775 ------
NM_004955chr63572 538 117 ------
NM_004956chr7104494 3768 3528 3438 3167 1511 1119 1106 429 326 1588 ----
NM_004958chr12888 61 ------
NM_004961chrX51453 409 398 316 155 ------
NM_004965chr211757 --1166 --
NM_004969chr102442 207 ------
NM_004973chr651244 1127 705 478 91 ------
NM_004976chr1154950 3825 2021 1583 1527 15167 15098 --
NM_004978chr131667 1324 1103 --1416 --
NM_004982chr122628 198 ------
NM_004985chr1294320 4167 4019 3029 1541 1185 259 223 142 ----11405
NM_004992chrX148347 8245 7495 7004 6201 5417 5404 5372 3195 2205 2139 2069 1850 1238 18547 ----
NM_004992chrX148347 8245 7495 7004 6201 5417 5404 5372 3195 2205 2139 2069 1850 1238 18547 ----
NM_004993chr1431314 373 278 ------
NM_004995chr1411495 ------
NM_004998chr154916 889 645 382 ------
NM_004999chr673983 1727 1369 1238 946 742 654 1548 14467 11393
NM_005003chr16157 ------
NM_005010chr751952 1886 1573 838 593 --1463 --
NM_005012chr1--1144 ----
NM_005020chr7140 --1592 --
NM_005023chr511479 2514 434 ----
NM_005026chr141731 498 384 125 --1404 --
NM_005028chr1022312 1676 --32079 2058 1551 --
NM_005032chrX31004 786 396 1762 ----
NM_005033chr4--1143 ----
NM_005036chr2286903 3288 1726 1327 1248 743 550 360 58341 7937 2315 866 300 26470 6039 --
NM_005045chr73998 657 406 --1204 --
NM_005056chr12174900 4270 4116 3950 2066 1929 1648 1545 1406 1233 1212 1002 515 477 447 253 28 24481 1560 45010 4403 3797 1124 --
NM_005060chr12995 532 ------
NM_005063chr1093422 3125 2906 2637 2601 2510 668 171 58 12941 23735 3500 --
NM_005065chr14124928 4783 4374 4289 3521 2158 2052 1510 1407 1230 466 290 11756 21444 158 --
NM_005067chr33939 649 335 1619 188 --
NM_005068chr611284 --11432 --
NM_005069chr213516 460 296 11228 11705 --
NM_005076chr143140 3069 832 596 --1320 --
NM_005079chr853200 2431 910 355 102 22875 312 ----
NM_005080chr224941 898 246 201 --1694 --
NM_005093chr2095245 4943 4033 3827 3635 1659 1605 1448 1339 ----14207
NM_005094chr92721 161 --1277 --
NM_005095chr122088 769 ------
NM_005096chrX5790 413 266 140 40 ------
NM_005099chr131293 1063 512 ------
NM_005104chr63656 619 553 1724 ----
NM_005105chr132071 1978 1666 --1674 --
NM_005109chr331928 973 245 1315 ----
NM_005110chr53594 157 141 ------
NM_005112chr41771 --1755 --
NM_005113chr142395 34 ------
NM_005114chr43672 465 233 ------
NM_005116chr2054305 1730 1615 1147 164 13278 1469 --
NM_005119chr141204 1091 1007 306 ------
NM_005121chr1783687 2698 1344 1028 996 598 528 427 2537 477 ----
NM_005124chr6151 ------
NM_005126chr362180 2024 1803 1585 583 468 ----11684
NM_005128chr21193 --1477 --
NM_005133chr111381 ------
NM_005134chr186988 918 716 349 271 22 ------
NM_005151chr1852453 1856 790 323 23 22270 432 1284 --
NM_005153chr161666 --1144 --
NM_005154chr153534 496 64 ------
NM_005156chr9115106 4424 4413 4243 4071 3910 3803 3437 3338 1441 633 11058 15381 --
NM_005159chr1552273 1560 874 238 51 1152 11458 11966
NM_005161chr1172223 2199 1734 1516 428 340 59 1152 1770 --
NM_005168chr231613 1487 582 --31784 1580 1558 11472
NM_005171chr12--1816 ----
NM_005180chr1091547 1489 1342 1228 1190 679 602 417 111 --11215 --
NM_005187chr1641708 369 91 77 ------
NM_005188chr11278325 7886 7611 7191 7000 6964 6895 6831 6768 6245 6186 5943 5927 5582 5435 5350 2865 2853 2682 2502 2237 1915 1710 1681 1332 1175 961 16079 57984 7460 5999 2829 1704 --
NM_005189chr17122391 2321 2250 1846 1677 1620 797 689 442 396 301 204 12489 ----
NM_005190chr61839 --168 --
NM_005197chr1496193 5822 5374 4798 1680 1481 1411 902 623 15047 ----
NM_005201chr33471 266 170 ------
NM_005202chr13596 210 143 ------
NM_005206chr1731164 899 374 ------
NM_005207chr2272982 2737 2288 1019 941 417 28 --13379 11492
NM_005208chr17195 ------
NM_005214chr22902 817 --1417 --
NM_005215chr182671 557 ------
NM_005217chr8138 --1112 --
NM_005219chr551255 396 333 126 68 1274 ----
NM_005222chr73958 837 244 ------
NM_005227chr11455 ------
NM_005231chr1141218 1193 919 148 11293 1175 --
NM_005233chr332507 2284 219 --1680 2615 141
NM_005235chr2147822 7768 7314 7271 7158 6709 6290 5639 5361 5301 5137 4785 2800 1053 15918 --12888
NM_005238chr1153373 2957 2533 1372 334 --12734 22818 1175
NM_005241chr31430 --21349 1325 194
NM_005244chr202666 492 1612 ----
NM_005245chr42489 24 ----1591
NM_005249chr142647 256 1818 ----
NM_005254chr1531064 1013 869 21257 1234 ----
NM_005256chr112353 167 1359 1838 --
NM_005257chr1841154 880 118 63 ----11258
NM_005259chr21589 ----1331
NM_005261chr81310 ----11028
NM_005275chr62105 43 ------
NM_005277chr451835 1759 1614 1327 730 11729 ----
NM_005279chr21541 --161 --
NM_005302chr71163 ------
NM_005308chr10----1527 --
NM_005311chr752757 2566 2546 1058 750 1967 12452 --
NM_005316chr113839 350 329 --11119 --
NM_005318chr2231262 1159 893 ------
NM_005324chr1711584 ------
NM_005328chr8------1304
NM_005329chr1652313 2044 1715 1444 643 1569 ----
NM_005335chr3188 ------
NM_005336chr242147 1885 1733 902 1823 12167 11985
NM_005339chr484223 4008 3451 3106 2855 1426 452 432 1996 21703 741 --
NM_005342chrX32638 1912 565 --1478 --
NM_005348chr141312 1684 1199 --
NM_005359chr18156422 6257 5793 4871 4828 4346 4225 2484 2235 1820 1718 921 894 602 138 24070 101 25099 1269 --
NM_005370chr193914 339 48 ------
NM_005375chr611158 11094 ----
NM_005376chr121121 381 ------
NM_005385chr352681 2157 988 871 178 --1748 --
NM_005386chr201730 ------
NM_005387chr111155 ------
NM_005388chr941091 600 315 78 --1555 --
NM_005397chr763177 2450 1478 1082 428 212 13010 --23903 3090
NM_005398chr1011055 ------
NM_005399chr1134292 4257 3793 3778 3477 3273 1612 1581 1063 980 893 146 98 12814 31699 1009 953 --
NM_005400chr252489 2255 1105 640 595 12835 --12952
NM_005402chr731733 701 396 21801 534 1380 1600
NM_005406chr183301 278 146 ----1617
NM_005407chr1451576 1336 1225 591 93 ------
NM_005410chr5--2639 269 1236 --
NM_005415chr21154 ------
NM_005418chr113256 138 31 ------
NM_005429chr41121 ------
NM_005433chr18--12518 1525 --
NM_005435chr72515 171 ------
NM_005436chr1073611 3182 3135 2805 2672 1517 606 13261 23932 2744 24076 3662
NM_005437chr1041125 1070 989 416 ----11062
NM_005438chr11146 ------
NM_005443chr41102 1152 ----
NM_005447chr12128 ------
NM_005455chr151668 1587 712 607 231 2639 178 21142 221 11526
NM_005458chr942159 1942 1595 858 12193 ----
NM_005460chr51175 ----1209
NM_005461chr2031483 1235 388 ------
NM_005465chr1--1250 --11905
NM_005471chr551244 1152 950 240 63 11105 ----
NM_005474chr1751535 636 462 370 210 ----1402
NM_005475chr1232879 2826 2022 1875 13024 --
NM_005476chr9163 --1206 --
NM_005479chr1021504 516 1410 ----
NM_005487chr2261895 1758 1481 1315 779 180 3419 410 281 ----
NM_005488chr223734 643 93 ------
NM_005493chr61306 1758 ----
NM_005494chr72246 210 1615 ----
NM_005497chr17115799 5616 5487 1964 1312 1145 871 500 415 240 27 21335 919 23916 740 --
NM_005499chr192550 265 ------
NM_005502chr952557 1190 736 633 190 --22724 206 --
NM_005503chr152317 258 --1183 --
NM_005509chr521771 728 --21166 101 1154
NM_005520chr51231 --1486 --
NM_005522chr741142 1106 254 71 ------
NM_005523chr741517 1231 592 482 ------
NM_005530chr1521183 358 ------
NM_005536chr841193 150 89 34 ------
NM_005537chr132160 65 1895 ----
NM_005539chr1031001 904 556 ------
NM_005541chr231185 1071 274 1413 11056 --
NM_005544chr2----11015 --
NM_005552chr142576 530 ------
NM_005558chr12726 402 ------
NM_005561chr131773 ------
NM_005563chr12646 634 ------
NM_005566chr111352 --1418 --
NM_005575chr52582 177 ------
NM_005578chr3104772 4542 4374 4095 2060 1933 1862 1244 946 392 44173 4042 494 125 ----
NM_005595chr11945 ------
NM_005596chr995685 4911 4460 4344 1879 1488 1412 1330 789 --35834 4774 1939 1430
NM_005602chr311117 1185 ----
NM_005604chr642249 1873 630 417 1636 --11864
NM_005610chr12939 810 ------
NM_005613chr162185 2145 1621 789 510 449 21979 94 ----
NM_005614chr731104 1005 85 ------
NM_005625chr821074 436 --1275 --
NM_005627chr62647 358 ------
NM_005637chr1832007 1909 521 ------
NM_005638chrX41761 1536 1358 147 1167 21746 415 --
NM_005639chr1221849 1348 ------
NM_005644chr11415 ----198
NM_005647chrX83466 3139 3125 2852 2409 696 669 620 1924 ----
NM_005650chr2221098 151 ------
NM_005652chr1641222 1141 1077 865 ------
NM_005655chr8170 1947 ----
NM_005665chr184923 4380 3144 1527 1240 1121 987 165 --13645 13374
NM_005667chr22161 50 ------
NM_005668chr594040 3592 2916 2799 947 567 532 470 47 14188 --11424
NM_005682chr1611344 ------
NM_005686chr12981 511 11497 1353 --
NM_005688chr32935 96 ------
NM_005707chr151169 --1137 --
NM_005711chr52877 171 ------
NM_005715chr631790 978 92 22601 1018 ----
NM_005717chr131267 123 115 1871 1932 --
NM_005718chr35725 618 303 197 48 ------
NM_005720chr73184 77 22 --1200 --
NM_005721chr22961 335 ------
NM_005722chr241695 908 243 142 --2349 37 --
NM_005725chr122399 181 1798 22390 639 1240
NM_005730chr12163279 3025 2917 2719 2651 2306 1297 1147 1081 967 680 651 629 611 94 57 11444 21235 468 11324
NM_005734chr112280 186 1556 ----
NM_005736chr1031356 1145 448 ------
NM_005737chr262050 1892 1155 763 723 134 --12689 12424
NM_005738chr721359 155 ------
NM_005740chr222338 120 --1910 --
NM_005742chr21621 ------
NM_005746chr72665 492 1345 ----
NM_005748chr1263378 3333 3201 2426 1252 172 --12911 --
NM_005749chr171548 1694 ----
NM_005751chr7174 ------
NM_005752chr1611202 1800 ----
NM_005754chr52994 801 --3979 922 337 1947
NM_005756chrX41457 1314 1165 32 --1389 --
NM_005759chr273679 3550 3460 3140 3074 1861 1787 13974 ----
NM_005761chr121125 ------
NM_005765chrX3845 214 143 177 1668 --
NM_005766chr132995 35 11361 ----
NM_005767chr13164 --1306 --
NM_005768chr123199 131 119 1535 ----
NM_005775chr82475 256 ------
NM_005776chr141748 1619 ----
NM_005778chr3----2390 92 --
NM_005779chr553141 2957 2635 818 522 --13206 --
NM_005785chr1221225 220 11778 ----
NM_005786chr181422 --1986 --
NM_005789chr1751912 1417 1335 324 56 1752 12077 --
NM_005795chr232834 2238 229 1767 ----
NM_005808chr3113359 3228 3221 3028 2877 2301 1060 782 403 231 136 22401 482 ----
NM_005813chr252308 2212 923 554 301 --1778 --
NM_005819chr163433 3002 1233 594 279 204 ----11164
NM_005822chr63856 167 81 --31686 940 48 --
NM_005826chr1--1409 1241 --
NM_005828chr17164715 4544 4275 4009 3878 3763 1933 1392 1367 1046 977 634 592 439 383 112 21728 550 1102 --
NM_005832chr3----1169 --
NM_005839chr12877 795 ------
NM_005840chrX127390 7138 6894 6842 6457 4696 2312 2169 1414 1005 554 382 34727 2825 1035 1170 --
NM_005841chr42954 748 1934 ----
NM_005842chr131173 1500 1142 --
NM_005851chr112393 354 ------
NM_005853chr161604 ----1188
NM_005857chr141452 1435 1204 1178 --21389 1302 --
NM_005859chr511508 ------
NM_005863chr1041121 1015 1001 454 ----1542
NM_005864chr142231 157 --1652 --
NM_005871chr10----1351 --
NM_005872chr11182 ------
NM_005875chr32404 66 ------
NM_005880chr1611090 181 ----
NM_005882chr41230 ------
NM_005884chr191819 ------
NM_005896chr2133 ------
NM_005898chr1142329 2298 1990 998 --22126 625 --
NM_005899chr1751497 1017 981 578 308 ------
NM_005901chr18128623 7367 6638 3345 2884 2580 1925 1829 1580 1467 553 473 46465 6441 3142 875 48489 2976 2748 2362 22100 249
NM_005903chr5105176 5119 4680 4136 2059 1900 1449 1069 920 796 13849 2998 276 --
NM_005904chr1831200 964 88 11378 ----
NM_005906chr641658 418 83 73 ------
NM_005907chr621659 371 1377 1537 --
NM_005909chr534227 3581 1172 42640 1300 943 315 13281 14146
NM_005910chr1784076 3749 3662 3617 1564 1483 1029 143 --1846 --
NM_005911chr241450 1413 1378 1048 --2454 281 --
NM_005920chr122633 2393 --23789 3048 --
NM_005924chr74429 342 276 218 1918 ----
NM_005927chr521157 869 --1837 --
NM_005928chr15133 ------
NM_005930chr143699 361 303 ------
NM_005933chr1172788 2476 2224 831 764 755 741 ------
NM_005934chr1931741 1608 665 1103 ----
NM_005935chr4125104 4808 4751 4541 4511 4341 4235 4004 3821 3477 1716 937 23571 3285 21220 27 --
NM_005937chr1783835 3801 3683 3305 3011 2963 1176 1041 13252 ----
NM_005938chrX21441 358 1104 ----
NM_005941chr863574 3088 1378 944 564 226 1454 ----
NM_005944chr331098 1080 502 1817 1936 --
NM_005955chr1125555 4797 4010 2133 1876 1707 1576 1310 883 756 430 63 14169 ----
NM_005964chr17--21133 121 ----
NM_005966chr222429 1534 11920 ----
NM_005973chr12327 220 ------
NM_005985chr202586 315 ------
NM_005986chr1322204 2007 ------
NM_005990chr582783 2603 2496 2302 1990 1938 554 150 ------
NM_005996chr1251587 1413 961 579 172 ------
NM_005999chr121613 279 --21081 224 --
NM_006003chr19----1239 --
NM_006007chr983155 2912 1354 1246 1141 701 381 335 44169 3181 1027 129 ----
NM_006009chr122208 28 --1149 --
NM_006011chr1594182 4003 3981 3689 3409 1139 1059 1048 846 ----13350
NM_006016chr641514 1413 693 316 31659 658 229 ----
NM_006020chr1431302 554 142 ------
NM_006022chr132301 169 ------
NM_006024chr71878 1216 198 --
NM_006033chr1862038 1806 1755 621 405 282 --12242 --
NM_006037chr264781 4627 1825 1633 675 45 1897 23757 1078 1740
NM_006042chr171465 ------
NM_006043chr161738 1289 ----
NM_006047chr2043492 2583 576 432 11293 12367 --
NM_006055chr282898 2255 2011 1143 579 507 458 79 --11110 1855
NM_006060chr7124169 4113 3968 3771 3189 2875 2780 2752 1601 779 411 176 --24450 3460 --
NM_006067chr163943 709 129 11070 ----
NM_006068chr42278 88 --1106 --
NM_006079chr61702 ------
NM_006080chr731898 770 283 31131 1103 716 22299 605 1881
NM_006089chrX----1279 --
NM_006091chr1531548 631 582 ------
NM_006094chr842175 1909 1657 498 ------
NM_006095chr4103781 3453 1691 1486 1463 1044 1037 723 627 516 1902 13465 --
NM_006106chr1183232 2937 2770 2579 2254 1156 1001 373 22419 1362 13019 --
NM_006113chr122071 715 2508 372 ----
NM_006121chr12160 ------
NM_006135chr141249 506 186 163 ------
NM_006136chr7136 --2333 219 --
NM_006141chr1662786 2761 2372 2365 1949 656 21028 860 22032 797 --
NM_006145chr1921044 342 1437 1461 --
NM_006147chr13366 188 136 ------
NM_006148chr1772646 1190 1070 949 863 714 24 ------
NM_006154chr1552039 1806 898 231 216 1536 21106 865 --
NM_006158chr841421 1401 1246 1215 --11777 --
NM_006162chr1831748 1734 674 31409 618 406 ----
NM_006166chr1292548 2525 2053 1608 1054 663 457 434 136 --1882 --
NM_006167chr842166 2128 1964 41 --11583 --
NM_006178chr1721535 1169 21103 76 11559 --
NM_006180chr921338 441 --1425 --
NM_006186chr231201 1087 359 ------
NM_006187chr124914 827 632 573 --12524 --
NM_006194chr1421064 111 1273 ----
NM_006195chr921444 434 1120 135 --
NM_006196chr22386 355 ------
NM_006197chr822182 114 --22253 863 --
NM_006201chrX2436 246 --1409 --
NM_006203chr555508 4973 4659 2247 2220 44117 3470 1285 1006 21173 23 --
NM_006206chr442707 2266 1121 208 --12013 --
NM_006209chr83350 165 135 ------
NM_006211chr82275 99 ------
NM_006212chr184730 4495 4026 1703 1686 1659 482 348 14789 3942 826 598 --
NM_006216chr24629 597 432 237 ------
NM_006218chr3------1247
NM_006224chr1752505 2291 944 921 356 --11599 --
NM_006226chr231259 445 233 --11168 --
NM_006237chr1342100 2069 1616 169 ----1502
NM_006241chr371768 959 814 657 473 196 171 1802 --1303
NM_006243chr121092 378 --148 --
NM_006245chr66745 684 258 232 196 89 1967 ----
NM_006246chr141387 1978 11266 --
NM_006247chr191466 ------
NM_006251chr553076 2949 2739 2102 65 --12976 --
NM_006252chr1127431 7343 7055 6171 4880 4619 1244 1205 1008 742 351 204 16899 27458 775 16436
NM_006256chr132264 1955 614 ----1567
NM_006258chr102286 27 11171 1114 --
NM_006265chr831368 376 121 ----11138
NM_006268chr1141158 814 280 137 ------
NM_006275chr2052418 2119 1833 1724 883 22513 501 ----
NM_006282chr2094682 4388 2995 2968 2881 1647 1602 1336 962 1802 1741 --
NM_006283chr864427 4159 3654 1541 818 129 31721 1427 71 11641 14319
NM_006287chr282602 2516 1633 792 613 585 161 121 12197 189 1898
NM_006298chr672467 1219 991 528 303 197 168 --12983 23148 928
NM_006300chr192664 617 1195 ----
NM_006301chr122619 606 1525 ----
NM_006306chrX155912 5847 5802 4964 4074 3938 3746 1850 1581 1413 1212 1197 1038 899 521 ----15936
NM_006312chr121757 ------
NM_006313chr1241591 1333 1273 1218 11540 ----
NM_006315chr494256 4180 3984 3434 3058 3010 1346 473 322 --33852 2809 441 --
NM_006320chr41209 1724 1955 --
NM_006321chr371385 831 701 614 499 468 84 2895 623 ----
NM_006330chr831489 1335 332 11106 ----
NM_006345chr42487 238 21317 951 ----
NM_006350chr5------173
NM_006352chr181919 1860 1576 1502 1374 829 415 318 1611 2460 283 --
NM_006353chr651375 1220 1141 579 142 ------
NM_006357chr21120 ------
NM_006359chrX51964 1711 467 270 88 --1672 --
NM_006363chr205629 574 232 161 53 ------
NM_006364chr1421255 1140 ------
NM_006366chr641144 1112 1005 200 1101 2836 822 --
NM_006371chr3165065 4855 4802 4771 4235 3522 3327 1544 977 751 612 591 570 530 457 168 14216 25197 3814 --
NM_006372chr62358 326 ------
NM_006375chrX61523 746 519 506 461 244 ------
NM_006378chr92494 28 ------
NM_006379chr73352 48 26 185 ----
NM_006380chr1773308 2995 2851 1469 1386 1225 160 23737 3381 ----
NM_006386chr2252096 1760 513 149 59 1450 ----
NM_006389chr1131212 934 485 ------
NM_006390chr1271695 1485 1432 1296 684 360 92 1655 11636 --
NM_006393chr1074059 3743 3456 2870 1251 913 429 11616 33967 2968 1734 --
NM_006400chr121275 ------
NM_006401chr9----1402 --
NM_006403chr641689 1547 1416 259 ------
NM_006415chr921222 169 11241 ----
NM_006420chr2053255 2567 958 677 569 --13459 12505
NM_006421chr82262 127 ------
NM_006434chr1052624 2502 2394 710 332 --12594 --
NM_006439chr42546 388 ------
NM_006451chr51302 2810 708 ----
NM_006457chr4104052 4010 3230 2764 2756 2717 2533 1291 1022 983 23997 839 --1394
NM_006458chr11----1407 --
NM_006459chr1031893 1747 801 ------
NM_006460chr1751361 631 622 209 169 --11593 --
NM_006465chr1531975 774 389 --21905 470 --
NM_006467chr542212 2171 1479 272 12053 ----
NM_006469chr141087 642 527 498 1562 ----
NM_006478chr22------1212
NM_006482chr1273220 2818 2662 2623 847 789 734 22926 2470 --1190
NM_006489chr1421891 1585 ------
NM_006494chr192626 44 158 ----
NM_006496chr151684 1565 1254 1237 264 11270 ----
NM_006504chr1052966 2565 1968 867 328 --1168 1126
NM_006516chr141275 1239 359 322 ------
NM_006517chrX12195 --1193 --
NM_006526chr2021560 389 1592 ----
NM_006527chr41758 1143 ----
NM_006529chr4----11378 --
NM_006532chr1951733 1391 1359 420 317 ------
NM_006534chr2063409 3067 2680 2198 1198 327 --21230 882 --
NM_006536chr121021 681 --1236 1721
NM_006537chr152581 400 1216 ----
NM_006538chr263756 3521 3500 2692 1365 238 1471 --12892
NM_006539chr162538 62 ------
NM_006540chr831370 1055 396 --11404 --
NM_006542chr1131 ------
NM_006544chr14116049 5673 5278 4978 3906 1563 1358 1037 1029 667 204 ----153
NM_006546chr1786544 6048 5117 4700 4332 4209 2510 534 12633 12386 --
NM_006548chr331487 1150 456 ------
NM_006555chr722003 1822 ------
NM_006557chr941765 672 641 166 ----11169
NM_006558chr81106 ------
NM_006559chr121212 1029 181 1249 --
NM_006560chr113387 134 68 ------
NM_006561chr1065934 5470 5206 4208 3794 2161 26053 4910 21790 139 --
NM_006565chr1631117 434 428 ------
NM_006572chr1793491 3336 2776 2651 2575 2205 1200 740 571 22933 2687 23202 2614 13248
NM_006574chr3----1135 --
NM_006575chr14--21201 97 --1371
NM_006584chr17----1118 --
NM_006587chr421335 460 ------
NM_006590chr2----1295 --
NM_006593chr22638 608 ------
NM_006595chr1141809 1451 626 157 --22048 263 --
NM_006597chr11------1214
NM_006599chr16128049 7287 6942 5727 5614 5262 5037 1730 1426 1420 1385 635 21198 998 22449 2167 16020
NM_006601chr121850 ------
NM_006602chr201185 1563 ----
NM_006603chrX51418 689 496 127 121 --21864 281 11410
NM_006609chr252994 2382 2367 2217 24 12591 ----
NM_006614chr363621 3286 2480 1102 871 837 --22847 2235 --
NM_006618chr141386 1169 1059 1026 1632 11273 --
NM_006620chr683901 3449 1722 1672 1515 1000 832 226 24845 1274 --1636
NM_006621chr121580 356 --11659 --
NM_006622chr5----1544 --
NM_006624chr101847 ------
NM_006625chr14463 420 330 291 ------
NM_006625chr14463 420 330 291 ------
NM_006625chr14463 420 330 291 ------
NM_006626chr942464 2301 1935 1004 --11059 1616
NM_006628chr1554606 4590 3235 1167 757 --14557 12996
NM_006629chr1822667 2387 11785 ----
NM_006640chr1771869 1852 1769 1388 1338 1182 631 ------
NM_006644chr132488 188 ------
NM_006646chr1392574 2182 2029 1979 1967 672 603 529 260 --1400 --
NM_006650chr553838 3625 3157 2579 1244 ------
NM_006653chr63295 132 101 ------
NM_006654chr1284389 4365 1781 1752 600 559 318 237 24730 889 --24626 876
NM_006656chr114997 355 347 234 1156 11197 --
NM_006660chr15------1266
NM_006662chr161281 ------
NM_006667chrX31181 732 67 ------
NM_006670chr61524 ------
NM_006682chr732449 481 110 22379 1013 22829 76 --
NM_006695chr173279 118 104 ------
NM_006698chr2031286 1212 179 --1593 --
NM_006699chr172646 2615 2511 2476 1004 829 233 ------
NM_006700chr125638 597 503 144 36 ------
NM_006703chr6--1331 ----
NM_006704chr132425 412 2318 131 ----
NM_006706chr52547 41 --1171 --
NM_006713chr55817 782 772 560 54 ------
NM_006717chr983117 3020 2298 2237 1176 1054 372 75 23047 549 11015 --
NM_006720chr1035028 4981 1217 15142 34339 3744 1598 --
NM_006721chr103688 339 156 ------
NM_006722chr352932 840 345 300 202 1491 --1123
NM_006727chr51170 ------
NM_006729chrX75488 4883 4821 4101 3732 1587 597 24272 2035 45371 4494 2118 1961 --
NM_006734chr671638 1384 989 537 324 245 93 ------
NM_006736chr241558 1368 575 99 ------
NM_006738chr15104277 3738 3410 1743 1732 1444 1291 1285 947 517 13341 21829 365 --
NM_006749chr821044 457 ------
NM_006750chr16187735 7369 7216 7042 6596 5753 5494 4960 3119 2722 2238 2194 1795 1262 858 726 666 106 18124 77777 7325 7207 5546 2400 1892 489 --
NM_006754chr761074 887 420 277 156 136 11212 11225 --
NM_006756chr811107 --21281 157 --
NM_006758chr21125 ------
NM_006763chr191917 1888 1739 763 749 645 588 485 211 11770 ----
NM_006766chr852567 2502 2445 995 600 --22576 2308 --
NM_006775chr652930 2171 1107 852 54 11160 12517 --
NM_006777chrX32553 2162 427 ------
NM_006788chr1872123 2080 1867 1592 461 330 109 12133 11455 --
NM_006790chr52353 327 ------
NM_006791chr152419 83 ------
NM_006802chr1157 11094 ----
NM_006805chr541643 1513 539 461 --1302 --
NM_006807chr1721213 74 21356 155 ----
NM_006811chr203635 351 158 --2665 105 --
NM_006813chr62762 89 ------
NM_006815chr1211121 1555 ----
NM_006823chr82276 38 --11132 --
NM_006826chr221177 178 ------
NM_006827chr1473195 3139 3077 2864 2640 2258 64 --12971 --
NM_006828chr63456 197 89 ------
NM_006832chr142919 366 1127 1822 --
NM_006838chr1261910 1508 1458 675 458 387 --1341 --
NM_006846chr51343 1102 ----
NM_006851chr1242209 923 773 387 --12793 --
NM_006852chr1752692 2572 2471 132 118 ------
NM_006854chr751925 1752 755 671 79 31568 1486 189 ----
NM_006861chr1251945 1747 702 692 343 --12108 --
NM_006870chr205742 694 673 217 108 ------
NM_006873chr253018 2627 2224 528 177 ----13088
NM_006884chr3----1782 --
NM_006885chr1643393 1145 985 195 1657 43109 2981 493 311 11541
NM_006887chr22633 204 --1575 --
NM_006888chr1432917 2847 1361 33164 2650 1248 1910 --
NM_006892chr2021413 1364 --1554 --
NM_006892chr2021413 1364 --1554 --
NM_006895chr242085 738 599 460 --11459 --
NM_006908chr751207 1099 1065 998 963 ------
NM_006914chr92980 449 ------
NM_006915chrX22521 2258 1977 ----
NM_006916chr231048 305 102 21168 299 ----
NM_006918chr1193847 3791 2044 1906 1718 1451 1344 344 209 24783 3562 24315 1366 --
NM_006920chr231606 676 137 --11689 --
NM_006922chr241016 855 648 131 1819 1763 --
NM_006924chr17114227 4167 4153 3745 1204 626 610 357 346 262 170 12794 1396 14060
NM_006925chr14198 --1200 1372
NM_006931chr1221351 763 22012 1325 ----
NM_006937chr171509 ------
NM_006939chr1441161 890 323 207 --21055 358 --
NM_006943chr2052769 2697 2312 549 542 1695 12303 --
NM_006947chr421311 1111 ----2544 408
NM_006948chr2112282 1156 22085 1918 --
NM_006951chr103769 724 241 ------
NM_006981chr952873 2638 1942 454 374 32707 630 428 12826 --
NM_006990chr181995 1788 981 604 558 536 255 50 --1632 --
NM_006996chr151563 1297 695 370 348 11269 ----
NM_006999chr541580 1285 394 228 --1697 --
NM_007005chr921256 1053 11419 --21215 1081
NM_007006chr1633112 2858 385 22598 727 --11091
NM_007007chr1294725 3636 1736 1469 686 620 572 372 323 23757 1228 13872 --
NM_007008chr22802 169 ------
NM_007011chr15114439 4287 2672 2158 1394 1253 1144 944 892 337 279 12535 15338 --
NM_007013chr8--1360 1813 --
NM_007017chr52654 137 --1169 --
NM_007019chr201125 ------
NM_007033chr152304 2042 1725 1420 590 12252 164 --
NM_007038chr21106091 5934 5878 5723 4489 2377 1853 1786 1593 100 --55563 4849 2315 1753 329 14050
NM_007039chr141898 11755 12094 --
NM_007040chr191771 ------
NM_007050chr20127649 7252 6583 5828 5813 5778 5317 2668 1336 760 700 306 12497 16049 --
NM_007054chr573780 3689 3043 2432 948 874 49 --23901 834 --
NM_007067chr1741354 1308 1070 343 1524 ----
NM_007073chr654033 3192 2949 1595 40 23738 97 44190 3765 315 227 --
NM_007084chr1321173 288 ------
NM_007097chr5165 ------
NM_007106chr1352648 2625 912 628 40 --11903 12323
NM_007107chr311977 12402 1241 --
NM_007114chr343038 2059 1217 1166 --11067 --
NM_007118chr52610 347 ------
NM_007121chr191354 ------
NM_007124chr621764 1236 11643 --1805
NM_007125chrY31466 1013 105 1463 11059 --
NM_007126chr9----1464 --
NM_007129chr131763 ------
NM_007145chr19--11223 ----
NM_007146chr1732768 2539 1861 1888 12444 11004
NM_007150chrX42066 1974 1627 528 11395 1130 --
NM_007157chrX82812 2622 2047 1075 924 886 753 258 11955 12301 --
NM_007158chr121187 873 1412 --1460
NM_007159chr341628 1448 1384 439 1142 ----
NM_007166chr1151600 1524 1170 1118 238 ------
NM_007170chr12365 295 ------
NM_007174chr1272028 1740 1545 1517 672 626 206 11727 ----
NM_007175chr883317 3214 986 892 552 450 414 101 1803 --13513
NM_007178chr121489 --1366 --
NM_007182chr32710 552 1546 ----
NM_007185chr14979 817 287 194 ------
NM_007187chr1311035 --2726 28 1913
NM_007191chr121217 1714 ----
NM_007195chr1893618 3563 2926 2850 2800 2792 914 528 211 12642 22782 2636 --
NM_007200chr15104277 3738 3410 1743 1732 1444 1291 1285 947 517 13341 21829 365 --
NM_007203chr943931 2929 1589 944 ------
NM_007212chr121777 773 ------
NM_007220chrX154953 4738 4459 3588 3515 3497 3192 1882 1174 1165 845 683 399 86 30 2332 37 34811 3956 218 13736
NM_007222chr841332 708 368 50 ----1509
NM_007236chr15102319 2137 2060 938 877 482 442 398 371 160 12440 ----
NM_007246chr44763 667 276 136 --11052 --
NM_007247chr1721071 1050 ------
NM_007249chr13109272 8182 8065 7939 6890 2774 1829 1320 1115 118 28763 3314 22867 2440 --
NM_007269chr12226 194 ------
NM_007271chr641444 1267 670 228 --21153 56 --
NM_007275chr33755 749 324 --1390 --
NM_007285chr161340 ------
NM_007286chr542112 1700 1343 402 ------
NM_007287chr3103259 3252 2895 2460 2383 2310 1073 635 608 235 ------
NM_007288chr3103259 3252 2895 2460 2383 2310 1073 635 608 235 ------
NM_007289chr3103259 3252 2895 2460 2383 2310 1073 635 608 235 ------
NM_007292chr17114948 4782 4459 4331 4299 4057 4038 3410 3309 2052 1218 14756 24910 1623 --
NM_007294chr1711131 ------
NM_007295chr1711131 ------
NM_007296chr1711131 ------
NM_007297chr1711131 ------
NM_007298chr1711131 ------
NM_007299chr1711131 ------
NM_007300chr1711131 ------
NM_007302chr1711131 ------
NM_007303chr1711131 ------
NM_007304chr1711131 ------
NM_007305chr1711131 ------
NM_007308chr41619 ------
NM_007322chr192405 37 ------
NM_007325chrX51540 1509 1402 814 228 1173 1716 --
NM_007345chr1872354 2152 2078 1759 1638 1586 148 ------
NM_007347chr151980 --13091 --
NM_007349chr71108 ------
NM_007350chr1264584 3384 1141 794 341 72 23923 1267 21608 1316 14528
NM_007353chr7102581 2541 1943 1139 1123 650 578 512 366 280 ------
NM_007358chr141936 1912 1680 466 22001 1482 ----
NM_007372chr171724 ------
NM_007373chr1031708 1590 1345 ------
NM_007375chr121954 1715 --31837 1780 628 --
NM_012074chr1431040 719 122 ------
NM_012081chr563371 3342 3196 1445 1362 513 31350 639 460 23383 406 13275
NM_012084chrX2570 231 ------
NM_012086chr2155 ------
NM_012090chr11977 2336 132 ----
NM_012095chr1093462 3403 3274 2700 1050 972 936 824 789 1496 --1755
NM_012096chr363499 3355 1166 1107 923 650 --22365 378 --
NM_012098chr951458 1446 604 585 223 1419 ----
NM_012102chr122361 2244 11890 11034 --
NM_012104chr1173819 3478 1333 1218 996 138 131 33532 1312 481 --12521
NM_012104chr1173819 3478 1333 1218 996 138 131 33532 1312 481 --12521
NM_012105chr213922 777 154 --1138 --
NM_012115chr62583 390 ------
NM_012120chr662873 2745 2551 1965 833 553 12391 ----
NM_012124chr112167 158 1919 ----
NM_012129chr722172 912 1701 21946 1638 --
NM_012137chr182913 2424 2201 2157 1136 1046 487 370 --22858 344 1852
NM_012141chr1383769 3580 3074 2540 1232 970 693 610 13905 ----
NM_012142chr153108 86 65 1274 ----
NM_012154chr8----2841 150 --
NM_012155chr19293 56 ------
NM_012156chr2042872 2863 932 878 --1694 --
NM_012158chr1321776 1506 --11853 --
NM_012160chr6136 --1467 1389
NM_012161chr451189 986 930 796 402 11080 --1266
NM_012164chr9127104 6026 6019 5387 5177 4917 4727 4576 2453 1772 1266 547 47360 7000 6574 6058 16064 --
NM_012174chr1232927 1120 127 22935 761 12969 --
NM_012175chr112819 177 ------
NM_012176chr52259 96 ------
NM_012180chr41488 ------
NM_012191chr3126 ------
NM_012193chr11135375 5363 5340 4983 4626 4390 3721 1660 1443 1130 789 680 597 11568 23562 22 11692
NM_012197chr951471 1462 1131 1041 54 ------
NM_012199chr1124548 4479 4075 3278 2919 1724 1701 1312 1065 778 747 334 23336 1203 1122 --
NM_012207chr103992 689 271 ----1729
NM_012210chr92517 454 11465 11065 --
NM_012214chr276351 5336 4862 2441 1412 905 534 --16223 --
NM_012215chr1041846 1765 541 397 ------
NM_012218chr1962237 2049 886 472 316 202 --22339 356 1398
NM_012223chr231018 374 234 ------
NM_012233chr21942 --11037 --
NM_012234chr343729 3371 1448 972 43716 3105 2516 996 13497 --
NM_012238chr1021488 615 21362 1217 ----
NM_012244chr1451223 493 341 107 60 ----11695
NM_012247chr104748 359 308 165 ------
NM_012249chr232488 609 422 32590 2422 1391 12608 --
NM_012250chr112554 238 --1932 --
NM_012252chr783552 3445 1654 1187 828 481 456 85 35278 4622 3492 34735 4036 3812 --
NM_012255chr201166 1435 ----
NM_012257chr73916 247 167 1220 ----
NM_012259chr631146 406 307 ------
NM_012261chr203531 497 154 ------
NM_012262chr1134951 4940 4687 4681 4671 4241 3689 3337 3322 1582 478 393 49 21816 912 ----
NM_012278chrX122 ------
NM_012281chr772466 1977 1963 1694 1549 526 265 --12058 --
NM_012287chr363975 3798 2908 1819 1539 1230 33543 1481 83 34290 839 382 11205
NM_012288chr6115645 5637 4827 3948 3748 3712 1959 1301 889 341 126 24323 328 15604 13680
NM_012293chr272120 2069 1900 1516 783 393 202 11679 22282 2220 --
NM_012294chr7114112 4073 3695 1164 1089 908 838 708 644 74 55 --23904 1529 --
NM_012295chr221411 ------
NM_012296chr1163777 3729 3640 2484 1364 240 12435 ----
NM_012297chr442638 898 852 411 ------
NM_012300chr542130 1780 369 70 ------
NM_012301chr711834 11977 11744 --
NM_012302chr131173 1041 823 --1925 --
NM_012307chr182695 273 --1353 --
NM_012308chr1162116 2056 1995 1905 847 375 ------
NM_012309chr11104852 4734 4455 4111 4050 3837 3616 3313 399 198 11209 1942 --
NM_012316chr1145439 5288 4945 4632 3555 3546 3511 1913 1760 1706 1604 1508 1279 1074 11743 24592 274 --
NM_012322chr72312 126 ------
NM_012325chr2021270 421 ----1401
NM_012327chr1841571 1127 617 354 ------
NM_012328chr73908 546 247 ------
NM_012329chr1741572 1291 1240 1041 11207 ----
NM_012330chr1031552 541 298 --31497 465 404 --
NM_012333chr161558 1475 1095 1061 610 587 1520 1442 --
NM_012341chr103427 411 130 ------
NM_012342chr102382 198 ------
NM_012383chr93380 63 41 ----1329
NM_012384chr2082424 2380 2313 1812 1538 777 608 417 ------
NM_012388chr1583164 2951 2700 2368 2035 1002 417 380 186 1143 --
NM_012399chr2221426 207 ------
NM_012405chr163655 3597 2533 1352 837 628 13565 1541 --
NM_012413chr21135 ------
NM_012414chr12861 711 --1103 --
NM_012416chr9--1225 ----
NM_012417chr172639 90 ------
NM_012421chr11401 ------
NM_012428chr153679 238 185 ----1133
NM_012433chr2156 ------
NM_012434chr631364 606 66 --21513 94 --
NM_012446chr52643 524 1473 ----
NM_012448chr1752104 1849 1622 521 495 1360 1966 --
NM_012453chr71217 ------
NM_012454chr6--1391 ----
NM_012460chr14--151 ----
NM_012463chr1211823 1111 ----
NM_012464chr451168 897 764 292 205 32933 2797 419 --1798
NM_012471chrX41591 314 295 197 ------
NM_012475chr1191 ------
NM_012479chr752594 2514 2049 1844 137 ------
NM_012486chr11429 --1398 --
NM_013229chr1292795 2738 2423 2222 860 605 403 381 282 32516 2386 484 ----
NM_013231chr14104078 3945 3913 3603 3525 2746 2696 1141 697 224 12707 ----
NM_013232chr52300 289 1387 1324 --
NM_013233chr211339 1203 ----
NM_013236chr2231037 476 217 --1845 --
NM_013238chr1321875 167 11652 1448 11691
NM_013253chr113474 396 265 168 11289 --
NM_013255chr7158335 8077 7567 6455 5769 5496 3222 2927 2831 1980 1486 976 578 426 162 48583 7016 6411 3101 37059 5480 1204 12482
NM_013257chr841766 1720 749 99 --12043 --
NM_013261chr453137 2738 2411 612 264 13190 23384 1350 --
NM_013262chr631464 925 509 11277 ----
NM_013263chr16----164 --
NM_013264chr11150 ------
NM_013266chr10125 159 ----
NM_013269chr1264177 4083 2962 1521 754 479 14040 --1328
NM_013277chr122995 754 ------
NM_013279chr1132367 2004 709 21916 693 --11651
NM_013281chr2031446 1319 210 ------
NM_013283chr51793 1867 ----
NM_013293chr71278 --1257 --
NM_013302chr1684597 3306 3002 1690 1217 659 652 580 --21014 160 --
NM_013304chr16----1241 --
NM_013309chr1532103 1679 444 42274 860 307 29 1824 --
NM_013313chr22103178 2800 2667 2443 2422 2205 1320 513 326 304 12246 1677 --
NM_013322chr741698 1302 1193 464 21459 167 1510 --
NM_013336chr341753 471 390 173 ------
NM_013346chrX176 ------
NM_013351chr173721 263 173 ------
NM_013354chr841123 1009 133 45 ------
NM_013363chr33441 420 42 ------
NM_013365chr221528 1759 ----
NM_013368chr191148 ----1230
NM_013372chr1593216 3148 2932 2405 2373 1090 941 752 173 1250 12917 --
NM_013373chr22--1720 ----
NM_013377chr122572 493 1473 ----
NM_013381chr121385 --22003 746 --
NM_013390chr91452 --11273 11535
NM_013396chr2141288 1037 292 59 --1259 --
NM_013400chr73990 371 78 ------
NM_013403chr193319 286 177 ------
NM_013423chrX2505 321 ------
NM_013427chrX2505 321 ------
NM_013433chr1931466 1352 691 --1138 --
NM_013434chr231919 484 408 ------
NM_013434chr231919 484 408 ------
NM_013437chr821422 1013 --1387 --
NM_013438chr921682 305 21698 73 ----
NM_013443chr91217 ------
NM_013444chrX31116 971 737 ------
NM_013446chr741340 365 144 75 ------
NM_013449chr1292907 2857 2253 2103 1985 1853 1160 694 548 ------
NM_013450chr221060 882 1497 ----
NM_013951chr212525 --11678 --
NM_013952chr212602 --11755 --
NM_013953chr212602 --11755 --
NM_013958chr8125 175 ----
NM_013959chr8125 175 ----
NM_013960chr82567 112 --1146 --
NM_013961chr8125 175 ----
NM_013962chr8125 175 ----
NM_013981chr5--1169 ----
NM_013982chr5--1169 ----
NM_013983chr5--1169 ----
NM_013989chr1475055 4056 4023 3508 3424 3290 399 --23555 318 --
NM_013992chr212602 --11755 --
NM_013995chrX32275 1751 264 1775 2591 580 --
NM_013996chr71358 --1490 --
NM_013996chr71358 --1490 --
NM_013997chr71358 --1490 --
NM_013997chr71358 --1490 --
NM_013998chr71358 --1490 --
NM_013998chr71358 --1490 --
NM_014000chr1041804 717 694 448 --11662 --
NM_014007chr91787 2924 909 ----
NM_014011chr232274 478 171 22472 697 12324 --
NM_014016chr341610 1508 1070 170 --1105 --
NM_014021chr153029 2341 2171 1236 135 ------
NM_014023chr1082879 2771 1178 629 397 269 196 116 11982 ----
NM_014028chr653134 2228 2055 1236 666 32588 2396 704 12270 --
NM_014041chr33266 55 26 ------
NM_014043chr331146 1034 417 2604 513 ----
NM_014048chr1635070 1705 1629 14635 15105 14952
NM_014057chr931515 362 184 --1658 --
NM_014059chr131290 ------
NM_014089chr1322280 2227 11579 ----
NM_014106chr1521827 713 11958 12229 11880
NM_014109chr82879 463 ------
NM_014110chr12186 118 ----11024
NM_014112chr8125482 4805 4072 3792 2041 1912 1877 1791 1528 1307 845 778 24039 112 25267 2169 172
NM_014117chr1632260 2110 171 --21953 351 12135
NM_014141chr775288 5021 4707 4210 3569 3562 1662 33301 990 290 25309 245 --
NM_014154chr31167 ------
NM_014155chr11177509 7273 6377 6207 6110 6001 5895 5742 5455 5157 4612 2334 1043 999 313 255 95 15636 16865 27576 6692
NM_014170chr35402 345 330 170 147 ------
NM_014171chr22784 49 ------
NM_014181chr272775 1156 820 777 738 573 298 1673 11130 --
NM_014191chr121221 ------
NM_014212chr12----1310 --
NM_014216chr1421666 1592 11301 ----
NM_014217chr12238 191 1480 1246 --
NM_014231chr1232101 609 246 ------
NM_014232chr1741414 1335 1119 271 ------
NM_014232chr1741414 1335 1119 271 ------
NM_014240chr3104094 3665 2650 2613 1347 1111 567 326 201 142 11354 ----
NM_014241chr10125 ------
NM_014243chr45763 587 569 161 73 1795 11411 --
NM_014245chr31365 ------
NM_014246chr2242198 1504 707 575 21601 434 ----
NM_014250chr2261895 1758 1481 1315 779 180 3419 410 281 ----
NM_014252chr133424 123 116 ------
NM_014253chrX72485 2404 1698 1621 629 424 130 12304 1497 --
NM_014263chr103964 337 23 --1126 --
NM_014267chr112289 139 ------
NM_014268chr181433 ------
NM_014271chrX160 1679 1195 --
NM_014282chr941221 930 369 105 ------
NM_014283chr171568 1075 1063 1056 1007 492 369 11331 1476 --
NM_014285chr92311 151 1860 ----
NM_014286chr9123218 2808 2606 1402 1246 1226 1039 921 624 446 331 23 --23124 1379 --
NM_014289chrX31421 1092 999 11437 1324 --
NM_014292chr2231563 423 102 ------
NM_014293chr2241573 620 558 122 --12654 --
NM_014294chr82213 45 2986 539 ----
NM_014296chr31615 --21216 308 --
NM_014299chr1931645 1626 590 ------
NM_014309chr22105040 4335 3559 2183 2177 2171 1909 607 282 194 24567 3937 1950 13326
NM_014319chr1241584 1505 628 67 11493 183 --
NM_014325chr1232155 1515 391 ------
NM_014329chr161225 --1341 --
NM_014333chr1162817 2329 1883 773 490 298 ------
NM_014342chr1141378 989 481 142 --11370 --
NM_014345chr63888 326 300 --1764 --
NM_014352chr1161484 1406 944 268 139 88 --166 --
NM_014361chr112497 23 134 ----
NM_014363chr1321045 316 ------
NM_014368chr972118 2087 1959 1889 1513 1371 460 ----12130
NM_014372chr142031 1856 1820 580 1532 ----
NM_014374chr73990 371 78 ------
NM_014376chr52459 247 --21902 730 --
NM_014382chr341766 1749 1705 1623 1665 1690 --
NM_014392chr41139 ------
NM_014393chr881755 1499 866 849 333 311 267 164 ----21615 548
NM_014394chr1041090 799 162 150 11049 ----
NM_014396chr751848 1511 919 908 849 --22272 199 --
NM_014405chr1742364 601 462 242 ------
NM_014410chr181357 ------
NM_014415chr331615 1353 227 ----2577 519
NM_014418chr1442032 1980 1847 327 ------
NM_014423chr585019 4719 3431 1635 1595 1110 1082 956 11423 55597 5178 4182 2097 210 12149
NM_014426chr20--1622 1707 --
NM_014432chr6122 21230 1135 ----
NM_014445chr381663 1601 1546 871 590 571 193 129 21907 1652 11954 --
NM_014447chr421646 1494 --11467 --
NM_014452chr62460 308 1921 21193 932 --
NM_014454chr641049 782 306 237 ------
NM_014455chr12322 197 1438 ----
NM_014456chr1031451 438 305 1472 ----
NM_014458chr11113 --21392 877 --
NM_014469chr112620 612 --1153 --
NM_014470chr123751 590 557 ------
NM_014480chr192682 540 ------
NM_014491chr711083 --1879 --
NM_014494chr1622266 1500 --2858 503 --
NM_014504chr751801 1500 754 538 312 12012 ----
NM_014505chr121390 ------
NM_014517chr351838 1638 783 546 315 ------
NM_014521chr251777 1450 1397 630 621 ------
NM_014548chr1531310 1218 295 ------
NM_014552chr261561 1494 1184 593 352 346 ------
NM_014554chr1251623 1443 599 253 160 12009 ----
NM_014562chr2--1779 ----
NM_014563chrX22096 1667 ------
NM_014572chr1341648 1465 1447 562 ------
NM_014573chr1761832 1720 1255 693 587 34 ------
NM_014574chr141272 2503 377 ----
NM_014575chr32404 117 ------
NM_014577chr22--1593 ----
NM_014584chr1431152 117 23 ----11516
NM_014585chr221096 119 11120 11023 --
NM_014587chr1651586 1517 1400 1307 108 ------
NM_014588chr20--1145 ----
NM_014591chr1021306 329 ----1958
NM_014603chr1721442 1117 ----21681 1373
NM_014606chr441416 627 484 340 ------
NM_014607chr261926 1877 600 543 306 115 187 11393 --
NM_014608chr151116 --2180 40 --
NM_014612chr911543 --11108 --
NM_014613chr532067 1014 365 12243 ----
NM_014615chr1653493 3387 964 414 397 ------
NM_014616chr32867 427 22597 1391 1813 1839
NM_014620chr12--1239 ----
NM_014629chr811219 1905 ----
NM_014630chr15153604 3273 2992 2740 2674 2624 2436 1609 1400 748 601 539 427 367 48 13142 13979 --
NM_014633chr11----2578 399 --
NM_014636chr964134 3153 2849 1685 710 323 1592 --1699
NM_014637chr831000 532 172 ----11055
NM_014647chr162610 587 11676 1457 --
NM_014660chr72272 161 --2362 333 --
NM_014666chr51950 ------
NM_014670chr231594 1199 58 ------
NM_014671chr751192 597 563 505 199 ------
NM_014674chr373840 3500 3299 2585 2573 1240 893 22740 1117 33863 1292 370 --
NM_014676chr121618 1612 --1643 --
NM_014677chr831146 104 91 ------
NM_014683chr1722157 872 1187 21990 50 12186
NM_014685chr161491 1509 2208 130 --
NM_014686chr1962523 2479 2174 1993 1871 267 ------
NM_014690chr772565 2389 2336 990 431 406 24 ------
NM_014693chr32177 170 1629 ----
NM_014701chr1562321 1351 880 289 184 64 --12343 13423
NM_014702chr612117 43432 3146 2736 943 12774 --
NM_014705chr731769 1599 579 11846 ----
NM_014707chr742270 2171 1831 631 ------
NM_014709chr2--1509 ----
NM_014711chr1651988 1700 1372 834 260 11724 1425 --
NM_014717chr192844 661 ------
NM_014720chr1041470 1318 626 381 ----11740
NM_014721chr6127393 7325 5858 5754 5305 5278 2188 2038 1991 1833 1439 705 27049 5527 56725 5999 4799 1953 728 --
NM_014723chr2042089 2062 1023 338 ------
NM_014729chr8101974 1850 1752 1536 1528 797 724 306 169 64 2871 290 12072 --
NM_014730chr12135286 4505 4336 3791 3783 3640 3334 2116 1278 1226 737 548 433 24628 1667 33937 1020 890 --
NM_014730chr12135286 4505 4336 3791 3783 3640 3334 2116 1278 1226 737 548 433 24628 1667 33937 1020 890 --
NM_014733chr541738 577 386 100 --11911 --
NM_014735chrX91693 1573 1503 1496 598 581 511 137 35 12074 11817 --
NM_014739chr664090 2927 2686 1340 551 280 23864 1266 24007 1553 12642
NM_014742chr2021764 232 --11773 --
NM_014743chr42562 289 1273 22990 466 --
NM_014746chr2104048 4000 3919 2864 1738 1492 1321 870 767 308 24344 100 24259 551 --
NM_014747chr1185118 4597 4498 4267 4062 3829 1387 1312 1299 1232 458 446 425 282 263 114 86 45 --15431 --
NM_014750chr142219 45 ------
NM_014751chr831770 1709 61 12059 --11512
NM_014752chr1161819 1255 638 557 241 194 ------
NM_014755chr2134146 3459 2929 2871 2767 1641 1449 1270 1211 1027 164 145 95 23728 822 12651 --
NM_014757chr532102 1537 828 --1911 --
NM_014761chr162986 174 1832 ----
NM_014762chr141643 896 678 74 11729 ----
NM_014764chr1251225 1022 456 308 122 172 ----
NM_014765chr162686 1930 1035 1027 882 94 22010 1043 ----
NM_014766chr7123473 3413 3104 2988 2787 2652 2617 2605 1303 624 534 505 13551 ----
NM_014771chr1621027 774 ------
NM_014772chr1843598 2730 1077 725 ------
NM_014774chr162748 2606 2557 1288 862 577 32407 890 374 1411 --
NM_014775chr22----1107 --
NM_014776chr1253142 2748 2570 2267 199 1189 33026 2046 1923 --
NM_014779chr32954 821 --1100 --
NM_014782chrX182 ------
NM_014787chr122798 44 11751 1532 --
NM_014791chr92297 211 ------
NM_014795chr231356 345 95 ------
NM_014797chr683303 3277 3105 2590 2453 2369 250 108 --23039 180 --
NM_014798chr1741762 1547 1452 579 11322 ----
NM_014803chr1032382 814 573 ------
NM_014810chr163032 2317 1381 607 486 179 1763 --11469
NM_014812chr12598 122 --11675 --
NM_014813chr12438 394 199 ----
NM_014819chr521926 943 --1440 --
NM_014820chr331273 542 147 ------
NM_014822chr43607 594 60 ------
NM_014824chr1161976 1880 1743 1699 271 177 --11380 --
NM_014826chr164030 3742 3148 1145 348 255 24228 4177 11077 --
NM_014827chr141588 672 595 375 --1495 --
NM_014828chr1452542 2205 1982 460 94 --1200 --
NM_014830chr1253857 3306 2645 865 101 1909 ----
NM_014838chr2232277 2132 829 32403 409 157 11058 --
NM_014839chr141818 868 667 572 12336 12185 --
NM_014840chr1273194 2986 2903 1254 845 386 348 1235 11061 23274 2651
NM_014841chr61281 ------
NM_014847chr13528 147 134 ------
NM_014850chr354874 4103 3909 3544 3297 13809 ----
NM_014853chr1741430 1019 1009 237 11436 ----
NM_014859chr1751359 1252 959 252 238 ------
NM_014862chr1554194 1418 1015 977 624 ------
NM_014864chr183779 3651 3175 2788 1613 980 452 415 13048 23645 136 --
NM_014868chr121192 --2816 65 --
NM_014871chr121569 ------
NM_014872chr942002 1820 822 436 1442 173 1486
NM_014873chr184567 3663 1508 1357 1196 894 819 662 14179 ----
NM_014877chr17157612 7274 7049 6887 6637 6379 5665 2686 2525 1967 1684 1641 1234 1042 134 15004 37800 2937 1143 12592
NM_014883chr411905 22413 163 11628 --
NM_014884chr19--167 ----
NM_014893chrY52066 1777 1674 1469 715 1244 ----
NM_014897chr172841 315 32761 2100 1170 ----
NM_014899chr552681 784 555 357 305 2992 270 12056 --
NM_014903chr1231605 894 35 1827 ----
NM_014904chr1053073 3020 2928 2616 1086 --33385 1397 921 12625
NM_014905chr261659 1531 1496 786 485 388 --1641 --
NM_014906chr1773638 1402 1237 1190 918 721 397 1833 --11356
NM_014909chr1473448 2957 2726 990 972 902 357 ------
NM_014912chr1063508 3250 2318 1213 1035 914 --12167 --
NM_014917chr1--1974 ----
NM_014918chr152497 174 11442 ----
NM_014923chr1341828 1495 729 72 1484 1265 --
NM_014925chr121774 ------
NM_014926chr341136 364 234 28 ------
NM_014932chr331810 636 317 ------
NM_014934chr1363772 3576 3179 3097 2925 2707 195 33959 2959 2433 --
NM_014936chr652901 2126 770 730 29 11762 1738 21107 653
NM_014939chr1831244 1221 447 11296 1574 --
NM_014942chr662032 1669 934 443 430 108 ------
NM_014944chr121137 32 ------
NM_014945chr531581 312 120 11939 11879 --
NM_014946chr283027 2650 2387 1900 1184 1134 386 212 21094 444 ----
NM_014947chr182645 2197 1972 1068 854 693 668 169 --2472 418 --
NM_014949chr11685 ------
NM_014950chr1421119 108 11364 ----
NM_014951chr1062481 2441 2364 2194 1862 608 12304 174 --
NM_014952chr1511577 1839 11840 --
NM_014953chr1344205 1017 704 509 1938 ----
NM_014956chr114851 314 74 57 ------
NM_014961chr451761 1639 872 602 387 11744 1337 --
NM_014962chr2042413 460 272 65 12419 12538 --
NM_014964chr1772056 2039 1615 966 590 357 143 ----1845
NM_014969chr12874 177 ------
NM_014978chr1051663 1308 1126 495 140 --189 --
NM_014982chr1485033 4761 4405 1830 1124 996 646 83 --15044 1308
NM_014988chr432766 2182 364 ------
NM_014989chr632033 1655 237 22016 1955 ----
NM_014990chr143450 252 103 ------
NM_014991chr442833 1179 991 625 --12717 --
NM_014992chr143802 181 77 --1771 --
NM_014997chr742571 2351 1123 828 11140 1137 12929
NM_014999chr1211145 21199 1032 ----
NM_015001chr11352 ----1208
NM_015002chr1252025 1535 465 285 252 --12010 --
NM_015005chr1441718 323 136 50 ------
NM_015008chr393279 2852 2699 1358 1248 1068 969 464 396 22504 2220 ----
NM_015017chr11253 197 21318 866 --
NM_015023chr161644 1267 674 343 268 88 11395 ----
NM_015024chr821235 320 ------
NM_015025chr242159 567 120 43 1154 22242 148 2551 338
NM_015026chr1294612 4020 3828 3073 1703 978 688 637 576 --22934 1069 14117
NM_015027chr1621736 140 --11583 --
NM_015032chr1332754 1032 604 11812 12358 1170
NM_015035chr20116115 5958 5107 2199 1930 1728 1709 1330 842 746 627 --25211 1227 1712
NM_015040chr263379 2599 2370 2280 945 634 --13205 --
NM_015042chr1573764 3529 3306 2848 1315 875 498 --11430 --
NM_015045chr1041432 1422 484 478 1304 12236 --
NM_015046chr982688 2469 2393 2058 1942 1821 1787 1697 ------
NM_015049chr252850 2402 1154 1101 268 12423 ----
NM_015052chr71167 1859 1413 --
NM_015054chr12----1430 --
NM_015055chr1192536 2506 2389 1907 1866 1178 585 442 419 11811 1804 --
NM_015056chr2162551 2389 2172 2048 695 33 ----11910
NM_015061chr92235 215 --1823 --
NM_015064chr1272570 2331 1349 817 770 549 541 1375 1936 --
NM_015068chr753850 3433 1411 1227 1176 13063 1739 --
NM_015069chr162605 233 --1521 --
NM_015073chr1932074 2051 1465 ------
NM_015075chrX42275 2237 1950 1485 ------
NM_015076chr674455 4434 3724 3640 1270 1054 58 21371 651 13808 --
NM_015079chr1583028 2770 1987 1305 1148 1019 738 436 2595 531 1305 --
NM_015090chr1115400 5216 4188 4174 3874 2158 1848 1549 959 593 402 1363 1578 11337
NM_015091chr14184 1706 ----
NM_015092chr1694627 4525 4131 4011 3136 3037 3027 2944 263 24476 1306 --13699
NM_015093chr62521 515 1661 --11197
NM_015094chr2231734 1289 859 ------
NM_015097chr341584 397 357 290 11957 1812 --
NM_015100chr151977 1889 1781 1581 731 --1427 --
NM_015101chr142885 2843 1858 1027 ------
NM_015107chrX82393 2283 1554 542 294 205 120 44 --22054 2034 --
NM_015110chr992513 2409 2395 2384 2303 766 643 454 120 ------
NM_015115chr473077 3008 2824 2528 2381 2326 193 --21241 831 --
NM_015116chr1351697 1198 563 252 80 11075 1106 --
NM_015124chr2252336 1581 897 670 227 --12527 --
NM_015132chr741881 1832 1773 1517 2683 200 11660 --
NM_015137chr851837 1663 766 234 217 12578 --1492
NM_015138chr1572804 2739 2484 1728 1033 402 273 --2930 255 --
NM_015143chr441285 324 284 160 11302 11432 --
NM_015144chr1623113 282 2951 116 13283 --
NM_015149chr112147 --12130 12095
NM_015153chr6--1544 ----
NM_015155chr1073142 3097 2944 2853 2610 1138 370 11322 ----
NM_015156chr1483862 3701 3307 2566 1475 1073 853 723 33528 904 157 21249 716 11502
NM_015161chr1631458 272 172 1355 ----
NM_015163chr1451767 1291 1266 284 195 ------
NM_015170chr832238 1868 1547 ------
NM_015171chr162430 74 ------
NM_015172chr111320 21143 1117 11033 --
NM_015176chr121680 477 11349 21243 496 --
NM_015180chr14--1564 1785 --
NM_015184chr32448 72 ------
NM_015185chrX82840 2273 2237 1897 706 401 353 324 ------
NM_015187chr42876 799 1347 1103 --
NM_015191chr1152654 2072 1730 1043 506 ----11063
NM_015192chr2063009 2845 2484 2469 508 310 ------
NM_015197chr1453099 2984 2916 2529 872 --1554 --
NM_015199chr342727 2212 1950 49 12795 12286 --
NM_015200chr441702 1008 636 128 --1387 --
NM_015206chr1583713 3432 2529 1217 1178 1158 911 812 --11367 13628
NM_015208chr1862949 992 809 778 503 71 --2962 93 --
NM_015209chr131767 860 682 ------
NM_015215chr132091 2030 40 22503 815 33027 2165 640 13171
NM_015216chr521085 439 --11449 --
NM_015221chr1061350 1237 1201 1004 40 34 --11045 --
NM_015225chr952969 2640 2615 1254 210 1875 129 --
NM_015230chr41129 11750 ----
NM_015233chr1342351 829 635 463 11882 ----
NM_015236chr41363 ------
NM_015247chr1694830 3722 3402 1189 529 419 365 158 136 --1105 --
NM_015250chr942006 1782 1268 532 --11912 --
NM_015251chr1652342 1749 586 235 139 22323 2016 21596 1559 --
NM_015252chr23845 764 602 ------
NM_015254chr8113173 2929 2429 1976 831 557 507 401 316 310 211 12775 1122 1373
NM_015262chr102476 167 ------
NM_015263chr1541086 1026 388 73 11059 ----
NM_015265chr292476 2414 2307 2150 1712 311 135 126 52 ----11652
NM_015268chr32740 89 ------
NM_015270chr1281923 1782 1711 1655 1649 466 455 341 --11455 --
NM_015271chr454267 4004 3705 1380 540 13881 33874 3276 727 14234
NM_015272chr163829 652 426 ------
NM_015275chr122637 415 2667 144 1602 --
NM_015277chr1861500 1352 1323 422 267 188 ------
NM_015278chr653044 2778 2518 896 571 32944 1369 597 12466 --
NM_015282chr252611 2322 1116 778 48 --1257 --
NM_015284chr121751 479 --1145 --
NM_015285chr1822486 152 ------
NM_015288chr583483 3095 2624 2416 2370 1149 928 170 --11527 --
NM_015291chr163551 3351 1400 1281 1168 324 --31003 813 803 --
NM_015292chr126711 548 304 247 42 34 ------
NM_015294chr172452 380 --11098 --
NM_015296chr132490 157 1352 1182 --
NM_015299chr1453605 3347 2748 546 118 21123 233 21415 1268 --
NM_015305chr1491898 1874 1694 1621 1285 747 493 393 346 ----11360
NM_015308chr113659 222 208 1670 ----
NM_015310chr8136739 6316 6288 6188 5657 5630 2165 1983 1843 1780 706 187 165 28112 7231 12885 15147
NM_015313chr11134705 4618 4455 4399 3996 3776 3698 3099 3084 1620 974 435 392 13456 13469 --
NM_015315chr573388 2742 2125 1058 1007 954 693 23429 920 23459 858 --
NM_015317chr262345 1792 1000 886 664 255 --11111 --
NM_015320chr21168 1810 ----
NM_015321chr1994897 4891 4268 3502 1819 1288 1192 576 434 --11909 --
NM_015326chr142911 2513 2492 2295 12159 22922 351 --
NM_015328chr7123077 2613 2597 2459 2315 2070 711 658 583 503 401 165 ------
NM_015329chr1942847 2486 2177 1894 --12786 --
NM_015335chr1252363 2024 1841 771 541 ------
NM_015336chr123534 64 40 11639 12198 --
NM_015338chr2061944 1566 1500 1250 686 121 11579 ----
NM_015339chr203283 92 75 --1327 --
NM_015344chr832047 1669 672 --1238 --
NM_015347chr1262852 2793 2499 2149 870 144 12225 --1701
NM_015349chr642907 1111 680 670 --1702 --
NM_015353chr1762536 2439 1941 1927 826 227 --1979 --
NM_015354chr91359 ------
NM_015355chr1741863 1720 1335 625 ------
NM_015358chr2111138 ----1957
NM_015359chr862620 2069 1929 1901 624 209 11983 ----
NM_015361chr22635 252 1815 ----
NM_015365chrX83665 3477 3361 3052 1518 871 326 284 --12781 --
NM_015367chr2251628 1455 1422 1389 382 1437 ----
NM_015375chr1114707 4700 4119 4014 3994 3848 3792 3459 845 489 310 ------
NM_015378chr152783 2522 2491 2023 433 --13007 --
NM_015379chr71212 ------
NM_015381chr2241444 1326 807 445 ------
NM_015385chr1052624 2502 2394 710 332 --12594 --
NM_015387chr231994 237 135 1445 11499 --
NM_015393chr473604 3289 3075 2987 2647 1313 707 31158 996 966 13013 --
NM_015396chr31327 --11230 --
NM_015397chr941421 735 475 184 11730 ----
NM_015416chr122790 698 ------
NM_015423chr1141749 1079 638 71 1664 21495 530 --
NM_015429chr311083 --2924 728 --
NM_015435chr831400 1363 1108 ------
NM_015436chr433161 2691 2132 1317 --2940 452
NM_015443chr1731426 1389 1045 --21477 1445 --
NM_015446chr151301 1224 1168 1123 278 --11674 --
NM_015453chr341662 1563 1376 546 1837 11681 --
NM_015455chr574099 1574 1239 942 350 289 232 --44142 2843 2522 1056 22725 194
NM_015458chr894957 4411 4015 3225 1945 1789 1189 1025 496 11381 14971 --
NM_015460chr362079 701 475 447 301 57 1209 ----
NM_015464chr72952 118 2142 45 2895 111 --
NM_015470chr251112 910 831 210 100 ------
NM_015475chr231078 1012 255 1853 ----
NM_015477chr151981 --2834 92 --
NM_015483chr72188 40 ------
NM_015488chr251759 1631 1522 1469 1461 --11503 1465
NM_015493chr1962128 1985 1734 1539 1484 1474 ------
NM_015497chr1531112 889 828 ------
NM_015507chrX--1169 1138 --
NM_015508chr331328 989 470 --1147 --
NM_015516chr1161475 1401 1185 1103 305 293 ------
NM_015517chr111548 --197 --
NM_015523chr111240 ------
NM_015530chr23915 645 370 ----1862
NM_015532chr1552484 556 527 315 148 12494 1358 --
NM_015534chr1193 ------
NM_015535chr293478 2651 2591 1672 1335 1123 909 560 338 1468 1204 --
NM_015541chr311440 1376 ----
NM_015542chr1031041 1030 929 ------
NM_015544chr172598 160 ------
NM_015548chr61143 ------
NM_015549chr142458 413 ------
NM_015553chr6115184 4842 3863 3781 3333 1373 788 558 535 514 295 25061 1972 --13232
NM_015554chr1562686 2103 1988 1817 251 240 22398 1895 ----
NM_015555chr621347 127 1587 ----
NM_015557chr182776 2763 1437 1212 1005 896 411 360 ------
NM_015559chr181737 --11067 --
NM_015564chr563203 2768 2574 1283 1047 237 --11014 --
NM_015565chr2141527 1426 599 183 1535 ----
NM_015568chr2073279 2998 2841 1265 1252 115 29 --11004 --
NM_015569chr174713 4665 4627 4469 4220 1440 301 14291 ----
NM_015570chr711304 ------
NM_015571chr662298 1771 1742 541 495 115 12195 ----
NM_015575chr251341 1060 1003 348 224 --12805 --
NM_015577chr541799 1696 420 42 1561 ----
NM_015601chr101883 1826 ----
NM_015605chr103615 481 141 ------
NM_015608chr10272 38 --1232 --
NM_015609chr152427 2327 2135 724 424 ------
NM_015610chr752882 1998 1957 1902 1003 ------
NM_015626chr1731155 1149 289 1930 1887 --
NM_015627chr151801 1567 1459 1362 1174 11836 1205 --
NM_015630chr21946 --1252 --
NM_015634chr101202 1505 ----
NM_015635chr982011 1897 1820 1465 739 605 313 76 1391 ----
NM_015640chr174930 3323 1711 1359 745 443 64 15056 ----
NM_015651chr992224 1953 1690 1436 859 516 338 221 120 --1837 --
NM_015652chr103494 275 75 ------
NM_015657chr2--1989 1675 --
NM_015680chr22630 537 ------
NM_015686chrX32470 1988 1932 ------
NM_015691chrX62303 2243 2162 2037 671 78 12969 ----
NM_015695chr652090 2030 1814 610 528 ------
NM_015713chr8103349 3274 2769 2699 2620 1426 678 566 413 201 --1195 12191
NM_015714chr1----1321 --
NM_015716chr172213 100 --1158 --
NM_015726chr121552 1194 21498 114 ----
NM_015836chr151570 1542 512 148 36 ------
NM_015850chr8102294 2261 2240 1714 541 526 456 412 375 149 12061 1680 --
NM_015852chr723457 1249 --12521 --
NM_015855chr111670 ------
NM_015878chr821980 470 --1384 --
NM_015879chr18148648 8590 8577 8461 8156 7115 6961 6817 6299 3185 2768 1652 692 631 23133 1726 27159 128 192
NM_015881chr113474 396 265 168 11289 --
NM_015888chr153400 2788 861 817 260 ------
NM_015889chr222131 118 ------
NM_015891chr621940 1558 ------
NM_015904chr23569 531 218 ------
NM_015905chr7--1408 ----
NM_015906chr134316 3686 1604 1972 13140 --
NM_015907chr4--134 2143 22 --
NM_015912chr882456 2335 2310 2213 1695 151 68 33 --22482 1634 --
NM_015934chr22148 44 ------
NM_015955chr2------1187
NM_015975chrX41473 1464 702 275 ------
NM_015981chr552562 2396 2384 628 313 --1795 --
NM_015982chr171310 ------
NM_015984chr11128 1376 1218 --
NM_015990chr43988 840 121 1906 ----
NM_015995chr1585172 5028 4963 4831 3399 1727 1034 457 ----1595
NM_015999chr1144 ------
NM_016003chr752882 1998 1957 1902 1003 ------
NM_016009chr164821 4540 4461 4252 3652 3375 14942 24608 485 --
NM_016018chr871966 1932 1751 904 892 462 102 12804 ----
NM_016019chr73332 299 171 1911 ----
NM_016021chr663008 2475 1126 846 812 234 --1826 --
NM_016022chr11139 ------
NM_016023chr861811 1549 854 732 385 178 1563 32081 2031 1632 --
NM_016027chr83446 203 36 ------
NM_016037chr11370 --1139 --
NM_016038chr72411 68 ------
NM_016039chr141151 ------
NM_016048chr531003 267 234 ------
NM_016057chr1221024 50 --11138 --
NM_016060chr1731110 1038 131 1274 ----
NM_016061chr221687 661 ----11638
NM_016072chr123379 326 248 22422 2361 11811 --
NM_016073chr154981 403 331 286 ------
NM_016075chr1352950 2877 2751 2107 37 12484 1483 --
NM_016076chr173014 2624 1147 1067 963 909 646 32508 1292 1111 22225 350 --
NM_016078chr172817 22 11082 ----
NM_016083chr653933 3363 3329 2454 992 --1329 --
NM_016087chr751718 1507 1249 691 30 ------
NM_016096chr852002 1651 1404 1368 79 2545 372 --12178
NM_016098chr61365 1174 ----
NM_016100chr201323 ----141
NM_016103chr5------1456
NM_016107chr561387 1371 1179 403 293 75 1316 ----
NM_016120chrX5842 791 771 126 64 1310 ----
NM_016131chr231794 944 215 2783 515 ----
NM_016132chr1553356 3132 2584 1131 86 ------
NM_016133chr221432 480 --21341 374 --
NM_016141chr3260 53 2748 620 ----
NM_016147chr112942 393 11054 1356 --
NM_016152chr34966 475 392 381 --11246 --
NM_016156chr1152346 2247 2146 1942 796 ------
NM_016162chr123738 323 71 ------
NM_016179chr132198 192 1212 ----
NM_016185chr173534 128 47 ------
NM_016192chr22190 101 ------
NM_016201chr33830 767 509 --11838 --
NM_016203chr71828 1359 ----
NM_016205chr441399 1387 1314 396 ------
NM_016206chr3168471 7631 7155 6673 3550 3324 3198 2874 2861 2497 2071 776 577 554 539 261 --25965 2321 --
NM_016217chr673305 3255 2493 2325 728 439 162 12868 13549 11222
NM_016224chr642065 1358 737 36 ----1328
NM_016227chr171568 1075 1063 1056 1007 492 369 11331 1476 --
NM_016228chr42482 460 ------
NM_016230chr6------1372
NM_016231chr172195 85 ------
NM_016235chr1631386 1100 62 ------
NM_016248chr1333838 3194 1226 22509 815 ----
NM_016252chr21192 --2986 637 --
NM_016257chr193294 3060 2860 2612 2577 1397 1388 1287 211 ----23495 350
NM_016258chr13771 532 297 ------
NM_016260chr256895 5933 2911 2255 934 --32703 2101 288 16086
NM_016263chr1982877 2723 2461 964 897 737 161 80 ------
NM_016271chr1822072 311 12346 ----
NM_016272chr2232118 2042 636 11933 ----
NM_016275chr382459 2287 1999 1813 1756 640 395 376 12093 31831 675 119 --
NM_016277chr63547 317 150 ------
NM_016281chr121151 1349 ----
NM_016282chr961773 1606 1381 526 240 70 --11305 11581
NM_016284chr16--1157 1385 --
NM_016287chr141489 310 185 174 11830 185 --
NM_016289chr211734 --1606 --
NM_016297chr272850 2775 2521 970 690 674 646 2991 594 ----
NM_016300chr31192 --1206 --
NM_016303chrX2184 48 ------
NM_016307chr91289 ------
NM_016308chr181859 1848 1762 1331 711 286 46 34 ------
NM_016315chr221395 279 ------
NM_016316chr21636 ------
NM_016320chr112691 62 ------
NM_016322chr983178 2851 2761 2626 1006 476 407 80 21053 545 13134 --
NM_016329chr31394 165 ----
NM_016339chr1771732 1463 696 624 505 345 69 ------
NM_016352chr751423 1409 1090 421 305 ------
NM_016356chr632514 1167 659 1957 32783 644 514 12809
NM_016359chr15----1676 1669
NM_016373chr165863 846 832 802 230 ------
NM_016374chr11184 --11042 --
NM_016374chr11184 --11042 --
NM_016376chr1753171 2703 1062 217 102 --24260 1654 13451
NM_016396chr1582767 2514 2212 1974 1967 947 610 115 ------
NM_016410chr91473 --1177 --
NM_016418chr2273502 2859 2782 2695 372 311 231 --1842 --
NM_016422chr1142770 2713 1098 871 --2727 171 --
NM_016423chr141449 ------
NM_016424chr1731336 531 248 1524 11403 1428
NM_016436chr2032671 2483 532 --21843 608 --
NM_016441chr262126 1756 1725 1620 866 681 11908 ----
NM_016442chr522182 715 1753 32277 2171 41 --
NM_016448chr141785 1626 678 122 --1502 --
NM_016451chr11186 ------
NM_016467chr231373 1020 176 ------
NM_016470chr20------127
NM_016480chr56730 720 639 332 299 139 ------
NM_016485chr642199 1682 1509 749 2766 651 ----
NM_016486chr11181 ------
NM_016492chr17--1144 ----
NM_016507chr1721085 577 ------
NM_016516chr2171 --1351 --
NM_016519chr42357 173 ------
NM_016522chr1121188 205 11401 11428 --
NM_016525chr91601 1813 ----
NM_016530chr1563471 1635 1514 1322 1177 477 ------
NM_016531chr443222 3180 594 438 ----11195
NM_016542chrX51446 1158 257 97 75 --11126 --
NM_016544chr243364 2861 2554 467 11056 23912 2725 --
NM_016545chr13745 253 234 ------
NM_016561chr1631008 122 58 1635 ----
NM_016569chr1251587 1413 961 579 172 ------
NM_016575chr12145374 5266 5175 4517 4228 3933 3811 3371 1692 1551 1172 309 243 85 14282 ----
NM_016599chr431160 540 210 --1495 11436
NM_016603chr51414 --11560 --
NM_016605chr512446 22227 358 11715 --
NM_016607chrX1212 ------
NM_016618chr22172 148 ------
NM_016620chr121437 1178 ------
NM_016621chr1163595 1733 1701 1671 304 139 12984 ----
NM_016623chr82623 105 ------
NM_016626chr1831339 488 428 ------
NM_016631chr21----1940 --
NM_016641chr1631735 1345 1265 ------
NM_016644chr5----1384 --
NM_016645chr152324 27 ------
NM_016651chr142981 171 --1109 --
NM_016654chr1531064 1013 869 21257 1234 ----
NM_016823chr1731034 471 244 ------
NM_016824chr1021823 1808 --11710 1454
NM_016830chr121463 ------
NM_016831chr131505 948 237 11878 ----
NM_016834chr1784076 3749 3662 3617 1564 1483 1029 143 --1846 --
NM_016835chr1784076 3749 3662 3617 1564 1483 1029 143 --1846 --
NM_016836chr21556 3612 583 86 2703 675 --
NM_016839chr21556 3612 583 86 2703 675 --
NM_016841chr1784076 3749 3662 3617 1564 1483 1029 143 --1846 --
NM_016929chr674489 4381 3925 3468 3098 2965 90 14314 24516 1061 1347
NM_016930chr43812 309 59 ------
NM_016932chr25935 372 365 309 28 ------
NM_016936chr1641885 835 751 157 ----11949
NM_016946chr1102381 2337 2248 1296 1252 988 841 524 102 73 23495 39 --194
NM_016950chr42978 184 ----1434
NM_016952chr1173487 2727 1482 1158 992 820 606 11009 23572 3350 1183
NM_016953chr2115884 5508 4889 4770 4571 1962 1692 1084 970 414 130 --25128 437 --
NM_016954chrX1651 1148 1486 --
NM_017409chr124583 576 176 64 --1523 --
NM_017410chr1231286 1209 36 ------
NM_017412chr861390 1306 1008 321 147 61 --1101 --
NM_017413chrX92529 2475 2298 2223 1738 1004 662 363 48 21965 654 22091 983 --
NM_017415chr5134488 4333 3689 3350 3325 3121 2967 1282 1224 1208 1088 793 485 12905 34295 3643 2892 --
NM_017420chr1443780 3109 2807 986 43610 3283 3049 1096 22732 1375 --
NM_017423chr492051 2025 1397 544 511 433 311 270 202 ------
NM_017447chr2184396 3723 3678 3182 1176 926 888 582 34173 1680 1401 11610 --
NM_017449chr131552 1062 592 ------
NM_017450chr1721013 322 --1130 --
NM_017451chr17--11003 ----
NM_017452chr2051459 1174 557 477 65 ------
NM_017453chr2051459 1174 557 477 65 ------
NM_017454chr2051459 1174 557 477 65 ------
NM_017455chr153679 238 185 ----1133
NM_017456chr1731990 1703 787 --1771 --
NM_017482chr231611 1514 105 ------
NM_017491chr41771 --1755 --
NM_017522chr141447 1166 973 25 --1428 --
NM_017540chr562559 2173 2077 2016 989 869 33051 402 239 ----
NM_017544chrX6983 838 717 210 98 29 ------
NM_017545chr202438 162 --1385 --
NM_017546chr23874 208 139 --1197 --
NM_017548chr331751 832 791 ------
NM_017549chr761461 1306 1161 1069 345 258 ------
NM_017551chr1052668 2226 655 606 413 12178 22607 2249 --
NM_017577chr321318 1245 11601 2512 339 --
NM_017580chr1031676 668 165 --21484 953 --
NM_017582chr131791 554 378 11552 11468 --
NM_017583chr1161754 1623 1510 1128 285 176 ------
NM_017588chr951700 1447 1295 575 69 --11971 --
NM_017590chr2212548 ------
NM_017593chr42459 379 ------
NM_017602chrX1654 ------
NM_017610chr1551863 1826 1533 1490 1372 1320 ----
NM_017628chr495113 4879 4826 4646 4547 4500 1591 83 76 11027 ----
NM_017629chr131497 783 65 --1512 --
NM_017632chr41101 ------
NM_017633chr693747 3031 2896 2859 2508 1115 832 824 531 ------
NM_017634chr851631 496 308 244 137 11564 ----
NM_017635chr1111606 --11547 --
NM_017637chr9209267 8756 8460 8338 8227 7963 7535 7093 6085 3637 3436 3311 3302 3128 2245 1825 903 860 467 191 12466 29360 7567 1760
NM_017640chr62152 39 1106 1276 --
NM_017641chr123980 317 267 21116 233 ----
NM_017643chr1732240 1101 977 ----12382
NM_017644chr3135024 4710 4030 4004 3590 1724 1540 1336 1084 430 325 288 129 44993 4487 4359 609 35181 5066 3600 --
NM_017650chr7125824 5595 5217 4668 4305 3872 2209 2198 1917 1909 1848 412 --25092 1900 14040
NM_017651chr641612 497 490 361 ------
NM_017657chr2131 --1273 1691
NM_017658chr1494336 3129 1454 899 617 501 460 325 97 24350 4298 44191 1192 1114 676 21836 397
NM_017660chr1972936 1351 1206 1135 473 439 266 1450 --12322
NM_017661chr1541206 1180 1148 518 --1822 --
NM_017664chr132356 269 1821 ----
NM_017666chrX52234 1901 1747 337 276 --1245 --
NM_017672chr151495 ----11120
NM_017673chr11229 --1801 --
NM_017679chr173586 538 434 ------
NM_017680chr92357 257 --1655 --
NM_017684chr151654 171 12004 --
NM_017686chr11808 1986 ----
NM_017694chr251655 1502 523 116 85 --21936 701 --
NM_017697chr81453 1168 1470 --
NM_017700chr41124 --1496 --
NM_017709chr1124187 3901 3841 3421 3329 3107 3043 2911 2805 1183 851 123 21635 1164 23015 2795 --
NM_017714chr20--1330 ----
NM_017719chr322230 780 22075 585 1341 1756
NM_017737chr161853 1631 891 458 344 56 31550 878 317 1492 --
NM_017742chr1821521 268 --1175 --
NM_017744chr152205 1638 958 433 215 ------
NM_017745chrX----1239 --
NM_017752chrX42151 1559 1534 419 --21612 579 --
NM_017754chr6154663 3940 3853 3677 3510 3262 3230 1965 1687 1609 1359 917 860 570 150 13461 1249 13645
NM_017757chr182834 459 ------
NM_017758chr1731082 443 373 --11225 --
NM_017762chr1562413 2222 1744 651 568 155 ------
NM_017768chr11921 ------
NM_017769chr1463092 3004 2842 916 833 591 ------
NM_017772chr661624 661 535 354 164 32 ------
NM_017778chr861517 1288 1169 1087 1018 436 1171 ----
NM_017779chr162734 2409 2275 2100 2010 726 1571 11103 11725
NM_017780chr81269 --2939 239 --
NM_017784chr341188 1176 1149 1091 ------
NM_017787chr1051846 896 867 700 184 --12314 --
NM_017791chr1441303 1116 342 308 21624 1544 ----
NM_017798chr2031033 360 119 ------
NM_017799chr1441690 1576 1373 355 1564 ----
NM_017801chr331023 441 53 21697 1613 --1353
NM_017811chr933101 1997 208 ------
NM_017813chr8135856 5721 5626 5313 3819 3803 1250 1238 1055 1040 942 206 187 25203 3885 ----
NM_017822chr123778 516 328 ------
NM_017830chr43800 758 666 --175 1996
NM_017831chr1864577 4532 4258 4128 3430 1615 2858 161 --11159
NM_017842chr121535 1678 ----
NM_017845chr4----193 --
NM_017847chr13886 165 123 1180 1389 --
NM_017848chrX114597 4541 4481 4410 3695 3464 3163 1875 1657 1141 91 ------
NM_017851chr154912 430 155 73 144 2945 382 --
NM_017856chrX72135 1869 1538 792 660 338 320 --1366 --
NM_017857chr111213 ------
NM_017866chr831068 851 66 1311 ----
NM_017873chr962943 2501 2226 2170 1236 630 ------
NM_017893chr1011067 ------
NM_017896chr20113348 3253 2957 2602 2539 2449 2412 2368 2339 776 379 --12951 --
NM_017902chr10155743 5447 5238 5213 4783 4590 4381 3986 2213 2205 1736 1561 612 432 294 35150 4350 4093 14410 --
NM_017905chr133532 523 266 ------
NM_017915chr12160 --1323 --
NM_017917chr141108 124 ----
NM_017919chr9105427 4042 3920 3589 1290 1164 1122 827 703 36 21689 1401 24073 3621 --
NM_017922chr142506 108 ------
NM_017923chr4----2514 283 --
NM_017925chr941468 1347 534 232 11530 11491 --
NM_017926chr142318 304 1780 3936 923 905 --
NM_017933chr221564 276 21573 364 1591 --
NM_017938chrX12180 32073 2056 1971 ----
NM_017944chr1152208 2199 2075 1189 1014 11933 ----
NM_017952chr2104380 3936 2803 1612 1555 1366 1314 854 651 370 14001 1733 --
NM_017955chr1431097 854 228 1379 11153 --
NM_017972chr142318 304 1780 3936 923 905 --
NM_017987chr1051937 1520 892 343 208 1264 11786 --
NM_017994chr792817 2307 1082 1007 894 779 657 203 139 13007 ----
NM_018003chr1552471 1687 1552 866 510 1673 2568 347 --
NM_018009chr121118 --1159 --
NM_018014chr22452 372 ------
NM_018018chr122764 728 1278 1438 1499
NM_018027chr1043235 2195 2041 1053 1174 ----
NM_018030chr1831064 796 388 --1270 --
NM_018046chr511788 ------
NM_018061chr15687 451 406 149 55 ----11273
NM_018062chr22415 402 ------
NM_018067chr13565 161 64 ------
NM_018070chr1----1442 --
NM_018078chr43653 358 46 ------
NM_018084chr233031 402 357 22708 809 12547 22963 2419
NM_018085chr1128148 7186 7108 7041 6254 5498 5370 2809 1324 1028 950 770 37178 5912 5644 1459 --
NM_018086chr221714 354 21398 368 --11670
NM_018087chr12212 194 ------
NM_018096chr1741000 743 736 56 ------
NM_018100chr673409 3231 2407 1345 1187 798 211 1182 150 --
NM_018112chr9----1957 1210
NM_018114chr32498 110 ------
NM_018117chr102770 216 ------
NM_018120chr841010 504 430 203 --1453 11218
NM_018121chr1083209 2694 2670 2631 2502 2489 481 279 --22469 2230 --
NM_018131chr101888 --1841 --
NM_018133chr341729 1714 1702 428 11778 1310 --
NM_018137chr131309 1238 499 --11232 --
NM_018155chr342951 1096 880 729 11042 1223 --
NM_018156chr152783 2522 2491 2023 433 --13007 --
NM_018157chr1273247 2532 2302 2208 1229 672 97 134 ----
NM_018171chr121215 --1137 --
NM_018179chr12--2635 237 ----
NM_018181chr183586 579 523 1504 1417 --
NM_018184chr361850 1743 1549 658 368 111 1237 ----
NM_018195chr1171829 842 650 474 459 145 110 ----11935
NM_018200chr1572177 2002 1936 1032 927 452 432 --21924 820 11653
NM_018201chr982523 2365 1981 1848 1008 912 685 481 22469 741 ----
NM_018207chr121494 1078 ------
NM_018211chr111874 166 22207 1657 1602
NM_018214chr62881 33 2281 158 ----
NM_018216chr11261 ------
NM_018217chr20158 ------
NM_018222chr1121177 583 174 11837 --
NM_018234chr272171 2153 2077 1755 1503 843 600 --12235 --
NM_018241chr41810 1280 1762 --
NM_018243chr4153994 3916 3575 3451 3377 2726 2591 1630 1335 1276 640 459 253 245 40 --13017 13782
NM_018244chr20163 --11169 --
NM_018247chr662892 2604 2511 625 500 252 12910 ----
NM_018254chr172252 2215 2135 1878 862 569 150 11839 22259 2122 --
NM_018257chr2062222 2186 2155 1852 1606 966 ------
NM_018263chr242370 1914 769 112 12241 11777 --
NM_018266chr32321 221 11091 ----
NM_018270chr201266 1744 ----
NM_018285chr152511 28 ------
NM_018287chr1031327 1222 181 ------
NM_018290chr4--21243 296 ----
NM_018293chr352266 2236 2046 1898 664 12171 11831 --
NM_018299chr812797 --1199 --
NM_018302chr482177 2132 2005 950 836 802 474 417 ----11631
NM_018307chr17------162
NM_018312chr1152157 2004 1934 1435 850 ----11485
NM_018313chr361996 1067 870 565 512 330 ------
NM_018323chr441595 1538 1277 385 31899 736 466 ----
NM_018327chr201158 --11802 --
NM_018328chr2----1519 --
NM_018330chr1021660 1533 ------
NM_018334chr71520 ------
NM_018335chr141369 --1183 --
NM_018339chr931725 1489 152 --11239 --
NM_018348chr161279 ------
NM_018351chr1264354 4222 3967 3390 3312 1701 --1473 --
NM_018354chr20--129 ----
NM_018361chr834076 3115 934 13291 13949 12556
NM_018362chr1163951 2977 2952 2700 1568 141 13071 21432 296 --
NM_018364chr194023 3602 3237 1389 1091 1084 600 410 347 23619 1381 23398 3174 --
NM_018371chr821305 240 ------
NM_018374chr7105148 3707 3435 1955 1832 1505 1428 1280 1146 943 --13185 14857
NM_018375chr1451646 1488 653 619 378 1458 ----
NM_018383chr211672 21778 432 ----
NM_018386chr133387 254 126 ------
NM_018387chr92370 82 ------
NM_018388chrX11398 ----179
NM_018403chr383878 3329 3107 2579 1585 1549 1227 326 ------
NM_018413chr12----132 --
NM_018416chr1222119 1641 --32631 2562 1910 --
NM_018424chr931503 101 64 --11705 --
NM_018425chr1062077 1938 958 462 381 240 1654 ----
NM_018426chr61116 ------
NM_018429chr562111 2042 1902 593 323 233 198 --12693
NM_018439chr1882225 2215 1872 682 622 407 340 316 11946 22338 945 --
NM_018440chr8178694 8211 7655 7515 7413 7337 7297 6515 6294 6156 5716 2176 2154 1955 1094 663 555 21870 103 38315 7432 5654 22329 737
NM_018441chr2258 37 ----1798
NM_018442chr11371 ------
NM_018444chr852390 2361 1861 575 250 12299 ----
NM_018445chr15--166 1374 --
NM_018449chr94740 579 301 119 ------
NM_018452chr6_random73483 2435 2423 1360 949 908 29 1541 --12608
NM_018454chr15----1676 1669
NM_018456chr3------195
NM_018460chr23111 46 39 ------
NM_018464chr101150 ------
NM_018476chrX147 ------
NM_018482chr852597 2030 828 172 53 22379 653 ----
NM_018489chr112194 --12062 --
NM_018553chr1731558 378 314 ------
NM_018566chr195031 4088 3267 2050 1077 1029 779 218 104 11257 14307 --
NM_018569chr461437 1092 258 205 198 124 11410 11487 --
NM_018571chr23569 471 54 ------
NM_018584chr141085 1014 1004 815 ------
NM_018593chr62509 35 ------
NM_018638chr1285564 5312 5215 3568 1937 1930 129 40 23611 117 14010 33702 1540 847
NM_018639chr1221377 498 21150 1073 11237 --
NM_018640chr1272606 2521 2299 2187 1855 842 810 --22339 422 --
NM_018649chr103589 441 62 ------
NM_018650chr141755 846 679 76 11607 1337 --
NM_018653chr171376 1397 ----
NM_018657chr31183 1268 ----
NM_018667chr1622599 387 --12585 --
NM_018682chr72519 150 ------
NM_018683chr2041310 642 631 200 11164 ----
NM_018685chr731184 464 318 ----194
NM_018686chr122269 56 ------
NM_018689chr1542557 2107 759 277 12728 12313 --
NM_018693chr22294 67 --1274 --
NM_018695chr5----21588 661 --
NM_018697chr752115 1658 1458 675 63 ------
NM_018698chrX31993 1884 1381 --11643 1203
NM_018700chr551212 452 254 180 161 --11312 2420 53
NM_018704chr151970 756 505 390 229 ------
NM_018712chr1161301 1048 1033 436 236 50 --1114 --
NM_018713chr141081 973 816 775 ------
NM_018718chr752244 2132 698 592 391 --12315 11555
NM_018719chr72155 70 1398 ----
NM_018834chr51138 ------
NM_018840chr201333 ------
NM_018841chr193927 3908 3621 3234 2933 1153 1035 1024 1010 --33661 3485 471 23706 1464
NM_018845chr11419 ----2547 524
NM_018847chr961931 1223 1212 758 421 296 --1233 --
NM_018890chr751207 1099 1065 998 963 ------
NM_018898chr542285 2199 2035 340 --11838 --
NM_018899chr542285 2199 2035 340 --11838 --
NM_018900chr542285 2199 2035 340 --11838 --
NM_018901chr542285 2199 2035 340 --11838 --
NM_018902chr542285 2199 2035 340 --11838 --
NM_018903chr542285 2199 2035 340 --11838 --
NM_018904chr542285 2199 2035 340 --11838 --
NM_018905chr542285 2199 2035 340 --11838 --
NM_018906chr542285 2199 2035 340 --11838 --
NM_018907chr542285 2199 2035 340 --11838 --
NM_018908chr542285 2199 2035 340 --11838 --
NM_018909chr542285 2199 2035 340 --11838 --
NM_018910chr542285 2199 2035 340 --11838 --
NM_018911chr542285 2199 2035 340 --11838 --
NM_018912chr541532 1371 605 352 --1709 --
NM_018913chr541532 1371 605 352 --1709 --
NM_018914chr541532 1371 605 352 --1709 --
NM_018915chr541532 1371 605 352 --1709 --
NM_018916chr541532 1371 605 352 --1709 --
NM_018917chr541532 1371 605 352 --1709 --
NM_018918chr541532 1371 605 352 --1709 --
NM_018919chr541532 1371 605 352 --1709 --
NM_018920chr541532 1371 605 352 --1709 --
NM_018921chr541532 1371 605 352 --1709 --
NM_018922chr541532 1371 605 352 --1709 --
NM_018923chr541532 1371 605 352 --1709 --
NM_018924chr541532 1371 605 352 --1709 --
NM_018925chr541532 1371 605 352 --1709 --
NM_018926chr541532 1371 605 352 --1709 --
NM_018927chr541532 1371 605 352 --1709 --
NM_018928chr541532 1371 605 352 --1709 --
NM_018929chr541532 1371 605 352 --1709 --
NM_018933chr53891 699 302 ------
NM_018945chr673692 3439 2927 2730 2700 1036 748 12263 23559 1023 --
NM_018947chr7134924 4656 4637 4545 4149 3339 3052 2006 1124 773 714 478 41 23821 390 24777 635 --
NM_018948chr171449 1361 1103 1068 1030 940 123 ------
NM_018951chr761116 951 456 333 301 60 ------
NM_018959chr191581 --1247 --
NM_018970chr712905 22614 822 ----
NM_018972chr872256 2096 1884 796 670 480 292 42291 502 178 83 12329 --
NM_018976chr12102915 2279 2253 2144 1854 822 592 496 353 301 ------
NM_018977chrX11069 ------
NM_018979chr1242654 1704 908 371 22086 572 1249 --
NM_018981chr251154 968 907 444 280 ------
NM_018992chr1631660 1265 99 --11084 --
NM_018993chr205947 409 354 73 56 ------
NM_018994chr13565 549 460 ------
NM_018999chr1074568 4478 4020 3406 3348 1050 325 13568 23116 1633 --
NM_019000chr531545 1497 1470 ------
NM_019001chr384391 3998 3623 3153 3040 1443 1207 70 1604 24032 533 --
NM_019004chr731661 588 64 ------
NM_019006chr151522 ------
NM_019008chr22123663 3580 3020 2791 2697 1045 644 453 372 342 108 81 11487 1402 --
NM_019015chr7----1133 --
NM_019016chr172221 28 1206 ----
NM_019027chr452139 1871 947 234 193 22538 736 11789 --
NM_019028chr112427 372 ------
NM_019030chr5--127 ----
NM_019036chr62918 434 1999 ----
NM_019041chr632095 1711 857 11918 ----
NM_019042chr721109 965 173 11153 --
NM_019048chr2--174 ----
NM_019049chr11195 --2762 525 --
NM_019050chr442136 1928 734 616 1519 12157 --
NM_019053chr1041048 1016 393 308 ------
NM_019054chr104494 195 89 57 1599 ----
NM_019063chr23626 549 245 --1840 --
NM_019071chr7----1494 --
NM_019080chr1331546 1295 984 11092 --11509
NM_019084chr1032041 1650 36 --32117 2059 765 --
NM_019087chr51253 ------
NM_019091chr231033 1005 820 ------
NM_019094chr1273842 3615 3230 2815 2614 1391 1011 13313 22987 149 1226
NM_019106chr2293170 2094 1352 1181 899 777 740 600 268 ------
NM_019114chr942244 1714 177 38 11863 11028 --
NM_019116chr16123666 3540 3446 3359 3296 3184 3115 2750 1197 1126 1056 886 33752 3384 3070 22809 782 --
NM_019117chrX31293 216 152 --11005 12553
NM_019555chr321575 1339 ------
NM_019556chrX81332 1264 1213 540 335 200 62 38 ------
NM_019558chr22268 144 ----1341
NM_019590chr1021346 1160 1304 11514 1989
NM_019593chr2083102 3075 3045 2833 2806 2039 942 901 --188 1760
NM_019594chr921115 449 21494 1408 ----
NM_019597chrX1228 --1493 --
NM_019605chr12231 135 1682 ----
NM_019606chr72548 172 ------
NM_019610chr161584 1374 749 574 504 210 21825 1546 ----
NM_019613chr171146 1476 ----
NM_019842chr61364 ------
NM_019849chr19--1170 ----
NM_019854chr123613 575 123 ------
NM_019857chrX41640 1423 633 348 --11434 --
NM_019859chr1051084 1013 348 291 113 ------
NM_019860chr1051132 1061 396 339 161 ------